TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-576-5p
miRNA Sequence: AUUCUAAUUUCUCCACGUCUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX33061 489 115 ----22472 277
NM_000084chrX66654 5680 1223 1184 1148 183 1649 --22412 221
NM_000092chr254011 3776 3301 3294 1352 31514 1474 1461 34148 2833 794 --
NM_000259chr15105520 5368 5184 4571 2112 2033 1745 1114 837 673 55107 1639 1320 387 168 15059 21697 1507
NM_000321chr131560 51655 1446 1390 1336 434 21634 579 31263 535 528
NM_000368chr944817 2973 1048 410 31855 1830 1597 24789 4302 23852 3211
NM_000555chrX77423 6861 6812 2361 2096 728 610 36464 2911 1095 --31724 1347 652
NM_000618chr1255847 2223 1107 173 81 24296 2289 24638 2180 14960
NM_000813chr571875 1780 1580 1210 994 316 303 44883 3485 644 76 --1963
NM_000899chr1274192 3579 3338 909 545 297 278 23477 1000 1170 13626
NM_001001419chr595157 4351 4293 4222 4111 4034 3964 3524 199 31849 1704 55 13436 --
NM_001002257chr283435 3387 3327 2853 2736 2410 2400 2393 42968 2835 2198 45 12801 12233
NM_001002860chr1473695 3402 1652 1505 807 424 151 23624 2994 1768 23493 814
NM_001003652chr18107220 7085 6076 5841 5353 3274 2911 2087 516 175 13126 --13189
NM_001004317chr6114375 3981 3936 3441 3433 2953 2922 1367 942 777 366 33834 3407 981 ----
NM_001005473chr5136505 6455 6202 6116 5226 4951 4678 4010 2617 1531 1226 311 53 31643 1285 232 12386 15738
NM_001007097chr963852 3664 1428 1190 913 311 11494 13952 23479 1460
NM_001007278chr1353649 1513 899 803 145 54688 4316 3229 47 37 ----
NM_001007466chr685051 4053 2075 1935 1616 429 332 138 11701 --21783 1237
NM_001008925chr483173 2466 2214 1346 761 636 433 105 12428 1278 1408
NM_001011537chr331846 1784 883 32322 1657 650 32145 1636 489 1469
NM_001011666chr775872 5851 5747 5221 4637 4051 76 14360 36367 6178 5665 --
NM_001012418chr6113895 3831 2992 1110 1096 464 452 438 412 383 24 13271 12805 --
NM_001012423chr15102824 2527 2406 2386 1952 1914 885 737 536 339 12594 22399 1075 --
NM_001014380chr13135461 4779 4629 3707 1943 1799 1344 724 533 515 496 413 84 45110 4020 315 298 14718 21259 1154
NM_001014797chr1097541 6133 6127 3241 3070 2471 2242 1944 232 67398 6742 5877 5381 1320 313 46269 5690 3227 2299 36321 6006 398
NM_001018067chr1105219 4647 3650 1485 1271 1131 1094 693 419 384 64978 4760 3641 1622 1441 212 14302 11265
NM_001025077chr1086658 5096 5089 4619 2213 2053 1647 484 37617 700 673 15015 --
NM_001025252chr853033 2830 2499 893 514 42162 2144 1072 222 --23040 2583
NM_001025356chr121950 1851 22589 249 22652 59
NM_001025580chrX33423 1358 979 53034 1524 1231 929 913 11222 24161 845
NM_001031695chr2275309 4351 3326 2116 1525 907 679 13881 41393 1027 971 362 21580 741
NM_001033557chr241419 1276 1260 962 1117 1243 21030 1017
NM_001039547chr357762 6793 6786 3029 1136 57928 6260 2966 2374 1571 --16907
NM_001039618chr1185894 5514 2363 2334 1737 1042 911 398 34196 1869 871 1678 45441 4760 2106 862
NM_001039840chrX105458 5352 5321 5301 4513 4495 4398 4097 2028 67 22002 430 --24987 4061
NM_001040152chr7124879 4835 4826 4712 4694 4687 3845 3601 3342 2023 1045 875 23941 1722 ----
NM_001040202chr43963 700 572 1325 --2683 345
NM_001040441chr144009 3674 1240 308 24178 3518 --21982 1368
NM_001040875chr821667 390 32537 1828 942 21730 547 22486 2249
NM_001042555chr1294750 4601 4485 3850 3615 1410 1005 940 830 22934 1470 11701 --
NM_001042599chr267681 7370 7302 5455 2362 2353 35420 5053 1881 41846 1818 474 171 21720 1241
NM_001042604chr374601 3476 1841 1132 666 635 357 --24728 84 11312
NM_001099678chr386389 5894 5859 3964 2496 1591 1560 53 14467 26301 1470 11295
NM_001100108chr197564 7200 6489 6393 3272 3255 2636 2164 484 37103 1635 239 22049 1455 11986
NM_001106chr3139631 8962 8811 8278 7797 7189 7088 3721 2403 2012 667 635 189 59608 9539 943 396 77 --18353
NM_001167chrX86670 6529 6316 5218 2511 1399 498 477 54711 2607 1526 904 737 1390 --
NM_001201chr443865 427 412 281 42625 2552 1379 291 23051 2446 --
NM_001259chr795844 5730 5415 4450 2415 2104 1797 1779 1763 55054 4855 1716 979 809 13863 34460 4370 588
NM_001609chr1054457 4231 2941 2793 1439 53974 3893 2905 793 616 --23411 3145
NM_001650chr1834064 3943 39 23523 3095 44021 3829 2533 1455 23085 95
NM_001806chr19132988 2856 2799 2427 2324 2291 2194 1936 1925 904 390 117 25 42249 2131 2070 662 22738 2121 11030
NM_001859chr952950 2767 1586 927 282 --13025 23371 494
NM_001918chr178046 6398 3332 3195 365 292 155 37917 7766 3559 38168 5879 3389 38748 8297 5757
NM_002006chr445560 4132 1477 1276 84408 3893 3685 3572 1885 879 306 56 --35133 5062 341
NM_002015chr1332854 1090 785 42721 2311 2092 634 --23337 248
NM_002025chrX108445 7626 6834 6009 5736 3362 2792 2200 1719 526 56763 6618 3640 3480 2488 12245 33380 3282 3167
NM_002214chr785666 5517 4910 3774 3507 2193 1227 1123 21144 943 --25298 1554
NM_002264chr384938 4454 1634 997 792 785 717 554 13562 1276 13509
NM_002336chr1274460 4431 3775 3555 3340 919 687 54017 3988 3565 3147 1190 11224 191
NM_002481chr1106001 5703 5246 2658 2410 1910 1368 1344 1232 332 36734 5009 1261 12529 26008 2668
NM_002577chr363873 3805 3798 2838 553 370 2920 664 12895 13314
NM_002655chr8104538 4434 3984 3718 1655 1611 1499 1092 526 171 ----24799 1278
NM_002709chr273438 3385 3189 2673 2345 1410 1356 33492 1008 585 --13052
NM_003034chr12127403 6808 6031 3198 2978 2814 2803 2567 1985 1633 737 438 47068 6782 1953 110 11905 17939
NM_003112chr752841 2645 808 548 345 5872 716 527 484 244 12907 32590 2462 1104
NM_003133chr121098 117 5235 206 185 155 37 --2320 60
NM_003221chr651294 666 110 97 85 31164 450 318 1362 --
NM_003262chr365085 4887 4234 1128 671 332 31940 1200 839 13844 23937 1952
NM_003298chr395889 5825 5574 5562 2095 1778 822 381 229 35614 2422 259 --15327
NM_003468chr233149 2770 739 22924 1682 --31551 1453 1152
NM_003489chr2152160 566 348 286 179 11242 1958 33354 764 497
NM_003590chr233020 2534 679 53847 3608 2878 1092 302 23130 1403 13166
NM_003895chr2122074 2032 21608 267 --21516 166
NM_004124chr1441428 1168 595 327 1653 --22545 313
NM_004133chr852081 1938 952 676 547 42622 2258 764 575 --1454
NM_004171chr11139236 8784 8478 7942 7698 7646 7160 2566 2310 1815 1150 264 139 48579 7490 3125 2654 37132 6122 3695 26932 733
NM_004293chr953378 1153 1137 441 358 73710 3407 2936 732 567 461 77 42737 2635 830 389 --
NM_004331chr831905 921 216 52290 1046 966 777 247 12583 22467 1889
NM_004719chr1222338 306 1752 22364 2048 22408 330
NM_004791chr13----2497 49 2197 160
NM_004815chr173550 3529 3291 3074 1350 1096 1036 34041 2981 912 44622 3707 3141 1547 13714
NM_004852chr18813318 11427 9823 5162 4701 1855 853 234 712536 11064 5554 4041 3951 1356 658 29243 9237 111320
NM_004857chr1464334 4130 3984 3736 273 199 12958 14272 13216
NM_004859chr1743018 1003 988 195 22642 2364 12778 12458
NM_004866chr583874 3702 3561 3492 3065 1639 1387 559 23598 361 32025 1964 1414 31924 1773 381
NM_004956chr774334 4242 3970 3743 1459 1092 820 1515 13291 14154
NM_004999chr673444 3408 3294 2798 1201 1133 94 43390 2743 1257 498 --1777
NM_005065chr14125385 5169 4959 4920 4595 1907 1538 694 552 509 147 75 24133 1612 24824 4509 33769 1211 842
NM_005156chr931086 557 293 54809 3718 965 815 662 14845 25166 756
NM_005188chr11118238 7229 5883 5840 2206 1952 1773 1438 1199 594 29 35602 1074 468 ----
NM_005266chr121373 584 21883 1723 --21844 1380
NM_005504chr12106169 5239 4511 4187 4171 1630 1553 1511 1123 952 35698 2224 915 35475 941 811 65750 4076 2583 1757 888 585
NM_005611chr1651153 927 423 239 171 1279 11250 11063
NM_005665chr153782 3624 3596 1674 58 53994 3169 1546 286 70 14875 13474
NM_005746chr742626 2375 2205 1028 32573 2120 816 11751 32581 1793 170
NM_005824chr73707 76 68 2750 493 2294 122 --
NM_005935chr455161 3974 3364 1472 1191 33830 3244 1069 24028 51 11417
NM_006047chr2042727 2455 2307 86 23430 3326 --33034 2803 245
NM_006106chr1172245 2144 1371 1347 1044 605 362 --11274 23299 1213
NM_006153chr3--1649 --3613 485 93
NM_006212chr1124873 1976 1664 1652 1554 1289 1229 1033 1022 890 848 243 43853 3492 1810 929 ----
NM_006241chr352168 1594 306 159 35 42009 1859 1705 150 1893 --
NM_006252chr166532 4631 2831 2287 2203 1528 37025 2803 1950 42897 2320 967 714 --
NM_006306chrX124895 4429 4285 4229 3907 3734 1479 1072 607 447 409 395 23788 1298 25232 3589 11609
NM_006315chr454107 3911 2841 898 494 21627 1269 --23473 1216
NM_006420chr2052674 2234 1378 643 511 1469 --2540 389
NM_006544chr1475607 4539 4032 2054 1554 1535 556 65481 4343 1642 1350 1171 369 24725 644 --
NM_006599chr1677718 5893 5395 5229 2987 2311 522 86359 6241 6053 6037 1978 1957 1002 895 38235 2837 1011 1349
NM_006628chr15104357 4125 3055 2896 1689 1562 1321 643 439 205 24452 1538 11578 --
NM_006729chrX65588 4662 3566 2102 1269 559 1518 --23962 2254
NM_006750chr16127829 7636 7561 7315 7198 5717 5509 778 715 645 493 265 27761 1330 27122 1290 --
NM_007007chr1274638 4059 3778 3462 3294 1754 1312 --1644 23684 304
NM_007249chr1398645 8034 5796 3699 3608 3335 2472 1875 1295 39430 7336 6226 13713 13578
NM_012081chr543663 3001 2760 2353 1480 23211 706 22790 314
NM_012096chr333728 3603 33 22434 955 3801 761 520 21495 392
NM_012164chr9117149 7110 7085 6769 6594 5681 5291 5083 4706 2839 258 27569 756 21751 1378 --
NM_012214chr256110 5565 4634 2143 921 76138 6094 6019 4279 1813 565 142 11950 1459
NM_012262chr164268 4056 3266 3245 1008 21 33947 3450 1640 34778 4750 495 23362 127
NM_012347chr653023 2955 2243 881 259 21978 1151 42476 2331 2069 155 --
NM_013255chr7148713 7520 7508 7410 7125 6795 5661 5573 5439 2998 1401 860 305 202 25624 2092 68118 7444 6660 6559 6491 3246 18094
NM_014141chr794449 2065 1766 1673 1627 968 367 308 250 --44550 3375 2016 880 15335
NM_014243chr421875 643 1333 2209 126 31600 1401 444
NM_014331chr4126993 6892 6247 5747 5734 5627 5454 5332 3079 2599 776 264 16787 27387 810 21333 1106
NM_014372chr121688 1282 2637 170 --3515 331 89
NM_014701chr1583158 2637 2371 1237 1155 1145 1105 1090 12861 --12412
NM_014729chr841859 1763 815 122 22041 1731 --2834 98
NM_014819chr542373 2049 877 729 1129 1532 22169 415
NM_014904chr1072872 1137 1043 802 544 249 31 22547 554 13582 --
NM_014906chr1763852 3130 2784 2585 1268 754 1976 21131 1039 13781
NM_014962chr2052879 2339 716 681 238 1482 --21773 612
NM_015026chr1244332 3642 3055 1166 13428 43864 3004 1930 1444 11784
NM_015071chr555386 4224 2611 2255 855 36143 5517 2189 --26332 5923
NM_015092chr1684261 4228 4202 3457 3212 1582 1229 347 44613 4158 2912 1853 33742 1859 1084 13900
NM_015156chr1463809 3673 2693 2498 844 358 21627 506 21017 956 13964
NM_015313chr1173062 3023 1920 1901 1863 1480 909 --14087 14015
NM_015455chr584112 4044 3780 3161 3076 1334 1110 709 32718 1463 511 --11625
NM_015879chr18128309 7899 7481 6879 6012 5322 5267 3423 2820 2327 1297 1011 78377 8229 6693 6463 6050 2432 1637 47937 7840 2854 1757 12629
NM_015906chr184789 3110 2986 1557 1283 1223 714 154 2630 291 11521 14849
NM_016132chr1552792 1208 1004 859 844 --32607 2601 413 12562
NM_016206chr397793 7009 6982 6015 5794 5778 3016 2896 2315 36500 5534 1259 38918 7754 1292 11554
NM_016221chr562141 2087 1605 958 295 82 12174 --22059 583
NM_016297chr293567 2900 1176 1087 1055 994 716 702 279 --32939 1306 233 13377
NM_016531chr484167 3857 3381 3111 2976 2849 2649 1355 ----1368
NM_017637chr998940 8853 3587 2924 2643 1796 1464 729 621 68343 7018 6894 3027 2977 1982 26521 1127 --
NM_017658chr1483986 3971 3638 3568 3394 3324 3186 1513 23075 651 --23528 3011
NM_017831chr1864587 4453 4172 1183 511 302 44505 975 894 497 --14390
NM_018085chr1117570 7267 6936 6781 5694 3282 3224 3005 2394 997 965 35648 703 181 12009 25828 1152
NM_018373chr1496287 6158 5252 4317 4057 1975 1675 890 218 24511 2359 24737 365 12407
NM_018374chr784886 4288 3900 3722 3341 3189 1136 1018 44910 4686 3522 1109 13586 --
NM_018440chr866817 6699 3363 3081 2538 529 37037 2992 2671 22071 1551 38059 2101 1661
NM_018638chr12104963 4179 3857 3485 1856 1668 1293 702 636 518 21374 546 --2605 213
NM_018970chr763041 2394 2224 2036 409 351 11249 31259 589 518 --
NM_020119chr743522 2592 1431 799 32452 743 598 43868 3274 2653 152 --
NM_020144chr721704 705 ----31516 622 105
NM_020453chr461934 1747 1570 426 123 41 42072 1718 781 286 --21385 663
NM_020466chr684394 4352 3642 3499 1603 336 267 57 44916 4474 3832 1989 13537 14514
NM_020772chr17118242 7738 7446 7161 6869 5626 2758 2674 2469 753 196 77279 7113 6945 6061 5888 2690 2497 37727 7643 42 16478
NM_020774chr1885361 3935 3869 2494 2222 1665 571 75 56222 4734 2424 1193 175 13809 --
NM_020830chr242861 2600 2123 335 22204 2140 13098 22480 470
NM_020872chr331394 534 396 21437 513 --21360 30
NM_020917chr192872 267 --11217 31305 1151 109
NM_021163chr773395 2838 2818 2352 830 694 560 3965 347 23 32420 605 123 --
NM_021961chr1177006 6578 5919 5467 2632 1922 522 15030 --26517 4740
NM_021964chr3106409 5901 2222 1472 1114 1064 974 930 331 39 24452 1599 --16580
NM_022351chr842519 2455 938 361 33372 2751 737 --33331 1396 71
NM_022828chr561767 1638 662 393 131 118 21430 1159 11563 1422
NM_022832chr472277 2147 1990 1908 1693 256 136 --1300 22223 1973
NM_024345chr9102371 2035 1950 1932 1344 1251 947 837 189 84 45966 2177 2102 48 23911 428 33895 2404 774
NM_024761chr934951 2114 22 35319 4972 4163 13248 25289 3792
NM_024947chr3159116 8397 7113 6964 6283 6012 3397 3352 3330 2748 2435 2094 1988 780 656 16221 59177 9129 8410 7647 1896 11751
NM_025054chr874153 4006 3802 3406 2963 490 218 14192 1260 12773
NM_025160chr1104280 3334 2915 1501 1082 834 730 440 396 201 21025 375 23243 1110 --
NM_030625chr1072613 2480 2330 1958 921 843 333 --1878 1885
NM_030806chr179436 8763 7803 7785 7444 7284 3717 38454 8032 961 39228 8154 5952 27774 2777
NM_032047chr362014 1872 1641 594 394 324 3652 341 215 --1715
NM_032182chr1011344 11148 1509 2320 313
NM_032373chr1055329 1763 1244 963 699 65758 1548 1405 1385 1345 469 44224 954 583 173 14555
NM_032446chr563748 3622 2893 2609 625 230 52834 2677 1062 658 200 22458 646 --
NM_032859chr1372832 2520 1391 1015 888 744 69 31600 1296 1133 --33509 900 166
NM_033211chr531457 469 448 ----32038 1475 362
NM_033224chr796529 6350 5844 5638 4877 2707 2266 1885 637 67389 6369 5693 5646 5431 1129 27376 5954 16150
NM_052832chr83982 699 364 22782 154 --32399 1888 690
NM_052879chr1243720 1264 1040 334 33173 1410 701 --24117 423
NM_080867chr1444886 4292 4251 1504 21833 1266 24678 803 23340 1452
NM_138348chr5126680 6366 5992 5826 5758 4883 2464 2365 2052 1487 1368 872 15548 22320 1664 --
NM_138468chr266211 5938 5462 4302 1773 1151 41729 522 482 344 1494 44317 1166 248 224
NM_138731chr1464171 3450 2995 1091 334 106 23107 937 --43940 3643 2847 1461
NM_144578chr1485446 5416 5359 4321 1468 1443 954 339 33903 1715 1536 195 14816
NM_144721chr452087 1026 961 933 329 1997 1948 1894
NM_144963chr842643 2026 856 652 22317 978 31065 1056 870 --
NM_145176chr682756 2717 2512 1343 826 797 754 46 12687 22646 508 1779
NM_145307chr1074191 3717 899 760 565 251 129 24421 690 21154 980 24539 3132
NM_152332chr1452330 2100 436 396 46 21070 983 2968 251 1675
NM_152624chr5147427 7183 7036 6737 6090 6084 5999 5844 5825 2763 2534 1673 923 381 67338 6952 5796 5736 2866 907 --16133
NM_152754chr763409 3378 1184 838 700 277 53444 3398 2941 2860 2534 13583 --
NM_152756chr563429 3415 3307 2942 1207 151 13469 22841 1349 22766 501
NM_152774chr752698 2493 2330 941 33 32616 2386 563 --22520 800
NM_153207chr1253201 1560 1430 645 138 34060 3230 3078 190 2467 372
NM_153456chr1385323 5175 4262 2349 2225 1219 1089 251 46099 4897 2483 1141 25145 1401 14466
NM_172070chr242092 442 332 144 ----2883 467
NM_172071chr196976 6924 4880 4717 2457 2437 791 617 581 47323 5619 2963 880 26947 2481 35867 1365 540
NM_173468chr475057 4350 4025 3834 2162 1407 1299 85133 5086 4571 4432 1509 1461 1051 1037 1453 --
NM_173552chr342059 1840 931 91 --1724 22216 294
NM_173665chr52524 478 ----3620 213 107
NM_173667chr521586 1532 12096 12185 32282 1546 396
NM_173826chr341722 1319 700 423 ----21652 1384
NM_173829chr5105725 4251 4115 4018 3902 2325 2298 2069 764 68 35780 1381 847 23973 869 11939
NM_173851chr832699 1034 189 --22948 476 2531 413
NM_177966chr31204 11922 --21478 1199
NM_178509chr1783385 3333 2774 1315 1153 459 287 251 11447 --24034 434
NM_181504chr554185 3440 1591 1553 723 53547 3309 1627 1498 673 --13679
NM_182485chr493237 2906 2597 2388 2340 1254 722 491 281 1659 --1953
NM_182503chr695605 5529 5188 4373 4337 3401 2088 783 170 64637 3871 560 531 325 258 25394 5366 --
NM_194247chr253479 1392 824 797 252 24461 956 1101 22847 1817
NM_194314chr175017 4779 4553 3938 3594 2228 1326 1982 34425 4370 4199 1493
NM_198468chr654470 4296 3693 1840 202 64552 4366 4112 4099 1662 564 23809 3735 --
NM_198581chr2107309 6070 6017 5933 4663 2772 2426 2394 2366 1217 26117 2442 12946 37448 4557 1102
NM_198715chr1105507 5256 4393 2319 2141 1998 1725 1552 594 139 22357 1504 14399 --
NM_203463chr294330 4286 4264 1800 1444 1252 599 416 249 54965 3694 3541 1749 1587 ----
NM_206854chr665167 4401 4033 3582 870 167 53688 3668 3434 840 773 --25139 4125
NM_207406chr4106492 5830 5806 5412 5065 4682 1830 1725 1002 195 56397 5738 4338 4240 1167 --25113 4795
NM_213589chr274033 2077 1483 755 544 376 348 14599 13424 11493