TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-574-5p
miRNA Sequence: UGAGUGUGUGUGUGUGAGUGUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000034chr162175 32 ------
NM_000037chr822380 607 1634 32302 134 76 11738
NM_000037chr822380 607 1634 32302 134 76 11738
NM_000068chr19147 11569 --11270
NM_000084chrX75779 1829 1678 1375 996 110 82 25890 1083 25029 1364 15262
NM_000089chr72550 231 ------
NM_000090chr22870 271 ------
NM_000125chr684149 3559 3372 3288 3257 1157 657 94 --24205 4061 --
NM_000129chr621379 1298 11018 ----
NM_000135chr161980 --1772 1694
NM_000141chr1031394 1070 54 ----1354
NM_000165chr631614 1544 483 ------
NM_000176chr563871 3355 2934 2518 351 138 --23080 1167 --
NM_000214chr2021305 139 --172 --
NM_000245chr762051 1740 819 504 436 232 --22039 34 --
NM_000266chrX2356 173 ----1799
NM_000271chr181471 ------
NM_000276chrX4657 627 455 267 ------
NM_000314chr1063113 2710 1230 620 479 176 1989 22421 1199 --
NM_000332chr6107188 7017 6281 5223 4765 4723 2743 2370 2177 858 25109 1477 26900 1140 --
NM_000358chr5----1103 --
NM_000391chr111427 ----1186
NM_000411chr2112819 21123 480 12240 21257 845
NM_000435chr191309 11029 ----
NM_000441chr732305 1888 433 188 ----
NM_000447chr12467 70 ------
NM_000486chr1222723 1035 23251 1053 13055 --
NM_000489chrX53131 2746 2687 2259 216 12934 12967 --
NM_000522chr721199 1109 11192 11142 --
NM_000575chr21138 ------
NM_000615chr1162403 1861 1158 839 682 281 12702 22786 377 1228
NM_000618chr1276068 5323 4218 4081 2282 1564 156 11729 --16299
NM_000633chr1865211 5032 4053 3374 3215 1869 --13887 --
NM_000678chr201655 ------
NM_000680chr81433 --1361 --
NM_000724chr1061832 1651 772 638 236 89 ----1709
NM_000726chr221345 973 1532 --11153
NM_000810chr15135 1246 ----
NM_000813chr5135397 4857 4588 4352 3707 3572 2157 1573 1452 840 443 359 183 --12125 14293
NM_000826chr422484 1697 --1485 --
NM_000828chrX51766 655 580 409 183 1638 ----
NM_000883chr7----1661 --
NM_000891chr1713282 1757 21270 1081 1877
NM_000901chr421918 1020 12008 32115 585 106 --
NM_000917chr102100 58 ------
NM_000919chr51589 --1127 --
NM_000949chr51258 ------
NM_000965chr33847 158 27 1268 --1401
NM_001001323chr1232215 2155 310 --1409 --
NM_001001330chr1021110 87 ------
NM_001001331chr342604 1832 896 342 1596 12531 --
NM_001001419chr544990 3220 1541 1292 31814 1599 898 ----
NM_001001481chr842694 2676 2398 882 ------
NM_001001483chr11------1435
NM_001001484chr1022261 2081 153 ----
NM_001001664chr264117 3435 2708 2608 1191 532 22751 2522 11065 --
NM_001001971chr101320 --11164 --
NM_001001974chr1022003 1952 1888 22205 411 --
NM_001001994chrX2204 57 ------
NM_001002255chr6----197 --
NM_001002800chr321105 872 --191 --
NM_001002860chr1473882 3646 3011 1161 433 381 359 --1750 11751
NM_001002909chr1741809 1680 1511 614 --12098 --
NM_001003398chr12----2485 64 --
NM_001003407chr1045094 5079 254 181 25071 4629 --15113
NM_001003712chr1263893 3487 1394 1007 495 164 1523 13038 --
NM_001004317chr654437 4330 4057 2790 1790 23624 1329 ----
NM_001004354chr9----11028 --
NM_001004360chr221789 421 ----1130
NM_001004720chr23845 805 235 1378 31010 179 21 --
NM_001005404chr1733617 86 56 ------
NM_001005473chr596389 5637 5409 5320 4976 4581 4554 74 60 11850 25032 170 --
NM_001005474chr351612 1524 1384 1320 557 134 ----
NM_001006115chr312107 11964 11039 --
NM_001006636chr23849 802 335 ----1310
NM_001007024chr1744212 3125 2713 200 ------
NM_001007094chr1084403 3737 3479 3117 1560 1223 1178 182 --1373 --
NM_001007214chr121191 188 ------
NM_001007271chr104720 436 391 301 --1752 --
NM_001007278chr1324152 3312 --13807 --
NM_001008220chr52796 300 --23673 362 12976
NM_001008222chrX21156 142 ------
NM_001008392chr3102953 2853 2203 2181 1041 836 793 727 100 34 --12362 --
NM_001008738chr542908 2724 1113 1006 --22759 709 --
NM_001008938chr11----1164 --
NM_001010888chrX93999 3638 3188 1217 1117 922 865 224 57 23922 3333 ----
NM_001010891chr566850 4672 2307 2160 1524 345 1641 --25473 1721
NM_001010942chr122337 273 --1165 --
NM_001011513chr433896 1382 771 ----14129
NM_001011538chr4----1430 --
NM_001011708chr262949 2395 2164 1810 887 316 1398 ----
NM_001011885chr1531622 1260 1155 142 ----
NM_001012338chr15----129 --
NM_001013031chr1092970 2688 2201 984 763 542 470 225 169 190 ----
NM_001013415chr42632 45 --11059 --
NM_001013438chr32325 259 1123 ----
NM_001013693chr111047 ----12320
NM_001013839chr172584 206 12328 3871 843 478 --
NM_001013843chr151236 --1644 --
NM_001014797chr1087257 5735 5593 3140 2889 2577 1891 345 35891 1603 30 25551 2173 16040
NM_001014839chr12853 818 11092 11019 --
NM_001015053chr1711584 --1647 181
NM_001015877chrX43000 1160 1110 840 ----2448 359
NM_001015887chr331504 1348 93 21631 1436 --11382
NM_001017395chr343539 2831 776 713 22984 794 1457 --
NM_001017926chr831544 1448 288 ----1113
NM_001017979chr41113 1668 1203 --
NM_001018004chr152726 522 --2224 26 --
NM_001018054chr151043 931 471 227 53 ------
NM_001018056chr9----1189 --
NM_001018111chr773927 3593 3022 886 814 716 409 1618 1174 --
NM_001018676chr8------1427
NM_001020658chr111474 --11573 --
NM_001024455chrX52232 2003 1889 1023 776 1548 12295 --
NM_001024460chr651168 998 419 299 221 ------
NM_001024649chr522738 2080 32124 450 95 ----
NM_001024808chr1252303 2297 1958 719 264 1200 12581 --
NM_001024934chr61626 1439 ----
NM_001025079chr354037 2539 1467 1167 58 11096 33203 861 628 --
NM_001025108chr214007 43474 1614 698 330 1353 --
NM_001025366chr631694 1550 95 11474 11515 --
NM_001030007chr1693515 3399 2948 2528 1462 291 271 252 228 1361 --12674
NM_001030055chr1473478 1599 1369 849 555 539 436 ----1109
NM_001031690chr731106 976 177 11021 12924 --
NM_001031702chr32577 261 ----1863
NM_001032283chr122362 71 ------
NM_001033081chr12552 85 1645 1371 --
NM_001033925chr1051870 754 462 433 58 21967 871 ----
NM_001034837chr54821 630 268 121 ------
NM_001035003chr431425 1382 1193 --1233 --
NM_001035521chr21637 1259 ----
NM_001035chr11823 ----2354 220
NM_001037954chr1142911 1280 606 86 --13266 --
NM_001039199chr2064465 4075 3711 3498 1915 1503 --14875 --
NM_001039348chr23881 739 254 1116 ----
NM_001039459chr711153 --2760 123 --
NM_001039711chr14776 742 325 59 ------
NM_001039802chr12137 47 11108 1539 --
NM_001039840chrX74877 4074 3949 1662 1361 919 201 --12081 1336
NM_001039937chr1353149 1660 1378 1131 555 --34147 2840 737 11028
NM_001040001chr621357 21 12078 41685 1404 1306 479 --
NM_001040092chr81306 ----1430
NM_001040142chr262327 2181 1861 1756 901 333 ------
NM_001040152chr753651 1053 902 569 402 --167 --
NM_001040159chr4------11439
NM_001040446chr592599 2225 2053 2021 1733 725 513 109 73 --1951 --
NM_001040450chr1542505 2336 965 179 2300 234 ----
NM_001040712chr953281 1233 773 717 438 ------
NM_001040876chr4--11942 1101 --
NM_001042406chr61931 155 ----
NM_001042413chr973912 3643 3567 2608 2548 1413 1097 23537 3384 ----
NM_001042430chr14----2203 111 --
NM_001042440chr551915 1481 1357 693 439 --1350 --
NM_001042510chr822148 362 1128 ----
NM_001042576chr20----157 --
NM_001042681chr152679 1957 1648 1045 364 --32503 1012 373 --
NM_001042749chrX----11821 --
NM_001044385chr2--12829 11386 --
NM_001046chr532817 748 78 42288 1089 1074 798 ----
NM_001092chr1741753 992 277 105 --1699 1694
NM_001100108chr1118164 6436 6292 5847 5657 1691 1185 954 946 101 33 27836 5917 ----
NM_001106chr3128662 7712 7680 7120 7067 6600 6492 6135 6077 5896 950 679 12838 1695 --
NM_001116chr1632827 2795 610 --22138 509 --
NM_001126chr12414 27 ------
NM_001191chr201459 --21418 177 --
NM_001198chr622381 1635 ------
NM_001206chr972394 2131 2123 1967 733 205 176 11999 1100 --
NM_001241chr22811 769 1620 2917 55 --
NM_001241chr22811 769 1620 2917 55 --
NM_001259chr786047 6025 5964 5745 3919 2512 1091 1072 24987 1826 ----
NM_001270chr541126 979 935 728 1435 ----
NM_001280chr19----1639 --
NM_001292chr152832 421 ------
NM_001304chr1733614 2649 1053 --1980 --
NM_001310chr1273109 2276 2232 2000 1103 743 321 31052 208 189 1901 --
NM_001332chr541273 1232 394 370 --1980 11224
NM_001345chr12----193 --
NM_001349chr2------187
NM_001356chrX42216 2115 2089 807 22277 709 --11586
NM_001364chr11134598 4571 4527 3947 2999 1715 952 941 851 514 419 373 66 ----24664 4155
NM_001390chr1842330 912 766 527 11241 124 12228
NM_001396chr2142418 2087 1824 106 --1504 --
NM_001419chr1943821 806 783 144 24811 1003 ----
NM_001424chr161302 ----147
NM_001429chr22----1969 --
NM_001452chr6--1630 1635 --
NM_001455chr664975 4432 3862 3323 1913 1455 --14319 --
NM_001500chr6------1268
NM_001609chr1021756 1390 ----13044
NM_001621chr762474 2217 1907 575 555 259 ------
NM_001626chr19----22827 30 --
NM_001655chr1142159 836 702 183 21828 786 ----
NM_001656chr51239 --11690 --
NM_001661chr172492 160 --149 --
NM_001663chr141825 --11764 --
NM_001668chr132096 2049 922 --12139 21600 829
NM_001677chr11127 1109 21167 357 --
NM_001703chr1----158 --
NM_001709chr114978 959 395 225 11770 2853 752 --
NM_001748chr12275 75 --1293 --
NM_001755chr1642274 1411 683 91 ----11800
NM_001759chr1264585 3946 2036 1182 1168 1031 --11962 --
NM_001797chr161244 ----1739
NM_001830chrX53985 3931 1238 1150 470 1780 ----
NM_001905chr13663 208 69 ------
NM_001907chr16----1356 --
NM_001938chr111897 1563 ----
NM_001949chr622683 2367 ----11188
NM_001955chr63387 148 65 --1271 --
NM_001995chr411233 --1219 --
NM_002025chrX137962 7045 6649 5989 5703 3532 3387 1702 1490 1093 845 304 57 48906 6382 1951 1935 --47925 5971 2771 1419
NM_002039chr46936 848 763 708 365 79 --1260 --
NM_002040chr2111210 13076 1145 --
NM_002074chr121538 1209 --21490 344 --
NM_002077chr922132 40 1680 ----
NM_002103chr194975 920 177 140 ----1400
NM_002158chr232992 654 25 --1857 --
NM_002181chr21492 --2508 307 --
NM_002192chr72580 563 1493 1615 --
NM_002199chr42927 757 ------
NM_002211chr1031075 758 235 --11085 --
NM_002232chr11160 --1131 --
NM_002234chr12198 --1214 --
NM_002249chr11524 189 ----
NM_002254chr232239 1975 414 11983 1389 --
NM_002267chr1342216 2111 379 344 ----133
NM_002293chr132734 2494 2136 1758 1244 --
NM_002399chr151114 2406 314 ----
NM_002442chr12--11560 11109 --
NM_002473chr2211079 ------
NM_002480chr122987 566 ------
NM_002487chr15--1774 ----
NM_002499chr1542492 2350 1969 1803 11624 12401 --
NM_002508chr121547 47 11597 ----
NM_002572chr11------1269
NM_002578chrX----1322 --
NM_002581chr995574 5181 3976 1993 1955 1653 946 832 159 25514 3966 1522 --
NM_002594chr2021891 1770 ----11964
NM_002595chr1261867 1530 668 595 525 112 21300 772 ----
NM_002607chr74221 184 158 77 ------
NM_002612chr73710 441 21 22039 723 ----
NM_002632chr14----2581 60 --
NM_002641chrX31883 747 558 21328 373 ----
NM_002655chr885128 4416 4353 4084 3906 1939 1496 234 25163 1708 --14236
NM_002657chr201795 12736 1276 --
NM_002658chr101850 ------
NM_002710chr122970 420 ------
NM_002719chr142881 67 22035 96 ----
NM_002731chr132344 2312 45 12932 1155 133
NM_002736chr731946 1574 214 --11910 --
NM_002745chr2223376 761 13550 --22940 1667
NM_002752chr5----1212 --
NM_002821chr62802 526 --1744 --
NM_002850chr19----1233 --
NM_002867chr12104 70 1189 --2631 115
NM_002868chr1231977 351 101 ------
NM_002874chr931999 1979 45 --126 --
NM_002885chr1----1961 --
NM_002890chr5----3396 110 100 --
NM_002902chr152250 93 ------
NM_002906chr1142291 691 422 245 --1407 --
NM_002924chr13501 408 141 --149 --
NM_002942chr321322 1122 --11051 --
NM_002959chr154306 3808 1456 149 56 --24055 1188 --
NM_003028chr973867 3848 2382 1418 1352 1284 899 12726 --12732
NM_003074chr341957 1592 668 169 1197 11475 --
NM_003076chr1231384 676 423 --11176 --
NM_003081chr201365 ----1806
NM_003108chr297256 6534 6461 5421 5083 5036 4482 2558 997 15870 ----
NM_003110chr171942 ------
NM_003112chr762571 2406 2374 2046 987 222 --12934 --
NM_003144chr621814 891 --11652 12076
NM_003194chr6----1479 --
NM_003205chr153759 179 127 1438 ----
NM_003214chr6----2457 157 --
NM_003300chr14----1194 --
NM_003319chr24617 362 208 22 130 ----
NM_003339chr531586 1195 159 ------
NM_003344chr71649 --1211 --
NM_003370chr192319 177 ------
NM_003374chr5--2827 694 ----
NM_003392chr334077 3708 1029 24014 3773 12774 --
NM_003403chr141604 --1337 --
NM_003406chr831936 1416 347 2647 501 1595 --
NM_003410chrX52915 2692 2580 2572 1975 22454 770 12601 --
NM_003458chr32753 438 23271 1469 1532 --
NM_003463chr643123 2731 924 724 ----1521
NM_003466chr232466 1978 763 --1131 --
NM_003478chr1163233 3134 2508 1104 456 161 22388 2050 1198 1868
NM_003482chr1212446 ----12458
NM_003567chr1--1423 --1162
NM_003574chr1885217 4155 3709 2216 1447 1251 1175 241 11069 ----
NM_003613chr15----1715 1535
NM_003618chr241231 935 918 276 --11180 --
NM_003629chr152855 2287 2241 1228 215 1706 ----
NM_003633chr521657 760 --12236 --
NM_003659chr211187 21208 223 1825 --
NM_003664chr53437 127 117 ------
NM_003672chr151965 610 559 400 224 11448 ----
NM_003692chr9124 ----1704
NM_003709chr21163 ------
NM_003743chr211505 11741 ----
NM_003749chr1332325 1965 866 2438 65 ----
NM_003750chr10------153
NM_003795chr62465 243 1122 ----
NM_003825chr1531508 1481 1005 --21387 95 --
NM_003872chr232735 2096 449 12104 12747 --
NM_003884chr341651 1462 1267 1145 1531 ----
NM_003902chr11641 --1242 --
NM_003908chr2021279 1089 ----1175
NM_003913chr673409 3115 3034 3018 2662 707 527 11183 ----
NM_003934chr931288 1124 832 ------
NM_004040chr21895 1887 1932 --
NM_004061chr54556 515 431 275 --1129 --
NM_004077chr1231299 1282 1210 ------
NM_004093chr1353193 2068 1145 908 126 1578 23233 201 --
NM_004117chr612049 11424 ----
NM_004124chr1492789 2227 1215 1082 853 837 732 250 49 --12643 --
NM_004132chr103790 454 390 1400 11186 --
NM_004161chr251429 1389 1325 560 489 --1515 --
NM_004229chrX31899 703 217 1548 ----
NM_004235chr93551 65 28 ----1854
NM_004240chr19------1212
NM_004267chr3----1141 --
NM_004272chr53732 636 41 1281 ----
NM_004308chr1121442 199 ----21883 1877
NM_004330chr15----1260 --
NM_004392chr1342390 579 445 56 21927 525 --12427
NM_004393chr33811 645 125 ----12301
NM_004418chr21543 1616 ----
NM_004458chrX22242 2135 22661 1964 ----
NM_004482chr22633 67 2329 303 --1337
NM_004501chr143599 1540 479 91 12663 ----
NM_004503chr12----173 --
NM_004504chr253017 2864 1991 344 46 1788 --1267
NM_004506chr62707 215 --1159 --
NM_004514chr173636 148 74 12773 22310 170 --
NM_004525chr231360 1311 468 183 138 --
NM_004529chr921119 383 1105 ----
NM_004575chr441330 1013 532 397 ------
NM_004578chr11857 ------
NM_004586chrX85349 4360 3331 1729 1234 898 293 99 ----14137
NM_004593chr32762 747 ------
NM_004613chr201283 --1603 11756
NM_004654chrY----11084 --
NM_004660chrY32181 2040 651 ----11528
NM_004663chr1531223 406 108 --11590 --
NM_004745chr8136915 6501 6260 5954 5529 5462 5388 5051 4917 4425 2630 2203 2152 25624 2609 34720 622 240 1703
NM_004748chr1543213 2835 1301 981 13713 ----
NM_004779chr51102 --2536 230 --
NM_004788chr1122690 2136 --12461 1960
NM_004801chr2124 21192 1174 11179 1577
NM_004808chr1063258 3151 2419 2068 958 507 1687 21207 244 --
NM_004821chr51581 --2317 165 --
NM_004831chr191325 1913 ----
NM_004834chr233154 2609 287 --12282 13236
NM_004836chr2------1933
NM_004850chr251754 1329 542 367 283 1127 --11114
NM_004852chr181414190 14148 13132 13098 12692 12335 12196 11786 10876 10471 3723 1820 1637 884 312314 11630 4291 411246 4725 4264 3531 1932
NM_004859chr1752631 2495 2354 512 313 --1180 --
NM_004863chr14104904 4691 4206 3619 1912 1818 1762 1283 855 291 13459 184 25221 4032
NM_004884chr152579 533 11352 11741 --
NM_004929chr841147 392 350 35 21362 485 ----
NM_004952chr11811 --1955 --
NM_004956chr764281 3071 1442 1279 995 971 --13122 --
NM_004981chr22------179
NM_004999chr684075 3550 3521 3420 3095 1128 565 404 22739 1426 --24324 3778
NM_005028chr1052295 2285 2183 1886 615 ------
NM_005065chr1453511 3400 3277 891 60 24157 279 32135 1898 632 --
NM_005067chr31266 ----1983
NM_005097chr10----189 --
NM_005100chr6------11006
NM_005156chr975283 4235 3844 1879 1695 618 543 22094 789 24544 1516 --
NM_005168chr211749 21459 136 1308 --
NM_005184chr19176 1642 31184 991 62 --
NM_005212chr4--1151 167 1162
NM_005229chrX11204 ----1507
NM_005231chr112143 44 --1223 --
NM_005233chr331866 840 568 1120 --12046
NM_005238chr1163109 2981 2712 2353 1152 740 ------
NM_005257chr1841023 1004 972 536 ------
NM_005295chr7------133
NM_005334chrX4687 539 177 98 ------
NM_005349chr4--1523 1563 --
NM_005354chr19----1623 --
NM_005398chr1021406 149 --11039 --
NM_005413chr2----1164 --
NM_005433chr1822147 1902 11113 22578 1918 --
NM_005436chr1044031 3957 2829 1043 --11447 --
NM_005465chr12382 182 11571 ----
NM_005499chr191162 --1409 --
NM_005502chr932687 1260 932 12468 1307 --
NM_005504chr12125794 5487 5460 2543 2496 2165 2007 1987 1455 893 623 343 --36570 1441 572 --
NM_005509chr511740 1370 1390 --
NM_005530chr1521054 450 21235 295 ----
NM_005539chr103545 434 39 --2137 77 --
NM_005542chr751864 1220 703 549 210 --2563 522 11899
NM_005561chr132865 623 --183 --
NM_005578chr3104196 4132 3945 3389 1339 1315 816 233 184 177 14263 11212 --
NM_005587chr151347 1769 1884 --
NM_005595chr1----1300 --
NM_005596chr9146387 5323 5242 5116 3985 2477 2432 2091 1687 1561 1480 1437 1398 582 24716 865 11282 --
NM_005627chr61142 --1173 --
NM_005650chr22179 --1924 1191
NM_005650chr22179 --1924 1191
NM_005664chr15177 ----1302
NM_005686chr121557 1542 1149 1412 --
NM_005708chr13171 ------
NM_005715chr672199 2075 1742 839 587 222 119 12293 12626 --
NM_005717chr1--1278 1996 --
NM_005721chr23776 387 347 ------
NM_005822chr632268 961 465 ------
NM_005898chr1133222 934 40 2776 244 ----
NM_005904chr1821516 1068 --144 1492
NM_005909chr574016 4005 3114 3060 1702 711 647 33472 3151 3011 14085 --
NM_005920chr131053 749 291 12652 23693 448 13244
NM_005941chr811333 1174 --23569 266
NM_005966chr232332 1500 55 1534 1234 --
NM_006035chr141918 --1909 --
NM_006037chr224654 3519 --42991 1394 1054 273 --
NM_006041chr171176 --1142 --
NM_006047chr2063385 3274 2195 2174 1345 1287 --21207 654 1699
NM_006080chr733017 2684 586 22065 1863 12620 --
NM_006106chr1133278 3146 2873 1353 23317 661 --
NM_006135chr141434 1416 1194 267 ----1484
NM_006139chr2----22608 235 --
NM_006154chr151918 12408 22904 2089 --
NM_006159chr121466 ------
NM_006160chr17------11548
NM_006190chr221077 351 ------
NM_006196chr21151 ------
NM_006237chr1331853 1636 873 22215 384 --12028
NM_006265chr821460 438 11355 1985 --
NM_006310chr171306 --1155 --
NM_006313chr1241446 1303 78 32 --1671 11160
NM_006315chr453021 1799 1237 1211 195 24168 2922 --2969 151
NM_006335chr11939 --1202 --
NM_006352chr11588 --11942 --
NM_006372chr6----1155 --
NM_006373chr17----11081 --
NM_006380chr1754335 2820 1569 227 54 ------
NM_006393chr1053253 2791 1791 981 899 11115 22989 938 --
NM_006421chr821049 155 ----1491
NM_006439chr4----1190 --
NM_006469chr171107 424 319 298 155 134 64 11171 ----
NM_006517chrX--12095 2620 88 --
NM_006521chrX21278 1191 ------
NM_006534chr2043280 3174 2426 2213 1802 1782 --
NM_006544chr1486043 5992 5425 4598 3828 535 218 152 --14515 --
NM_006555chr721401 393 ------
NM_006599chr1698248 8028 7386 6273 6046 3185 2080 1036 542 47260 6059 5302 609 26346 1320 --
NM_006609chr232873 831 645 ------
NM_006618chr131427 452 195 --11490 --
NM_006621chr11650 --143 11804
NM_006698chr2021402 1072 --1110 --
NM_006717chr923211 3030 1630 ----
NM_006734chr631166 360 33 11401 11318 --
NM_006763chr131727 1679 1416 ------
NM_006775chr642979 2278 1902 773 32821 2271 2127 ----
NM_006777chrX21860 107 --12859 --
NM_006790chr5----1165 --
NM_006791chr15144 ----1405
NM_006885chr1654210 3424 725 363 188 --23037 521 --
NM_006888chr1453327 3018 2866 460 291 --12834 --
NM_006902chr122554 2226 12886 --11098
NM_006908chr72429 334 --1222 1114
NM_006915chrX42038 678 459 71 12185 ----
NM_006950chrX----1270 --
NM_006951chr103672 599 177 ------
NM_007005chr921335 240 1109 --1613
NM_007011chr1555864 5627 5328 5266 4838 42440 2032 1863 1208 56558 6501 6243 2445 23 --
NM_007050chr2087603 7512 7449 7394 5914 5418 5092 2372 36182 4906 2295 27763 1672 17580
NM_007051chr1----1115 --
NM_007146chr1742737 2080 2063 1806 --11799 --
NM_007219chr203880 723 281 ------
NM_007238chr2094026 3809 3306 1731 1231 1010 944 760 261 14139 14672 --
NM_007246chr42838 674 --1715 --
NM_007259chr1----2396 343 --
NM_007331chr472314 2268 2206 722 511 307 54 1647 12441 12669
NM_012090chr1----21163 955 --
NM_012137chr112731 1281 ----
NM_012156chr2032607 1006 503 13422 23233 2431 --
NM_012157chr31737 ----2950 320
NM_012193chr1153680 3601 2101 1050 565 11075 24581 1746 --
NM_012199chr144130 3508 1498 648 13712 ----
NM_012218chr1911196 --1289 --
NM_012249chr293528 3277 3218 2888 2745 1265 740 678 342 --23434 2341 --
NM_012257chr721045 853 --11013 --
NM_012290chr221540 456 --1206 21400 54
NM_012297chr42331 189 1464 1802 --
NM_012300chr532575 2553 858 --22209 1674 --
NM_012301chr721921 1724 --1534 --
NM_012308chr112615 528 --2467 105 --
NM_012333chr13643 565 260 --1128 --
NM_012395chr763161 1034 835 626 475 385 22870 2577 1399 --
NM_012396chr1----1613 --
NM_012399chr2231645 1480 285 --1258 --
NM_012431chr742675 2455 933 798 1607 --1156
NM_012471chrX31979 1488 216 --1150 --
NM_012482chr1--1218 --1656
NM_013230chrY61686 1547 1515 1380 1323 526 1312 ----
NM_013231chr1454377 3298 3233 459 128 13753 24350 55 1836
NM_013233chr21189 1340 ----
NM_013242chr16------1391
NM_013261chr482770 1489 1452 1247 1061 447 111 87 13306 ----
NM_013281chr2011493 --11373 --
NM_013302chr1654484 3384 3238 1503 772 11417 11176 1446
NM_013354chr831364 1342 1300 ------
NM_013433chr19--21511 401 21521 711 --
NM_013436chr2----1818 1196
NM_013446chr711186 ----1320
NM_013449chr1222679 421 12150 ----
NM_013943chr162811 2080 1259 761 249 168 ------
NM_014007chr951257 1161 1146 1123 1028 ----1952
NM_014141chr783915 3515 1729 1348 1198 1159 840 425 --21750 83 --
NM_014271chrX2710 546 1686 ----
NM_014289chrX21431 241 ------
NM_014300chr151472 ------
NM_014325chr1242256 386 302 116 1566 1152 --
NM_014408chr11459 --1615 1191
NM_014423chr5105549 4192 3638 3612 3463 3455 1478 1225 1011 227 34608 1816 886 13520 --
NM_014445chr31633 --1455 --
NM_014494chr1632224 210 116 ------
NM_014554chr12----11782 --
NM_014572chr1341721 456 377 167 11558 --11634
NM_014577chr221787 ------
NM_014606chr43473 290 49 --11169 --
NM_014630chr1553394 3267 3019 2455 587 1862 ----
NM_014637chr82567 321 11091 ----
NM_014679chr111462 ----21103 86
NM_014705chr731959 1780 604 ----11800
NM_014709chr2----1546 --
NM_014711chr161571 --11933 --
NM_014726chr17--159 1985 --
NM_014729chr841660 886 697 431 1536 ----
NM_014730chr1245317 4967 4751 1044 ------
NM_014755chr251421 1380 194 133 72 12689 21575 1472 --
NM_014761chr1621122 133 ------
NM_014767chr1043657 2505 1182 256 23521 345 11266 --
NM_014774chr123050 970 ----12934
NM_014779chr331184 1094 353 --1978 --
NM_014798chr1751847 1816 1596 1589 472 187 1362 --
NM_014810chr123425 1445 23581 809 1501 --
NM_014839chr132223 2119 956 21854 149 ----
NM_014841chr631290 1091 1059 1475 ----
NM_014873chr15654 558 415 258 229 ------
NM_014897chr1732863 2344 2156 2892 269 22212 549 --
NM_014906chr1743461 3210 2996 862 22885 2706 23510 3256 --
NM_014912chr1032895 727 452 1974 1775 --
NM_014926chr32908 85 --1822 1210
NM_014932chr3------1240
NM_014935chr183527 3305 2803 2469 1509 806 356 121 --33391 2767 58 --
NM_014947chr122713 2338 11250 1601 1792
NM_014978chr1041534 1400 636 368 ----21487 714
NM_014982chr1454661 4585 4178 3554 1684 --11860 --
NM_014989chr662022 1805 1782 1437 1304 364 ------
NM_014990chr1431237 1162 1117 ------
NM_014991chr442774 2281 2125 237 12479 ----
NM_015001chr11406 1944 ----
NM_015020chr1631541 919 523 11367 ----
NM_015039chr112679 1623 44026 3751 1060 330 --
NM_015042chr1564203 4065 2924 1702 1378 897 33940 3539 637 ----
NM_015044chr1633185 2110 502 23193 2539 1636 --
NM_015075chrX----11474 2835 772
NM_015079chr1552628 2306 2162 1053 330 ------
NM_015092chr1684402 3712 3260 3121 1760 940 593 479 21190 178 14255 --
NM_015094chr2254537 4037 3335 1218 728 --14502 --
NM_015155chr1082737 2492 1208 859 836 745 715 57 12183 ----
NM_015156chr1441149 1092 572 23 11410 1220 13892
NM_015170chr83876 395 238 --12272 --
NM_015199chr342350 2101 295 221 12921 12275 --
NM_015206chr1563798 3319 946 603 205 161 --23748 2808 --
NM_015210chr18----1119 --
NM_015213chr111599 1114 1194 --
NM_015263chr152193 46 ------
NM_015265chr252261 2158 1007 766 255 ----1812
NM_015268chr35645 527 249 188 174 --152 --
NM_015271chr454086 4030 3227 3138 1221 22820 306 33164 2704 1262 --
NM_015277chr181225 --1140 1640
NM_015288chr573866 3410 3322 3292 3119 449 162 ----1896
NM_015296chr1331223 941 373 1877 ----
NM_015299chr1444053 3464 2913 890 --33615 1357 1115 --
NM_015305chr1411341 ----1229
NM_015328chr743032 2064 923 634 11130 22748 356 --
NM_015335chr1252561 756 492 192 72 --12659 --
NM_015336chr122184 150 --174 1259
NM_015344chr82325 151 21481 530 --1223
NM_015347chr1232779 657 472 1799 ----
NM_015354chr9145 --1353 --
NM_015382chr142597 103 ----1686
NM_015397chr9131 --21415 289 --
NM_015435chr83569 457 281 ----1970
NM_015455chr573532 3205 1104 919 836 623 392 23985 1637 ----
NM_015475chr21980 ------
NM_015508chr311037 --2263 248 11378
NM_015509chr1211306 ----1145
NM_015527chr161773 ------
NM_015534chr12285 195 1110 ----
NM_015569chr174306 4099 4068 3090 1803 1047 868 11521 21111 407 --
NM_015630chr22740 77 ------
NM_015635chr93860 600 259 1481 ----
NM_015649chr19----1114 --
NM_015678chr1331194 576 112 11310 11092 --
NM_015686chrX22297 33 --31828 934 415 --
NM_015695chr621834 590 --21443 456 --
NM_015906chr154821 1517 1457 742 617 --1180 23449 1113
NM_015955chr2----243 35 --
NM_015995chr1573886 3571 1861 1182 622 355 324 14848 24660 4321 --
NM_015999chr11731 ------
NM_016018chr842680 2215 2047 1829 22785 2173 --11068
NM_016022chr1----190 --
NM_016071chr7----1181 --
NM_016076chr122439 2148 1901 11163 22818 23
NM_016083chr663387 3025 2616 1180 765 724 12672 13257 --
NM_016089chr341335 808 699 388 154 31736 1502 557 3642 222 138
NM_016120chrX1271 --1468 --
NM_016131chr2--1468 11828 --
NM_016132chr1552850 1180 899 841 24 ------
NM_016206chr3118945 8574 8233 8210 8182 5631 2809 1878 1834 1809 345 28397 7099 18342 --
NM_016231chr17----11677 --
NM_016252chr21904 1616 ----
NM_016264chr191556 --1544 144
NM_016275chr311872 22079 1912 1858 1204
NM_016281chr12--1740 21031 79 --
NM_016300chr31365 1106 ----
NM_016358chr5----1442 --
NM_016396chr1562783 2716 2292 2204 1114 625 ------
NM_016422chr1142687 1187 632 294 12511 13028 --
NM_016424chr1741772 1473 1395 271 ----11356
NM_016577chr344482 4244 3148 33 13345 13723 --
NM_016578chr11--1446 --1591
NM_016588chr6--1120 --139
NM_016604chr5--155 2507 295 --
NM_016623chr81190 ------
NM_016626chr1841595 1479 437 414 ------
NM_016929chr654424 1775 1169 550 100 11441 23987 600 --
NM_017420chr1463177 2930 1335 553 539 97 13589 ----
NM_017423chr452121 2087 1928 1372 536 1328 1369 --
NM_017437chr142928 584 --1823 --
NM_017525chr11----177 --
NM_017590chr2211774 --12578 --
NM_017593chr4------1337
NM_017637chr9127157 5994 5940 5714 3090 2753 1745 1504 1094 889 833 683 37003 2785 1303 ----
NM_017643chr1732326 1157 751 ------
NM_017664chr131942 --21096 664 --
NM_017709chr143225 2962 2903 2885 23512 1512 11000 --
NM_017715chr7----2668 39 2753 588
NM_017742chr1831708 436 286 132 ----
NM_017744chr111592 1360 11660 --
NM_017752chrX3637 222 42 11521 11770 --
NM_017778chr841157 1030 527 262 ------
NM_017784chr31272 2379 287 21211 165 --
NM_017813chr895696 5358 5248 5175 5127 3642 1671 1491 961 1781 --1485
NM_017831chr1884472 1691 1559 1513 1469 1175 784 310 24242 416 --11494
NM_017848chrX44282 3380 1630 631 1385 11180 --
NM_017926chr14195 --1872 --
NM_018030chr18--2841 117 --1966
NM_018061chr141702 1609 511 27 2679 561 21254 92 11658
NM_018071chr142771 219 --3748 540 49 --
NM_018084chr222178 1256 33305 2853 1188 12223 --
NM_018086chr211467 1254 ----
NM_018110chr1631407 912 468 --1258 --
NM_018159chrX31376 406 143 ------
NM_018184chr321625 1361 11431 ----
NM_018206chr16--1156 123 --
NM_018247chr652930 2066 1102 590 473 2915 886 11053 --
NM_018263chr262504 2474 841 455 262 22 22447 878 21766 1676 --
NM_018287chr102852 299 --1249 --
NM_018328chr2----1407 --
NM_018364chr171185 1132 965 798 768 129 22 ----13208
NM_018375chr1431555 570 186 1590 1780 1327
NM_018444chr831478 597 123 --1654 --
NM_018650chr131713 800 371 12101 11384 --
NM_018704chr141981 1656 1624 32 1324 ----
NM_018718chr732252 2220 1781 22074 637 --11793
NM_018898chr51350 ------
NM_018970chr732630 437 128 12647 1528 11176
NM_019004chr752329 2004 1787 1492 884 --1285 --
NM_019012chr121199 --1589 --
NM_019049chr12732 91 1655 ----
NM_019084chr1022142 945 31767 933 745 --21933 1927
NM_019094chr1253621 3500 2805 2755 803 11113 12367 --
NM_019106chr2233163 2939 1294 13398 ----
NM_019613chr173992 829 301 ----11300
NM_020122chr2115913 5608 5197 4941 4460 4319 3739 1810 1696 609 264 1128 1914 1272
NM_020145chr9------1578
NM_020156chr71113 --1615 --
NM_020177chr553117 2634 2609 992 466 33366 1002 227 13108 --
NM_020182chr2033611 1195 52 ------
NM_020193chr112954 233 ----1917
NM_020205chr153489 3131 2641 2315 472 ------
NM_020214chr15----1181 --
NM_020310chr1712689 --2323 83 --
NM_020336chr2062939 2784 1228 604 522 142 --22767 207 12776
NM_020337chr492943 2847 2553 2200 2191 565 435 421 265 --11189 --
NM_020344chr91153 --150 --
NM_020373chr12----1636 --
NM_020379chr11203 1862 1216 --
NM_020381chr621797 127 11317 1224 --
NM_020403chr1361631 1401 1212 712 501 214 ------
NM_020429chr722983 2289 12545 --11096
NM_020432chr752338 1684 922 896 619 1815 ----
NM_020443chr176648 6554 5054 5001 4237 1254 230 --15578 --
NM_020456chr1351996 1491 838 799 677 --1814 --
NM_020463chr2----11048 1476
NM_020466chr6124996 4805 4245 4231 4113 3900 3608 3570 3342 3264 1983 1348 44178 3678 3384 1414 23448 3090 1613
NM_020474chr181225 1639 172 --
NM_020546chr533177 1257 993 11979 2290 56 --
NM_020655chr1621434 220 ------
NM_020673chr2097717 7675 5298 2656 2615 2101 1363 1040 967 --26845 2723 12517
NM_020689chr2031692 1126 1072 --11525 11674
NM_020697chr8132 1223 ----
NM_020699chr155302 4898 3737 1464 197 1484 ----
NM_020715chr1431969 906 712 --21737 1409 --
NM_020726chr5----1417 1585
NM_020748chr17--12172 11945 --
NM_020760chr221840 150 1449 ----
NM_020770chr111336 ------
NM_020775chr1----1207 --
NM_020801chr542208 493 417 175 --1984 1237
NM_020802chr1163129 3042 3017 2625 2089 1073 ----13325
NM_020805chr181436 --21263 35 --
NM_020818chr142107 31 ------
NM_020831chr221226 --2999 875 --
NM_020856chr1921331 573 11048 11505 --
NM_020860chr4--1838 1893 --
NM_020899chr17----32030 447 103 --
NM_020924chr9----1316 --
NM_020962chr1532454 1673 728 --3904 405 177 --
NM_021003chr141780 ------
NM_021038chr372989 2599 954 885 729 206 192 23108 2345 --11126
NM_021072chr521740 34 156 12405 --
NM_021097chr242298 1964 1150 246 12688 22540 132 --
NM_021117chr1122062 1602 1185 1928 --
NM_021183chrX22226 566 31908 1651 359 1972 --
NM_021190chr12374 35 ------
NM_021252chr1041465 1424 794 347 1245 11409 --
NM_021643chr231751 1209 371 --1110 --
NM_021804chrX--1849 1872 --
NM_021813chr675769 5528 4659 3905 558 116 105 1984 25142 1529 14946
NM_021814chr611240 11634 11447 --
NM_021907chr2----197 --
NM_021961chr11117414 6334 5428 4989 2736 2053 1257 1245 1140 855 186 16790 36835 5212 64 14865
NM_021964chr3115445 4795 4579 4100 2328 1354 906 830 658 362 325 12396 11420 --
NM_021977chr6--33243 3047 1387 13259 --
NM_022075chr1----1316 --
NM_022085chr631592 1283 115 --1164 --
NM_022170chr721163 174 21701 1539 --11710
NM_022374chr21356 ----144
NM_022454chr82803 770 1782 151 --
NM_022455chr51111 ------
NM_022459chr1334595 4305 4002 11441 1809 --
NM_022469chr132877 383 96 --22850 2250 --
NM_022475chr4----191 2564 198
NM_022658chr121866 1119 2359 270 --
NM_022719chr2293518 2875 2688 2384 1489 1475 1376 432 172 12935 ----
NM_022739chr172411 102 1307 --1224
NM_022781chr983347 2419 2269 2138 667 628 595 257 12192 ----
NM_022826chr221225 1073 ----21178 808
NM_022893chr252670 2590 1991 1076 492 ----12189
NM_022894chr21204 ------
NM_022898chr1494232 3850 3459 3085 1727 1703 1380 1179 133 2696 492 ----
NM_022912chr252934 2897 1997 1023 424 12394 ----
NM_023018chr1--1602 1641 --
NM_023927chr51322 11184 1285 --
NM_024063chr15132 --174 --
NM_024345chr995958 5007 4861 4786 4436 4383 2322 2121 1786 --1138 15707
NM_024408chr183630 3469 2999 1064 684 451 378 313 --13157 13713
NM_024491chr3----1445 --
NM_024524chr342963 2369 2264 364 33172 3158 1202 ----
NM_024612chr1711049 ----2973 962
NM_024713chr1541075 662 526 178 1440 ----
NM_024721chr831945 1791 587 ------
NM_024761chr964773 4587 4010 1695 647 147 24662 3365 34758 3642 1074 14528
NM_024811chr11----11580 --
NM_024824chr1421207 66 11272 ----
NM_024915chr822439 2083 2589 357 ----
NM_024920chr431565 449 411 --11334 --
NM_024933chr21587 --1613 --
NM_024947chr3199489 9444 9259 9165 7989 7936 7176 7068 7059 6394 3766 3697 3292 2853 2729 2559 1975 1025 117 26823 93 11287 --
NM_025010chr342869 2341 920 703 --32436 843 523 --
NM_025054chr853314 3216 3029 1672 1584 ----1530
NM_025146chr362443 940 505 448 325 83 ------
NM_025147chr21730 11101 --1383
NM_025179chr184912 4732 4596 3984 3184 1632 639 52 ------
NM_025191chr163266 3007 2378 1314 1112 482 22359 2282 ----
NM_025235chr1031472 376 146 --22237 718 --
NM_030621chr1473210 3038 1510 1346 815 729 615 ------
NM_030625chr1032603 912 198 12105 --1808
NM_030627chr563055 2874 1490 1061 85 46 1961 ----
NM_030640chr12----1690 --
NM_030647chr785649 5309 4954 4729 1905 772 719 674 --25156 3856 --
NM_030759chr10----1530 --
NM_030786chr121565 575 ------
NM_030816chr173340 3193 2691 371 310 240 112 ------
NM_030820chr6--1706 --1326
NM_030949chr6--1278 21042 427 --
NM_030963chr6--176 1553 --
NM_030964chr533315 2358 2287 12724 ----
NM_031431chr131419 11688 1538 --
NM_031445chr273424 3375 2944 2697 2346 693 328 --12398 12087
NM_031911chr442308 2010 1980 30 ------
NM_031935chr141031 885 230 121 ------
NM_032016chr72678 187 ------
NM_032102chr1122261 201 --1122 161
NM_032109chr521387 1228 --3577 571 448 1590
NM_032121chrX22785 1729 12645 12584 --
NM_032139chr19--1379 --1740
NM_032153chr342558 812 658 161 --1644 --
NM_032199chr1033343 1378 930 13768 ----
NM_032208chr213187 13494 1111 13449
NM_032289chr521497 612 ----21438 1350
NM_032294chr1711610 ----139
NM_032298chr19----1491 --
NM_032316chr342369 932 422 246 --1310 1132
NM_032440chr1062740 1081 684 466 412 101 ----12160
NM_032457chr433834 3130 1246 3705 628 240 11287 --
NM_032458chrX33330 1170 49 --1258 2778 689
NM_032491chr121946 ----21314 831
NM_032523chr2----135 --
NM_032557chr41155 ----1127
NM_032575chr1611623 --11889 --
NM_032626chr161254 ----1127
NM_032632chr1421788 1687 ------
NM_032682chr343453 2371 865 825 --23598 1081 --
NM_032737chr1922725 943 ------
NM_032787chr3----1276 --
NM_032873chr1133524 2921 615 34127 1011 723 21204 86 1132
NM_032875chr172693 46 --2715 674 1649
NM_033030chr21300 11147 --1137
NM_033055chr141032 865 749 73 11086 ----
NM_033089chr2021399 427 --11055 --
NM_033116chr14------160
NM_033119chr161936 ------
NM_033127chr11567 --1635 --
NM_033133chr1713534 12356 23725 194 12756
NM_033224chr788021 7195 6480 6241 5849 5320 5122 5014 --17778 --
NM_033261chr101597 ----1476
NM_033309chr1611100 ----21022 735
NM_033512chr822270 237 1323 ----
NM_033515chr62560 474 --11233 --
NM_033540chr3------11045
NM_033631chr133935 2424 1016 1648 12581 --
NM_033656chr2155855 5464 4884 2036 450 22021 1217 12384 --
NM_052848chr1912114 ----1537
NM_052879chr1243271 2949 2771 1035 1728 13136 --
NM_052900chr831739 210 59 --191 --
NM_052905chr241917 1534 1372 1164 11657 21589 572 --
NM_052934chr112088 --11577 --
NM_052950chr132684 172 --11371 --
NM_052964chr41213 ------
NM_052998chr11171 ------
NM_053002chr31307 --1911 --
NM_053023chr1112176 --1277 32227 2209 453
NM_053024chr341379 1290 1046 1024 ----1272
NM_057749chr83976 433 126 ------
NM_058172chr451544 1140 705 181 42 ----11837
NM_058187chr21130 --1172 --
NM_080616chr204536 522 168 24 --1135 --
NM_130469chr14------1633
NM_130768chr7196 ----1260
NM_130808chr32338 108 ------
NM_133264chr1723360 1243 --13699 13959
NM_133265chrX53069 2368 2362 2290 2258 2674 470 12336 --
NM_133328chr191314 ----1293
NM_133334chr484921 4500 4409 2439 2114 2008 1751 485 --14778 35245 204 55
NM_133369chr54914 664 357 26 --1215 --
NM_138426chr742089 911 905 651 --1658 --
NM_138635chr733197 913 302 12681 13038 --
NM_138731chr1463809 2783 2731 2692 700 118 21272 610 22588 129 --
NM_139072chr21566 144 ----
NM_139177chr17189 ----21478 1358
NM_139318chr14----1225 --
NM_139319chr122483 450 ------
NM_139321chr2043891 1123 866 383 34028 1673 303 ----
NM_144571chr486587 5731 5149 4271 4239 2446 2253 492 14231 26633 2601 --
NM_144594chr12----1136 1185
NM_144660chr10----2286 166 --
NM_144726chr53772 116 33 11033 1950 --
NM_144963chr822309 1755 --3933 786 29 --
NM_145117chr1132543 2237 563 --11059 --
NM_145176chr663539 3044 2803 2414 1407 126 31008 553 43 23561 919 --
NM_145207chr474913 4216 3557 3242 1866 1715 1538 --11519 --
NM_145290chr4--147 152 --
NM_145307chr1064107 4042 1454 1373 1356 1216 34442 719 678 ----
NM_145912chr221836 --24380 3080 1128
NM_147156chr102378 224 --11119 --
NM_147202chr952589 2391 2118 778 638 ------
NM_152271chr81824 1723 1258 --
NM_152272chr811162 ----1299
NM_152424chrX53962 3671 1278 269 230 ----13259
NM_152440chr12--1885 1146 --
NM_152523chr22195 154 ------
NM_152556chr742571 2553 1857 931 1819 12210 12387
NM_152570chr9------1283
NM_152594chr1561762 1526 1445 758 730 419 1836 1609 11600
NM_152641chr125673 407 318 55 46 12763 ----
NM_152653chr31704 1723 1190 145
NM_152666chr12175 76 ----1112
NM_152745chr74278 153 139 107 11178 ----
NM_152749chr711160 --1147 --
NM_152754chr743387 2926 2568 2365 12827 11137 --
NM_152756chr573774 3502 3166 2907 2734 118 32 --1942 --
NM_152758chr83381 178 120 22922 2017 2669 194 --
NM_152787chrX41546 1381 1289 1142 ----13574
NM_152857chr641018 355 292 132 1839 1125 --
NM_152890chr12880 486 ----11281
NM_152996chr161646 850 614 235 129 48 ------
NM_153020chr651629 1524 1317 1137 153 ------
NM_153207chr1293629 3600 1537 1480 1323 261 223 165 86 33012 2945 1385 ----
NM_153252chrX1111 ------
NM_153341chr11330 --136 --
NM_153347chr1132387 1001 969 ----21029 939
NM_153487chr631934 367 58 14342 --1220
NM_153620chr731591 1376 374 11517 ----
NM_153685chr123362 355 141 1238 3419 378 291 1259
NM_153689chr252275 2242 1565 844 728 21644 788 1130 --
NM_153702chr4289 33 ----144
NM_170665chr1234399 4160 100 1285 22883 125 --
NM_172071chr1116687 6667 6429 2821 2608 1658 1595 1507 1004 334 180 15787 16125 14988
NM_172212chr12461 216 --138 --
NM_173359chr361336 1288 561 441 333 198 21694 1358 1502 --
NM_173470chrX3870 280 71 ------
NM_173495chrX22073 1656 12103 ----
NM_173511chr243934 2939 2901 772 --1948 --
NM_173536chr443690 3546 3205 813 21805 225 15212 --
NM_173582chr11135340 5063 4648 4496 4432 4315 4110 4002 1695 1687 1480 671 239 25832 5763 ----
NM_173595chr1263512 1522 757 656 616 487 --15247 11457
NM_173642chr1179237 9076 9042 8794 8710 7923 7310 7062 5938 5865 2930 2093 1898 1792 1282 1109 1005 76990 6861 1353 1298 522 198 123 12989 --
NM_173653chr331316 976 571 21381 1294 ----
NM_173808chr173887 2967 1226 807 724 425 208 13817 ----
NM_173822chr252145 850 135 80 69 ------
NM_173825chr362414 1977 1207 1189 1143 946 ----1359
NM_173829chr565446 4149 4026 1628 1239 1001 ----15640
NM_173851chr8112790 2582 2553 1444 1422 1323 1001 761 587 472 124 22954 2533 --23944 1358
NM_173854chr13722 477 460 --31470 772 88 --
NM_174890chr102215 128 ----1600
NM_175039chr91158 --2386 71 --
NM_175767chr541418 1187 687 56 ------
NM_175876chr172812 2738 2326 1053 1027 807 266 --185 --
NM_176815chr372969 1894 1066 872 657 262 173 22861 834 ----
NM_177966chr321279 1211 11810 1721 --
NM_177968chr242142 1872 1378 334 --1231 --
NM_178126chr17--1162 --11387
NM_178140chr532783 2188 948 --12380 1482
NM_178313chr252047 1711 487 447 191 ----1333
NM_178826chr124690 266 250 171 ----174
NM_178831chr752614 2551 2540 2228 124 --21954 143 --
NM_181336chr611229 --2149 98 --
NM_181358chr123410 1349 --12828 --
NM_181552chr75979 923 808 736 300 ------
NM_181671chr173732 716 277 --1230 --
NM_181836chr52280 114 22055 1878 12377 --
NM_182485chr452900 2824 2566 1189 665 --12771 --
NM_182487chr922865 1489 --23408 655 2994 216
NM_182488chr13126 --1123 --
NM_182493chr16145189 3823 3545 3279 2005 1721 1692 1643 1612 1598 1361 841 814 323 35369 3311 1569 14222 13712
NM_194282chr452843 2314 2194 579 60 --11907 1452
NM_194314chr1115534 5338 4640 3637 2105 1746 1609 1601 1422 421 207 1590 ----
NM_198098chr7288 78 --11526 --
NM_198270chrX23396 176 23358 1266 12146 --
NM_198490chr313248 2768 549 23494 242 --
NM_198511chrX21757 515 21827 1264 --1256
NM_198581chr287496 6946 6727 6150 2514 2436 276 109 11422 ----
NM_198991chr182546 126 --1599 --
NM_199141chr192888 141 --1618 --
NM_199320chr422170 113 --12297 --
NM_203301chr1411166 ----1696
NM_203451chr1341670 1580 1519 343 --22233 1948 22300 571
NM_206853chr644067 3264 1443 278 12579 --13009
NM_207348chr111829 --11951 --
NM_207426chr1012090 ----5882 876 846 834 822
NM_207442chr141706 ------
NM_207517chr1531920 1364 551 --11733 --
NM_207647chr911697 21613 980 12001 --