TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-574-3p
miRNA Sequence: CACGCUCAUGCACACACCCACA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX56207 5742 5709 4642 1512 --16500 --
NM_000163chr5--1631 12038 --
NM_000201chr191901 ------
NM_000248chr312494 --1724 --
NM_000318chr8----1349 12314
NM_000319chr121810 --127 --
NM_000461chr322991 2980 ----24622 3008
NM_000533chrX1528 1671 --1125
NM_000572chr1----1287 --
NM_000697chr17----1280 --
NM_000724chr10----11275 --
NM_000814chr1534179 375 44 --14009 --
NM_000817chr2----1264 --
NM_000868chrX----12076 --
NM_000885chr211557 --1843 --
NM_001002032chr17----1101 --
NM_001003652chr18----1269 --
NM_001005209chr2----1251 --
NM_001005909chr3------1237
NM_001005920chr161791 ------
NM_001006617chr931298 964 588 ----11227
NM_001008239chr1833761 3594 2595 13862 13600 --
NM_001008738chr511122 ----1538
NM_001010922chr123119 1198 --13652 --
NM_001011666chr735927 5454 4798 --12132 --
NM_001011713chr14----1135 --
NM_001011885chr15----1290 --
NM_001012761chr512106 --12678 --
NM_001017440chr767258 7251 6542 6293 3079 150 --15147 --
NM_001018054chr1------1109
NM_001018056chr9----1557 --
NM_001024948chr122179 1408 ----1135
NM_001030006chr17----22513 2426 1308
NM_001032393chrX------1603
NM_001033507chr141942 1861 663 636 --1411 --
NM_001037738chr5----183 --
NM_001039580chr411238 ----1597
NM_001039582chrX----1325 --
NM_001039590chrX----23740 3710 --
NM_001039711chr11769 --1959 --
NM_001040001chr6--11490 11582 --
NM_001040110chr7----1302 --
NM_001040135chr7----1766 --
NM_001040429chr1331308 1218 858 --11068 --
NM_001042355chr1623329 636 --11167 --
NM_001042388chr18----1650 --
NM_001042413chr924085 3080 ----13404
NM_001042493chr6----21960 204 172
NM_001092chr1721916 1589 ----1870
NM_001095chr12----1326 --
NM_001100108chr137409 6694 6105 16193 25551 108 12471
NM_001106chr358478 7542 6357 6089 2922 --29615 7447 17055
NM_001157chr10----1498 --
NM_001241chr212009 ----1469
NM_001256chr17--1999 1126 --
NM_001257chr16----11302 --
NM_001280chr19------1476
NM_001387chr542807 471 386 297 --12031 --
NM_001389chr211500 --1187 --
NM_001390chr1813080 ----1609
NM_001660chr3----1296 --
NM_001690chr31644 --12247 --
NM_001855chr9------1356
NM_001935chr2----1894 --
NM_002070chr3----1674 --
NM_002073chr2221194 989 ------
NM_002074chr1------1324
NM_002094chr161386 --1378 --
NM_002137chr721595 1463 1305 12101 --
NM_002166chr21477 ------
NM_002265chr172118 80 ------
NM_002408chr14----1556 --
NM_002430chr221115 --12514 --
NM_002501chr19----12546 --
NM_002504chr9----1146 --
NM_002507chr17----11522 --
NM_002515chr1411279 --11571 --
NM_002641chrX------1181
NM_002713chr1----11225 --
NM_002807chr2----1180 --
NM_002829chr9----11021 --
NM_002866chr19----1596 --
NM_003081chr20----1396 --
NM_003131chr622156 1992 --32181 2161 2031 --
NM_003155chr8------174
NM_003188chr6----188 --
NM_003221chr613650 --1564 --
NM_003222chr20----11146 1866
NM_003344chr7----11447 --
NM_003472chr6----1147 --
NM_004255chr15----151 --
NM_004360chr16------11916
NM_004438chr233141 2231 2159 ------
NM_004496chr14------1927
NM_004499chr5----1554 --
NM_004555chr16----1390 --
NM_004586chrX11900 --14291 --
NM_004598chr5----13173 --
NM_004615chrX--1235 1855 --
NM_004742chr31332 --11827 --
NM_004748chr1532752 2590 856 --24158 2861 --
NM_004859chr1711876 ----2816 580
NM_004993chr14----1260 --
NM_005141chr4----1116 --
NM_005225chr201857 ------
NM_005339chr423804 3624 --1359 --
NM_005375chr6------1949
NM_005502chr9----1485 11298
NM_005547chr1----1289 --
NM_005587chr15----1149 --
NM_005628chr19----1616 --
NM_005736chr10299 72 --1118 --
NM_005746chr721976 198 ----1971
NM_005806chr211366 11248 11334 --
NM_005859chr5----1333 --
NM_005875chr3----1251 --
NM_005941chr81162 ----11575
NM_006226chr21245 ----11187
NM_006252chr133024 2936 1031 --17405 --
NM_006352chr111911 ------
NM_006420chr201574 --33094 1374 461 1935
NM_006476chr11----147 --
NM_006546chr1776425 6354 5498 1365 993 86 57 ----11604
NM_006790chr5----1417 --
NM_007182chr3----295 63 --
NM_007212chr1------11938
NM_012199chr1--1113 13371 11281
NM_012281chr711828 --1595 --
NM_012290chr2----175 --
NM_012476chr21183 --1195 --
NM_013261chr453643 2801 2383 1327 291 ------
NM_014223chr11306 --1243 --
NM_014548chr15----11376 --
NM_014572chr1321625 1151 ------
NM_014588chr201161 --1535 --
NM_014666chr5------1992
NM_014767chr102184 128 --1134 --
NM_014810chr122989 29 --1935 --
NM_014873chr1----23951 3732 11143
NM_014916chr7----1643 --
NM_014982chr1434472 1304 529 --35308 5292 921 --
NM_014992chr141118 --2274 187 --
NM_015057chr13----1637 --
NM_015156chr14----13615 --
NM_015251chr16----11949 1180
NM_015268chr3------1623
NM_015288chr5----191 --
NM_015310chr857346 5621 5609 2525 2117 15531 27307 5600 --
NM_015317chr21213 --12701 --
NM_015423chr11------11724
NM_015461chr18----1636 --
NM_015525chr6----1955 --
NM_015534chr1----1133 --
NM_015569chr124283 1580 --13223 --
NM_015570chr7----11273 --
NM_016057chr12----1366 --
NM_016068chr7------1168
NM_016200chr7----185 --
NM_016223chr11------1323
NM_016605chr532508 416 106 1435 1250 --
NM_017440chr12180 ----1569
NM_017599chr12------185
NM_017602chrX1864 ----1856
NM_017754chr62878 517 ----15026
NM_018027chr10----12912 --
NM_018061chr1----11138 --
NM_018092chr16----1525 --
NM_018388chrX----1964 --
NM_018403chr343981 3421 3005 2888 --14076 1920
NM_018602chr15----2612 138 --
NM_018638chr12------1351
NM_019087chr5------11369
NM_020130chr811340 --1505 --
NM_020168chr15----11384 --
NM_020207chr9----1369 --
NM_020737chr6----1238 --
NM_020738chr22456 26 ----11495
NM_020765chr1----1278 --
NM_020783chr18----12028 --
NM_020794chr1----11589 --
NM_020845chr12----12493 --
NM_021083chrX33186 2376 655 --1191 13537
NM_021116chr767405 6500 3054 1058 955 420 11534 49059 6383 6118 2523 --
NM_021202chr2032909 2600 770 --12212 --
NM_021255chr14--1159 11170 --
NM_021914chr14------1668
NM_022049chr1----2708 407 --
NM_022459chr1315651 15473 25896 1076 14636
NM_022841chr151974 --12251 --
NM_022898chr1443404 3047 1599 768 --11494 --
NM_022912chr22689 64 --1166 --
NM_023037chr13----1782 --
NM_024524chr3----2569 446 --
NM_024770chr246195 5816 2336 1193 ------
NM_024949chr413918 --14985 1181
NM_025133chr2----1741 --
NM_025146chr31666 --22085 418 --
NM_025235chr1021884 542 --11980 --
NM_025244chr2176 ----1232
NM_030806chr156799 6692 2692 2386 616 --38579 2223 1201 --
NM_030891chr2111364 --11315 --
NM_030939chr6----1989 --
NM_031445chr223407 2891 --12780 --
NM_031450chr11----1640 --
NM_031453chr10------12465
NM_031483chr20------1117
NM_032199chr1011287 --12876 --
NM_032272chr8----1455 --
NM_032373chr101874 --1538 --
NM_032440chr10------12850
NM_032446chr5----1873 --
NM_032574chr2------1202
NM_032859chr1311174 --13695 --
NM_033027chr3----11046 --
NM_033224chr756383 5141 5093 1299 880 --12197 16644
NM_033285chr853994 3070 1749 1018 977 13988 --14389
NM_033631chr123230 2521 ------
NM_052879chr121148 --1535 --
NM_052923chr6----160 --
NM_052950chr13------1271
NM_080388chr1----1161 --
NM_080422chr18------1229
NM_138459chr62693 622 --1159 --
NM_144723chr51111 --1659 --
NM_144976chr191243 ------
NM_145268chr7------2303 281
NM_145800chrX----1798 --
NM_152660chr1----1195 --
NM_153029chr1623299 541 ----1281
NM_153184chr331754 1385 304 --11978 --
NM_153619chr1522828 2604 --11072 --
NM_153689chr21397 --157 1146
NM_173156chr1--11531 1151 --
NM_175061chr71742 ------
NM_176814chr7------1469
NM_178126chr172332 219 --12133 --
NM_194272chr15------1400
NM_206853chr611419 1205 --13919