TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-576-3p
miRNA Sequence: AAGAUGUGGAAAAAUUGGAAUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr551827 1637 827 383 61 ------
NM_000052chrX43419 3333 3056 156 1480 23200 2505 12121
NM_000068chr1941437 1106 391 34 ------
NM_000084chrX146959 6342 6088 5779 5616 5530 5045 5028 4822 4729 4706 2673 2183 110 --183 --
NM_000089chr72334 308 ----1114
NM_000109chrX42609 2314 2211 779 22561 681 --1271
NM_000125chr623257 367 --1171 --
NM_000138chr1552553 2441 2286 1869 86 1630 ----
NM_000151chr1751892 1845 1206 1184 225 ------
NM_000170chr94541 408 340 120 --1463 --
NM_000176chr553168 2518 1278 1166 790 --23872 2510 --
NM_000176chr553168 2518 1278 1166 790 --23872 2510 --
NM_000196chr16----1518 --
NM_000208chr1963580 3544 1549 1523 845 133 11487 ----
NM_000217chr1274111 3991 3943 3651 451 430 331 ------
NM_000222chr431894 1601 706 21616 1410 --1682
NM_000232chr463173 2086 690 682 180 34 ------
NM_000245chr752258 1992 1683 1576 463 11488 ----
NM_000248chr322329 989 ----11153
NM_000259chr15106220 5436 4957 4939 2162 1911 1805 454 86 34 46304 6093 2194 823 26177 5706 11923
NM_000267chr1763229 2929 2796 2310 689 429 11016 ----
NM_000280chr111943 1864 1768 --
NM_000314chr1072348 1307 1198 970 746 403 158 1245 11231 --
NM_000325chr43619 267 197 ------
NM_000332chr6105797 5542 4860 4811 4418 2264 2008 1263 1155 602 22205 1808 34766 2178 1720 --
NM_000337chr5126218 6009 5818 5804 5733 4722 4234 2642 2175 1949 1512 316 26534 4274 21442 406 --
NM_000362chr2262895 2487 2477 2299 1158 745 1128 11011 --
NM_000430chr1742868 2767 1367 1162 --1567 --
NM_000448chr1183088 2972 2768 2269 944 609 539 532 11151 22248 479 --
NM_000465chr2122 --184 --
NM_000489chrX63425 3335 2135 1254 1134 180 --22260 821 12748
NM_000503chr85699 651 469 264 74 ----1171
NM_000522chr771174 1141 929 798 503 402 333 --11110 --
NM_000555chrX167859 7230 7034 6916 6299 6170 5946 5344 5261 3013 2401 2060 1868 1702 667 140 16345 26922 3134 --
NM_000599chr22784 412 1121 14529 --
NM_000601chr71451 ------
NM_000615chr1131173 1158 1042 --22404 126 --
NM_000618chr12146593 6392 6265 6108 4977 4237 2550 2317 1946 1485 1205 849 658 281 36532 1881 113 --11760
NM_000621chr132967 558 11094 1120 --
NM_000633chr18135211 4525 4357 4175 4007 3171 2070 2039 1823 1635 1570 909 893 ------
NM_000673chr41228 2842 167 1550 --
NM_000680chr8--1442 1434 --
NM_000719chr12106164 5836 5179 4165 4099 2503 2484 2108 1905 871 --35114 4666 1888 --
NM_000782chr205948 288 247 169 36 11171 11260 11205
NM_000793chr1484912 4777 3689 3269 1881 1431 305 198 --23311 776 --
NM_000813chr565047 3707 1452 826 443 83 15445 15398 13416
NM_000814chr15124129 3707 3493 3423 3324 1228 908 861 835 723 519 260 13523 ----
NM_000826chr461022 1014 843 830 792 335 1542 12192 --
NM_000859chr521702 1659 11391 ----
NM_000868chrX42472 2097 518 424 --12215 --
NM_000875chr15126576 6464 6102 5430 5319 4530 2667 1469 1252 1196 1185 1125 12617 45533 4449 1674 168 --
NM_000891chr1743163 2917 2468 1080 1985 13018 --
NM_000899chr1263942 3472 3387 2800 1339 634 1983 1119 --
NM_000901chr412509 ----2978 270
NM_000908chr52800 713 --2554 301 --
NM_000912chr873392 3075 2731 2670 2399 1212 890 --21045 557 11272
NM_000933chr2061752 1685 1502 1126 658 111 1488 21789 1736 1644
NM_000945chr241515 1356 597 235 --21877 125 --
NM_000956chr14137 1130 11011 --
NM_000963chr141860 374 253 98 21733 1664 11715 --
NM_000965chr3173 ----1449
NM_001001323chr1242155 1035 100 65 42612 2186 2061 1063 ----
NM_001001433chr2031126 1106 797 ----1639
NM_001001557chr812161 --21816 477 --
NM_001001664chr224117 467 2757 607 11455 --
NM_001001938chr974046 3906 3323 3228 3110 921 126 --33419 2704 843 --
NM_001001971chr1041361 1163 1089 897 2874 501 ----
NM_001001974chr1082076 2003 1829 1608 1518 660 410 219 12335 12227 --
NM_001001994chrX----1205 --
NM_001002032chr17----1749 --
NM_001002033chr17180 --1849 --
NM_001002838chrX------11713
NM_001002860chr1494593 3566 3457 3386 799 749 714 504 198 23310 309 24309 3974 1361
NM_001002909chr1772058 896 664 657 598 366 285 --1615 11513
NM_001003652chr18168082 7950 7695 7464 6338 5497 5329 3319 2726 2262 2163 1648 1606 1512 1496 359 13336 57515 6817 2987 2610 2219 --
NM_001003665chr143177 2750 932 811 11378 2343 159 --
NM_001003679chr171492 1467 712 558 517 407 81 11571 12067 1342
NM_001003681chr22--1116 32144 1956 334 --
NM_001004065chr912896 21548 565 1770 --
NM_001004317chr674043 3843 3339 2838 2808 1483 164 ----14112
NM_001004360chr231407 802 618 21444 1380 11790 --
NM_001005335chr192275 42 --1303 --
NM_001005463chr1072571 2483 2129 1958 1677 758 404 --1242 --
NM_001005474chr331612 1524 232 1176 11233 --
NM_001005739chr22771 233 2881 714 ----
NM_001005743chr142971 498 ----1328
NM_001005909chr3----1206 --
NM_001006612chrX3426 297 141 ------
NM_001006623chr272350 1667 1625 841 828 576 299 1402 32404 1797 992 138
NM_001007097chr963692 3474 3292 3284 3169 1888 1360 14996 14245
NM_001007237chr122862 2047 --1483 1281
NM_001007255chr11220 130 146 --
NM_001007527chr55224 209 143 66 44 ------
NM_001007559chr181683 11348 1208 11440
NM_001008239chr1842697 2652 752 450 1388 ----
NM_001008392chr343469 3134 850 462 52446 2440 2434 2428 2422 1794 --
NM_001008408chr755188 4685 3885 1261 218 ----11299
NM_001008493chr121563 1275 ------
NM_001008540chr2----159 --
NM_001008541chr101942 --12230 1365
NM_001008564chr1362082 1505 894 436 246 167 --21800 344 --
NM_001008660chr1131193 1183 1045 ------
NM_001008710chr81369 1456 21257 176 --
NM_001008738chr522894 2551 ------
NM_001009554chr4134485 4170 3933 3684 3394 1680 1638 1432 1369 880 608 602 27 54070 3923 3025 1843 591 33145 2970 1532 13159
NM_001009555chr461670 1647 1455 479 318 265 3389 234 107 11305 --
NM_001009899chr396477 6388 5278 4872 4783 4388 4159 4099 241 24515 445 25708 4330 --
NM_001009909chr1173841 3483 3149 2949 2719 1220 400 22796 308 2682 142 --
NM_001009993chr253485 545 485 476 41 --11818 1282
NM_001010853chr633132 2957 2781 ----1164
NM_001010861chr162713 2482 2260 2079 570 507 22725 410 12465 --
NM_001010867chr1176558 6523 6458 6315 6178 6093 6060 5966 5054 4999 4289 2650 2624 2370 1776 1570 548 1848 34384 4161 1953 14856
NM_001010888chrX53164 1696 922 882 153 24263 1234 34126 1218 1118 --
NM_001010891chr5156715 6704 6305 5865 5047 1956 1731 1719 1524 1364 972 904 752 630 247 15999 ----
NM_001010908chr10--1780 2614 148 --
NM_001010971chr12952 933 ------
NM_001010980chr193557 2710 2250 1173 932 517 389 193 120 12782 1554 --
NM_001010986chrX32411 1895 698 12437 1389 12244
NM_001011666chr786522 5819 4886 4566 4249 2267 561 428 45654 4843 4317 202 46024 5113 2405 1762 16463
NM_001011708chr231810 409 46 22009 649 1317 --
NM_001011713chr1421024 389 --1171 --
NM_001012393chr1174262 3907 3538 1055 847 430 44 13565 34344 1428 526 1564
NM_001012755chrX84768 4682 4378 4091 3168 726 690 459 45039 4502 3955 110 33499 1890 803 --
NM_001012989chrX1119 1543 ----
NM_001013691chr194721 703 649 120 ----1206
NM_001013746chr711682 11818 ----
NM_001013843chr15----1237 --
NM_001014797chr10137882 7857 7786 7193 6038 5516 2889 2850 2726 2404 2162 2032 433 21651 445 25594 1892 --
NM_001015045chr421557 603 --11983 --
NM_001015877chrX32853 2314 724 22950 2376 --11162
NM_001018054chr111273 --11218 --
NM_001018065chr9135664 5422 5340 4810 3796 3786 2173 2165 1937 1634 1217 347 118 35024 4934 1835 45865 4891 4772 4282 --
NM_001018067chr1115313 4621 1981 1616 1506 1490 1430 997 825 779 718 --1656 24481 1376
NM_001023567chr1542110 1680 910 261 --12387 --
NM_001023587chr31391 --1166 --
NM_001024218chr144809 153 122 42 1683 ----
NM_001024649chr522080 281 2224 163 ----
NM_001024948chr163345 2339 1196 753 171 63 --1838 --
NM_001024956chr11135890 5561 5263 5153 5078 4965 4097 3897 3835 2271 1273 639 510 24922 4797 34953 1823 1292 --
NM_001025076chr10106002 4723 4366 4088 4005 1946 1353 528 153 50 11538 12043 --
NM_001025077chr10127360 6081 5724 5446 5363 2711 1886 1511 1408 558 344 98 35006 2896 613 21141 546 --
NM_001025079chr3103982 3891 3662 3601 3552 2732 2617 1306 627 554 33675 1377 399 24038 1168 --
NM_001025105chr521505 1239 21131 609 ----
NM_001025108chr293924 3810 3662 3284 3247 1652 1317 1300 115 23711 3070 13877 --
NM_001025233chr1232003 1894 1039 12475 1898 --
NM_001025252chr832985 890 164 22053 204 33101 2962 61 --
NM_001025266chr374491 1577 1564 988 899 777 234 --24239 981 23487 965
NM_001025366chr631876 1514 398 21544 360 11796 --
NM_001025580chrX41562 1054 823 512 ----24129 1290
NM_001025616chr4----21742 151 --
NM_001025780chr91351 1574 ----
NM_001029858chr622114 650 ----13003
NM_001029875chr572936 2551 1041 913 848 810 33 2545 364 22952 2815 --
NM_001030006chr171188 ----12707
NM_001030007chr1663781 2963 1462 1337 1126 481 13958 23802 2529 1273
NM_001030055chr1463850 2917 1233 882 120 107 2956 365 24099 556 1851
NM_001030chr1----149 --
NM_001031679chr1243264 2784 2376 2210 12895 22861 2422 --
NM_001031684chr211085 ----1219
NM_001031689chr91119 --156 --
NM_001031710chr7----1278 1211
NM_001031723chr4------1451
NM_001031743chr6--175 1169 --
NM_001031804chr1643731 3509 2679 1164 --24276 2935 11257
NM_001031812chr572315 1941 1849 1730 1522 499 295 11494 ----
NM_001032280chr621224 525 --1681 --
NM_001032283chr122274 62 1784 --1364
NM_001032288chr202330 92 ----1307
NM_001032296chr1362833 2716 2337 956 865 588 --1800 --
NM_001033045chr2104085 3890 3773 3691 2883 2823 1452 1099 859 696 12810 14375 --
NM_001033047chr442582 1930 555 218 1567 ----
NM_001033081chr111921 --186 --
NM_001033117chr394338 4267 4074 1955 1150 889 541 299 170 33819 1355 436 ----
NM_001033557chr231391 1239 945 ------
NM_001033561chr172666 221 1654 ----
NM_001033566chr171316 ------
NM_001033575chr22126 86 --1358 --
NM_001033578chr842149 1979 1661 535 22192 322 ----
NM_001033581chr1----1294 --
NM_001033659chr17--1392 --21166 386
NM_001033925chr1031673 699 300 --1463 --
NM_001034841chr1674923 4787 3758 3490 1230 733 186 13895 ----
NM_001034954chr1063242 2446 2374 1150 782 424 12512 22605 2340 --
NM_001035003chr441211 1193 404 315 --11426 --
NM_001035chr141168 966 518 83 ------
NM_001037132chr732026 687 583 31679 1667 1389 --1327
NM_001037164chr73459 345 21 ------
NM_001037172chr331277 380 163 ------
NM_001037332chr5142556 2131 2099 2093 1943 1878 1738 1653 962 910 880 360 179 134 12427 ----
NM_001037494chr122198 107 ------
NM_001037954chr1163171 3157 3048 2283 1396 887 --31306 846 173 --
NM_001038640chr153977 681 328 1967 --1192
NM_001039141chr2222715 2660 --22439 234 12623
NM_001039459chr761136 1044 948 454 174 122 ------
NM_001039547chr397228 6582 6461 3177 2410 1746 1663 1251 222 16037 46572 6471 2550 272 --
NM_001039590chrX33364 1615 1263 1652 23884 2834 --
NM_001039618chr1195973 5309 4963 3798 1974 990 842 354 81 24620 3610 21404 96 --
NM_001039840chrX125881 5768 4601 4434 4102 3823 2159 1956 1361 1015 911 355 34998 4448 1259 2920 166 --
NM_001039937chr1384146 3385 3049 2906 2564 1660 1391 217 31621 1317 944 --1557
NM_001040001chr621645 610 11770 11358 --
NM_001040020chr721465 564 21488 1011 1222 --
NM_001040057chr731352 551 335 1192 ----
NM_001040092chr81428 ----1308
NM_001040110chr7----11537 1341
NM_001040142chr252483 2327 2181 597 518 --21757 902 --
NM_001040152chr7104480 4387 4381 3546 3435 1893 1829 1345 1317 1266 34170 3928 1525 24505 3652 24295 589
NM_001040214chr652182 1664 805 432 397 12195 ----
NM_001040284chr16125901 5757 5501 5425 5115 4662 4631 4612 4392 3993 3730 1493 22112 1646 34649 4510 1892 --
NM_001040409chr21308 --11030 --
NM_001040429chr13123381 3334 2773 1432 1420 1345 1007 726 653 600 550 133 --13056 --
NM_001040441chr134118 1552 1413 23506 3454 15370 1454
NM_001040446chr532567 1932 950 --32738 514 197 --
NM_001040450chr1541067 575 332 311 --1966 --
NM_001040613chr831042 66 53 --1326 --
NM_001040624chr842603 2146 570 507 --1905 --
NM_001040665chr764761 3489 1746 742 444 381 24966 476 --11617
NM_001040712chr982298 1298 1171 1099 1032 678 454 234 --1718 --
NM_001042388chr18------1631
NM_001042404chr121887 354 11956 11218 1666
NM_001042413chr933228 2861 727 --13602 --
NM_001042481chr1422587 704 22544 2094 2345 91 22511 2463
NM_001042494chr1563445 3393 3327 882 497 116 1800 23636 247 22875 1039
NM_001042548chr2----1104 --
NM_001042555chr1294192 3702 3529 3328 2916 802 743 688 136 --34529 3676 2922 --
NM_001042599chr2157292 7010 5282 5116 2567 2158 2072 1708 1521 1285 1185 885 875 732 490 27671 1858 ----
NM_001042601chr373239 3071 2302 2072 893 738 391 ------
NM_001042604chr374849 4685 4505 4103 3708 1288 875 22961 1663 34553 1832 578 165
NM_001042749chrX31820 1435 407 21969 355 11980 --
NM_001043351chr141866 1849 1828 612 1226 1284 --
NM_001044305chr611138 ----161
NM_001068chr3380 37 23 ------
NM_001071775chr1341539 561 396 198 1742 31833 326 204 --
NM_001099678chr3105813 5551 5451 4642 4223 4142 1000 882 844 138 56313 6307 4473 2379 600 24845 226 --
NM_001100108chr198164 8148 7955 7009 6790 5329 3040 2932 1185 15355 134 --
NM_001106chr3169533 8713 8286 7160 6710 6492 3884 3003 2539 1761 1598 1357 1297 890 694 240 38856 3461 2150 48663 7912 7681 6601 12502
NM_001116chr1642974 2438 2413 382 --22908 2828 --
NM_001121chr1021657 307 11740 --263 50
NM_001135chr151257 --1145 1190
NM_001149chr101124 --1178 --
NM_001152chrX--1254 158 --
NM_001167chrX31451 1357 1271 --14985 --
NM_001172chr142623 122 1116 --1304
NM_001174chrX51821 585 388 316 112 --12027 --
NM_001186chr2153213 3101 2876 1260 322 32948 1191 352 1735 22402 2294
NM_001187chr213616 522 248 --1225 --
NM_001189chr4----1460 --
NM_001198chr651966 1956 1774 1680 215 --1497 --
NM_001200chr2031033 907 255 1176 11109 --
NM_001204chr2166821 6606 6282 6143 5938 5797 5564 2523 2328 2128 2099 1949 1368 953 807 484 22628 1393 16074 37089 5204 3080
NM_001206chr952977 2856 2778 2050 176 --12395 1618
NM_001241chr231852 589 54 ------
NM_001249chr14------1137
NM_001271chr1521151 702 ----12307
NM_001289chrX51624 1213 1148 467 369 11667 1400 --
NM_001304chr1741358 979 817 321 21009 950 ----
NM_001316chr20----1460 --
NM_001326chr11----1365 --
NM_001332chr541222 1127 979 58 --11274 --
NM_001340chr921010 944 11045 ----
NM_001364chr11134790 4058 3947 3752 3652 3348 1916 1688 1008 967 941 886 554 --2444 405 --
NM_001391chr184957 239 199 178 --11092 --
NM_001401chr921645 1523 --11088 --
NM_001412chrX53191 2593 2389 2331 964 --12489 --
NM_001416chr172160 97 ------
NM_001423chr1241838 1828 1538 474 11931 11858 --
NM_001429chr222441 401 1803 ----
NM_001431chr611129 --1872 --
NM_001438chr133327 2772 2578 --23472 226 --
NM_001463chr24777 720 642 92 ------
NM_001494chr102649 203 ----137
NM_001498chr62424 259 ----1231
NM_001530chr1431160 1148 1060 180 1415 --
NM_001546chr62527 262 1438 --11371
NM_001621chr762413 2332 945 627 259 253 12488 21908 556 12799
NM_001650chr1874149 4118 3712 3443 2869 1094 450 34054 3809 3647 11270 1335
NM_001660chr32799 537 --1753 --
NM_001663chr1442301 1862 733 247 21067 596 --12011
NM_001701chr921457 1213 11196 21102 103 --
NM_001704chr62619 74 --1511 --
NM_001721chrX----1245 --
NM_001743chr21485 1236 ----
NM_001755chr1642193 1936 1431 91 ----11413
NM_001792chr182848 810 ------
NM_001806chr1972681 2460 1150 1125 864 263 186 21985 658 1610 --
NM_001884chr5----2426 378 --
NM_001918chr176788 5679 2331 2193 1310 1150 1048 22712 1425 38887 6279 209 28417 2255
NM_001931chr1111003 ----1195
NM_001939chrX103301 3241 2947 2657 2482 1540 1435 1407 604 104 --23605 736 21398 1385
NM_001942chr1821992 1872 ----1389
NM_001949chr62148 62 1946 12684 --
NM_001955chr621001 270 --1388 --
NM_001969chr14103742 3716 2413 1562 1544 1197 998 587 536 188 1171 23504 255 1267
NM_001980chr1241430 841 282 160 1800 147 --
NM_001987chr1254324 3665 3285 786 381 22846 412 ----
NM_001995chr41940 11264 11234 --
NM_002006chr4135235 5195 5179 4704 4524 4377 4266 3549 2251 1406 1165 1087 213 25572 3917 31315 720 650 --
NM_002017chr1151003 983 863 242 143 ------
NM_002025chrX169180 9090 8243 8065 7923 7333 6082 5819 5761 5703 3486 3347 2541 2226 1417 1378 43416 2331 933 694 37930 3400 1094 16651
NM_002031chr61276 --1561 --
NM_002054chr21106 --1340 --
NM_002062chr631647 1585 138 --1206 --
NM_002072chr9----1219 --
NM_002103chr19--11148 --1977
NM_002114chr6----182 --
NM_002126chr1793890 3237 3075 3011 2964 2610 1646 1039 141 --14052 --
NM_002128chr133886 770 616 1714 ----
NM_002137chr721490 685 22062 488 ----
NM_002139chrX1575 ------
NM_002146chr1741052 965 395 228 --2470 340 --
NM_002198chr52838 644 --1618 --
NM_002199chr41914 --1928 --
NM_002202chr531100 1073 942 ----1343
NM_002242chr231759 164 111 --11450 --
NM_002247chr103922 848 685 12154 ----
NM_002253chr41163 11144 21375 896 --
NM_002264chr3105047 4904 4566 4051 3988 3736 3353 1985 1661 852 23306 1812 21369 160 11845
NM_002270chr5115645 5446 5004 4852 4094 3598 3570 1109 761 743 213 24720 4374 ----
NM_002291chr7151 --1114 --
NM_002310chr5116629 6223 6154 5277 5024 4919 4856 4767 4004 1076 64 35674 5171 927 21098 809 --
NM_002351chrX--1135 --11738
NM_002397chr562049 1369 691 652 523 356 ------
NM_002402chr72767 216 --11101 --
NM_002460chr673753 3253 2717 1385 957 896 357 22385 472 ----
NM_002480chr1251394 1273 1101 987 419 ------
NM_002501chr1933237 2896 161 12714 12684 --
NM_002544chr172336 124 1292 --172
NM_002547chrX84200 3917 3835 3713 3001 2939 1509 190 23496 2725 34169 3102 800 --
NM_002563chr331061 779 155 2447 248 1865 --
NM_002572chr112267 28 ----1124
NM_002581chr984747 4279 3762 2005 1709 371 159 48 34899 1968 314 32167 947 833 --
NM_002582chr1611008 --2948 64 --
NM_002595chr124668 653 595 403 1735 11531 --
NM_002601chr2121 1445 --1353
NM_002607chr7--1326 1185 --
NM_002609chr521561 58 ----11823
NM_002655chr8125167 5153 5128 3794 2130 1667 1496 1351 1110 1032 849 367 12072 1235 11581
NM_002657chr2043892 2792 2590 1020 --23851 796 --
NM_002660chr20----21131 248 --
NM_002709chr2113454 3022 2943 2882 2708 2482 1080 615 529 452 250 ------
NM_002718chr382576 2565 2275 2227 1821 1078 591 491 --22284 2074 1165
NM_002719chr1442297 2268 2164 1989 --1882 --
NM_002734chr1741644 753 635 501 ----12039
NM_002736chr741596 844 727 587 2789 126 11575 --
NM_002745chr22104535 4271 3323 2882 1665 1650 1063 842 611 413 13729 1600 --
NM_002748chr1531067 1029 380 1796 1423 --
NM_002752chr5----1510 --
NM_002822chr1211819 1704 11172 --
NM_002827chr2021731 1399 --11472 --
NM_002865chr8------1202
NM_002869chr1141694 660 273 262 --11575 --
NM_002886chr3114904 4752 4498 4483 3889 3847 3721 1966 1891 1100 50 --54343 3491 2087 867 688 --
NM_002888chr3------198
NM_002906chr1192369 2078 1929 1731 1693 884 406 360 338 21662 581 3423 299 246 --
NM_002923chr1134 ------
NM_002924chr1------1410
NM_002945chr172781 574 --2565 146 --
NM_002998chr851883 1714 890 192 149 ----1684
NM_003014chr721536 407 --1133 --
NM_003016chr1732022 520 266 ----21885 1821
NM_003020chr15129 --1447 --
NM_003036chr131210 1165 110 1282 1346 --
NM_003060chr51335 ------
NM_003071chr311338 21770 269 197 --
NM_003107chr642409 2325 1828 1615 12336 12093 --
NM_003108chr2107299 6365 5595 4841 4494 2149 1600 916 484 247 21713 1141 26462 2846 --
NM_003112chr743242 1135 782 580 --12572 --
NM_003137chr622196 389 11827 1518 --
NM_003144chr671865 1677 1651 1525 1422 711 337 11690 1574 --
NM_003155chr862717 2679 2557 1100 649 614 32368 2341 625 32645 1799 490 1566
NM_003161chr1773410 3045 2477 1217 862 246 221 23486 3245 --12375
NM_003162chr22434 128 21027 867 1820 --
NM_003178chr352285 2106 1895 1798 730 ------
NM_003206chr6------1371
NM_003221chr663559 3103 1579 837 531 225 12916 23675 1433 1860
NM_003234chr341763 1583 1499 744 22167 1722 11902 --
NM_003246chr1531782 763 217 1265 12003 --
NM_003257chr1521317 1172 --3562 440 405 --
NM_003262chr3145275 4892 4312 3812 3451 1813 1294 1179 1171 870 754 616 383 377 --25213 1421 --
NM_003269chr611156 --11184 --
NM_003274chr2132796 2309 862 12779 13011 --
NM_003286chr2021034 124 --11103 --
NM_003292chr162289 1689 494 312 273 80 11558 12126 --
NM_003298chr385959 5570 4347 1775 1259 899 767 457 36087 5861 5527 15774 --
NM_003304chr341593 1499 416 322 11545 ----
NM_003319chr23682 263 188 1337 ----
NM_003336chrX21131 939 185 1869 --
NM_003337chr521244 1066 11276 1288 --
NM_003338chr1081887 1804 1763 1449 1231 1221 259 253 1225 1740 --
NM_003339chr571579 1349 1038 622 586 523 480 1561 ----
NM_003348chr1241661 1108 147 119 --11081 11435
NM_003359chr421342 995 165 1476 --
NM_003392chr374266 2773 1700 1472 1406 347 325 --24342 3298 --
NM_003403chr144825 336 284 40 --1605 --
NM_003410chrX61975 1113 646 408 274 158 21968 436 12581 --
NM_003411chrY91569 1491 609 498 397 387 352 147 77 ------
NM_003412chr373091 3050 2669 2384 671 613 417 23162 2203 ----
NM_003413chrX4608 551 117 46 11495 12016 --
NM_003442chr111143 --1120 --
NM_003458chr352995 2957 917 531 217 --13153 1110
NM_003463chr642741 2347 519 510 53221 2847 2365 1254 1041 --12733
NM_003471chr33888 583 487 --1169 --
NM_003472chr621333 257 --21303 431 --
NM_003478chr1121172 161 22752 1198 1903 --
NM_003489chr21103268 3087 3005 2639 2463 1312 1189 1061 1004 514 32542 1357 776 32519 1300 392 --
NM_003506chr82959 929 1916 11282 --
NM_003567chr13439 366 29 ------
NM_003583chr1263890 3568 3086 2919 2520 896 12934 22444 824 --
NM_003593chr17166 --1192 --
NM_003603chr441936 1463 368 245 22129 2082 --11738
NM_003615chr3103578 3305 3155 2831 2597 1261 1234 1183 1087 464 23878 1015 --1629
NM_003624chr193268 233 145 11416 11348 --
NM_003631chr102963 21 1171 1116 --
NM_003633chr532534 1752 1657 --1761 --
NM_003659chr23824 211 104 1164 --11189
NM_003705chr23764 319 302 --1347 --
NM_003714chr573079 3033 2741 2591 2566 990 911 32835 746 74 22264 753 --
NM_003783chr12855 74 1840 1954 --
NM_003787chr1841629 605 131 58 ------
NM_003796chr19129 --1431 --
NM_003800chr662357 1973 842 486 214 198 --21667 116 1336
NM_003825chr1521500 1462 ----11483
NM_003829chr911020 21160 267 ----
NM_003887chr281766 1700 1581 1542 869 534 484 159 11990 ----
NM_003913chr683946 3515 3483 3401 2830 813 553 282 11717 --23052 709
NM_003916chrX31221 460 298 1330 11008 21484 1114
NM_003922chr151304 ----1134
NM_003941chr711888 12377 ----
NM_003953chr152886 2229 2123 1912 654 11962 11746 --
NM_003958chr632651 2526 1422 --12901 --
NM_003972chr1021305 45 1539 11314 1928
NM_004035chr1764879 4729 3808 2016 1560 1147 11309 24013 334 --
NM_004048chr152480 444 ------
NM_004056chr83891 242 157 11117 ----
NM_004064chr1251311 1015 888 96 44 ------
NM_004093chr1333232 3193 2037 22298 2276 43240 1146 557 264 --
NM_004114chrX--1107 11062 --
NM_004124chr1453246 3126 1323 913 641 12377 21099 854 --
NM_004157chr32583 259 1837 1715 --
NM_004161chr211228 --11430 --
NM_004162chr3--11265 2922 501 --
NM_004171chr11149661 9569 9337 9143 8971 8716 8201 7592 6879 6608 3851 3735 1208 642 49380 7295 6540 2913 49492 7194 6412 1536 --
NM_004227chr732990 2755 2531 12870 12462 --
NM_004229chrX31668 665 578 22076 729 21463 218 --
NM_004232chr1873591 3297 3251 3245 3204 928 21 12892 33847 579 343 --
NM_004272chr51340 1404 1733 --
NM_004286chr2222819 256 --1246 --
NM_004294chr132669 115 --1156 --
NM_004296chr1452868 2566 481 430 311 --42776 578 510 68 --
NM_004331chr892688 2462 2172 1731 872 765 688 211 121 ------
NM_004342chr711679 --2672 301 1577
NM_004349chr831243 495 224 ----11186
NM_004370chr652097 1874 1550 1440 560 11980 ----
NM_004376chr101479 ----1998
NM_004389chr2--1654 --1901
NM_004392chr1352550 1969 1000 631 375 --22391 640 --
NM_004432chr9102431 2056 1598 1574 1502 949 490 303 238 189 31724 659 440 12335 --
NM_004440chr61569 --11617 11732
NM_004442chr1----11114 --
NM_004458chrX62227 2177 2087 983 840 747 1651 12136 --
NM_004459chr1752053 1887 1878 1850 778 --1337 --
NM_004494chr1----1882 --
NM_004504chr2112984 2864 2753 2663 1199 704 406 344 321 265 46 12541 11992 --
NM_004537chr1231129 257 76 ------
NM_004575chr431330 1013 480 ------
NM_004580chr1521772 499 2577 373 ----
NM_004586chrX105235 5189 4723 4544 4042 1987 1404 914 485 448 11316 33332 678 666 14362
NM_004588chr1133753 2593 1467 12710 ----
NM_004645chr17----1847 --
NM_004655chr1731294 1077 85 ------
NM_004660chrY52068 1737 1526 1489 554 ------
NM_004685chr1332984 2534 741 12888 21958 799 --
NM_004687chr1731876 820 661 --11577 --
NM_004713chr144548 530 257 239 1666 ----
NM_004734chr1332492 847 584 52387 2337 1092 943 573 13111 --
NM_004736chr12365 26 1723 2861 116 --
NM_004738chr2042406 2312 106 48 12368 --12647
NM_004742chr3----2665 119 --
NM_004748chr1594254 4026 3931 3697 2982 1556 1485 1370 150 13024 33817 2836 2815 --
NM_004768chr11158 1283 --1762
NM_004788chr1152762 1977 824 780 373 ------
NM_004789chr9----1108 --
NM_004798chr202214 200 --23213 426 --
NM_004850chr261500 1105 1093 542 418 331 ----1369
NM_004852chr181913132 12839 12692 12459 11925 10471 10444 10255 10114 8614 4697 4437 4263 2503 1848 1409 1255 818 637 11309 1885 --
NM_004869chr18----21563 118 --
NM_004874chr82397 389 --1407 --
NM_004887chr53846 343 190 --1392 --
NM_004891chr2------1202
NM_004898chr462518 2321 2172 2124 1065 597 12501 ----
NM_004906chr63659 547 248 ------
NM_004921chr142260 1669 718 105 12032 1261 --
NM_004926chr1441722 1357 1146 55 ------
NM_004930chr11684 --1227 --
NM_004949chr1841998 1966 1621 474 1651 11431 1356
NM_004965chr212480 115 ------
NM_004979chrX3761 352 203 ------
NM_004985chr1244398 3696 2908 673 --14305 --
NM_004992chrX98033 7907 7774 7738 6480 6225 5489 5146 3407 22079 1056 22026 1888 --
NM_004993chr141394 1221 21485 1057 --
NM_004998chr15--1742 1401 --
NM_004999chr6104350 4322 3776 3403 2817 1153 919 491 481 296 24460 3269 11129 14316
NM_005006chr2----1783 --
NM_005020chr71547 --1103 --
NM_005028chr103943 784 125 --12286 --
NM_005037chr3129 ----1160
NM_005056chr1275483 4689 4285 2243 1014 289 133 14577 14938 1432
NM_005063chr1032945 2853 770 11484 13143 --
NM_005065chr1454282 3400 3265 2064 963 24430 2021 13278 --
NM_005095chr142122 1830 597 226 12162 ----
NM_005109chr351782 812 675 415 405 ------
NM_005121chr1753509 3204 2613 433 234 23669 2723 1817 --
NM_005126chr352147 1481 1431 194 44 --11442 --
NM_005154chr151432 1171 ----
NM_005156chr9115402 5339 5021 4602 1748 1553 1337 1103 543 500 350 --11880 --
NM_005171chr1231336 1117 130 21237 145 ----
NM_005233chr311928 12587 1569 --
NM_005238chr1143505 1053 861 371 --12354 --
NM_005244chr202707 621 ------
NM_005245chr45624 524 511 230 215 ------
NM_005249chr14----143 --
NM_005259chr211031 21502 251 11546 --
NM_005277chr441639 1541 1356 476 ------
NM_005316chr114432 340 161 116 ------
NM_005318chr221396 ----11101
NM_005324chr172549 389 ------
NM_005334chrX----2540 178 11086
NM_005339chr442819 1203 184 58 13977 14285 12924
NM_005373chr1--11518 11562 11193
NM_005385chr352525 1057 584 40 25 --22164 204 --
NM_005400chr252963 2168 1918 1100 697 ------
NM_005402chr761584 1535 1263 1193 622 99 1228 ----
NM_005406chr1831186 603 418 --11445 --
NM_005436chr1053730 1203 1043 566 358 --13948 --
NM_005455chr141467 1369 417 123 ----1688
NM_005479chr10----11585 11435
NM_005491chrX22147 1968 --12115 --
NM_005504chr12146569 6248 5794 5198 4819 2496 2428 2180 1899 1620 754 623 538 415 36469 5589 4564 34216 2436 2166 --
NM_005544chr21370 --1115 --
NM_005578chr3114412 3908 3389 3344 1618 1583 1186 1179 868 507 184 23544 1202 33946 234 178 --
NM_005587chr152999 883 --1774 159
NM_005596chr9105794 5741 5495 5253 5162 5116 4549 2477 1700 1480 25962 899 11399 11689
NM_005599chr1----21542 1421 --
NM_005604chr642490 2330 2244 740 1764 ----
NM_005611chr162176 130 162 11098 --
NM_005627chr63831 172 92 --1113 --
NM_005662chr81312 --1426 --
NM_005690chr121165 ----1174
NM_005711chr531061 917 229 --11043 --
NM_005715chr672625 2546 2494 1000 771 278 246 --11743 --
NM_005717chr13995 154 95 --1132 --
NM_005725chr162250 2233 2185 1526 846 128 --21581 590 --
NM_005748chr1231365 198 183 22952 1281 21069 78 --
NM_005776chr14----1154 --
NM_005778chr31320 --1432 --
NM_005779chr542726 390 194 151 --12950 --
NM_005780chr131897 ----1956
NM_005786chr1851236 1202 1116 935 224 ------
NM_005795chr283003 2845 2407 1030 724 655 644 634 21910 1158 ----
NM_005797chr1161507 519 439 366 276 178 11225 31536 1434 556 --
NM_005822chr662395 2268 1981 515 266 179 --11974 --
NM_005824chr72647 509 ----165
NM_005862chr31421 ------
NM_005875chr3----2398 133 --
NM_005880chr163348 187 108 11322 143 --
NM_005885chr531022 604 270 ------
NM_005898chr1132903 2289 1239 12048 ----
NM_005909chr533390 1680 258 --1677 14184
NM_005941chr853782 3567 3199 703 673 14066 ----
NM_005966chr262022 1897 1847 706 625 233 ------
NM_005969chr111370 --11172 --
NM_006011chr1544074 3168 3075 2919 21104 149 135 --
NM_006015chr1----1384 --
NM_006016chr642251 1905 885 625 --21718 1628 --
NM_006047chr2033139 2225 1345 22869 989 --13387
NM_006060chr774089 3028 3015 2948 1708 1190 1040 1557 23761 794 --
NM_006067chr164818 794 653 82 --1384 --
NM_006080chr752684 2127 1203 838 782 1994 23018 2904 --
NM_006106chr1153164 2873 2819 2290 475 1954 13279 --
NM_006135chr13526 482 305 1212 --1269
NM_006141chr1642592 2359 2345 619 --1257 1173
NM_006158chr8----21677 1145 --
NM_006162chr182577 57 --1495 --
NM_006166chr1241792 1748 1637 724 --1822 --
NM_006186chr23963 855 816 --1430 --
NM_006190chr23808 770 83 ------
NM_006192chr201850 --1883 --
NM_006194chr145994 866 251 137 79 ------
NM_006197chr851878 1632 703 651 76 11595 ----
NM_006226chr251415 1357 1027 992 984 31145 1133 454 --11066
NM_006246chr1421081 498 --1515 --
NM_006251chr551189 1076 832 794 489 11238 --12911
NM_006265chr811062 --11461 --
NM_006267chr21638 1594 11765 --
NM_006283chr854475 3897 3522 1727 1042 1926 34747 1662 705 --
NM_006290chr641789 643 435 337 ----11883
NM_006310chr1711287 ------
NM_006313chr1271692 1545 1312 1204 1195 1158 78 1206 21447 1304 --
NM_006315chr453842 3397 2846 1211 713 13442 11238 --
NM_006345chr42339 253 1189 ----
NM_006364chr1431101 889 424 --1153 --
NM_006375chrX41903 1651 625 498 21723 665 ----
NM_006380chr1734283 3630 1569 24223 3877 1228 --
NM_006393chr1043391 1610 959 625 11804 ----
NM_006403chr641764 1332 423 127 --21771 1217 --
NM_006415chr931152 823 803 1938 --1196
NM_006416chr6----1668 --
NM_006420chr2083475 2764 2749 2686 2622 2472 2150 103 12852 33114 2668 69 --
NM_006449chr24701 686 373 336 1557 1496 --
NM_006451chr521005 997 1425 --187
NM_006469chr151258 1252 1107 319 269 --1299 --
NM_006475chr13----1482 --
NM_006476chr113695 566 266 1472 1194 --
NM_006494chr19----1133 --
NM_006496chr121414 1367 ------
NM_006517chrX171 12319 1770 --
NM_006526chr201692 1419 21902 1685 --
NM_006537chr15146 ------
NM_006541chr102201 167 ------
NM_006557chr92306 257 --1391 11362
NM_006572chr1753508 3235 1135 403 29 23357 958 12330 --
NM_006595chr1141394 604 492 332 ------
NM_006599chr16108240 8085 7236 6146 6027 5556 5319 2500 935 195 98174 7659 6669 5012 2978 1933 1621 1298 858 36047 2081 1037 --
NM_006601chr122301 232 1697 ----
NM_006602chr20----1154 --
NM_006621chr121802 1260 --11732 11839
NM_006624chr1032040 425 271 1356 21856 732 --
NM_006626chr91767 ----12549
NM_006628chr1594280 4228 4184 3952 3365 2872 2852 2827 1855 --11000 14133
NM_006646chr1373029 2760 2115 1155 255 237 134 23058 2267 22557 2472 --
NM_006682chr722359 2207 22333 822 22640 686 12865
NM_006686chr9------165
NM_006690chr201674 --12327 --
NM_006699chr132675 1863 156 22734 1882 --1889
NM_006717chr922087 823 23396 408 13212 --
NM_006734chr621266 513 --134 --
NM_006754chr711264 1486 31199 1120 237 --
NM_006769chr12737 261 ------
NM_006790chr52164 61 ----1321
NM_006791chr15----145 --
NM_006803chr831715 1693 300 --136 --
NM_006805chr531403 1264 546 --21215 223 --
NM_006826chr241301 1268 1145 1010 --152 --
NM_006838chr123449 429 354 1521 11447 --
NM_006852chr1752412 2221 1063 622 448 --11953 --
NM_006873chr263376 3238 2863 2301 1036 902 11340 --12429
NM_006885chr1613771 23561 939 --13536
NM_006888chr1443531 2866 710 213 1696 --1462
NM_006898chr2----1569 --
NM_006902chr173291 2535 2409 2359 2246 2028 770 23247 841 22227 1063 --
NM_006910chr161150 --1289 --
NM_006915chrX72369 936 907 678 475 385 149 --22039 460 --
NM_006920chr262076 1922 1913 1676 1619 1319 12046 2385 376 --
NM_006939chr1411009 1462 ----
NM_006951chr103806 691 557 2299 232 1178 --
NM_006993chr101277 --1259 --
NM_007006chr1643396 3293 3066 548 12426 23172 2569 --
NM_007011chr1596557 6500 6289 5734 4701 2444 921 779 270 1296 26465 6063 --
NM_007026chr172211 44 --1196 --
NM_007033chr111392 --21697 653 --
NM_007039chr1462358 1888 1859 1425 735 624 --1274 --
NM_007084chr1321515 1017 11505 11298 --
NM_007087chr16----138 --
NM_007125chrY1500 1993 ----
NM_007137chrX85252 5155 5105 3643 2201 2084 1612 500 --1637 --
NM_007172chr2272954 2484 1321 1042 1033 1026 221 --12746 --
NM_007175chr873136 2622 2477 1219 699 654 497 12704 ----
NM_007190chr1011042 --21106 216 --
NM_007195chr1883761 3527 3502 2470 2273 1356 826 385 33252 2452 479 1351 --
NM_007217chr32395 318 ------
NM_007218chr8----1247 --
NM_007231chrX22501 2094 22390 2179 1437 1135
NM_007249chr13238840 8752 8600 8196 7989 7876 7725 6495 6393 6105 5912 5740 5714 3412 2592 2358 2208 2117 1576 1453 464 318 299 13725 13454 --
NM_007294chr171133 ----11092
NM_007345chr1852109 1923 1447 770 717 --22349 850 --
NM_007349chr72424 163 --1435 --
NM_007351chr421137 994 --2402 74 --
NM_007373chr1041261 272 261 66 ------
NM_007375chr162406 2341 1852 1043 656 150 12303 1997 --
NM_012081chr522371 739 --22820 2380 --
NM_012092chr261959 1827 1543 1501 398 112 1722 1286 1326
NM_012104chr1123462 2726 ------
NM_012156chr2063232 2170 470 268 254 198 ------
NM_012161chr42358 244 1921 2431 76 --
NM_012175chr111755 --1942 --
NM_012193chr1184250 3541 3447 1862 1761 1050 702 520 21673 942 ----
NM_012199chr144282 3762 1516 997 --2649 241 --
NM_012218chr1932686 681 493 ------
NM_012234chr352993 1272 1233 414 150 13231 ----
NM_012249chr2103433 2914 2681 2340 2269 1127 878 381 279 191 13207 32405 679 343 --
NM_012255chr201416 ------
NM_012262chr174834 4542 4156 3584 1420 740 256 44814 1883 1864 674 24861 4374 --
NM_012281chr772406 2381 2290 1885 1820 831 363 11496 ----
NM_012288chr645737 5458 3633 1842 --1764 --
NM_012297chr452341 912 510 189 128 --2332 243 1746
NM_012301chr762014 1854 704 533 455 174 ----1502
NM_012306chr1273374 2522 2223 1176 823 231 198 --22818 1108 --
NM_012316chr135586 4449 3932 --55222 4919 4608 1960 580 --
NM_012323chr2221151 126 --31239 1168 558 --
NM_012325chr20--1587 1429 --
NM_012330chr1021214 114 11432 11334 --
NM_012333chr1----1566 --
NM_012388chr15----12012 13175
NM_012395chr762538 2105 1079 1021 905 756 1808 2476 386 1628
NM_012425chr1042518 991 867 653 --1542 --
NM_012446chr51408 ------
NM_012463chr1231604 1464 1426 ----1466
NM_012471chrX41726 1223 758 149 21881 1217 11809 1703
NM_013230chrY123 11717 11381 --
NM_013243chr15----1464 --
NM_013261chr453758 3544 1391 1359 852 12944 22516 1453 13162
NM_013281chr2041493 1236 1184 127 --1589 --
NM_013293chr73544 220 29 1131 ----
NM_013305chr182709 695 --1318 --
NM_013386chr121703 1413 1464 ----
NM_013437chr82990 487 --1400 --
NM_013438chr951393 1270 638 625 287 --1497 --
NM_013444chrX2897 765 1856 ----
NM_013995chrX31598 888 603 1997 ----
NM_014016chr3181 --2444 122 --
NM_014021chr183151 2764 2473 2448 946 727 654 215 2899 634 23200 2704 22279 52
NM_014028chr65653 582 483 336 28 2589 368 ----
NM_014034chr6------11237
NM_014043chr361512 1351 1326 1267 1045 507 --21066 631 --
NM_014048chr16165322 5282 5165 5144 4958 4944 4223 4190 4131 3828 3636 2024 1098 985 782 166 1355 13625 25222 4428
NM_014112chr8105211 4786 3964 3806 3699 1936 1868 1626 1513 885 15492 ----
NM_014154chr311253 11110 1207 --
NM_014157chr1663903 3883 3812 3700 960 620 1637 31339 898 148 --
NM_014191chr123951 250 158 --1978 --
NM_014253chrX52426 1845 1612 851 120 ------
NM_014263chr1021453 356 --1507 1147
NM_014268chr1831259 1119 233 --1423 --
NM_014305chr131647 ----1481
NM_014319chr1221767 115 21812 233 ----
NM_014372chr11447 ------
NM_014388chr1104472 2223 1652 1407 1383 1078 776 635 387 141 35997 5834 1391 24225 985 --
NM_014394chr1031157 40 32 --1214 --
NM_014408chr15614 579 556 459 189 ------
NM_014410chr18------1307
NM_014421chr451908 1895 1790 1409 764 11736 1241 --
NM_014423chr595247 5240 5214 3612 1978 450 412 227 52 24082 3880 25550 5420 --
NM_014445chr342314 1683 956 913 3785 606 544 ----
NM_014456chr103676 127 45 2578 143 ----
NM_014469chr11--1264 ----
NM_014491chr72729 38 --1737 --
NM_014494chr1641866 1778 1492 144 --1117 --
NM_014515chr121688 1763 ----
NM_014517chr341578 1499 1356 210 --21961 1242 --
NM_014554chr1232003 1781 1499 --1155 --
NM_014572chr1331616 636 348 11544 1692 2583 379
NM_014584chr1421545 101 1435 1155 --
NM_014586chr2154600 4511 4255 4239 3231 --34707 1616 63 --
NM_014602chr3----1343 --
NM_014612chr941352 617 89 56 --1168 --
NM_014636chr974361 4089 3244 3231 3101 1253 280 11529 11279 --
NM_014637chr82549 302 --2568 322 --
NM_014648chr311370 --11160 1559
NM_014660chr731157 943 752 ------
NM_014667chr342261 2014 580 226 --11695 --
NM_014670chr221305 80 --11270 --
NM_014671chr731446 1011 288 11593 11494 --
NM_014682chr852328 2294 1882 832 301 --11453 --
NM_014686chr1952544 2294 2281 1978 501 12605 ----
NM_014689chr21456 --1164 --
NM_014701chr1573347 3271 3234 3046 2098 304 77 ------
NM_014702chr673373 3201 3097 3087 2930 2220 857 12273 22988 2212 1567
NM_014712chr16----1609 --
NM_014729chr832304 1708 1660 21436 422 --1699
NM_014746chr2104213 3746 3606 3087 1243 1074 746 221 89 25 --32842 1477 1037 --
NM_014751chr821606 619 1647 31411 1346 228 --
NM_014755chr284175 3770 3112 1421 1328 1163 1145 404 11611 ----
NM_014757chr511510 --12097 --
NM_014774chr143034 2284 570 234 141 23051 2463 --
NM_014787chr11341 32831 928 815 22017 1810 --
NM_014810chr1103555 3425 3302 3151 2683 2663 1305 999 500 373 13230 ----
NM_014819chr542254 1744 1557 182 --22123 821 --
NM_014820chr342038 1888 1820 135 ------
NM_014822chr41528 --1452 --
NM_014824chr111642 --2702 592 --
NM_014828chr1452421 2141 1851 610 447 --11704 --
NM_014830chr1263873 3361 2913 1536 1525 919 23744 58 --1201
NM_014832chr1342062 1551 1309 402 3639 527 495 ----
NM_014840chr1243127 3104 2410 538 --12780 --
NM_014841chr65920 892 865 511 345 ------
NM_014846chr8----1235 --
NM_014848chr1522765 892 31961 631 570 --12076
NM_014872chr931621 920 637 --1185 2873 283
NM_014873chr154031 3386 1549 1114 700 24333 986 34407 416 259 --
NM_014876chr2242060 2035 1722 100 ------
NM_014893chrY52382 2303 2044 1499 397 ------
NM_014900chr251135 755 400 310 67 --2798 730 --
NM_014901chr512120 --12006 --
NM_014903chr12102263 2249 2233 2219 2171 1895 1664 949 802 219 ------
NM_014904chr1053944 1177 959 853 303 33268 3013 550 12867 --
NM_014906chr1754024 3934 3867 434 76 12614 --13212
NM_014912chr10----13294 12382
NM_014918chr1531637 1501 1167 --1185 --
NM_014926chr34941 821 793 434 ------
NM_014932chr361688 1521 1447 1261 238 126 11409 ----
NM_014935chr173752 3527 3305 2930 2415 806 57 13576 --12805
NM_014936chr652347 860 334 225 57 22433 2114 12738 11885
NM_014943chr811267 1483 11101 --
NM_014947chr12790 776 ----12900
NM_014949chr1----2974 302 --
NM_014953chr13114337 3867 3851 3600 3244 1283 946 908 710 129 111 24138 1734 33943 3769 3538 11656
NM_014962chr2032356 1942 528 31806 1018 247 32637 2000 43 12282
NM_014970chr11232 --1214 --
NM_014978chr1031861 726 230 --11535 21743 1402
NM_014989chr621608 616 --31438 494 365 --
NM_014990chr1421232 1181 1285 11163 --
NM_014991chr463187 3124 2852 2685 2511 317 22566 2547 1100 --
NM_014992chr143848 607 268 ------
NM_014996chr31182 --11080 --
NM_014997chr752934 2714 848 170 128 1415 11879 --
NM_015000chr1273084 2478 1902 1227 997 501 363 12939 ----
NM_015020chr162416 81 --13767 1525
NM_015025chr221069 504 21000 280 42734 2703 267 196 --
NM_015026chr12114067 3477 3108 2988 2919 1046 967 723 619 172 81 12998 23818 267 --
NM_015032chr1362762 2403 2082 959 261 154 --32930 2855 2159 --
NM_015035chr203809 521 326 15669 36610 2061 1796 --
NM_015051chr943110 1260 1073 599 23102 2281 12788 --
NM_015063chr19----21204 1057 --
NM_015071chr596126 6030 5494 4935 2301 1987 1917 1872 762 26428 5834 46137 5770 2173 781 11234
NM_015074chr134770 3876 516 ------
NM_015091chr144824 631 347 96 --1148 --
NM_015100chr131683 1547 469 11425 1199 11816
NM_015110chr941700 1563 810 802 11749 ----
NM_015116chr1331390 1109 483 --11738 --
NM_015124chr2252448 2272 2121 1790 219 --1816 --
NM_015143chr441271 1251 1172 422 --122 11121
NM_015155chr1062978 2951 2229 901 715 580 --3881 837 411 --
NM_015156chr1483946 3890 3782 2488 1291 1161 816 213 --3573 258 93 --
NM_015170chr841841 1572 612 593 172 ----
NM_015192chr2052310 1889 910 696 494 --32946 2302 2169 11863
NM_015199chr372832 2823 2274 1885 663 606 221 ----12369
NM_015206chr1583232 3184 3120 3072 1513 1353 984 233 22702 2384 23799 3320 --
NM_015215chr152433 2227 990 925 240 --12515 1604
NM_015263chr153827 271 29 1788 ----
NM_015265chr282429 1959 968 766 423 342 165 31 12444 11008 --
NM_015268chr34527 264 174 51 --1250 --
NM_015271chr473454 2703 1677 1612 1261 486 238 11464 ----
NM_015272chr1692133 2094 1965 1709 1432 696 548 300 23 22159 1915 ----
NM_015277chr183498 301 235 11160 11143 --
NM_015282chr262953 2934 2193 996 588 485 --12941 11217
NM_015294chr1711043 ----1824
NM_015296chr134867 859 813 129 --21235 51 --
NM_015313chr1194650 4446 4200 4072 3710 3647 3111 1258 66 24736 4730 54767 4584 3766 1567 375 --
NM_015320chr21745 ----11036
NM_015326chr143000 903 852 394 --32852 2806 479 --
NM_015329chr1962351 2133 1873 620 294 284 --12070 --
NM_015393chr453540 3223 2813 2741 360 --33807 2980 2715 --
NM_015455chr563564 3532 3411 2956 1428 1032 1802 23990 1105 --
NM_015477chr15--1924 ----
NM_015484chr14988 633 619 339 --1183 --
NM_015496chr82105 39 ------
NM_015530chr25902 672 624 390 287 1809 1887 --
NM_015542chr1031197 1101 451 --21078 92 --
NM_015549chr14----1600 --
NM_015560chr352837 1019 860 60 36 ------
NM_015564chr551176 736 595 203 27 --13585 172
NM_015565chr2182113 1962 1800 1708 1642 1403 543 36 2876 425 11898 --
NM_015567chr1331255 211 193 --173 --
NM_015569chr144870 3825 3504 406 13285 23091 750 11049
NM_015570chr711392 --2221 152 --
NM_015576chr33882 360 117 12444 31894 970 859 1785
NM_015577chr521683 568 ------
NM_015622chr7150 ----129
NM_015630chr241184 827 780 369 1733 --1742
NM_015635chr942044 1375 776 550 1407 1260 --
NM_015678chr1391585 1546 1386 1091 656 445 435 93 68 ------
NM_015686chrX4985 455 414 132 --1914 --
NM_015691chrX41146 682 544 212 1145 1114 --
NM_015702chr21211 --1329 --
NM_015713chr833566 1044 953 12864 --12332
NM_015885chr111151 1628 1583 193
NM_015888chr183125 2882 2556 2143 2096 729 564 255 --52584 2504 1211 242 210 12976
NM_015984chr11574 1429 126 --
NM_016009chr184846 4531 3929 3710 2993 1357 1094 1002 --14887 --
NM_016018chr822067 1912 --12216 --
NM_016045chr2031527 1448 1236 ------
NM_016048chr53746 734 709 ------
NM_016073chr154996 733 376 179 ----1947
NM_016081chr451809 1526 824 401 276 ----1421
NM_016083chr6123923 3738 3507 3230 3015 2624 2541 1529 1491 847 765 620 ------
NM_016090chr111840 --1114 --
NM_016120chrX1467 ----1878
NM_016129chr43255 97 32 ------
NM_016132chr1542406 841 832 31 11071 21181 872 --
NM_016169chr1033291 1075 933 --12312 --
NM_016217chr643616 2939 2485 1370 --22475 58 1904
NM_016231chr1731739 1525 403 ------
NM_016252chr21695 ------
NM_016271chr1872038 1897 1849 1801 1617 1493 23 1541 --1359
NM_016272chr2242269 2232 1937 293 ------
NM_016275chr332629 487 202 ------
NM_016277chr621198 510 11005 11159 --
NM_016287chr141848 1819 1519 612 11587 ----
NM_016308chr131290 342 102 ----1705
NM_016315chr241367 1255 496 307 21814 759 --11722
NM_016322chr932244 368 89 --22336 1097 13221
NM_016340chr511106 --21262 1042 --
NM_016396chr1592716 2045 1951 1943 832 625 589 488 262 ------
NM_016410chr91570 1624 123 --
NM_016424chr172737 187 11601 1272 --
NM_016436chr2041786 998 991 246 --32167 1803 566 12621
NM_016442chr541946 1699 918 52 22306 801 ----
NM_016529chr131886 --31054 116 67 --
NM_016530chr1553435 3071 2843 2536 298 22978 878 13326 13252
NM_016531chr483671 3582 3411 3098 2866 1183 789 96 23452 3288 181 --
NM_016559chr331364 1343 1069 11227 1347 --
NM_016598chr311304 --1173 --
NM_016604chr531151 294 232 ----1895
NM_017420chr1473712 3482 3457 3379 3054 923 75 11141 2554 540 --
NM_017423chr452193 2043 860 449 230 11722 12088 1538
NM_017508chr115883 671 645 103 38 32446 2213 1579 1929 --
NM_017519chr61210 --21215 950 --
NM_017594chr973150 2655 2076 2052 1217 972 769 13112 32949 2407 414 --
NM_017628chr475197 2006 1561 1226 1088 463 55 --23736 3673 --
NM_017633chr653165 1067 1054 982 815 13521 1668 11211
NM_017634chr821889 672 21452 124 11419 --
NM_017637chr9138991 8411 7436 6705 6209 3695 3176 2902 2588 2055 1957 1719 610 --47158 7119 2754 684 --
NM_017640chr62864 73 1618 1219 --
NM_017643chr1752903 2868 2808 751 97 --21902 452 --
NM_017644chr3114781 4345 4338 4315 4123 4101 3381 1922 1707 1547 1309 34734 3630 1489 182 14246
NM_017650chr785816 3792 2259 1933 1670 1508 1095 277 --25860 4382 --
NM_017658chr1464205 4157 4087 1472 1259 758 --24060 467 --
NM_017666chrX22003 1805 12014 21615 202 --
NM_017686chr14877 864 766 339 --1200 --
NM_017694chr2--21952 127 1594 --
NM_017709chr153614 3225 2962 2885 999 --1250 --
NM_017753chr92911 135 ----1267
NM_017754chr654179 3557 3114 1642 344 15009 1912 --
NM_017778chr811490 --21031 328 --
NM_017779chr142471 2166 943 119 --158 12343
NM_017784chr321073 255 ----1274
NM_017812chr7155 --1725 --
NM_017857chr11188 --2700 73 --
NM_017915chr1241221 404 232 212 1264 ----
NM_017944chr1143083 1081 829 437 22831 972 ----
NM_017964chr221021 331 --2796 128 --
NM_017974chr221077 354 1959 11242 --
NM_017982chr18980 545 403 380 332 312 140 132 2945 871 ----
NM_017994chr743022 2655 407 130 --21031 623 --
NM_018018chr1251635 1616 759 557 377 1654 1221 11279
NM_018103chr12346 104 ------
NM_018121chr1063159 2605 2543 2443 1951 786 2606 133 ----
NM_018133chr3----12174 --
NM_018176chr4----1154 --
NM_018178chr141976 1698 533 251 1309 12063 --
NM_018181chr1841527 1477 55 37 --21451 548 --
NM_018184chr321888 551 ------
NM_018200chr1552613 2087 1585 478 332 --1299 --
NM_018243chr4134009 3954 3911 3646 3522 3461 1420 1089 1083 924 632 551 339 --23413 3140 22493 703
NM_018247chr663164 2105 1957 1052 212 79 12550 12931 1462
NM_018263chr261883 1758 1675 927 396 164 --1263 --
NM_018293chr342256 2230 1906 1149 1728 31934 233 144 --
NM_018317chr4------130
NM_018364chr163672 1415 1272 1185 1132 474 1951 43495 799 149 23 --
NM_018374chr744220 4081 2050 1128 55089 3396 1308 511 36 23922 658 32010 1983 1963
NM_018375chr1451555 1291 779 570 246 1465 1106 1188
NM_018383chr251886 732 563 458 292 --12044 11994
NM_018444chr82825 85 2474 43 22385 1479 --
NM_018448chr1231307 1215 245 ------
NM_018460chr22160 61 --134 --
NM_018462chr32552 240 1250 --1836
NM_018464chr10----1174 1137
NM_018469chr1741519 1274 988 542 1176 ----
NM_018471chr23179 155 143 1504 ----
NM_018482chr841865 867 251 31 1240 31903 980 703 --
NM_018489chr152348 2160 1459 269 29 ----12261
NM_018490chr112650 409 --11707 --
NM_018566chr1104651 4292 3748 3356 1717 1646 866 855 656 42 35121 1594 490 63997 3487 1564 1127 448 341 14162
NM_018569chr461505 1470 1404 1312 988 649 1996 11630 --
NM_018638chr1295523 5414 5324 4528 4328 1960 1862 981 583 12199 11008 --
NM_018652chr153977 681 328 1967 --1192
NM_018704chr111560 31997 766 125 41721 1625 739 193 --
NM_018710chr84954 389 235 68 1277 --1378
NM_018717chr421093 804 22698 2367 11152 1821
NM_018718chr731846 1543 1447 --21782 379 --
NM_018834chr55959 817 761 742 351 ------
NM_018841chr183785 3295 3272 2771 2685 1172 1056 602 --13774 --
NM_018847chr911764 --11754 --
NM_018898chr532335 2273 1912 ------
NM_018945chr653255 1108 978 790 660 --11387 --
NM_018970chr782851 2699 2630 2535 1174 982 431 356 1912 12789 --
NM_018976chr1232684 2495 933 ------
NM_018979chr1262545 2429 2270 2231 1884 900 --11639 --
NM_018999chr10104823 4209 3846 3720 3656 1704 1674 1398 1006 38 2518 476 34599 4490 62 --
NM_019008chr2253798 3522 2833 2507 153 --23132 432 --
NM_019012chr12----1837 --
NM_019045chrX4877 773 720 29 ------
NM_019046chr102972 171 --1205 --
NM_019080chr1351474 1322 1124 1006 468 31457 1345 380 1290 --
NM_019094chr1283831 3621 3487 3185 2713 940 737 76 ------
NM_019116chr1653501 2456 1142 418 401 --11425 --
NM_019600chr152554 525 --1270 --
NM_019610chr161735 1707 1453 1393 864 584 1354 ----
NM_020122chr255100 4455 1898 913 270 --34461 1811 1792 --
NM_020123chr1041320 1059 607 495 31432 1233 154 ----
NM_020144chr771914 1840 1420 521 396 263 121 31764 1506 758 11792 --
NM_020150chr1021472 887 1453 1300 --
NM_020159chr441594 1527 1202 125 296 63 ----
NM_020193chr113921 915 476 21343 1264 --1235
NM_020198chr1721549 1480 11608 ----
NM_020199chr51354 --31287 393 335 --
NM_020228chr1132311 2211 2080 32498 2411 948 ----
NM_020310chr1742638 1063 1031 82 --22323 2219 --
NM_020336chr2053546 2480 309 232 142 23859 433 22785 605 --
NM_020337chr463161 2943 2542 2185 565 435 11967 11950 --
NM_020346chr1181467 1306 1125 1117 576 470 319 99 1440 ----
NM_020357chr331116 1106 199 --21226 1072 --
NM_020403chr1331689 712 351 11738 11632 --
NM_020416chr452716 2421 2109 338 304 22125 1780 --11891
NM_020452chr13818 461 158 11354 12113 --
NM_020546chr552145 1967 910 540 289 --22795 374 --
NM_020640chr362203 1583 1542 254 158 146 42112 1850 1842 221 ----
NM_020647chr842164 1778 725 592 11449 ----
NM_020648chr1872276 2016 1971 1744 1148 1111 428 12481 12726 --
NM_020689chr2021524 557 --11693 --
NM_020699chr134693 4237 2134 --14899 --
NM_020734chr1273042 2544 2318 846 826 423 387 22847 919 11076 --
NM_020742chrX72469 2456 2373 2112 796 787 415 --1243 --
NM_020748chr1721944 738 --21574 190 --
NM_020752chr1042492 2307 794 476 ----1606
NM_020768chr542391 1159 1010 876 --1106 --
NM_020769chrX4973 941 132 30 --1315 --
NM_020770chr11207 11094 --11338
NM_020782chr1244397 4362 3833 381 23525 492 13952 14636
NM_020796chr582937 2926 2672 2666 2410 1077 470 402 --11083 --
NM_020810chr1493251 3071 3040 2622 2324 874 653 528 428 31062 555 226 1941 1967
NM_020830chr222624 123 22501 1248 ----
NM_020850chr1643273 3170 2612 2035 1943 ----
NM_020870chr4----2899 79 --
NM_020871chrX102337 2050 1934 988 956 734 725 360 339 319 12323 11891 12095
NM_020872chr321709 456 21446 1433 21338 1317 --
NM_020925chr12936 514 --21246 187 --
NM_020940chr103966 228 47 1627 32887 2356 2334 --
NM_020951chr1941996 1518 697 335 22437 369 12224 --
NM_020964chr1834019 872 814 23830 49 34751 4095 1739 14673
NM_020988chr1621295 237 ----1210
NM_021003chr141129 1727 1781 --
NM_021035chr2011218 11257 21072 453 --
NM_021038chr372806 2058 1124 682 625 391 171 32517 2427 217 1730 --
NM_021064chr611658 21751 99 2603 76 --
NM_021072chr552404 2140 2045 1740 994 31717 448 180 ----
NM_021097chr252426 2072 1032 905 84 ------
NM_021111chr92507 262 --1969 --
NM_021132chr101445 --129 1293
NM_021140chrX3773 263 244 ----11026
NM_021180chr13829 683 620 --1737 --
NM_021183chrX22587 782 32340 922 147 22227 567 --
NM_021222chr111316 --2276 216 --
NM_021252chr1051807 1408 1385 810 48 21940 264 ----
NM_021255chr1463772 3693 2847 1123 780 236 13229 --13968
NM_021637chrX51199 1163 1118 185 178 1153 1225 --
NM_021785chrX----1233 --
NM_021813chr6115861 5509 4944 1528 1497 1419 1307 1196 1180 963 401 --34527 3906 106 15453
NM_021914chr1422190 1884 --1617 --
NM_021945chr643093 2971 724 691 --23532 2716 --
NM_021951chr91788 --1159 --
NM_021961chr11167446 7127 6834 6611 6339 5824 2504 2116 1806 1795 1727 1345 1330 1303 1091 28 36746 2663 377 17415 22055 1247
NM_021964chr395506 5445 4490 4439 4269 2506 1555 1521 1058 --12329 --
NM_021999chr132537 63 1859 1611 --
NM_022037chr22814 163 1869 ----
NM_022049chr121730 1616 11367 11867 --
NM_022058chr251996 1824 1686 1487 331 --12114 --
NM_022098chr22------2536 322
NM_022119chr16----2324 51 --
NM_022136chr21--125 1474 --
NM_022154chr441236 940 447 54 ------
NM_022170chr731708 1605 582 11645 11151 --
NM_022374chr21143 1304 1357 --
NM_022459chr13126296 6004 5608 5336 5009 4850 4345 1727 1676 1614 1604 762 12099 24155 950 25585 1106
NM_022474chr1432746 1888 821 --1920 --
NM_022477chr203246 221 67 ------
NM_022728chr7----1754 --
NM_022735chr121542 1532 151 --11410
NM_022739chr174280 247 222 137 --1412 --
NM_022753chr131969 1870 713 --22494 2279 --
NM_022763chr363113 2201 1236 967 701 391 --140 155
NM_022823chr21531 --1343 --
NM_022824chr561843 1819 1798 1552 1508 61 --11270 1472
NM_022831chr131806 708 173 --1380 --
NM_022832chr452402 2186 1577 955 308 ----11708
NM_022841chr1562799 2449 1113 1076 249 105 --12019 --
NM_022898chr1433160 3091 1360 14850 23512 402 11729
NM_022912chr253094 2463 1131 625 403 --23074 2935 --
NM_022913chr52256 41 ------
NM_024019chr411080 ----1306
NM_024090chr411905 1497 21725 367 --
NM_024345chr9135914 5705 5699 4975 4675 4383 3931 3922 2285 851 724 384 179 24693 4202 25959 4787 12324
NM_024501chr21622 1714 1489 --
NM_024524chr373093 2264 2040 1957 1232 247 216 32669 2017 1264 12964 22867 366
NM_024545chr2----2748 519 --
NM_024551chr1232527 1010 308 1412 12488 --
NM_024561chr1321095 369 --11320 --
NM_024595chr11461 --2185 84 --
NM_024624chr241577 1502 1279 345 --1315 --
NM_024638chr342432 2010 1869 1800 --12368 --
NM_024646chr183738 3376 3042 1453 1439 1318 813 66 13946 1241 --
NM_024665chr374591 3769 3636 3004 1615 722 617 --14638 13923
NM_024675chr16185 --1231 --
NM_024699chr81792 --1133 --
NM_024721chr841863 1804 833 436 11925 11792 --
NM_024814chr71361 ------
NM_024911chr13848 276 145 --1239 --
NM_024947chr3199060 7936 7040 6723 3739 3590 2719 2559 2263 1286 804 719 701 486 388 356 145 131 117 58663 8018 7018 3491 649 59490 9260 7060 3293 1976 --
NM_024948chr10----1131 --
NM_024953chr1272826 2475 2145 1982 785 294 74 --12097 --
NM_024969chr22865 576 --2593 249 --
NM_024989chr2107533 6822 6607 5403 2698 2623 2162 1918 1452 1145 58010 7958 3100 2480 561 47471 5433 1876 966 --
NM_025004chr112661 632 --1492 --
NM_025146chr342739 2184 577 325 22552 284 11096 --
NM_025154chr731485 1262 28 11075 1423 --
NM_025160chr1124083 4041 3601 3485 3403 3322 3062 2993 1396 726 605 195 1156 23625 1730 11367
NM_025187chr1671337 1262 470 460 402 322 49 ------
NM_025191chr163309 3104 2964 2533 2477 982 --11113 11316
NM_030579chr1623356 2719 13178 ----
NM_030621chr1463634 3539 1662 1226 1022 848 33799 283 163 1616 --
NM_030625chr1062661 1666 892 806 472 416 --1199 --
NM_030647chr785519 5309 4817 4043 2494 997 896 418 ----15651
NM_030648chr4155337 5078 4862 4711 4678 4560 4159 3754 1669 1591 931 756 443 287 108 45388 5240 3856 3514 --15065
NM_030763chrX2599 131 2930 175 ----
NM_030786chr141750 1449 765 387 --1332 --
NM_030821chr41133 --1567 1329
NM_030885chr322364 1727 11830 1345 --
NM_030918chr135032 1680 775 ----15255
NM_030939chr62426 373 ------
NM_030940chr931113 453 108 ------
NM_030965chr11771 ------
NM_031372chr411433 --1229 --
NM_031412chr1231140 824 404 1120 1154 --
NM_031445chr242397 943 593 443 13222 ----
NM_032042chr52485 251 1136 11778 --
NM_032102chr1131945 1934 863 --1202 1802
NM_032121chrX32835 2785 2583 32043 978 249 1485 1562
NM_032139chr19----2787 75 --
NM_032144chr23512 123 112 --11432 --
NM_032145chr631877 1319 662 1140 11806 --
NM_032153chr362484 1924 848 673 118 73 1228 158 --
NM_032199chr1012366 --43369 3344 1358 751 --
NM_032228chr11113465 3046 3035 2344 1314 780 686 593 583 514 151 2397 29 13067 --
NM_032229chr131897 1315 --1298
NM_032246chr1531099 1021 218 11291 ----
NM_032352chr1431250 1007 269 1333 1361 --
NM_032373chr1095563 5421 5270 5241 4296 4278 2206 614 436 --32297 1491 1043 21454 738
NM_032410chr841141 993 792 68 ----31166 1070 855
NM_032439chr1041661 1332 1249 616 ----11276
NM_032440chr1041152 1081 593 404 --1467 --
NM_032457chr443610 3177 1479 1461 --11247 13132
NM_032458chrX43183 2644 1054 310 23280 2706 ----
NM_032499chr152155 89 11682 ----
NM_032547chr411364 11399 2930 466 --
NM_032557chr42729 653 281 40 --1157
NM_032558chr911053 11388 11440 --
NM_032576chrY--1352 1110 --
NM_032632chr1441788 593 288 31 1531 11627 --
NM_032682chr353514 3276 2762 1080 62 --12854 --
NM_032689chr193474 348 42 --11155 --
NM_032784chr62314 299 1983 ----
NM_032801chr1131551 1017 428 1750 ----
NM_032810chr1011097 --1418 --
NM_032832chr641371 1161 1088 291 21077 58 11646 --
NM_032838chr193828 431 103 ------
NM_032839chr33510 392 146 --161 180
NM_032859chr1363569 2760 2534 788 487 196 43921 3415 984 544 1233 11226
NM_032873chr1154538 2820 1793 1203 908 43814 3044 1509 597 22922 616 --
NM_032961chr431190 1091 1035 ------
NM_032968chrX114109 3199 3069 2828 2724 2711 1564 1182 796 634 381 13146 11424 13521
NM_032973chrY124101 3194 3064 2823 2719 2706 1563 1182 821 796 634 381 13141 11424 13517
NM_033058chr85892 885 736 724 276 --177 --
NM_033081chr202502 343 11280 2558 161 --
NM_033084chr3----2228 148 --
NM_033089chr2021201 124 ------
NM_033121chr1241432 1165 710 693 --21585 281 --
NM_033127chr12722 634 --1568 --
NM_033132chr1351983 1664 747 597 56 1165 1755 --
NM_033143chr4114609 4326 4174 3672 3223 2993 1272 969 896 683 457 44183 3910 3295 1189 24578 158 --
NM_033201chr161992 --1292 --
NM_033222chr91323 --1454 --
NM_033224chr777619 5709 5670 1749 1110 336 238 16075 16481 15016
NM_033225chr882375 2297 2284 2105 2010 289 276 237 --12711 12226
NM_033254chr31445 --1537 --
NM_033274chr522200 580 13561 23395 133 --
NM_033309chr1611020 --11101 --
NM_033389chr1754707 3996 3662 1738 797 ----14525
NM_033396chr111417 ----1151
NM_033495chrX1740 11089 ----
NM_052840chr1531181 1006 326 1383 ----
NM_052845chr1243108 2605 2235 757 --1495 --
NM_052864chr431647 634 371 1614 12005 --
NM_052876chr1911698 --1464 12649
NM_052879chr1284055 3912 3871 3199 3135 2707 1619 355 12957 --11037
NM_052898chr811656 --21548 654 --
NM_052900chr81437 21676 1495 --161
NM_052905chr261588 1192 731 571 421 368 --11535 --
NM_052910chr1351995 1688 751 582 44 1390 --1370
NM_052917chr243342 2773 2550 1050 12251 11143 1580
NM_052927chr51700 21466 888 1711 --
NM_053002chr331106 133 112 --1308 --
NM_053023chr1132656 1280 639 12196 1552 --
NM_053053chr12363 139 --3999 192 76 --
NM_053064chr1452663 2034 1132 794 183 --23056 2967 --
NM_057175chr452653 1852 1040 451 378 1174 11757 143
NM_057749chr8--21219 173 ----
NM_058170chr141624 1344 557 385 11574 21055 185 --
NM_058237chr143706 391 271 ------
NM_078476chr631624 1400 125 31784 1775 1752 --1642
NM_080546chr92599 314 21840 1833 2774 303 --
NM_080617chr2011044 ----11027
NM_080671chr2----22271 2109 --
NM_080738chr131914 1328 393 --1194 --
NM_080743chr62774 640 12528 1758 --
NM_080797chr2043707 2951 2591 568 --22965 940 --
NM_080836chr2074493 3922 3578 3544 3529 1774 913 14285 23011 72 --
NM_080867chr1484556 4135 1795 1405 1398 1271 675 253 --2344 315 --
NM_080872chr853534 1122 546 429 47 --22680 232 --
NM_080874chr411576 1213 11585 --
NM_101395chr2152183 927 586 567 380 22164 2126 13004 --
NM_130808chr3--1360 --1110
NM_133265chrX73006 2678 2527 2368 2335 2290 286 --13211 --
NM_133367chr632956 2742 627 --13020 12849
NM_133433chr53902 249 153 --1888 --
NM_133468chr732287 903 335 ----1452
NM_133496chr1104011 3996 3850 3358 3291 3255 1318 1261 1108 194 13609 11184 --
NM_133638chr521151 175 ------
NM_134268chr171366 ----2473 394
NM_138288chr1462252 1711 862 645 404 328 ------
NM_138323chr15------2911 90
NM_138333chr942248 1885 645 239 22514 488 12430 12616
NM_138375chr18------1938
NM_138423chr1562189 2091 2067 1893 1791 1648 1249 1276 --
NM_138426chr752345 2245 911 657 61 ------
NM_138459chr653527 2957 2831 1124 990 11385 22568 1056 --
NM_138701chr73307 267 44 --1213 --
NM_138731chr1483842 3787 3315 2783 700 276 268 128 13567 32732 342 38 13811
NM_138771chr711541 11093 1118 1349
NM_138773chr52760 653 1806 1639 1915
NM_138782chr531772 1671 377 21661 663 12336 1230
NM_138927chr211273 1776 ----
NM_138959chr1156797 6314 6194 5855 5794 5189 4627 4517 4317 2634 2519 1877 463 423 207 22381 62 56803 6568 5174 4214 389 14263
NM_138962chr17--1378 1331 --
NM_139136chr1241042 939 419 363 ------
NM_139283chr12--32128 2014 412 2192 84 --
NM_144571chr4176632 6226 6070 5149 5051 4911 4608 4547 4538 4271 4246 2196 1911 1771 1624 492 147 24690 2026 ----
NM_144579chr232221 1835 663 --2199 168 --
NM_144590chr1052937 2748 2662 2086 1060 1680 22683 2623 --
NM_144599chr1594374 4321 4001 3809 1874 1297 1167 566 299 14438 24216 3441 --
NM_144629chr23831 334 227 2472 192 ----
NM_144657chrX1109 1447 ----
NM_144664chr1132558 736 557 1843 12544 --
NM_144709chr22312 156 1425 ----
NM_144778chr1332628 2558 617 ------
NM_144963chr831774 1040 635 --1176 --
NM_144964chr92923 418 1883 --1455
NM_144967chrX31081 320 52 ------
NM_144973chr1265284 4864 4382 3602 3552 1362 25326 5085 14066 --
NM_145000chr56585 558 451 173 166 151 128 ----
NM_145115chr71586 1432 12096 12248
NM_145176chr653321 3087 2861 2681 2192 ------
NM_145203chr132703 632 ----166
NM_145234chrX2965 183 --1277 --
NM_145235chr101143 1100 ----
NM_145243chr11201 --1244 --
NM_145251chr1441355 1023 455 155 --1534 --
NM_145263chr442031 2003 1925 564 32352 2339 355 1764 --
NM_145296chr191632 184 1887 --
NM_145313chr1061702 1151 601 315 264 151 ------
NM_145753chr34484 332 266 135 --11695 --
NM_145808chr743093 2737 2443 302 1764 12968 --
NM_145891chr1651302 623 299 143 85 ------
NM_147128chr741293 553 302 262 --11588 --
NM_147156chr1011048 --3388 341 225 --
NM_152253chr2243897 1033 954 646 --13844 11735
NM_152261chr1242385 2017 733 616 1860 ----
NM_152271chr831008 824 806 1750 --181
NM_152280chr152823 2756 1158 1045 853 --23111 3025 --
NM_152381chr211289 31738 1554 271 ----
NM_152399chr42304 106 11050 ----
NM_152409chr573459 3390 2776 2320 755 749 515 62843 2759 2403 1316 897 469 --12510
NM_152423chrX3587 413 337 ------
NM_152424chrX94678 4670 4521 4122 3616 1656 1602 1303 199 ------
NM_152442chr1241220 424 301 137 ----1160
NM_152446chr143720 628 54 --1296 --
NM_152519chr232152 594 280 11400 21477 827 --
NM_152556chr732385 2209 1885 --12554 12573
NM_152622chr573162 2830 2752 2521 959 949 139 --12337 --
NM_152624chr5107032 5717 5483 4623 4606 1605 1228 887 447 128 36966 5614 2279 15347 --
NM_152638chr1251068 1047 1016 898 415 ------
NM_152641chr122944 318 1502 2408 47 --
NM_152734chr6104894 4627 4486 4419 3953 3748 3680 3391 1439 444 --23841 1985 --
NM_152745chr7----2279 84 --
NM_152754chr783404 2926 2920 1468 1343 1255 1074 889 22530 2487 13388 12336
NM_152756chr573442 3166 3106 3058 1398 1380 941 --13775 --
NM_152758chr892376 2094 1211 1151 1127 1096 668 593 110 1821 22844 166 --
NM_152787chrX43572 3186 2758 635 13420 11382 --
NM_152995chr4----1356 --
NM_153015chr82924 846 2876 868 ----
NM_153020chr621706 1460 1423 11318 --
NM_153207chr1284122 3979 3600 3328 1323 1305 995 86 --23357 224 --
NM_153208chr161957 --2746 221 --
NM_153211chr18----2352 125 --
NM_153234chr5102648 2532 2365 2298 1826 861 264 207 132 91 1820 ----
NM_153251chr13----1276 --
NM_153261chr162481 420 ------
NM_153332chr853025 2947 2444 2403 1257 1110 3535 393 333 --
NM_153607chr552843 2642 2050 886 287 1105 12525 --
NM_153619chr1553352 2592 941 673 488 --1536 --
NM_153634chr1241442 595 498 152 --11061 11452
NM_153702chr4142 --134 --
NM_153810chr1054963 4629 3355 1157 268 14052 11768 --
NM_170606chr711418 21904 591 ----
NM_172037chr871260 1239 989 401 268 83 67 ------
NM_172070chr292137 1727 1611 1537 688 411 393 355 190 ------
NM_172127chr42717 680 ----12020
NM_173075chr431699 1520 219 11448 11532 --
NM_173156chr131585 818 460 ------
NM_173468chr454335 1982 1779 726 686 11789 14876 21554 496
NM_173469chr1521326 191 --31478 1217 1132 --
NM_173470chrX42792 2708 1827 1176 --2281 251 --
NM_173473chr1022628 391 --22402 120 --
NM_173495chrX51871 1628 1599 1025 705 ------
NM_173576chr1062150 2099 2086 1520 444 233 2617 483 ----
NM_173582chr1196196 5570 5411 4513 4207 2227 1991 1144 1011 24056 2478 55791 4497 4111 4003 1607 --
NM_173602chr12103747 3533 3322 2774 1016 729 637 537 238 200 --12329 --
NM_173645chr24234 178 169 48 --1462 --
NM_173648chr22321 116 1726 1262 --
NM_173666chr51401 --1932 --
NM_173667chr511982 1378 --1158
NM_173698chrX41325 552 308 137 21683 1519 --1672
NM_173803chr1621324 1301 --2393 109 --
NM_173808chr173973 3310 1785 1472 1402 966 208 43944 3225 3214 1709 24306 2968 2510 427
NM_173822chr251857 1564 188 80 49 11590 ----
NM_173825chr312541 1804 --1948
NM_173851chr893950 3813 3570 3493 2790 1588 1247 472 319 13301 2588 125 --
NM_174890chr105640 598 588 556 162 1759 ----
NM_174911chr843911 3614 2904 1513 ----13227
NM_174916chr1562154 927 743 320 302 131 ------
NM_175061chr772098 1537 1491 784 733 402 182 --1264 22198 1778
NM_175607chr341334 1207 223 101 147 ----
NM_175607chr341334 1207 223 101 147 ----
NM_175630chr21912 1152 1753 --
NM_175767chr521856 687 --11419 158
NM_175768chr6------1166
NM_175854chr1342145 745 376 341 2773 767 21743 93 --
NM_176806chr54972 789 736 361 ----1208
NM_176812chr201791 1749 ----
NM_176814chr76548 505 428 388 118 82 21308 1057 ----
NM_177968chr22736 239 ----11380
NM_178011chr1073280 2998 2318 1169 1127 950 376 13173 22948 399 --
NM_178013chr1472837 2253 1254 1220 824 456 253 --1523 --
NM_178123chr2----1130 --
NM_178135chr411233 --184 --
NM_178140chr542701 2220 1703 480 2816 320 32738 2568 2150 --
NM_178313chr251610 1524 1391 583 331 ----11425
NM_178439chr24545 505 217 116 ------
NM_178539chr1241947 1686 551 456 ------
NM_178812chr811548 --1469 --
NM_178826chr121250 ----2692 533
NM_181457chr231056 149 119 ------
NM_181504chr574120 2997 2939 2575 1588 541 483 13133 ----
NM_181552chr72923 847 ----1810
NM_181645chr111700 --1181 --
NM_181656chr17--1673 1628 149
NM_181701chr932388 2336 120 --12367 --
NM_181807chr11----190 --
NM_182485chr442847 573 186 132 12793 12901 --
NM_182492chr221270 ------
NM_182503chr6155619 5553 5033 4760 4649 4467 4383 4367 3756 3590 2209 1695 1666 1582 1169 24660 3994 13446 --
NM_182524chr42719 195 --1661 --
NM_182663chr151388 696 668 449 90 --1723 --
NM_182767chr1261810 1690 1633 1446 1390 185 22134 2071 1442 --
NM_182830chr1422281 2209 --11465 --
NM_182970chr20181 --23935 1250 --
NM_183397chr2094875 4852 4205 4148 3846 3530 1860 183 29 13335 11169 --
NM_194247chr293885 3495 2944 2842 1180 1006 829 415 316 1843 23569 3288 --
NM_194291chr862106 2065 1063 378 243 170 2486 72 --1526
NM_194314chr195515 5338 4241 3813 3676 2234 2105 2070 1802 13522 45142 4641 1886 208 --
NM_194318chr1362524 2332 2137 1034 991 186 --12167 --
NM_198074chr1141 1170 1978 --
NM_198279chrX3996 465 53 --31262 833 820 --
NM_198465chrX42253 997 57 27 12338 ----
NM_198490chr333493 558 241 1812 --13250
NM_198581chr2137175 7077 6855 6321 4581 2252 1983 1910 1649 1620 1453 648 488 1697 22638 587 12438
NM_198834chr1732316 1461 749 --12293 11861
NM_198859chr365152 4259 3213 1867 1714 513 23741 1480 34774 3673 203 11945
NM_198904chr53815 586 525 ----11793
NM_198920chr61473 ------
NM_198935chr2093106 2860 2369 2204 1214 1099 1025 576 527 23175 2423 21189 119 --
NM_198965chr123471 310 148 ------
NM_198991chr181546 169 --1128
NM_199000chr771968 1809 1580 735 727 492 75 ------
NM_199072chr743091 2642 244 73 12847 12460 --
NM_199168chr1031142 404 135 --11230 --
NM_199320chr432953 2680 2518 ----22172 115
NM_201439chr121128 1148 ----
NM_201613chr12--1651 1708 --
NM_203301chr1441565 1198 694 660 ----1530
NM_203434chr91796 ------
NM_203459chr132321 1021 998 --11708 --
NM_205848chr142471 1874 1834 768 --1873 --
NM_206853chr653440 3327 3264 3166 660 24160 2796 13454 --
NM_206854chr694701 4588 4525 4427 3701 1921 1104 596 363 25421 4057 44715 3407 1098 463 --
NM_206914chr1221973 1489 1336 ----
NM_207015chr352299 1762 846 840 166 1194 --1176
NM_207306chr123821 1795 --24491 3494 --
NM_207337chr123758 214 190 ------
NM_207372chr101526 1154 --12301
NM_207387chr1771799 1784 1185 682 476 426 68 --11842 --
NM_207413chr81352 3468 334 36 ----
NM_212558chr984285 3943 3090 1157 1021 947 722 668 1753 22710 176 --
NM_213606chr1062569 2445 2422 2331 2106 698 11030 1774 --