TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-577
miRNA Sequence: UAGAUAAAAUAUUGGUACCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr54452 195 188 176 --1144 --
NM_000027chr41201 1173 1305 1183
NM_000038chr562043 1358 783 424 298 180 22054 1844 41716 1517 705 165 --
NM_000051chr1173558 2632 2381 2168 1136 921 724 13501 41049 1028 689 61 11067
NM_000052chrX63432 3348 3132 3033 2819 620 22185 532 43297 1371 314 140 21368 192
NM_000081chr111165 21758 1572 --11668
NM_000084chrX166591 6534 5968 5924 5844 5453 5405 4769 2687 2175 2093 1951 1896 1341 728 122 --36494 1962 1956 --
NM_000090chr21865 1108 2210 111 --
NM_000092chr263714 3705 2817 1378 230 127 14155 11722 --
NM_000093chr912104 --22267 943 --
NM_000096chr3----1782 --
NM_000097chr331222 1065 472 --21070 399 --
NM_000104chr282936 2924 2615 1154 1138 940 589 269 22910 2413 12037 --
NM_000108chr731205 578 405 --11893 1509
NM_000112chr5115509 5013 4989 4908 4717 4271 4250 1442 1398 872 757 25262 2073 65561 5186 4834 4698 2076 1775 --
NM_000138chr1552484 2446 2368 617 549 ----12225
NM_000151chr1711880 --21766 328 11898
NM_000158chr3--1105 1577 1168
NM_000161chr1461782 776 493 143 113 55 --21813 1685 --
NM_000163chr532059 1948 258 --32393 788 521 1441
NM_000165chr621702 570 --31452 1396 1089 --
NM_000167chrX61605 1586 1554 1471 1307 588 ----1110
NM_000176chr5113726 3653 3647 2786 1467 1341 583 231 104 73 53 --53828 3485 2768 993 98 --
NM_000176chr5113726 3653 3647 2786 1467 1341 583 231 104 73 53 --53828 3485 2768 993 98 --
NM_000176chr5113726 3653 3647 2786 1467 1341 583 231 104 73 53 --53828 3485 2768 993 98 --
NM_000179chr2----182 --
NM_000189chr221765 266 --21537 139 1809
NM_000192chr1221288 477 --1211 11211
NM_000196chr16----1541 --
NM_000199chr17----11141 --
NM_000208chr1934794 4660 3664 --23840 3249 --
NM_000210chr222062 821 12199 32231 838 438 --
NM_000211chr211118 ----1310
NM_000214chr2041501 638 613 362 1478 1481 2682 354
NM_000216chrX114068 3648 2793 2653 1590 1468 1011 795 774 713 498 33986 3504 780 23110 2831 33935 3508 2800
NM_000217chr1274932 4289 2068 1661 1022 1010 222 --45152 3327 889 527 --
NM_000222chr462093 1933 1636 1554 162 67 11346 21849 1744 --
NM_000230chr762492 940 807 788 507 294 ----1493
NM_000232chr462925 2623 2589 674 184 100 22018 935 32929 2290 579 11966
NM_000233chr21186 2656 105 2889 108 1630
NM_000237chr871943 1821 1565 694 687 269 154 --1727 11710
NM_000244chr11----1778 --
NM_000248chr34939 690 313 125 12131 82473 1992 1215 893 833 828 753 149 12470
NM_000259chr15125737 4568 4485 4385 4283 2177 2157 1025 954 199 110 61 1867 35466 2205 319 22202 2198
NM_000264chr953357 2846 2345 421 155 --62639 2435 2385 2242 2237 668 12624
NM_000267chr1743436 3127 2634 779 --21037 759 13325
NM_000274chr102519 69 --1594 --
NM_000289chr121111 --1305 1302
NM_000296chr16----1264 --
NM_000297chr451960 1840 1657 653 381 --2807 147 --
NM_000314chr1062269 2196 2078 992 882 289 --23253 2435 12512
NM_000321chr1371713 1503 1418 1160 719 388 50 31332 1097 194 41460 1111 1104 568 21787 1404
NM_000325chr4----1674 --
NM_000328chrX1124 ----1162
NM_000329chr12800 587 ----1176
NM_000332chr6167174 7153 7089 7031 6863 6330 6108 5663 5381 5292 1869 1847 1578 1485 1144 97 12379 45751 5740 4346 989 15764
NM_000337chr566177 5923 5320 4276 4089 2650 25773 1448 64796 4527 4473 4136 1451 1055 --
NM_000345chr43982 965 293 --21022 988 --
NM_000346chr1751366 1308 758 525 385 --31866 1290 113 21714 1287
NM_000349chr8--11292 --11222
NM_000353chr1621188 1174 --11236 --
NM_000361chr2051964 1913 1467 733 260 11700 32013 848 362 11704
NM_000362chr2233632 3588 161 13556 33656 2492 2407 --
NM_000389chr631257 1038 101 1180 1236 --
NM_000390chrX63352 2494 2080 1161 1027 399 33319 746 628 33346 3061 410 23210 3132
NM_000393chr222132 1550 1816 3415 315 174 --
NM_000404chr3----1268 --
NM_000408chr283397 2813 2593 2575 2444 1319 1308 302 23111 539 42721 2460 182 168 1869
NM_000435chr192405 335 --1341 1187
NM_000439chr542330 2205 1025 85 1580 --12491
NM_000441chr742328 782 755 470 ----1148
NM_000448chr1153034 2980 2848 1234 228 --53167 3066 2372 1322 809 --
NM_000450chr131764 1669 1139 ----21822 1340
NM_000452chr1332066 494 67 --12101 --
NM_000458chr17----1933 --
NM_000462chr1571569 1331 471 348 249 233 175 --1316 --
NM_000474chr7------1584
NM_000480chr1141559 1420 1405 1169 21087 239 21645 1185 1537
NM_000489chrX103349 3229 2652 2330 1300 774 638 567 530 183 12756 53268 2277 1259 719 53 --
NM_000493chr6--31021 925 751 1109 1929
NM_000503chr831450 1165 522 1481 21893 1803 --
NM_000509chr4----144 1168
NM_000510chr1151412 1365 1213 1062 230 ----21203 953
NM_000523chr251101 400 208 148 47 --1376 --
NM_000527chr1952342 871 686 121 65 --12239 --
NM_000533chrX31965 1376 1338 ------
NM_000536chr112416 232 ----195
NM_000538chr1351441 1387 1370 473 211 --31845 1787 37 --
NM_000545chr12------11285
NM_000555chrX157810 7358 7017 6652 6439 5732 5638 5248 5236 5159 5094 5084 1532 1334 127 17711 55644 4765 2209 160 110 21287 1030
NM_000572chr13949 230 131 --1981 1167
NM_000574chr161222 915 387 349 124 67 --21238 937 --
NM_000582chr43462 395 101 --1423 --
NM_000584chr421074 788 21105 216 4906 765 760 219 --
NM_000586chr42207 71 1191 --148
NM_000588chr5--1158 1287 2259 255
NM_000589chr5----135 --
NM_000596chr7----1176 1158
NM_000597chr2----1283 --
NM_000598chr741574 1550 421 44 --31555 1451 1408 --
NM_000599chr234606 4564 635 --24600 3889 24625 955
NM_000609chr1022897 2126 --1182 --
NM_000610chr1162964 2766 2481 2185 2145 635 --42157 1847 568 550 --
NM_000615chr1132529 986 599 --42545 2439 791 464 --
NM_000618chr12136524 6421 6292 5190 5158 4634 2479 2257 2075 1903 420 232 167 24325 393 86116 6046 5901 4750 2640 814 649 630 --
NM_000633chr1895232 4959 4901 4374 3945 3443 2055 1563 1490 --41913 1739 1514 229 2264 260
NM_000637chr8--1157 1104 --
NM_000641chr1921541 104 4324 171 161 48 3468 174 59 3328 56 52
NM_000665chr7----163 --
NM_000680chr8----1405 --
NM_000686chrX51312 621 350 143 63 11345 11500 --
NM_000719chr1255562 4589 1982 1539 1200 36692 1039 896 36244 781 33 16675
NM_000726chr211332 --1509 --
NM_000756chr8----1103 --
NM_000758chr51270 ----4249 245 241 237
NM_000780chr831220 1055 283 --3839 314 309 11042
NM_000793chr1453423 2055 1802 1718 879 12018 34937 1860 1855 1119
NM_000801chr2011096 --2406 256 1433
NM_000806chr551454 595 465 121 85 11233 11635 151
NM_000809chr4208914 8856 8210 7942 7848 6905 6533 6454 6388 3680 3146 2778 2577 2438 2210 1967 1507 1404 407 201 12698 98933 8145 6500 6206 6144 5759 5720 3135 2565 3875 782 699
NM_000813chr575543 4621 1936 1086 977 422 264 13716 55233 4958 4143 3515 1101 14140
NM_000814chr15104224 4152 4090 3969 3631 3547 2839 2710 1645 650 11125 23979 1199 --
NM_000824chr4----1937 --
NM_000826chr472440 2328 2006 1640 1616 858 220 --12563 --
NM_000827chr511783 --1337 12472
NM_000834chr12------1128
NM_000842chr111714 ------
NM_000845chr7----1491 --
NM_000872chr1021566 1295 11527 21591 1264 --
NM_000875chr1576931 2635 2370 2198 781 395 207 25052 4718 36684 2461 507 36663 6316 2621
NM_000878chr2222115 1807 ----12168
NM_000879chr5--1244 --1324
NM_000882chr32389 313 1399 --2376 328
NM_000885chr262137 1778 1460 780 669 261 12149 --1522
NM_000891chr17133686 3596 3233 2990 2841 2778 2481 2376 1200 915 683 473 308 12666 33304 2669 937 --
NM_000899chr1274396 3678 3661 3514 1222 1098 380 11078 21375 125 33919 3120 3116
NM_000901chr452398 2384 1957 1846 992 1607 --1872
NM_000910chr421278 274 --11741 11251
NM_000919chr52574 206 ----1133
NM_000935chr341126 1041 1005 886 1347 41017 970 242 33 1374
NM_000937chr171393 --2398 386 --
NM_000938chr4----1112 --
NM_000944chr462175 1818 693 489 364 116 --12311 1392
NM_000945chr221914 811 1583 2457 278 1627
NM_000950chrX83535 2972 2473 2365 2345 977 882 95 --53179 3125 2717 2236 137 --
NM_000956chr14------2955 768
NM_000958chr541328 498 441 324 --11065 --
NM_000963chr192115 2025 1983 1760 984 814 785 431 215 31775 1641 59 12504 31516 28 24
NM_000964chr1711414 --1521 --
NM_000966chr12------1846
NM_001001323chr1253153 2795 2188 1205 384 1710 63212 3182 3178 2458 596 429 23162 1272
NM_001001331chr322572 451 1775 --12706
NM_001001395chr12102599 2520 2494 2402 2329 1958 1803 1765 337 194 --2278 50 12197
NM_001001419chr5145133 5064 4931 4827 4470 4299 4274 1970 1843 1634 434 304 285 111 12052 74613 4399 3847 1890 846 519 314 --
NM_001001433chr2053138 3013 2579 1285 1061 22979 2970 22982 1990 --
NM_001001436chr161773 1857 2820 569 1703
NM_001001481chr893361 3141 2981 2118 1211 1029 848 601 203 12788 72725 2487 1215 1170 784 268 262 52722 2718 2714 2710 945
NM_001001484chr102354 210 --1850 --
NM_001001549chr732746 1057 777 --22565 2303 12075
NM_001001557chr8------11866
NM_001001567chr21----1178 --
NM_001001664chr2133858 3537 2878 2653 1329 654 402 368 263 232 218 167 101 13962 33257 619 552 23679 1607
NM_001001665chr21521 --43171 1259 1203 988 --
NM_001001668chr1953909 3387 3244 1153 198 12712 14147 --
NM_001001669chr522209 570 12498 2518 492 12502
NM_001001791chr1031690 1663 1542 --21529 1385 --
NM_001001890chr2153795 2970 1619 486 407 21714 817 43660 3269 3253 547 1645
NM_001001928chr2287973 6532 6106 2432 1773 1580 1440 1268 --56634 6629 6624 5305 498 --
NM_001001933chr15608 240 171 50 43 --1472 197
NM_001001938chr9133677 3086 3070 2895 2754 2512 1342 1318 1209 1112 1097 857 638 --54056 3367 3332 2879 621 --
NM_001001971chr1041216 1050 1030 292 --3992 464 54 1339
NM_001001974chr10102409 2354 2189 1770 1652 870 780 720 705 559 12182 12150 --
NM_001002233chr831658 1474 743 12097 12111 32194 2117 2078
NM_001002243chr21237 ----1167
NM_001002257chr263564 2544 1303 995 525 119 13337 --12681
NM_001002265chr10----1603 --
NM_001002295chr102932 320 --1728 1769
NM_001002838chrX21495 46 21639 427 1509 --
NM_001002843chr1521093 372 --1486 21172 1054
NM_001002860chr14104682 3956 3949 3661 3380 1596 1288 1237 351 148 --53223 471 312 268 211 24540 3819
NM_001002919chr22414 207 1219 1109 --
NM_001003398chr121523 --3608 549 537 --
NM_001003407chr1085144 5086 4163 4093 3973 1588 1241 418 --44365 4290 4051 310 --
NM_001003652chr18198447 7633 6678 6023 6000 3338 3246 3090 2917 2180 1865 1755 1736 1012 976 933 756 462 283 21875 513 68419 7094 6259 5319 2883 873 32890 2780 1317
NM_001003674chr18116750 6241 5367 5129 4958 4525 1925 1710 1051 882 645 26686 2707 66156 5955 5189 4980 469 222 --
NM_001003678chr11----193 --
NM_001003681chr2231363 612 363 --12049 --
NM_001003694chr3----1616 --
NM_001003712chr12123654 3641 3430 3364 2809 2706 1109 905 535 436 289 81 --43495 2644 792 157 12950
NM_001003760chr6103637 3511 3400 2801 2634 2613 1355 1347 1205 806 141 83143 2881 2607 1371 1008 698 401 241 33543 460 456
NM_001003792chr31414 --61261 949 780 483 478 208 --
NM_001003800chr911245 --23535 3468 11051
NM_001003809chr18----1274 --
NM_001003810chr4----1209 --
NM_001004303chr15717 691 603 529 201 1284 --1723
NM_001004313chr1711598 11704 21365 84 31590 1386 331
NM_001004317chr653717 3521 3225 1435 1023 21042 962 53824 3694 3538 2744 315 14243
NM_001004346chr411199 --5239 178 110 93 48 --
NM_001004356chr4----11519 --
NM_001004419chr12104468 4275 4249 3448 2849 2817 1798 1473 710 556 14326 44107 3300 541 155 --
NM_001004441chr531279 350 270 11459 21478 1078 --
NM_001005291chr17--1542 1494 --
NM_001005377chr19--1277 1280 --
NM_001005386chr271967 1960 917 629 353 132 52 --31645 771 616 1658
NM_001005408chr17----1312 --
NM_001005463chr1062637 1734 994 945 572 213 --22563 2365 1155
NM_001005473chr5126668 5869 5839 5182 4574 4412 2637 2628 2319 2266 1625 455 --46625 5343 4205 1630 --
NM_001005474chr341468 1334 1200 531 --11307 --
NM_001005609chrX43825 2443 1221 945 1133 13608 1747
NM_001005739chr2----1816 --
NM_001005781chr2----1238 --
NM_001005782chr22785 730 --3790 687 45 --
NM_001005845chr851904 1792 1590 724 60 --175 --
NM_001005845chr851904 1792 1590 724 60 --175 --
NM_001005861chr33952 856 201 --4781 632 365 109 1778
NM_001005909chr31267 --1179 1176
NM_001005910chr3----1476 --
NM_001006600chr5102296 2238 2065 2006 1655 1595 628 565 401 42 --2926 291 11547
NM_001006618chr9----2276 209 --
NM_001006641chr921443 1163 --21469 1087 --
NM_001006945chr11253 1530 1206 --
NM_001007024chr1754335 3894 3433 3129 2670 13244 22975 252 13248
NM_001007075chr43909 308 44 --2839 344 --
NM_001007097chr994792 4783 3970 1363 679 610 384 362 114 --65035 4121 3921 3844 1484 884 14137
NM_001007102chr641355 1308 472 54 2299 130 21563 242 --
NM_001007156chr1511870 --41971 1667 623 617 --
NM_001007189chr5148 --2157 113 --
NM_001007214chr12550 207 --1743 2748 163
NM_001007245chr7183 --1616 1238
NM_001007257chr111244 11134 ----
NM_001007466chr6155159 5133 5121 5111 5020 4767 4730 4612 3648 3353 3260 1347 889 290 280 14686 21696 266 --
NM_001007467chr22----196 --
NM_001007471chr93768 669 98 1641 1847 --
NM_001007538chr1351479 1328 389 346 328 --11633 --
NM_001007553chr12496 333 --31161 1110 261 11062
NM_001007559chr1812091 11327 1433 1635
NM_001007595chr152139 107 180 183 192
NM_001007794chr14732 633 129 122 --2757 650 --
NM_001008239chr1883701 3046 3022 2985 2962 2909 2738 247 --53181 2972 548 363 261 13369
NM_001008272chr3--1255 1274 4271 267 263 259
NM_001008388chr42352 87 --1101 1139
NM_001008392chr372352 930 760 747 672 476 417 --22381 781 --
NM_001008405chr731346 1304 393 11313 21863 494 --
NM_001008408chr795792 4441 4059 2558 2077 1968 859 464 414 --34953 4885 1849 --
NM_001008495chr84690 479 307 213 --31812 653 267 21946 327
NM_001008541chr1062134 2007 1962 544 537 507 --31587 895 826 --
NM_001008564chr1342266 2226 2217 1950 11928 21931 1854 11851
NM_001008660chr1151420 1277 639 435 316 --11599 1551
NM_001008738chr552673 2569 2120 479 439 1662 11973 12186
NM_001008779chr2----1275 --
NM_001008925chr4113550 3434 3331 3052 2985 2921 2437 1371 1324 966 924 --33280 3227 2976 --
NM_001009185chr5----1184 --
NM_001009566chr1----1422 --
NM_001009569chr1031620 444 336 11557 21547 1478 11071
NM_001009881chr11212 1178 1607 --
NM_001009894chr1241553 1235 161 23 ----1623
NM_001009899chr3136498 6461 5508 4517 4132 4006 2594 2006 1118 607 548 188 128 46125 4822 702 672 96380 5692 4402 4251 3995 1826 968 887 222 16527
NM_001009909chr11103630 3260 1551 1113 1048 574 533 513 497 42 13144 33700 2903 2891 22888 539
NM_001009958chr72421 245 --1532 1620
NM_001009959chr242425 1637 966 85 21792 785 2758 219 --
NM_001009960chr762215 818 671 555 505 28 12427 2995 805 2968 776
NM_001009993chr2124529 4359 3980 3946 3823 1823 1778 1402 1291 1228 879 849 --13926 21122 949
NM_001009994chr6----190 --
NM_001010853chr653114 3059 2980 2311 2302 12904 43298 2753 2599 1090 22750 1998
NM_001010854chr14--1626 --1662
NM_001010861chr162492 1789 1024 493 390 189 1698 52587 1076 701 530 470 --
NM_001010862chrX52409 2238 2215 2107 740 --1266 --
NM_001010888chrX64347 3834 3415 2958 1236 870 14651 54504 3209 2904 1658 416 --
NM_001010891chr5136888 6672 6400 6134 4895 4626 1674 1151 1086 1006 763 378 369 25604 1398 35064 2262 356 --
NM_001010922chr1154250 4162 3748 3673 3475 3342 3319 3260 2624 1288 1270 794 212 139 110 13178 23572 3140 23469 3182
NM_001010923chr641706 1501 1102 286 11323 11366 21363 258
NM_001010927chr64549 414 167 158 --1563 1395
NM_001010935chr131004 901 357 --1761 --
NM_001010942chr12------11053
NM_001010984chr162571 2131 1793 1663 807 231 12252 32317 2064 202 1783
NM_001011513chr4144000 3935 3845 3355 2926 2767 2755 2631 882 831 485 446 403 197 --43586 3116 2955 2605 --
NM_001011537chr3102395 2141 2011 1990 1801 1493 678 362 307 121 --1127 --
NM_001011657chrX2974 837 1878 1899 --
NM_001011666chr7106465 4966 4958 4507 4279 4263 4083 4069 2084 153 15484 64320 1651 1510 1498 1138 673 26337 2055
NM_001011708chr272930 2719 2585 2514 2505 651 129 --42854 2709 615 135 --
NM_001011713chr1421243 306 1288 51119 1114 600 568 454 11340
NM_001012279chr61131 --2210 48 --
NM_001012329chr12583 297 --3284 278 246 --
NM_001012393chr11124996 4970 4678 4506 4134 2075 1814 1067 914 798 457 447 3936 873 505 55027 4079 856 161 143 1789
NM_001012415chr9----1833 --
NM_001012423chr1532233 824 119 --42807 2649 2038 149 --
NM_001012425chr1----1134 --
NM_001012754chr1382174 2146 1862 1687 1607 1513 337 268 --51945 1848 1639 182 90 --
NM_001012755chrX55041 4927 4861 4820 714 --24906 4183 --
NM_001012761chr532561 2193 124 --32355 275 29 137
NM_001012968chrX92666 2653 2542 2437 2417 1905 1085 123 51 11839 61932 1818 1723 893 672 659 22360 718
NM_001012989chrX3642 260 129 ----1492
NM_001013399chr61317 --1133 --
NM_001013415chr441251 1027 297 23 --41582 1438 1037 305 11456
NM_001013438chr31889 --1955 1769
NM_001013620chr12258299 8028 7377 7344 7198 7185 6872 6707 6532 6241 5655 5486 5340 3299 2583 2224 2173 2144 1846 1787 1674 1269 1171 346 307 38415 2056 960 68478 8379 5751 2834 2668 1655 37422 5318 5195
NM_001013659chr19115389 4927 4641 4297 4067 1610 1118 1052 937 354 71 22015 1262 44958 2058 422 405 3419 415 411
NM_001014283chr132726 223 --2817 680 11892
NM_001014286chr13------1301
NM_001014380chr13155800 5589 5403 4941 4776 4243 1991 1971 1746 1703 1661 1512 1169 1092 971 34614 4185 1177 75747 4885 2258 2241 2236 2231 2122 43656 2255 2251 2247
NM_001014431chr14----2215 85 --
NM_001014434chr15685 315 185 70 48 179 --1210
NM_001014797chr1078182 7051 7029 6766 6176 1864 384 1728 57373 3043 854 731 281 45270 3050 1224 391
NM_001014839chr1--1719 1722 --
NM_001015048chr1442951 2785 236 205 --23018 2875 12749
NM_001015877chrX43082 2545 2357 1049 1993 33045 2710 920 1956
NM_001015887chr351881 1846 1698 1155 383 11861 41832 1323 725 616 2613 609
NM_001017369chr4----2998 423 --
NM_001017371chr261140 524 505 432 87 34 --11162 21035 347
NM_001017395chr373481 1396 1247 968 837 400 183 12261 42842 2698 1307 892 --
NM_001017420chr821374 200 1386 21458 1259 11393
NM_001017424chr121721 483 --21508 752 --
NM_001017440chr798202 8144 7793 7055 6829 5844 2754 2645 1552 28248 5077 46619 5308 2797 1455 --
NM_001017923chr1471590 1551 1120 515 499 326 209 --41704 1574 1368 67 21403 271
NM_001017926chr831372 713 498 1513 31795 1354 1235 --
NM_001017963chr14--1688 2222 82 --
NM_001017970chr1452339 2295 1966 1786 1076 22461 1716 32553 2106 1857 --
NM_001017975chr1--1489 2166 72 --
NM_001017992chr571242 1196 1167 1044 1011 970 69 11072 31515 1457 1284 --
NM_001017999chr162345 2087 908 695 681 292 --1804 12214
NM_001018004chr15------186
NM_001018054chr121225 1212 1499 1562 --
NM_001018064chr961967 1891 1320 666 490 206 ----2631 543
NM_001018065chr985487 4213 3678 1558 1281 1106 685 94 14977 35850 1403 569 15980
NM_001018067chr1145147 4779 4382 3469 3397 1587 1425 1378 1364 1358 1242 1202 664 490 13314 35391 2145 144 --
NM_001018090chr1582803 2243 2222 2105 2076 1034 577 349 --22389 147 11075
NM_001020658chr121655 186 --21679 1215 11451
NM_001023567chr1552499 1924 827 501 119 --22378 149 --
NM_001024218chr14--1862 1618 --
NM_001024226chr11241 --11038 1169
NM_001024465chr6----1149 --
NM_001024647chr12107717 7199 6446 6404 6180 6146 2331 1951 1182 618 --96169 5760 4832 1147 575 491 456 450 81 16737
NM_001024660chr3----21361 1034 1582
NM_001024680chr251152 586 218 188 82 --1151 --
NM_001024807chr19----1233 1247
NM_001024808chr12--12809 12011 --
NM_001024847chr392478 2433 2340 1935 1855 988 685 418 277 --12455 --
NM_001024948chr152864 2724 2433 962 296 23027 783 33143 3097 2441 --
NM_001025068chr381807 1790 1137 630 544 475 439 381 ------
NM_001025076chr10126137 5959 5297 4913 4477 3878 2070 1666 1284 1165 338 283 14526 25372 4529 --
NM_001025077chr10187495 7317 6655 6271 5835 5236 5055 4713 4646 3024 2642 2523 1696 1641 1077 1047 615 128 45884 1099 906 641 66730 5887 5023 842 660 587 --
NM_001025079chr3164057 3868 3770 3611 3265 3148 3057 2915 2786 1563 1395 1063 704 681 250 168 13628 43276 3259 2582 2522 13921
NM_001025108chr253317 3216 924 525 97 13865 44116 3233 2894 1335 1235
NM_001025252chr883007 2804 2748 1282 909 731 708 593 21261 667 1354 32928 218 108
NM_001025366chr641758 1444 1370 578 11237 41844 1802 318 271 11740
NM_001025579chr1711014 ----11083
NM_001025580chrX93912 3751 3355 2712 1204 1027 951 703 201 --73782 3637 3583 3527 2839 2614 550 11059
NM_001025616chr43538 399 277 11658 31554 1497 420 11494
NM_001029858chr662536 2458 2363 2250 2166 1000 --62598 2269 2206 2054 874 445 --
NM_001029875chr562738 2383 1887 1010 954 396 1306 1130 12324
NM_001029998chr42990 171 --1107 --
NM_001030007chr1663153 3021 2932 2711 439 28 11044 31069 662 369 --
NM_001030051chr662305 2253 848 529 197 85 ------
NM_001030055chr14154744 4640 4543 4347 4053 3648 3282 3020 1612 1583 1475 1386 1358 1344 403 11747 64749 4505 4486 4380 2873 1854 --
NM_001031623chr641314 1203 541 494 --2380 352 --
NM_001031679chr1253545 3447 3421 2313 70 --43052 652 647 642 --
NM_001031684chr241372 1337 1126 35 21488 1447 21450 209 --
NM_001031694chr11954 --1262 --
NM_001031700chr492381 2255 2020 2010 1702 1002 993 876 309 --52318 2191 2135 649 555 12409
NM_001031709chr10169 --143 --
NM_001031715chr153202 178 164 ----1184
NM_001031716chr241140 1034 795 101 --3717 378 221 171
NM_001031717chr3----1283 --
NM_001031723chr4----141 1378
NM_001031732chr4103673 3412 2837 2705 2569 823 783 311 226 129 13563 32993 538 86 22542 1049
NM_001031738chr2----166 --
NM_001031804chr1674373 3800 3450 3401 1393 1091 1014 --62881 1415 1409 1365 910 497 14193
NM_001031812chr582259 2096 1974 1659 1437 728 215 151 11468 41823 1699 1575 1471 --
NM_001032280chr651707 1442 1390 1148 530 --31733 1728 1094 --
NM_001032282chr851097 949 492 484 237 ------
NM_001032283chr123903 786 279 --1257 1770
NM_001032289chrX1643 --3976 878 164 --
NM_001032293chr173598 167 115 --1148 --
NM_001032296chr1352741 1910 1017 640 576 --3621 236 231 --
NM_001032367chr15------1455
NM_001032380chr1031703 1581 281 --52010 1473 1467 402 149 --
NM_001032394chr631971 1772 697 --22608 2569 12605
NM_001033045chr293801 3667 3473 3380 2918 1783 1705 1623 115 12978 32840 1550 868 12941
NM_001033047chr442656 2199 1981 84 12595 2576 570 11716
NM_001033057chr342110 843 382 238 173 31968 1851 489 --
NM_001033506chr111101 --1334 --
NM_001033507chr131379 444 241 --2570 490 --
NM_001033557chr221089 252 --11254 1380
NM_001033557chr221089 252 --11254 1380
NM_001033578chr851600 947 911 567 221 --22215 1869 --
NM_001033723chr832792 2409 910 --31822 1800 1730 --
NM_001033925chr1021897 858 --2330 101 --
NM_001034841chr1685540 5259 4193 3885 3650 1822 758 457 --35020 3631 485 --
NM_001034850chr581638 1554 1523 1317 632 606 368 199 11379 21382 128 --
NM_001034915chr82546 171 --11287 1112
NM_001034915chr82546 171 --11287 1112
NM_001034954chr1083271 2988 2656 2561 2244 1240 831 27 13259 33188 3020 2501 12837
NM_001035003chr421156 276 --1567 1942
NM_001035260chr1011062 11038 2238 219 --
NM_001035534chr91161 ----11500
NM_001035chr121281 854 --2524 370 --
NM_001037132chr74805 277 62 45 --12062 --
NM_001037165chr766010 3309 2789 2045 1281 378 --48869 7381 6816 6670 18887
NM_001037290chr1111009 --1934 --
NM_001037324chr3----1716 --
NM_001037332chr52941 26 --12284 12431
NM_001037334chr18131912 1889 1881 1725 895 717 614 540 378 258 246 186 46 21537 436 22095 789 --
NM_001037494chr12----1208 --
NM_001037535chrX61225 996 592 534 516 253 --31180 973 458 1552
NM_001037631chr2121 --2460 124 --
NM_001037954chr1183227 2789 2133 1167 995 967 381 333 11229 12144 --
NM_001038640chr151894 --3292 225 195 --
NM_001038702chr551091 981 598 333 308 --3859 708 403 --
NM_001039199chr2033433 3351 1867 13075 34967 3318 1957 --
NM_001039348chr21956 --1185 174
NM_001039366chr221124 ----1487
NM_001039372chr74627 500 440 429 --2633 478 --
NM_001039479chr1472218 2186 1884 1727 1550 159 142 --1269 12237
NM_001039538chr2123427 3159 2490 2351 1323 1184 1057 846 490 412 276 240 1580 42426 1350 1228 1151 --
NM_001039547chr3168032 7041 6978 6443 6426 6300 5178 3138 1945 1333 948 924 876 813 737 173 1845 73199 2997 2468 1294 1235 962 831 47157 6850 6783 1596
NM_001039569chr242743 2142 771 724 --32671 668 566 --
NM_001039570chr2244665 3539 1147 411 14616 14493 --
NM_001039580chr4124643 4409 4241 3922 3172 2042 1893 1087 794 690 248 23 53533 2025 314 79 32 64197 4127 3536 3328 937 605 52029 934 930 926 565
NM_001039590chrX113427 2721 2702 1520 1477 1432 1005 603 541 142 129 23515 2871 22644 1418 13914
NM_001039618chr11145370 5124 4855 4435 4079 2253 2083 1877 1564 1535 1213 1128 751 23 25600 4519 95039 5004 4182 4121 3673 1556 1479 1416 996 55214 5001 4713 3989 336
NM_001039661chr1121067 990 --11107 --
NM_001039711chr1----1201 2973 390
NM_001039840chrX166054 5800 5226 3938 3849 3776 3717 2266 2200 2010 1453 1401 946 804 513 496 1880 65576 5563 5549 1262 844 175 15374
NM_001039844chr1011192 --21184 606 --
NM_001039937chr1393831 3773 3115 2885 2622 1383 864 435 27 --23553 182 11044
NM_001040001chr6--1234 41525 727 407 173 --
NM_001040057chr711190 --1933 1467
NM_001040092chr8168 --1355 --
NM_001040100chr32949 487 --1973 1276
NM_001040110chr741709 1703 1688 408 ------
NM_001040142chr242238 1904 1733 415 --41797 1576 1571 753 --
NM_001040152chr775066 4130 3890 3763 3517 3457 1191 24823 4684 34586 4209 3816 --
NM_001040159chr441417 934 128 73 ------
NM_001040181chr31112 21068 1000 3935 93 38 31072 820 132
NM_001040202chr4102517 2474 2325 2276 2081 1814 1792 1725 1703 374 42429 2409 2237 768 ----
NM_001040272chr932088 1855 1776 12396 2451 98 42400 936 95 91
NM_001040284chr16175930 5863 5605 5240 5222 4617 4431 4415 3669 2296 1950 1914 1896 1861 1307 494 235 45680 4774 4085 2038 65976 4777 4336 1981 789 784 --
NM_001040402chr4102918 2876 2672 2380 2093 1181 1155 586 316 47 12498 52793 2399 858 652 392 12062
NM_001040424chr2142347 2082 1891 941 11822 32222 2127 745 --
NM_001040429chr13153392 2898 2873 2777 2650 2440 2421 2320 1388 1094 1032 1024 899 699 38 23617 2798 23121 2607 12802
NM_001040441chr184872 4842 4325 3707 3528 604 278 97 34293 1490 1135 --13635
NM_001040445chr243953 3847 3835 3823 --35267 930 361 11309
NM_001040446chr542267 1819 376 158 --22689 2449 --
NM_001040450chr1572292 2249 2242 1883 781 749 587 11787 --1562
NM_001040451chr5----1489 --
NM_001040633chr73908 679 277 1705 1217 --
NM_001040653chr342519 2332 2007 695 12597 32085 2025 198 12534
NM_001040665chr7134852 4673 4260 3754 3267 3253 3146 1909 1049 858 678 671 52 13183 24318 3201 33658 3586 1808
NM_001040708chr811082 --1162 11042
NM_001040712chr962792 2376 2344 1045 834 669 22825 1376 63517 3214 3187 2919 2757 630 1249
NM_001042368chr9----1810 --
NM_001042388chr183865 697 198 --1987 1365
NM_001042404chr141971 1958 1907 597 11941 31944 1913 143 31763 140 136
NM_001042406chr651185 997 961 935 907 ----1991
NM_001042413chr993710 3678 3339 3243 2878 2641 2589 1493 1175 22950 639 44112 3715 3419 3255 --
NM_001042422chr17----166 --
NM_001042437chr2----1176 --
NM_001042472chr20------1608
NM_001042473chr1072177 2026 1859 1681 744 391 318 21709 846 --11788
NM_001042479chrX41743 1723 1700 337 --2327 59 1625
NM_001042481chr1442640 2629 1858 352 12441 22174 823 --
NM_001042493chr671372 1362 1352 1340 179 155 31 1730 1590 --
NM_001042498chrX1780 --21015 301 11114
NM_001042533chr332798 663 483 33019 1204 961 22974 1207 1240
NM_001042537chrX72254 2231 1975 1836 930 471 404 --32469 2434 913 --
NM_001042555chr1294732 4468 4407 1811 1756 1195 976 879 284 14544 54430 3735 3029 843 466 11052
NM_001042599chr2147639 7484 7313 7028 6576 6306 5930 5920 5912 5890 1537 1289 930 854 13054 37298 2972 1104 27130 1963
NM_001042601chr353221 2853 1324 312 147 --2546 535 --
NM_001042603chr12104723 4216 4025 3724 1975 1667 1195 644 524 346 --11690 14207
NM_001042604chr3164696 4625 3812 3721 3652 3588 3408 3124 1543 1522 1482 1472 1185 1127 843 606 43473 3393 1004 511 54390 1568 1512 860 463 13348
NM_001042646chr331994 1667 1244 21441 1349 31760 1225 756 11342
NM_001042683chr671425 1262 1143 710 573 242 129 --21841 236 11838
NM_001042749chrX41544 1392 436 273 11586 1781 2359 240
NM_001042762chr721035 340 2948 430 31025 250 49 --
NM_001043318chr1454158 3639 3178 2561 1643 14121 44038 3889 3779 801 21567 619
NM_001044305chr651545 1511 484 248 76 --1613 --
NM_001044385chr253703 3029 2517 848 41 13818 2446 254 1190
NM_001046chr552899 2539 2003 702 460 1710 32775 817 418 12592
NM_001049chr1421687 410 12012 11518 --
NM_001071775chr1361681 1444 1363 1339 1191 719 41759 1735 1656 272 --1505
NM_001079874chr192132 1972 1728 1598 758 646 506 400 374 --32070 1848 1756 --
NM_001083621chr134736 4637 1386 --43514 3237 1168 1058 --
NM_001094chr171729 --2775 703 1832
NM_001099678chr396405 5874 4620 4521 4099 2289 1311 194 92 35773 5385 5160 45397 2395 1626 1586 --
NM_001100108chr1128382 8251 7979 7301 5958 2605 2336 1846 1252 991 840 724 15070 21605 1287 23354 1284
NM_001106chr3198894 8666 7821 7267 7218 7038 6992 6828 6605 6003 3096 2485 2335 1695 1514 1489 350 178 135 28929 6482 69776 8837 7924 6803 2459 527 11747
NM_001116chr1662703 2420 2269 367 325 38 --23041 436 4892 888 884 880
NM_001121chr1051883 658 637 546 393 1699 1349 --
NM_001123chr102170 90 1730 2271 201 --
NM_001126chr12997 961 --31046 930 804 --
NM_001140chr17123 --1533 --
NM_001148chr421991 1685 --21455 1396 11393
NM_001149chr101419 11411 31289 907 294 --
NM_001153chr2299 85 --1626 --
NM_001165chr11269 42 ----2103 99
NM_001167chrX66745 5452 5190 1111 549 334 1217 42686 2590 2027 1845 35916 1855 1851
NM_001177chr1262356 1998 1728 563 490 402 22424 2066 2900 468 1905
NM_001189chr42859 270 --1797 --
NM_001198chr64383 371 343 22 22399 241 22297 462 --
NM_001200chr201975 --2939 303 2315 125
NM_001201chr473324 2481 2456 1367 1257 492 120 1521 72978 1286 1188 652 362 307 48 23733 882
NM_001202chr141286 1185 ----
NM_001204chr2277783 7485 7123 6922 6904 6816 6447 6247 5828 5165 2565 2274 2079 2002 1986 1900 1568 1449 1372 1320 1088 958 821 715 472 89 32 47591 5788 5558 1400 95922 2712 2085 1729 1168 905 900 423 242 47097 7093 6258 941
NM_001206chr963064 2914 2449 2287 2002 889 --43035 1118 801 314 12720
NM_001219chr762226 1708 1657 1437 857 671 --2260 40 --
NM_001241chr282288 2179 1886 1789 1775 1534 1515 235 1418 41485 673 668 279 22442 1718
NM_001253chr6----2125 78 --
NM_001254chr17----3928 908 769 --
NM_001256chr1762911 2152 1956 1183 699 666 --52294 2104 1821 392 315 --
NM_001259chr7115230 5021 4334 2539 2446 1529 1368 985 961 830 795 34845 4510 1121 55588 5116 4723 897 225 --
NM_001273chr12----1365 --
NM_001277chr1111057 --1171 --
NM_001278chr1021159 939 1317 31163 966 828 --
NM_001280chr19------1603
NM_001286chr141900 1837 1825 514 11759 12841 --
NM_001289chrX1619 --2431 209 --
NM_001304chr1793860 3316 3131 2952 2725 2462 1457 1307 700 1773 33696 2975 2783 --
NM_001310chr1282976 2954 2549 2483 2037 511 487 329 --42207 2181 1913 770 22661 494
NM_001315chr631983 1941 1570 --22224 911 --
NM_001316chr201405 --1386 1395
NM_001326chr111359 --1321 1428
NM_001330chr161665 --2960 66 1311
NM_001343chr571683 1332 1277 1079 1057 135 123 ------
NM_001351chr351547 1513 1161 588 516 1532 41711 603 249 147 1176
NM_001356chrX62464 2303 2241 2094 1799 1577 11674 52520 1823 1708 1645 338 --
NM_001357chr1----186 --
NM_001358chr4----1106 --
NM_001364chr1154765 4685 3254 1867 1676 --22921 1470 --
NM_001365chr17--1116 2776 119 1773
NM_001395chrX------11012
NM_001401chr91532 --1395 11172
NM_001408chr1182 --11158 11155
NM_001412chrX103629 3204 3043 2830 2303 1113 1091 684 484 176 11195 32939 1321 834 22862 2459
NM_001415chrX11545 --3805 304 74 --
NM_001419chr1964676 4570 4356 3385 2954 218 11036 74416 4206 3496 1612 1230 115 109 21643 1621
NM_001420chr1963161 3102 2664 2490 2420 2142 12956 --12272
NM_001427chr742136 1379 384 329 11581 31773 1493 1462 --
NM_001431chr631250 890 211 ----1936
NM_001432chr4123746 3692 2613 2588 2466 1534 1458 1011 1000 978 942 68 --73880 3633 2622 2569 1247 153 142 33877 3260 724
NM_001438chr153186 2673 1086 910 274 33294 3116 2645 33556 314 242 --
NM_001448chrX71779 665 525 511 457 292 280 11798 --1446
NM_001451chr1611013 --4465 458 450 431 1960
NM_001453chr671562 1383 1201 692 470 411 288 1234 1515 --
NM_001455chr674601 4385 4371 3290 3199 1532 1123 --13973 24765 4198
NM_001460chr1103367 3188 2465 2429 2388 1069 913 870 378 217 21136 1105 22220 1130 32603 1221 1086
NM_001483chr73983 435 51 --2761 709 1899
NM_001489chr9----1184 --
NM_001491chr642479 2412 840 260 22495 987 11732 11673
NM_001497chr962141 1922 1843 870 671 585 --1825 --
NM_001511chr4--1493 --2158 154
NM_001520chr161271 1709 2712 649 --
NM_001523chr191199 1262 1313 1310
NM_001527chr6134461 3726 3602 1737 1407 1351 1075 860 510 361 347 319 163 1811 63372 3200 1609 1603 354 120 --
NM_001530chr1441029 967 319 302 --1284 2281 277
NM_001554chr1------2627 533
NM_001558chr1121816 321 11725 11550 31564 1547 1543
NM_001560chrX22667 68 --21809 361 --
NM_001567chr112133 117 --1749 1483
NM_001584chr1161188 1129 1009 796 310 154 186 2164 159 --
NM_001609chr1063623 3498 3052 1133 881 727 --14188 23002 789
NM_001616chr243342 1153 1077 433 23201 689 32706 993 81 --
NM_001619chr11152 --287 37 --
NM_001621chr792499 1922 1078 1007 938 847 648 345 293 1757 62779 2720 2404 2276 1028 465 12656
NM_001627chr392058 1956 1823 1793 1712 1694 766 552 165 11530 31852 1724 394 --
NM_001642chr112891 305 --21194 1153 1436
NM_001650chr1893129 3002 2795 2764 1343 909 895 395 384 33992 3901 948 12958 1253
NM_001655chr1132033 1917 363 --4829 659 334 328 --
NM_001656chr542032 1825 605 338 21533 264 11461 --
NM_001663chr1422346 441 12556 32357 521 359 --
NM_001668chr151963 1585 875 812 622 --31803 1578 641 --
NM_001677chr12384 192 11054 2999 930 1331
NM_001679chr32642 41 --1528 1771
NM_001681chr122672 535 2585 291 1645 --
NM_001690chr362404 1030 620 296 134 98 11802 51778 612 605 599 219 --
NM_001695chr883960 3812 3740 3707 1144 866 658 200 --43864 3508 1696 1311 3843 264 244
NM_001709chr1152753 2294 2282 1053 159 148 12533 --
NM_001722chr8----1242 --
NM_001729chr44402 394 353 155 --1130 --
NM_001730chr1321522 582 --21310 1300 21307 1075
NM_001731chr122944 714 --2821 237 --
NM_001742chr72408 131 11314 1379 --
NM_001743chr24494 184 157 74 --148 --
NM_001752chr111498 --1412 --
NM_001753chr741837 1403 266 112 --21666 240 --
NM_001759chr1285219 4964 4501 3774 1801 1578 1378 1360 --34812 4298 648 --
NM_001773chr1------1168
NM_001789chr341226 541 493 438 11283 2466 461 --
NM_001792chr184774 721 452 405 --2916 909 --
NM_001801chr5----1477 --
NM_001806chr1922277 749 22228 1070 22952 1111 --
NM_001813chr42351 43 1293 ----
NM_001823chr14----1143 --
NM_001829chr4----146 --
NM_001829chr4----146 --
NM_001830chrX93976 3497 2805 1579 1358 1096 973 766 600 1429 23871 3080 1826
NM_001851chr61695 1709 1712 --
NM_001854chr151453 1076 606 410 385 1988 21473 1340 --
NM_001858chr6215080 4861 4784 4718 4432 4380 4370 4339 4165 4108 4095 4070 3395 3266 2029 1991 1961 1869 1732 616 402 --84962 4583 3974 3630 3186 2054 1719 1467 21738 1716
NM_001873chr4----1106 --
NM_001880chr21233 --1286 --
NM_001881chr10----1469 --
NM_001882chr51448 1484 1438 --
NM_001891chr44314 147 139 33 --1320 --
NM_001894chr2221237 1136 --31040 1035 1030 11081
NM_001901chr62923 755 198 21015 681 --
NM_001902chr11123 --1306 --
NM_001931chr113961 514 105 1137 21180 92 --
NM_001938chr131535 666 78 --2626 483 --
NM_001949chr652780 2259 992 970 45 22694 186 12107 12658
NM_001956chr11535 1567 1570 --
NM_001957chr462080 1835 767 536 439 163 1547 3749 627 479 12178
NM_001961chr19----2345 186 --
NM_001963chr43578 277 193 1788 1609 --
NM_001965chr2----1497 --
NM_001969chr1443407 1493 695 480 42821 2760 1119 215 32794 828 512 --
NM_001970chr17----2132 120 --
NM_001977chr461692 1541 1531 647 482 271 --21267 444 11355
NM_001981chr12800 457 --42180 1936 1729 671 --
NM_001992chr562149 2092 1621 322 163 86 ----32118 1680 1370
NM_001993chr1------11110
NM_001999chr551539 1394 1131 998 983 --1398 1395
NM_002006chr4155836 5746 5148 5031 4802 4675 4636 4621 4512 1590 1461 1367 545 271 128 22271 1076 44812 3981 2189 1815 --
NM_002009chr1552310 2284 940 445 330 3968 953 345 22563 92 12155
NM_002014chr12----2270 109 --
NM_002015chr1343332 1263 698 43 11087 22589 690 --
NM_002018chr17----1289 --
NM_002024chrX1512 11543 2259 146 22235 1932
NM_002025chrX189041 8369 8122 7460 7190 6940 6726 6567 6331 6144 2992 2094 2087 1204 1141 748 195 135 19298 47423 3370 1286 697 --
NM_002033chr1143815 3046 2829 773 1974 32912 1138 977 --
NM_002040chr2173150 2700 2573 2135 883 706 71 1553 22168 96 --
NM_002041chr15130 --189 --
NM_002048chr941343 1335 1196 1094 --11017 --
NM_002061chr13631 158 136 1235 2357 271 --
NM_002063chrX21268 69 --1809 --
NM_002069chr751860 1241 603 539 317 1502 --1437
NM_002073chr2211178 11572 --11084
NM_002074chr1--11747 21243 262 --
NM_002076chr1231986 871 277 --23284 1213 --
NM_002079chr10------1234
NM_002089chr42674 258 1498 2266 169 4166 162 158 154
NM_002090chr42619 489 4477 262 215 164 1175 --
NM_002094chr16179 --1320 --
NM_002115chr5------1202
NM_002126chr1753614 2982 2936 918 605 --34141 3571 3265 --
NM_002128chr1362531 2043 1689 565 461 328 134 --21020 601
NM_002129chr43391 382 56 --1397 --
NM_002137chr751757 1608 1480 640 113 32298 953 198 1541 --
NM_002139chrX----1187 --
NM_002140chr92943 888 --2288 103 --
NM_002141chr7--1485 --1552
NM_002147chr172221 185 ------
NM_002152chr19----173 --
NM_002158chr293433 3334 3141 2783 2348 732 719 153 111 13546 33788 3549 483 13193
NM_002166chr24689 638 86 28 1214 1662 --
NM_002173chr9------2232 228
NM_002176chr93186 148 132 --1169 2159 155
NM_002177chr94345 223 122 74 1334 ----
NM_002182chr342679 2220 1940 594 1280 42798 2722 905 417 12578
NM_002187chr51271 1290 31275 388 300 31272 1268 1264
NM_002190chr621074 132 2387 265 3410 343 334 --
NM_002193chr231702 1609 1514 ----11809
NM_002196chr2031057 976 820 1776 1291 2791 787
NM_002199chr43896 810 357 --3850 787 69 --
NM_002203chr563864 3402 2772 2758 1529 98 --23787 393 1565
NM_002210chr2123264 3164 2296 2215 1395 876 828 812 660 252 150 54 13301 32442 973 349 --
NM_002214chr7135600 5496 5463 5333 5135 4740 4653 4643 4441 1950 1038 769 611 44977 4918 3889 259 45639 4851 1567 915 24820 1912
NM_002223chr1242933 2888 2678 1157 --23088 350 1552
NM_002226chr141347 --2140 98 --
NM_002229chr191461 --1421 --
NM_002234chr121752 --1762 --
NM_002240chr212549 55 --1100 --
NM_002242chr221668 647 11965 1734 --
NM_002247chr1031951 647 378 1223 2475 164 1348
NM_002254chr221807 1609 1191 --22143 177
NM_002264chr353680 3284 3072 1814 1139 11727 44168 3868 1229 403 --
NM_002265chr171300 1277 ----
NM_002267chr1332353 1862 634 11754 11658 --
NM_002268chr321874 1761 1271 11404 --
NM_002270chr5114920 4585 4464 4300 3438 2227 1926 1753 1604 1377 1258 --34937 3781 1051 13746
NM_002293chr142537 2515 2401 881 22524 632 12450 22772 201
NM_002296chr131675 1522 415 --21744 1554 --
NM_002309chr2243097 2725 2319 1069 22688 2681 23132 2604 13104
NM_002315chr111272 --1246 --
NM_002336chr1284846 4767 4366 4210 3610 3252 929 363 --54813 4806 3940 3590 256 13457
NM_002349chr221388 180 --41672 1443 1418 524 --
NM_002351chrX4646 426 359 222 --21763 29 --
NM_002356chr692558 2548 2534 2034 745 738 681 351 328 32767 1073 92 3284 277 130 --
NM_002358chr43531 243 206 --2158 86 --
NM_002359chr1734260 4205 3080 11009 14305 1723
NM_002360chr732604 2513 2334 12492 12495 22309 1892
NM_002381chr24967 779 703 112 ----21037 291
NM_002382chr1421342 1290 --41169 836 140 105 --
NM_002396chr18--1463 1562 1687
NM_002397chr531625 1607 700 21829 329 ----
NM_002398chr221545 343 --21145 1125 --
NM_002402chr711109 11141 11207 --
NM_002408chr143286 224 46 --1299 1273
NM_002427chr112821 130 3877 830 25 1893 --
NM_002430chr2252519 2256 427 394 228 --31673 647 461 --
NM_002440chr1----153 --
NM_002442chr1241788 1509 1377 426 --31760 1520 263 1260
NM_002449chr571302 1287 1253 1241 1202 435 324 --1801 --
NM_002467chr8------1386
NM_002480chr12--1136 31344 1120 1038 --
NM_002486chr982541 1976 994 775 736 642 455 261 --41613 607 519 55 --
NM_002499chr154906 665 654 397 --3560 402 386 12471
NM_002500chr251027 438 298 200 139 ------
NM_002501chr1922767 1527 --12631 11283
NM_002507chr17----11739 --
NM_002508chr181886 1877 1868 1800 1629 1259 1252 515 1565 11700 --
NM_002509chr20----1709 --
NM_002515chr1462042 1949 1826 1726 1624 235 ----11860
NM_002519chr1111026 --1197 11493
NM_002522chr1773771 3537 3183 2980 2953 563 148 --53953 3657 3157 604 493 --
NM_002523chr711002 --21109 1051 --
NM_002541chr71951 --1990 1987
NM_002546chr83813 715 524 3755 671 221 1630 --
NM_002577chr383947 3501 3020 2944 2826 1546 1475 272 33995 2919 1267 73969 3935 2927 2922 2494 2488 789 --
NM_002578chrX----1174 --
NM_002581chr955545 5093 3725 3643 280 --45490 4555 3816 1559 15434
NM_002583chr12----2195 121 1455
NM_002594chr2031942 1690 151 12365 22378 246 --
NM_002595chr1261892 1701 1432 1341 387 76 31352 702 302 31396 705 141 2345 108
NM_002603chr8----1132 --
NM_002607chr71105 --21156 906 --
NM_002608chr2211063 137 11587 11608
NM_002612chr771777 1687 1371 680 572 550 219 --12080 --
NM_002613chr1675320 5262 5155 5093 5076 4403 1350 15133 13921 23555 141
NM_002623chr201776 2284 158 3694 161 25 1121
NM_002645chr1183083 2730 2684 2626 2577 1119 879 558 21913 794 32374 1063 1045 --
NM_002648chr621291 840 --31334 1251 921 3918 914 910
NM_002655chr8165188 4966 4679 4582 4515 3491 2074 2055 1991 1606 1205 954 730 598 573 209 24310 1825 84402 4069 3874 3687 3383 3325 884 67 1339
NM_002657chr2023926 2727 33711 3260 240 2511 249 --
NM_002662chr341992 1601 450 346 --22089 703 --
NM_002667chr65995 923 841 510 359 11286 1205 --
NM_002670chr33518 254 95 11527 21303 428 --
NM_002687chr1441328 837 437 391 1189 2506 383 --
NM_002690chr8----151 --
NM_002693chr15----1297 --
NM_002699chr141537 1474 1419 479 --31424 1342 1230 1565
NM_002705chr161723 ----1833
NM_002709chr2113625 3614 2918 2860 2221 1432 1269 1173 1084 503 379 --12976 1518
NM_002716chr1163340 1404 933 448 264 250 1211 62590 2347 2338 1443 604 590 --
NM_002719chr1432185 2020 1787 --3792 723 696 11998
NM_002725chr113260 --11775 --
NM_002731chr1103065 2759 2735 2651 2578 2047 456 249 199 132 --22659 322 --
NM_002734chr1732271 788 145 --42099 2050 1420 70 21639 630
NM_002737chr1766146 5389 2183 1584 814 192 1965 14689 54686 4682 4678 4674 969
NM_002738chr16----2788 252 --
NM_002740chr372203 1771 1013 910 496 369 271 11722 22747 2642 11920
NM_002745chr2243842 3696 3677 474 34311 3992 3636 23732 3108 --
NM_002748chr152941 60 1489 41191 977 51 22 --
NM_002755chr152727 176 --2772 653 --
NM_002758chr172382 373 1536 1495 --
NM_002767chr171211 --1467 --
NM_002814chrX----1487 --
NM_002825chr71622 2216 99 ----
NM_002827chr2031800 715 505 1618 --1404
NM_002828chr181315 --2864 71 1391
NM_002834chr12103993 3854 3767 3650 3449 3181 3141 3128 2865 756 --2364 358 13626
NM_002835chr72577 313 --1189 --
NM_002841chr3----2440 135 --
NM_002843chr1111301 1946 ----
NM_002848chr1221129 1007 --2330 136 --
NM_002852chr3----1138 --
NM_002858chr151355 1121 850 508 397 1475 11013 --
NM_002866chr19--1130 --2154 150
NM_002868chr1212138 --22310 550 --
NM_002869chr1122064 759 1197 52152 2026 1963 1396 377 --
NM_002871chr13614 490 99 --21874 1869 --
NM_002874chr93911 694 66 --32185 1989 256 --
NM_002886chr395189 3864 3850 3353 3339 1434 1312 1201 833 --64664 4660 3894 3605 3243 74 14031
NM_002888chr3----1101 --
NM_002890chr53846 835 650 --1630 1963
NM_002897chr21273 1131 1228 --
NM_002902chr152539 123 --1182 --
NM_002906chr1151685 1567 1459 904 447 1663 1707 11666
NM_002912chr64819 728 607 114 ------
NM_002924chr14493 412 192 127 --2625 527 --
NM_002927chr11547 ----2504 65
NM_002928chr1--21412 1339 --11561
NM_002941chr381643 1590 1384 1322 1140 170 159 125 11653 21027 624 --
NM_002942chr341297 1092 1037 341 --21196 449 196
NM_002948chr34912 346 116 73 --5377 316 212 201 77 --
NM_002956chr1241139 479 273 102 1322 21162 891 --
NM_002959chr153920 3627 1231 1098 245 13292 21533 1488 --
NM_002968chr161348 1184 2966 961 --
NM_002971chr32379 70 1423 ----
NM_002973chr12--1462 193 --
NM_002977chr2123271 3259 3080 2380 1338 1056 914 555 511 396 174 97 2851 386 148 1390
NM_002994chr471432 752 740 653 551 455 250 1586 61957 1657 1464 680 255 116 --
NM_003010chr1782353 2293 2224 2149 2133 1783 358 87 --32297 904 628 --
NM_003012chr842610 2296 984 640 --33147 2654 2326 --
NM_003016chr1741746 1554 797 258 11466 2689 397 --
NM_003026chr91482 1343 31177 844 504 11225
NM_003030chr331895 1876 445 21839 647 31548 1504 1403 --
NM_003034chr12107688 7319 5141 3160 2847 1620 1377 854 830 641 46722 2105 1052 468 96683 5724 5626 3174 2650 1680 1487 795 471 --
NM_003037chr11594 --1599 --
NM_003048chr282821 2767 2707 2449 1759 274 234 54 --12632 1362
NM_003054chr101240 --1222 --
NM_003071chr352097 1968 1898 465 361 1386 1545 1812
NM_003074chr362214 2129 1787 637 527 396 11498 2404 360 --
NM_003092chr20--140 ----
NM_003095chr121340 1295 ----
NM_003099chr15134708 2626 2256 2110 1860 1832 1748 1579 1515 1500 847 762 162 22076 1876 35930 2214 918 14794
NM_003105chr111104 ------
NM_003106chr32988 917 --1948 --
NM_003108chr2166409 6341 5961 5485 5458 5442 5218 5194 4965 4778 4603 1264 1230 330 285 266 17114 25765 2135 36562 5507 4505
NM_003110chr1731052 953 289 --1991 --
NM_003112chr7103043 2986 2928 2819 2788 2508 2474 2249 592 352 --32673 1204 1075 22286 2145
NM_003115chr11469 --3406 117 46 --
NM_003133chr151011 673 385 248 24 ----1196
NM_003149chr321513 1394 --21428 1313 --
NM_003155chr862843 2756 2743 1929 814 699 12663 32748 1007 849 1401
NM_003157chr32869 827 --4800 786 680 297 --
NM_003161chr1763581 3385 3304 2664 2414 2377 12523 42701 2532 2392 722 --
NM_003162chr251019 1004 954 887 854 --3937 797 257 --
NM_003171chr10----154 --
NM_003182chr7123 191 1137 195
NM_003184chr851045 888 833 695 62 1161 1981 --
NM_003185chr2061351 1175 1010 928 867 330 11066 61367 1210 1205 460 411 406 --
NM_003188chr6----1153 --
NM_003189chr123038 2632 12306 23003 2801 --
NM_003194chr62462 182 ------
NM_003204chr1711731 --31760 1749 1558 --
NM_003205chr1542212 1898 1819 82 12054 42018 867 666 660 1371
NM_003221chr654172 3666 3553 2720 862 24047 3608 24050 2919 13991
NM_003222chr2021006 243 --11113 1879
NM_003234chr362000 1767 1758 880 789 723 --22153 2134 1889
NM_003246chr1542008 1817 1756 308 --21743 1327 --
NM_003247chr611878 21856 1268 --11932
NM_003262chr3114971 4332 4128 3911 3799 3194 1715 1651 1425 580 210 1779 44120 996 759 455 11798
NM_003272chr11175 --1113 --
NM_003275chr931241 461 411 1229 1423 --
NM_003286chr2031129 874 283 21163 194 2967 254 --
NM_003304chr331439 1011 452 11333 21379 474 21461 480
NM_003309chr641803 1629 1344 318 --21746 295 --
NM_003311chr11----1159 --
NM_003319chr2----1253 --
NM_003336chrX51078 361 280 92 58 --1828 11047
NM_003337chr55538 445 437 328 177 --1592 --
NM_003338chr1081966 1604 1390 673 548 306 227 197 1356 21937 724 --
NM_003340chr4--11316 21157 121 --
NM_003341chr32133 29 --2514 33 --
NM_003348chr1291617 1519 1455 1383 1347 1269 1124 632 260 --5366 361 356 351 346 1490
NM_003358chr9----1132 --
NM_003363chr33701 682 197 --1203 --
NM_003369chr1132689 2386 916 12709 22822 287 1299
NM_003370chr19----1652 --
NM_003372chrX4785 227 61 45 ----2137 133
NM_003384chr14----180 --
NM_003392chr363342 2863 1518 863 185 163 24327 47 84330 4104 3906 3534 1729 1194 224 97 --
NM_003400chr23735 601 70 ----1203
NM_003405chr22----1659 --
NM_003406chr881717 1461 1448 635 603 355 199 57 --31675 655 21 --
NM_003407chr19------2513 498
NM_003410chrX52697 1997 904 653 502 1642 12428 1294
NM_003411chrY61330 656 616 463 294 151 11364 41633 1367 690 662 1284
NM_003412chr372736 2346 2323 2296 903 880 203 --11945 --
NM_003413chrX31982 1791 627 22022 1276 --1488
NM_003419chr1991245 1229 1201 500 470 436 399 374 255 1184 11176 1380
NM_003423chr1952561 2525 1940 868 585 11885 21879 933 --
NM_003430chr1941661 1620 1578 1142 --21432 1426 --
NM_003442chr114877 703 259 147 3863 827 642 1830 --
NM_003443chr1195 ----128
NM_003453chr132224 66 1232 1235 --
NM_003463chr6133058 2292 2256 2129 1314 1278 1207 1104 952 784 592 486 440 12501 22815 807 --
NM_003466chr2------189
NM_003468chr244271 3857 1092 1055 24293 2875 24011 3680 --
NM_003469chr24481 359 350 173 ----1432
NM_003471chr352332 1548 892 649 210 --21873 1820 --
NM_003472chr631257 951 577 --21227 140 --
NM_003473chr1031009 909 87 --3826 431 267 --
NM_003477chr112791 501 ----2122 118
NM_003478chr11103145 2922 2870 2808 2754 2360 2067 912 892 415 --43349 3328 3167 89 12790
NM_003480chr1211579 1723 32119 415 174 1385
NM_003482chr12----12563 --
NM_003483chr1222806 2142 --42626 2491 2029 591 --
NM_003486chr1612848 11071 22923 2688 12685
NM_003489chr2143349 2626 1333 345 --3779 553 359 12955
NM_003498chr1612499 --12679 12787
NM_003503chr111174 --1109 --
NM_003505chr741785 1699 1374 1305 1355 --11732
NM_003508chr71290 ----1275
NM_003558chr92639 613 ----1671
NM_003566chr1283264 3143 2722 2687 2344 1385 913 698 12633 4979 918 741 579 12137
NM_003569chr62126 84 137 1581 1288
NM_003574chr18105082 4855 4513 4004 2072 1516 1327 1245 1229 335 --45142 4730 3812 359 1392
NM_003579chr1----1140 --
NM_003583chr1273903 3657 3394 2661 2425 1383 1356 --41298 1247 846 91 --
NM_003590chr2104060 4044 3499 1552 1399 806 697 453 200 25 32861 2508 488 83592 3399 2942 2488 1605 1564 1237 798 11250
NM_003596chr71391 1473 1549 --
NM_003597chr242156 1677 889 531 12270 12006 21453 1424
NM_003603chr442155 1632 1593 415 --22132 852 1849
NM_003607chr194195 4029 3299 2956 2813 1081 950 738 658 13115 34200 4037 961 --
NM_003609chr16----1175 --
NM_003615chr3103761 3716 3671 3353 3314 1154 957 826 394 223 13367 63370 2998 1267 1055 1041 836 33292 2588 2584
NM_003618chr24992 469 331 121 --11271 --
NM_003622chr1262552 2057 1991 1857 1817 481 195 52153 2142 1669 1656 545 12618
NM_003630chr63615 534 499 --2503 154 --
NM_003651chr12--1495 1498 --
NM_003653chr17------1218
NM_003658chr112719 187 --1848 --
NM_003668chr12----1267 --
NM_003670chr31488 --41275 1209 1184 1068 11423
NM_003672chr161990 1546 1301 619 298 271 21288 666 31920 630 481 --
NM_003676chr11653 --1631 --
NM_003688chrX----1300 --
NM_003692chr94843 820 93 46 --179 --
NM_003714chr563088 2526 2352 2339 2224 1019 154 22727 262 1732
NM_003716chr33860 732 117 ------
NM_003718chr7----3423 113 35 --
NM_003737chr11------1308
NM_003740chr611322 --31882 1334 327 --
NM_003743chr261757 865 797 310 283 166 1829 11465 --
NM_003745chr162409 50 --1348 --
NM_003749chr1332300 1768 882 12458 --11800
NM_003750chr101230 --1314 --
NM_003758chr1551568 1317 1266 1149 508 31158 1133 130 31204 1136 455 --
NM_003760chr1--1235 ----
NM_003766chr171594 --2382 144 --
NM_003769chr12----129 --
NM_003774chr1293394 3148 2816 2579 2505 2404 2241 906 236 12223 83215 2511 2429 2393 1308 998 484 88 22653 2426
NM_003783chr1----1999 --
NM_003787chr1821325 1155 21661 1391 ----
NM_003803chr18198 ------
NM_003818chr201981 --1141 --
NM_003822chr173011 2962 2625 2192 2103 2090 825 --52468 2461 2456 2451 696 11938
NM_003825chr1551476 1343 1324 30 23 --31486 1030 367 --
NM_003827chr19------1228
NM_003831chr1841527 431 388 245 --11567 --
NM_003848chr33897 691 84 ----1988
NM_003850chr134549 277 220 207 --1438 --
NM_003861chr1432274 620 353 --52836 2085 2080 2061 1886 --
NM_003877chr123889 647 288 1866 --1972
NM_003884chr341684 1667 1636 710 --31133 414 198 --
NM_003885chr1762660 2156 1929 945 655 54 --32670 2556 1922 12667
NM_003888chr152326 314 21538 1501 11710 11384
NM_003913chr6134024 3765 3619 3425 3265 2657 1690 1468 1445 1028 1013 575 67 24276 1160 31320 1109 656 13176
NM_003916chrX31293 568 332 --21487 1276 --
NM_003922chr15----2396 174 --
NM_003924chr4----11257 11609
NM_003930chr792500 2106 1747 524 390 131 118 103 34 1535 22416 538 1259
NM_003934chr951172 929 501 212 203 --21266 340 --
NM_003941chr782293 2097 1997 1835 1733 1622 699 176 --2920 454 --
NM_003947chr321079 401 --11030 --
NM_003948chr442084 1632 923 652 11967 12429 22123 447
NM_003956chr10----1483 1121
NM_003966chr5176608 6526 6088 5985 5792 5133 4872 4852 2854 2666 2432 2355 2039 1796 1646 1621 293 --87817 7263 5038 2655 2328 2088 1214 1028 --
NM_003971chr17----154 174
NM_003977chr11----1107 1104
NM_003998chr41493 --1671 --
NM_004035chr1784781 4330 4056 2062 2031 647 576 326 --44917 4271 3381 3371 11688
NM_004036chr22753 741 --2578 47 --
NM_004040chr231255 855 428 1538 31267 1062 514 --
NM_004050chr14----22725 1919 12688
NM_004064chr124953 935 234 35 11115 1525 --
NM_004071chr22199 74 ------
NM_004073chr1--2256 221 --1238
NM_004083chr12------1181
NM_004093chr1311150 11272 13150 13072
NM_004094chr1461854 1125 1084 1071 1011 709 --52968 840 494 488 115 2813 672
NM_004097chr2----1317 --
NM_004109chr1192372 2325 2234 2206 1998 1783 700 152 57 --21848 179 1489
NM_004124chr1483296 3230 3143 2821 2782 2235 1047 774 32600 2417 74 33540 2737 1394 2738 385
NM_004128chr131444 ----1199
NM_004133chr892614 2600 2565 2337 1830 928 668 336 301 1835 12029 --
NM_004136chr15103284 2954 2871 2348 1021 784 543 526 272 111 23162 3155 22914 2671 13124
NM_004161chr221065 165 --21510 1217 --
NM_004162chr341176 998 865 140 1426 11145 --
NM_004169chr17----1718 --
NM_004170chr961382 1289 685 505 231 134 --11724 --
NM_004171chr11158651 8147 6638 5962 3281 2941 2667 1687 1454 1108 1081 956 912 874 233 16916 68288 2801 2505 1858 1765 553 32898 2787 826
NM_004180chr22421 159 2565 439 ----
NM_004202chrY2571 56 ------
NM_004225chr82605 574 11088 2460 454 --
NM_004229chrX51811 1695 1633 1608 744 --21780 1536 21373 311
NM_004232chr1853527 1519 1387 1367 607 11233 31314 901 180 2685 525
NM_004238chr2----1249 --
NM_004240chr19----182 --
NM_004241chr102815 619 --1288 1610
NM_004247chr17----1309 --
NM_004272chr562014 1875 725 714 658 373 ----1395
NM_004273chr1064437 3557 3516 3094 784 416 15057 1395 11338
NM_004274chr14103216 2972 2850 2666 2507 2169 770 476 129 116 12360 21256 587 22128 584
NM_004277chr651551 1153 449 186 83 --1145 --
NM_004279chr752388 1628 706 498 270 --21935 853 --
NM_004280chr62339 104 --1157 --
NM_004287chr1722387 670 --12593 12599
NM_004288chr2133 --1295 2950 134
NM_004290chr521154 1019 --3874 357 294 --
NM_004294chr13----1176 --
NM_004295chr172863 501 1433 1436 --
NM_004296chr1441561 837 806 795 --23981 1102 --
NM_004310chr41474 ----1698
NM_004311chr1022784 220 --12982 1402
NM_004326chr131066 1042 232 --2400 218 --
NM_004329chr1041296 957 499 485 1987 21013 218 --
NM_004330chr1541040 998 290 78 --1773 --
NM_004331chr852190 314 298 155 67 1442 41805 894 886 879 1604
NM_004337chr85798 687 654 370 275 22033 299 1622 1619
NM_004342chr782316 2139 2029 1623 1450 512 442 110 --1117 --
NM_004346chr451536 1424 1178 534 387 --31549 508 458 --
NM_004354chr44817 692 332 165 --2862 232 --
NM_004364chr191940 --21033 359 --
NM_004370chr641824 1738 582 249 12173 22176 1722 --
NM_004375chr1791574 1415 1140 557 542 422 383 171 117 ------
NM_004383chr151404 ------
NM_004392chr1332594 1770 900 12457 21036 963 22467 1777
NM_004393chr352412 2020 1598 621 62 --32333 215 209 --
NM_004397chr1154043 3613 3061 575 447 --44316 3533 1327 99 --
NM_004402chr11555 --21582 1250 --
NM_004405chr22978 737 21082 1028 2923 828 --
NM_004411chr71703 --1523 --
NM_004412chr1094911 4758 4185 2323 2228 1827 846 141 107 21287 614 65921 5334 4376 715 466 386 --
NM_004417chr5--3569 415 107 --1111
NM_004420chr1132282 1701 103 ----2136 132
NM_004421chr11833 ------
NM_004422chr171199 --1478 --
NM_004430chr832772 2611 1110 --22777 2515 --
NM_004431chr13842 823 805 --1100 197
NM_004432chr932268 1885 156 11920 32304 1909 521 1497
NM_004437chr133481 2979 2312 --22638 321 --
NM_004438chr263186 2772 2719 2380 2342 708 12949 23002 2888 23244 1141
NM_004439chr4----167 --
NM_004440chr661894 1828 1293 608 434 339 --21845 288 21591 1277
NM_004447chr1261005 986 966 270 172 109 11076 1856 --
NM_004451chr11----1617 --
NM_004457chr261285 1274 1227 626 520 396 11061 1620 --
NM_004458chrX102616 2298 1866 1769 1751 1019 782 722 376 215 --2935 482 --
NM_004459chr17141910 1782 1462 781 714 618 452 440 424 262 207 166 127 49 ----31643 1486 397
NM_004464chr4133875 3227 3163 2916 2807 2764 1726 1352 1214 945 860 590 470 12940 83241 3218 3015 1555 1398 900 600 358 12876
NM_004472chr51460 --2535 446 --
NM_004482chr21930 1133 --1939
NM_004486chr911110 21130 808 21215 1203 --
NM_004492chr151175 ----181
NM_004496chr1451258 1189 1177 1149 178 1351 2128 24 --
NM_004501chr1114146 3952 3627 3071 3047 1372 1332 1133 678 333 290 1804 1261 13504
NM_004505chr1761790 1487 1332 1316 438 105 31563 1250 395 31970 1253 525 11699
NM_004506chr61537 --158 --
NM_004516chr1931077 177 133 --21270 383 1344
NM_004521chr101267 --1367 1281
NM_004523chr1011482 --127 --
NM_004525chr241551 1430 1031 226 1424 1979 --
NM_004529chr941365 1062 1012 411 --1160 --
NM_004535chr2041536 1340 1117 131 31544 1360 1109 2351 243 21185 1172
NM_004561chr1121826 1746 --31835 694 684 --
NM_004566chr1012331 --22479 2324 22364 2360
NM_004571chr2163447 3413 3131 2929 1161 1088 --165 --
NM_004573chr15----1767 1764
NM_004575chr451608 1577 1516 556 358 11389 21557 223 11533
NM_004578chr1----1365 --
NM_004586chrX65033 4461 4106 1309 1111 321 14707 24979 3995 11910
NM_004598chr553257 2834 2748 2230 608 --23352 224 --
NM_004607chr52222 64 --1187 --
NM_004612chr9124084 3922 3684 3521 3494 3345 3185 1791 1616 1111 515 253 2945 740 53952 3722 1095 743 247 --
NM_004615chrX1775 ------
NM_004621chr114966 959 803 56 --3373 68 33 --
NM_004622chr25750 611 488 467 333 --2918 114 --
NM_004625chr32312 99 ----1339
NM_004637chr33962 412 399 ------
NM_004643chr14----2803 748 --
NM_004654chrY51393 966 441 333 161 11183 21090 141 --
NM_004657chr231526 558 347 --31461 1309 1274 11175
NM_004660chrY92324 2190 2161 2129 2019 1729 1641 1584 774 --11753 --
NM_004673chr12496 215 --197 2415 342
NM_004681chrY2675 202 --2149 126 1490
NM_004685chr1383017 2919 2759 2721 2385 1102 845 712 1757 32480 2089 862 190
NM_004690chr62580 171 --3664 605 131 --
NM_004705chr112843 289 --2877 712 1814
NM_004717chr741365 1299 468 427 --21379 304 11371
NM_004718chr21516 --2687 651 --
NM_004723chr11275 ----2266 262
NM_004730chr541690 1500 415 188 --11942 --
NM_004736chr151866 1816 1473 564 428 32111 1511 630 21407 799 --
NM_004742chr371821 1751 1662 1240 659 354 88 ----2386 211
NM_004744chr482820 2809 1457 988 861 700 541 454 21520 1156 13534 --
NM_004748chr15174212 3723 3522 2988 2852 2823 1671 1650 1636 1587 1439 1150 1060 543 465 321 296 12892 32939 1308 199 24059 3876
NM_004755chr1451143 857 484 419 40 --1834 --
NM_004764chr122168 89 --5667 537 245 201 137 168
NM_004768chr14841 828 753 324 1154 1967 --
NM_004774chr1721965 576 --3809 611 589 13159
NM_004775chr1852328 2256 2175 923 422 11750 62391 1909 1772 1753 447 318 --
NM_004779chr52901 69 --1167 --
NM_004788chr1142341 2109 314 271 --42485 2162 1853 1691 --
NM_004795chr1331708 1690 1680 11590 21643 1492 --
NM_004798chr2033679 3005 808 23454 3364 13605 13623
NM_004801chr241312 1005 630 256 173 2976 50 --
NM_004807chr222132 303 ----32638 2531 2527
NM_004815chr1194709 4069 3972 3943 3564 3523 3461 1854 1661 1610 1274 1129 1116 1032 529 463 210 142 43 1399 53633 1615 868 755 367 1992
NM_004824chr651249 340 223 208 150 --11335 1969
NM_004827chr461747 1625 1382 1242 257 28 1403 11687 --
NM_004830chr62593 345 --3838 194 131 --
NM_004831chr191951 --1706 --
NM_004834chr272862 2682 1079 824 392 329 176 23372 3208 23183 951 --
NM_004836chr2----1851 1881
NM_004842chr631333 1104 478 --21483 377 21754 516
NM_004850chr221077 87 --21290 530 --
NM_004852chr182413778 13634 13456 13012 12829 11938 11805 11349 11094 10859 10650 10409 10105 8942 8636 4864 4787 4392 4324 3546 3517 2183 2078 1963 212532 3959 1214018 12887 12781 11466 11411 11251 5544 5327 5294 2903 2203 2174 310302 10000 4797
NM_004859chr1741189 422 231 173 1399 2202 111 --
NM_004863chr1485099 4634 4453 1845 1369 1142 1076 1048 1495 63330 3306 2047 1435 1211 262 --
NM_004865chr65411 317 301 156 112 --1347 --
NM_004866chr5154720 4649 4485 3972 3881 3749 3240 3132 1797 1784 1654 1431 533 269 157 1975 64893 4703 4502 3768 3172 1608 13699
NM_004869chr1821278 1173 11452 21701 372 160
NM_004872chr11159 --1468 --
NM_004888chr93877 241 105 1185 --1409
NM_004891chr2----1209 1206
NM_004897chr10------1606
NM_004898chr442545 1133 887 622 --21992 927 12342
NM_004902chr20165 --1703 173
NM_004921chr152591 2500 2468 2384 1880 12064 22367 69 22036 1968
NM_004926chr1461386 1229 1187 391 284 201 21444 1166 21447 1391 11801
NM_004927chr11----11428 --
NM_004929chr841365 443 398 354 11125 11119 --
NM_004930chr1----1648 --
NM_004932chr521410 68 --41671 1499 471 196 --
NM_004935chr7------1167
NM_004936chr933039 2029 1219 1964 31102 187 36 12714
NM_004941chr17----1457 --
NM_004946chr51344 --2401 336 --
NM_004947chr332231 1701 785 12358 1216 --
NM_004953chr3----1309 --
NM_004956chr744217 3808 1226 212 21360 910 73667 2941 581 362 180 104 84 23894 3444
NM_004985chr12114496 4142 4073 3774 3596 1673 1455 951 503 296 146 --33007 2867 548 1372
NM_004991chr3----154 --
NM_004992chrX108528 8432 7003 6819 3149 3017 2204 1374 977 56 12015 67044 5376 3300 2950 2736 2364 15441
NM_004996chr161466 --21784 1658 --
NM_004998chr15------1257
NM_004999chr663180 2930 2791 1490 192 124 --11630 11412
NM_005006chr23989 711 294 1673 2311 78 --
NM_005022chr17----181 --
NM_005023chr571467 1377 1178 1027 507 286 211 --1512 --
NM_005026chr122002 754 21644 145 --21648 149
NM_005028chr1022163 2019 --22115 2084 12091
NM_005044chrX2700 292 1186 2487 247 --
NM_005053chr19------193
NM_005065chr1495200 4264 1488 1370 1334 1241 575 333 47 14348 65260 4288 4180 1130 929 163 24352 1928
NM_005066chr11116 --2213 205 --
NM_005086chr1251787 1521 1393 1193 314 --1491 --
NM_005095chr152010 1742 1675 267 22 --1881 --
NM_005097chr10------1304
NM_005098chr8----11066 --
NM_005099chr11318 --1532 2330 309
NM_005114chr4----3512 488 100 --
NM_005116chr2064566 3521 1794 1159 901 774 1194 24383 4377 13480
NM_005117chr112942 185 1956 1921 --
NM_005121chr17103315 2670 2457 2367 2321 1149 652 611 475 78 23118 446 33277 2328 1091 21357 1353
NM_005124chr661000 862 777 766 646 86 ----1328
NM_005125chr11----1154 --
NM_005126chr351905 1687 1435 878 678 --22194 2179 --
NM_005154chr153605 417 28 --1213 --
NM_005156chr9125105 4923 4462 4247 3271 1660 1620 1507 1221 942 792 751 13934 64369 3802 3473 3468 3458 1396 11682
NM_005157chr9--11212 21561 235 --
NM_005160chr22135908 5632 5457 5288 5102 4946 4866 2197 1585 1480 1440 1341 1264 35665 5587 1633 56436 5648 4974 2584 174 11530
NM_005171chr1241317 1083 932 854 ----21196 102
NM_005180chr1041396 1381 1248 1147 --51605 1493 1334 626 423 11138
NM_005188chr11107856 7464 6894 5464 5434 2410 2271 1834 717 190 28261 3202 78215 7610 5443 5386 2170 1709 1126 15598
NM_005203chr10----154 --
NM_005207chr2223686 1014 --23711 3253 --
NM_005229chrX2490 165 --3959 408 277 2274 270
NM_005233chr362506 2172 2110 892 662 183 12408 42411 642 517 167 --
NM_005238chr1142802 2664 2634 1178 --43483 670 575 97 --
NM_005239chr2151781 1589 1387 1295 783 1673 1587 11916
NM_005245chr41311 ------
NM_005252chr142634 121 --3692 687 491 1652
NM_005254chr1531402 1251 975 11294 11237 --
NM_005256chr113782 658 242 --1158 --
NM_005257chr1821323 332 --31153 933 124 --
NM_005259chr251492 1467 1338 1285 607 --11389 21426 1001
NM_005261chr85978 901 894 713 671 1657 1191 --
NM_005273chr71325 --1314 --
NM_005277chr461623 1449 1296 617 353 178 11574 21800 508 --
NM_005296chrX4963 836 800 149 --3442 417 412 --
NM_005302chr72459 358 --131 --
NM_005324chr17------1756
NM_005328chr81206 --3782 731 145 --
NM_005329chr1652397 2362 2185 2139 786 --12302 --
NM_005339chr4103844 3782 3740 3520 1725 1066 998 569 530 65 43920 3013 1442 122 54222 3323 1739 1445 809 --
NM_005342chrX72758 2718 2029 962 791 564 71 --1335 --
NM_005358chr1361684 1504 628 423 379 347 11462 21510 555 21315 189
NM_005359chr18135897 5669 5425 5387 5352 4981 4731 4014 1924 1772 1613 601 420 54122 4074 1835 1576 1553 75231 4023 1819 1523 620 324 104 15091
NM_005370chr19----2878 159 --
NM_005385chr352620 2536 859 290 30 ----1268
NM_005391chrX1253 --141 1137
NM_005392chr981792 1760 1750 1520 1445 1395 1206 1196 --11815 --
NM_005393chrX----2300 248 --
NM_005400chr253014 2003 1019 206 135 --42955 2104 1975 999 --
NM_005401chr11163 --1182 --
NM_005402chr751560 344 230 210 26 11695 11831 --
NM_005413chr2----1409 --
NM_005415chr24667 608 312 175 --1111 1761
NM_005429chr4----1267 --
NM_005436chr10103259 1437 1379 1119 971 810 711 580 152 102 34080 3983 118 13332 --
NM_005437chr1051350 1266 462 351 195 ------
NM_005438chr11----1605 --
NM_005439chr12----1519 --
NM_005445chr101276 ------
NM_005455chr141658 1339 661 402 1327 21154 257 --
NM_005493chr62189 118 1215 --1720
NM_005509chr551693 1393 628 404 29 --21471 120 --
NM_005515chr7--1614 1553 --
NM_005521chr10----2272 262 --
NM_005522chr731286 526 80 --21347 541 1359
NM_005524chr3----1342 --
NM_005530chr152556 382 ----1213
NM_005536chr861288 1227 1106 481 140 108 1983 21364 962 --
NM_005561chr131821 --2833 827 --
NM_005565chr51128 1518 --1186
NM_005566chr111447 --182 --
NM_005568chr17------156
NM_005570chr18----2817 410 --
NM_005576chr15----1231 --
NM_005578chr3164999 4817 4706 4541 4373 4176 3716 3396 3199 1957 1866 1299 1287 1243 1008 914 --54455 4362 3894 1758 301 --
NM_005584chr13--1686 1587 1825
NM_005587chr15--1900 2975 951 1388
NM_005596chr996235 6048 4350 4278 4191 1579 649 507 457 --21681 990 21127 1123
NM_005598chr121272 219 11246 --71254 1250 1238 1222 1218 1214 1210
NM_005600chr1----1234 --
NM_005604chr661872 1715 1011 856 638 120 12563 42365 1948 1770 107 22286 447
NM_005605chr8------160
NM_005610chr12280 90 --1615 --
NM_005645chr1----1133 --
NM_005650chr221425 ----11328
NM_005657chr15126 --1120 --
NM_005665chr1124884 4422 4313 3376 1940 1508 930 894 801 493 415 160 14612 54466 3041 1273 839 172 23732 33
NM_005667chr21434 --1152 --
NM_005668chr5114605 4527 3957 3903 3827 2825 1768 1231 1208 1003 622 --63689 3244 1268 975 682 531 13610
NM_005680chr2----1293 --
NM_005688chr321352 184 --2359 110 --
NM_005707chr1531293 809 489 --21334 1194 --
NM_005715chr652422 2037 1867 741 180 12605 52673 2475 2315 167 30 --
NM_005717chr12344 22 1483 ----
NM_005719chr12----180 --
NM_005733chr51257 ----1192
NM_005737chr232805 2062 595 12957 42336 2259 1791 258 --
NM_005746chr782603 2473 1760 1055 1004 497 100 49 --1914 --
NM_005748chr12123140 2999 2637 2401 2391 2217 2120 877 657 638 384 160 1704 12897 1609
NM_005754chr551238 1193 1041 864 387 --1812 --
NM_005765chrX1343 --2731 132 --
NM_005767chr13--1255 ----
NM_005776chr141135 --1710 --
NM_005779chr522500 451 23584 2545 12548 --
NM_005785chr1231600 1522 296 --11384 --
NM_005786chr181180 3799 508 288 1215 --
NM_005795chr2122781 2701 2613 2576 2062 1841 1203 943 885 812 463 207 11865 62895 2585 2286 2268 1177 948 11921
NM_005797chr1131773 1335 1114 1216 31767 525 357 --
NM_005802chr94779 752 295 166 1241 2658 545 --
NM_005806chr2151295 1001 949 888 824 --21263 1096 --
NM_005813chr242543 1994 1924 1048 --32307 891 300 --
NM_005819chr162845 2719 2204 1113 990 981 --23432 2461 --
NM_005822chr64783 505 66 41 1207 1496 1882
NM_005832chr33567 229 173 --11047 --
NM_005839chr11384 --2794 33 --
NM_005842chr133638 515 147 --3663 627 583 --
NM_005845chr1361525 1383 1331 617 458 343 --41626 1140 422 180 1187
NM_005857chr151393 1225 1171 262 40 21353 511 61408 1356 999 985 288 225 --
NM_005862chr32970 897 140 2674 386 1681
NM_005870chr1311334 --31192 903 29 --
NM_005875chr32268 256 --1403 1108
NM_005876chr2------2722 718
NM_005885chr531155 576 297 --1319 --
NM_005895chr1254026 3267 3184 1379 986 21564 59 33202 451 62 1992
NM_005896chr23805 627 32 --4753 223 218 130 --
NM_005898chr1152263 1263 849 414 313 182 32759 2639 1227 11271
NM_005899chr1751207 474 312 89 51 21421 1283 --11348
NM_005907chr681631 1595 1558 524 247 190 145 21 --1468 --
NM_005909chr552633 1554 985 824 574 --33726 1298 313 --
NM_005930chr142694 178 1633 1189 --
NM_005935chr4103949 3410 3337 3288 2129 1903 1720 1537 1462 135 22080 1140 34010 3716 2059 24762 1619
NM_005941chr893811 3283 1680 1582 1255 972 591 348 234 --31284 536 225 13619
NM_005955chr164485 4167 3595 1234 834 142 15560 55271 4369 3669 3600 3436 11126
NM_005966chr232337 1993 1510 2406 296 32188 2128 385 --
NM_005967chr121726 1715 2743 718 --
NM_005969chr111234 ------
NM_005977chr132267 72 1779 1254 --
NM_005986chr1352555 989 887 638 267 --42058 2052 1755 668 --
NM_005990chr562806 2704 2187 2178 624 213 1578 12677 --
NM_005994chr171660 ----194
NM_005999chr131170 252 88 21097 68 21521 260 --
NM_006010chr31231 --181 --
NM_006011chr1544261 4197 3728 3663 13253 14147 33257 3246 3222
NM_006015chr121283 479 --21081 290 178
NM_006016chr662330 2200 799 453 315 232 --1811 11439
NM_006033chr1831839 1702 1503 --22274 2037 --
NM_006037chr2164892 4780 4707 4158 3981 3925 3889 3374 1701 1442 1083 899 686 482 427 30 --34374 4102 1713 13949
NM_006047chr20103360 2767 2676 2570 2406 2218 2200 1093 1018 522 --22439 2153 43044 755 585 455
NM_006055chr273227 2810 2743 2559 2492 1115 625 22994 301 32877 980 140 1788
NM_006079chr61835 --1690 --
NM_006080chr742459 1946 1101 637 22638 944 62109 2034 884 787 714 282 1454
NM_006089chrX51588 1200 580 570 118 --41544 1265 1259 1254 --
NM_006094chr842435 2364 2315 1477 11693 2739 358 --
NM_006096chr81121 --11676 --
NM_006099chr1----1876 --
NM_006100chr3----144 --
NM_006106chr1193420 3194 2828 2805 2417 1200 910 781 425 1896 43358 1239 600 234 --
NM_006135chr131404 520 162 1983 11380 --
NM_006136chr721260 167 2554 456 31224 1219 871 --
NM_006141chr1662655 2556 2487 2210 1960 608 21742 844 52371 2286 1954 1948 863 12067
NM_006143chr12----1112 --
NM_006154chr1572896 2307 1089 958 517 317 163 12339 11805 12768
NM_006157chr11----2388 342 1385
NM_006166chr12102309 1976 1683 1675 611 524 511 438 321 289 --1456 --
NM_006194chr1421318 358 11296 1885 --
NM_006197chr842086 1924 590 424 1306 11761 22028 699
NM_006204chr10----1228 --
NM_006216chr21484 ------
NM_006224chr1711838 11878 32513 1693 320 12489
NM_006226chr221378 502 --11264 21247 166
NM_006237chr1321961 1456 11812 1733 22015 1816
NM_006239chr41659 1715 --1620
NM_006241chr372281 1612 1522 1509 944 472 380 --31720 488 342 12296
NM_006243chr12254 213 ----2873 198
NM_006244chr111408 ----1498
NM_006251chr593391 2680 2107 1271 1179 1087 1013 527 365 --33217 2738 2461 --
NM_006252chr1157259 7045 7015 6491 6014 5212 4708 3019 1800 1386 1374 1305 1007 898 116 42135 1411 480 174 107430 4672 1167 911 817 741 681 652 430 65 11361
NM_006254chr3----1420 --
NM_006264chr43565 529 366 1204 ----
NM_006275chr2072159 1736 941 894 882 634 367 --31790 669 355 11759
NM_006279chr1----1367 --
NM_006281chr83933 382 355 1407 --1411
NM_006282chr2064387 4368 3418 1672 304 209 14291 11896 13613
NM_006283chr8134212 4134 3937 3789 3759 3678 3623 3310 1756 1719 1680 939 64 --1290 1429
NM_006290chr611814 21987 1846 11379 --
NM_006299chr6--1226 1240 1237
NM_006304chr71105 --1119 --
NM_006313chr1251566 590 521 193 132 11461 31664 1210 356 21712 1465
NM_006315chr463896 2838 1538 1345 1206 409 --34373 2873 1372 --
NM_006320chr42752 727 1170 1436 --
NM_006330chr881560 1241 1158 1131 627 545 413 304 11590 31109 612 593 --
NM_006335chr1----11001 1193
NM_006345chr42512 49 1263 --1900
NM_006346chr13----2185 117 --
NM_006352chr151835 1773 398 317 302 1500 22002 828 --
NM_006364chr1411007 --41269 511 201 76 --
NM_006372chr6----2516 185 --
NM_006378chr941336 477 414 187 2382 146 11407 --
NM_006379chr721730 252 1759 32113 1894 762 21444 242
NM_006380chr17114316 4089 4052 3746 3666 1655 1603 1235 1224 799 776 11276 13373 --
NM_006393chr1064116 3542 1786 1759 97 29 --63621 3173 3019 1706 1256 604 13479
NM_006403chr611374 31363 1337 84 31403 476 300 --
NM_006415chr91173 --11291 --
NM_006420chr2052594 2487 2122 892 487 --43197 2655 2548 913 12443
NM_006421chr811259 ------
NM_006425chr551179 1012 645 628 93 --31606 262 238 2259 255
NM_006451chr53788 212 171 --1734 1712
NM_006464chr263607 3152 1380 1019 697 81 --24574 1219 1268
NM_006465chr1512299 --1374 --
NM_006466chr20121 2768 372 --1152
NM_006467chr552127 1895 1872 1737 1478 12303 52314 2291 759 448 75 12231
NM_006469chr12478 226 1446 31438 991 169 --
NM_006496chr121945 430 --31280 413 405 --
NM_006504chr1011156 --42965 1921 521 70 --
NM_006526chr2051929 1358 676 590 266 1871 22098 2078 12149
NM_006534chr2073152 2459 2327 2088 1245 545 479 --33350 3087 2565 1725
NM_006538chr253520 3292 2650 2609 568 22884 1634 53897 3226 2872 1666 479 --
NM_006540chr811070 --31441 1176 442 11479
NM_006544chr14216005 5733 5375 5361 5135 4691 4635 4444 4434 3932 3922 2189 1891 1883 1831 812 804 756 702 478 286 --45761 4255 2033 971 22091 172
NM_006546chr1765032 2678 2373 2232 1667 1330 --21798 493 15570
NM_006558chr82355 198 --1360 --
NM_006575chr1451346 1270 1212 1199 330 1476 1578 --
NM_006577chr241130 894 871 270 1483 31043 451 363 1985
NM_006598chr5------21313 1309
NM_006599chr16167631 7424 6904 6712 6474 5293 5044 3049 2915 2761 2402 2171 723 519 385 275 57012 6462 6105 5497 3072 78015 6651 5261 2106 1729 1536 648 28006 2456
NM_006601chr12----2955 772 --
NM_006609chr232850 1984 1877 12008 52699 2289 1901 746 611 11890
NM_006614chr353401 3121 2785 1265 1180 2523 451 52735 1343 945 648 54 --
NM_006618chr121173 512 --1550 1547
NM_006620chr684784 4082 3798 3442 3038 2982 1094 779 1606 34292 3764 881 31331 975 971
NM_006622chr51531 ----1505
NM_006624chr1071397 1325 802 742 597 486 217 ----11308
NM_006626chr942528 2141 998 116 22396 2387 2803 606 2811 672
NM_006628chr1594636 4429 4034 3265 3199 1532 1422 1006 42 31683 359 65 43761 3432 3427 75 --
NM_006646chr1382547 2338 2306 2208 2181 2144 2103 1966 --13017 --
NM_006653chr63433 417 389 --2378 294 1367
NM_006667chrX2777 769 ----1444
NM_006675chr1263104 2655 2419 1072 548 337 --2519 514 --
NM_006682chr772481 2448 2211 1028 846 721 628 136 12229 --
NM_006691chr1111086 11004 21025 792 --
NM_006698chr204971 507 183 144 --21440 441 11042
NM_006699chr152442 2355 905 870 725 12093 22737 2418 1959
NM_006708chr61368 --3459 231 198 --
NM_006713chr54596 564 536 189 --1205 --
NM_006717chr973045 2923 2524 2232 1088 715 50 --33274 2731 2725 1590
NM_006727chr5----1534 1197
NM_006729chrX125435 5202 4725 4364 4275 4250 3925 3908 3479 2038 1306 1295 23785 556 55186 3441 1034 901 567 32099 857 727
NM_006734chr611534 ----1489
NM_006735chr7----4305 91 84 72 --
NM_006738chr15----44599 1567 1555 371 24596 1613
NM_006750chr16137477 6646 6634 6553 6279 6252 6173 2883 2683 1846 884 841 232 --77052 6345 5336 5144 799 769 272 --
NM_006751chr2----21074 142 --
NM_006754chr751229 1215 1073 103 76 --1368 --
NM_006756chr841408 1007 994 573 1493 11437 --
NM_006775chr693112 3061 2934 2916 2681 2543 2363 2081 1163 --73105 2553 2175 1119 1106 1045 724 32672 2206 2109
NM_006777chrX52349 2108 2007 1101 111 --32405 1020 426 --
NM_006788chr1831332 336 242 ------
NM_006790chr51411 1144 ----
NM_006800chrX3637 575 540 ------
NM_006813chr6----1333 --
NM_006815chr1221260 284 --2880 90 --
NM_006818chr1141 ----3978 157 153
NM_006832chr144360 205 107 99 --21102 1078 --
NM_006838chr1271924 1419 1281 1235 674 119 86 --2524 33 --
NM_006852chr1732138 1855 551 --42515 884 606 123 --
NM_006854chr741566 523 201 192 --2447 331 --
NM_006885chr16104155 3670 3496 3342 2580 1238 1175 984 499 194 --33325 2585 1313 11321
NM_006888chr1443319 3085 627 101 13104 --13501
NM_006901chr15----1428 --
NM_006902chr182979 2815 2490 2272 1228 948 704 227 12923 1397 --
NM_006914chr951542 1364 301 261 131 --1187 --
NM_006915chrX82468 2432 1720 966 801 662 396 296 12192 22257 123 12544
NM_006920chr281773 1637 1492 1311 724 435 379 67 --32083 1453 1448 21720 1263
NM_006927chr16----22145 1718 --
NM_006931chr1211524 --3594 477 190 1474
NM_006939chr1431001 211 63 --11039 11134
NM_006940chr1231772 1382 666 ----1686
NM_006948chr2172316 2249 1668 822 57 36 24 --41817 636 631 154 22146 2142
NM_006956chr762204 2176 1695 1522 617 551 --21842 1816 --
NM_006959chr191354 --1342 --
NM_006981chr953018 2435 1960 660 646 --42884 2705 2503 525 --
NM_006988chr212946 267 --21189 1175 --
NM_006996chr161894 1866 1635 1272 594 476 2646 205 2649 192 --
NM_006999chr51640 --1688 1524
NM_007005chr931304 1194 1141 --1292 --
NM_007006chr1673077 2621 2592 2305 701 372 39 11063 53544 2821 471 261 102 22255 202
NM_007007chr12124679 4161 4112 3514 3202 1749 1676 1560 1405 957 459 258 --94818 4724 4192 3755 3438 1625 974 210 185 --
NM_007010chr1721904 63 11206 11209 11307
NM_007013chr82685 248 1378 --1178
NM_007026chr171604 2525 486 1140 --
NM_007034chr1----1211 --
NM_007035chr122672 237 1562 1258 --
NM_007038chr2174904 4206 2220 2171 1416 1105 1050 --54672 2113 2107 2015 1666 14389
NM_007039chr146806 765 630 588 516 506 1740 21865 395 --
NM_007045chr6----1531 --
NM_007050chr2097411 7398 5066 3132 3002 2250 1545 879 759 28030 4933 35812 2411 1006 --
NM_007054chr593733 3491 3047 1585 1135 1101 998 782 318 1511 23723 966 13222
NM_007055chr1031329 529 228 1492 1495 --
NM_007068chr2211034 --1150 --
NM_007073chr673376 3234 2642 2563 469 326 179 --24196 921 --
NM_007074chr16----1105 --
NM_007084chr1331252 1079 974 11128 11105 --
NM_007085chr32768 691 11732 3735 137 128 11006
NM_007106chr1352608 2021 1874 382 281 12457 42739 1074 198 39 --
NM_007114chr3103017 2579 2353 1143 1083 998 801 277 269 174 21158 713 63105 3030 1007 626 224 197 22417 745
NM_007115chr2--1443 --192
NM_007121chr19------1360
NM_007124chr661678 1493 761 507 492 279 2793 483 2796 658 --
NM_007125chrY51465 1279 1074 441 32 --1983 --
NM_007126chr9----1454 --
NM_007137chrX74317 4311 3879 3767 3745 3545 1704 25512 1354 13588 1781
NM_007146chr17122773 2674 2418 2400 2321 2137 1029 609 461 452 354 105 --22894 1877 --
NM_007159chr31195 1309 --11235
NM_007175chr893567 2877 2506 2499 833 691 538 519 273 --63522 3310 2587 2545 193 47 13107
NM_007185chr11872 1989 --1993
NM_007187chr133331 302 110 1276 31034 164 66 1796
NM_007198chr841556 1455 1125 1009 --21657 1431 --
NM_007207chr1----2967 145 1901
NM_007212chr122047 1794 --31838 1776 1407 1162
NM_007214chr631185 528 293 --31005 518 227 --
NM_007216chr1181154 1058 970 914 445 432 176 135 11031 --1854
NM_007231chrX32331 2251 888 2212 67 3922 309 70 --
NM_007240chr1----1190 --
NM_007245chr161919 1806 1795 --
NM_007246chr42321 164 1768 2377 371 --
NM_007249chr13189355 9032 8359 8026 7403 6858 6697 6427 6359 5704 3769 3312 3156 2773 2046 1617 1224 652 --18942 18956
NM_007271chr611343 --1634 1595
NM_007285chr161327 --2186 125 --
NM_007345chr1842121 2091 1627 147 21886 133 32034 1889 1776 2209 121
NM_007347chr1593163 2906 2532 2044 1244 1115 696 663 591 23150 61 63172 3012 2966 2192 642 297 --
NM_007349chr71386 --1392 --
NM_007350chr1294435 3101 1612 1488 1265 798 480 472 71 24659 320 54616 3504 573 393 293 2603 225
NM_007351chr461085 1072 1055 268 162 32 --2466 60 11041
NM_007358chr161897 1810 1557 1456 1302 740 11437 41945 1485 1258 423 --
NM_007374chr14--1424 --1416
NM_007375chr1122656 2305 2278 2035 2003 1947 1826 1798 1094 695 489 304 --22695 710 --
NM_012064chr1211054 --1111 11009
NM_012069chrX21731 751 11820 51831 1823 1806 1801 45 --
NM_012081chr583557 3411 1361 1348 1276 965 956 512 32979 264 45 21463 1242 22735 49
NM_012082chr81240 --2791 205 1248
NM_012090chr141096 820 135 69 11235 1339 1842
NM_012092chr221608 75 --1499 --
NM_012115chr62204 95 --3553 385 227 --
NM_012120chr6112936 2928 2906 2361 2116 923 896 524 316 300 204 21176 1117 1561 --
NM_012121chr1711442 ------
NM_012158chr1331857 1789 142 21564 1182 161 --
NM_012161chr441082 856 741 414 --2795 470 124
NM_012164chr9177444 7248 6899 6572 5419 5196 4726 2921 2893 2638 2519 2208 2201 1371 811 365 184 17276 66223 5974 5386 2877 1446 903 1136
NM_012180chr43600 487 212 --2634 463 --
NM_012198chr23644 548 212 --2609 140 --
NM_012199chr154446 3900 3469 3334 1260 --11700 13907
NM_012207chr101129 --1177 --
NM_012214chr2166102 5201 5073 5052 4933 2546 2532 2055 1946 1835 1145 1096 931 694 454 365 26294 5850 66297 5853 5043 4745 904 77 --
NM_012223chr241332 1138 366 152 --168 1973
NM_012224chr451152 1139 1110 841 238 21231 95 21200 847 2188 99
NM_012234chr363702 3398 3333 3166 994 512 12577 11131 23631 381
NM_012238chr1051603 1371 614 502 170 --31504 1305 1192 21199 327
NM_012242chr102324 255 ------
NM_012243chr11800 --1373 --
NM_012249chr262986 2593 2281 1257 654 553 --32900 1157 222 43502 3187 2868 2184
NM_012257chr751094 1064 800 223 90 --1333 --
NM_012262chr175259 4368 3979 2057 786 712 491 --44657 4215 1546 199 --
NM_012281chr7102386 2316 2189 2163 2129 2004 1991 1597 954 525 ------
NM_012285chr17----1532 --
NM_012287chr394487 4459 4405 4136 4119 4035 907 529 205 33603 1824 167 54221 3725 3546 1028 673 --
NM_012293chr211677 12005 21661 29 22188 258
NM_012294chr784042 3959 3627 2958 2658 804 798 105 --23611 1482 --
NM_012297chr472515 2396 2345 2065 2033 851 162 --22414 591 --
NM_012300chr552445 2325 1764 1710 672 1642 22221 948 --
NM_012301chr721811 668 --21881 81 --
NM_012302chr13975 842 216 --11123 --
NM_012307chr182735 365 --1898 --
NM_012309chr11134552 4049 3666 3644 3523 3317 3094 1871 1549 1542 1207 867 538 13290 2704 118 --
NM_012316chr155201 4266 4176 3996 435 35576 1576 557 45444 387 345 339 --
NM_012323chr22----21544 1173 21541 1052
NM_012328chr791439 1415 1195 1082 1068 929 584 196 51 ------
NM_012329chr1731185 622 35 --21598 1419 --
NM_012330chr1031551 653 342 11353 21513 1152 1132
NM_012333chr121241 268 ------
NM_012334chr584777 4425 3452 3252 1450 1412 1157 746 --22987 1250 --
NM_012338chr72963 434 1769 31217 1169 1098 --
NM_012342chr103330 193 160 --2364 76 --
NM_012345chr1311296 1506 41552 1441 673 258 --
NM_012347chr652037 503 312 206 162 12235 22833 429 1216
NM_012382chr5114444 3760 3473 3009 1693 1534 1392 1187 1128 638 22 --41539 1280 843 697 --
NM_012395chr733394 2474 2433 --33367 3207 3200 1188
NM_012399chr2261737 1719 1333 757 651 488 --21291 634 11299
NM_012405chr133382 3014 651 --43146 2648 886 481 13805
NM_012414chr13765 282 62 --2836 254 --
NM_012434chr621199 556 --11621 145
NM_012446chr52556 485 --1132 --
NM_012448chr1742384 1543 681 488 22423 1586 11649 --
NM_012463chr1251828 1528 468 332 260 ----1349
NM_012465chr1012604 --43370 3314 2851 2169 12265
NM_012479chr742676 2644 2599 2524 --32152 1939 53 --
NM_012482chr1----2142 52 --
NM_013230chrY21698 129 1512 11150 --
NM_013231chr1464416 3268 1140 1121 928 909 23053 1012 11419 --
NM_013233chr23503 413 205 21329 354 1549 --
NM_013246chr112921 679 1905 1891 1888
NM_013254chr121495 --2500 193 --
NM_013255chr7208690 8684 7834 7740 7246 7014 6890 6826 5386 3265 2973 2671 2609 2588 2014 1508 1479 1030 1000 577 27957 5555 116325 6255 5491 3367 2741 2051 1968 985 915 332 271 26519 2131
NM_013261chr473710 2871 2670 2435 2398 2360 243 --33032 3026 1109 --
NM_013275chr16----1759 --
NM_013286chr373162 3118 3041 1428 110 98 51 --33795 496 267 --
NM_013293chr74607 597 172 141 1638 --1124
NM_013302chr1664322 3773 2874 1861 1851 630 21465 80 44683 4489 4466 613 11377
NM_013309chr1551742 858 842 649 401 133 32640 1926 547 1676
NM_013322chr761652 1473 1396 305 165 144 ------
NM_013328chr1--1534 1568 --
NM_013330chr1183 --1246 --
NM_013354chr871444 1423 1370 1127 940 465 124 --61351 355 313 62 27 21 --
NM_013367chr4----1111 --
NM_013368chr19--1562 --1216
NM_013374chr373091 2413 2356 2209 2117 791 397 11211 43105 2984 698 659 --
NM_013381chr1282305 1829 1686 1616 1497 589 572 389 --4816 767 172 145 12176
NM_013386chr151509 1199 714 629 519 --81696 1370 1351 1159 697 590 341 232 --
NM_013396chr2131281 1041 241 11474 3501 297 111 2605 426
NM_013433chr19----11831 --
NM_013436chr21707 --2309 243 --
NM_013437chr871417 1282 1086 995 935 366 53 --21344 1032 31212 492 323
NM_013438chr941784 704 279 229 --4471 300 76 36 --
NM_013438chr941784 704 279 229 --4471 300 76 36 --
NM_013438chr941784 704 279 229 --4471 300 76 36 --
NM_013438chr941784 704 279 229 --4471 300 76 36 --
NM_013442chr9----2101 93 --
NM_013444chrX81135 832 360 349 261 222 197 38 --1434 --
NM_013447chr1943727 3096 2986 801 1480 33587 2878 2517 --
NM_013448chr142635 523 ----1540
NM_013449chr12--1376 42528 1835 1159 280 11919
NM_013450chr221240 212 1435 3795 401 22 21190 1109
NM_013943chr1133144 2803 2673 2266 2235 2152 1322 993 819 636 386 185 155 --73262 2896 2753 2723 2474 832 729 --
NM_013956chr8----141 --
NM_013995chrX42388 1781 913 210 --12429 --
NM_014001chr1711553 ----1204
NM_014005chr522172 374 --22302 29 51180 1060 545 210 99
NM_014007chr9----1385 --
NM_014010chr92620 233 --1216 --
NM_014011chr231883 659 382 --22470 948 --
NM_014016chr32374 109 21526 357 31684 1297 677 --
NM_014021chr1113507 3253 2993 2964 2897 2620 2394 2351 1250 423 87 13372 2758 342 --
NM_014028chr6133195 3159 3033 2350 1220 1061 790 772 731 706 659 273 239 22434 221 53344 1187 671 592 278 13084
NM_014034chr62252 209 --1214 21493 1299
NM_014048chr1685224 4931 3392 1573 1537 1515 1311 1223 --24137 600 14688
NM_014079chr31843 --2890 76 1849
NM_014106chr1572630 2276 1834 565 458 78 44 32622 2432 63 72215 2187 2099 1182 1103 884 429 --
NM_014112chr894683 4323 1948 1907 1548 1485 1440 737 680 14964 45394 5389 1378 1006 21917 1003
NM_014117chr1632221 636 302 1427 1335 1991
NM_014153chr16----1613 --
NM_014154chr321293 1135 1296 11040 --
NM_014155chr1187442 5491 5364 5156 4693 2877 1776 814 --77046 5802 4762 4714 1608 1423 438 --
NM_014166chr131754 1370 11110 --
NM_014176chr1----1119 1116
NM_014181chr232420 872 219 42863 2622 1841 534 --1538
NM_014191chr121359 --1347 --
NM_014212chr12147 --470 63 57 52 --
NM_014225chr19----2401 387 --
NM_014231chr1221475 577 --12100 1805
NM_014240chr334081 4007 346 1904 22649 1116 --
NM_014243chr422098 508 --1116 1435
NM_014249chr151157 --1523 --
NM_014263chr1051442 149 140 129 35 11509 ----
NM_014264chr42566 538 --1458 --
NM_014271chrX1805 --2339 334 --
NM_014283chr141567 1192 951 422 11298 11074 1377
NM_014286chr92683 530 --1343 --
NM_014294chr821176 398 --41035 542 259 248 --
NM_014319chr12101995 1845 1814 1549 1388 1212 663 263 195 103 134 21672 66 --
NM_014325chr1252141 1906 552 221 131 12085 22154 173 11935
NM_014337chr22----12075 --
NM_014344chr111804 --2821 781 --
NM_014345chr63887 283 85 --31049 781 269 --
NM_014368chr932133 1429 524 --1465 22016 390
NM_014372chr181827 1741 1468 1324 786 434 348 60 --11344 2779 597
NM_014382chr331652 1515 1400 21593 258 51360 674 668 354 22 --
NM_014388chr1115756 4581 2387 1825 1693 1568 1085 1054 320 299 134 21368 624 1782 11867
NM_014391chr10199 1186 1189 2214 210
NM_014393chr82740 179 21474 123 32245 2186 1638 --
NM_014395chr431934 1577 704 11320 21985 571 11913
NM_014415chr351100 579 404 352 262 --41558 549 434 149 1639
NM_014421chr441987 1611 1417 773 1221 11584 12002
NM_014423chr5145222 5062 5030 3563 1819 1650 988 969 861 844 684 560 439 358 33617 2056 202 45285 5046 1392 309 2419 306
NM_014445chr331986 1918 430 --1788 --
NM_014456chr1061745 1707 1347 1259 664 462 1278 1470 1377
NM_014458chr161072 1032 910 382 215 99 --1199 --
NM_014462chr81131 --1121 --
NM_014489chr11----1863 --
NM_014504chr752146 1334 765 562 190 --3554 237 27 --
NM_014520chr17----1399 --
NM_014552chr251505 1192 1157 960 269 1322 11493 --
NM_014553chr263343 2851 2484 2436 2372 2200 --31113 983 787 12173
NM_014575chr3----2161 40 --
NM_014577chr22--1338 3864 858 140 --
NM_014584chr141559 --31360 1185 600 11568
NM_014585chr251179 970 428 342 57 --2943 409 --
NM_014586chr2194584 4473 4080 3460 3294 1751 1282 1020 682 14185 24338 1525 --
NM_014587chr16----2622 598 --
NM_014588chr20------1765
NM_014602chr31232 --1285 --
NM_014606chr431163 1150 576 21346 100 31521 991 439 11080
NM_014607chr251759 1690 852 721 122 31358 558 276 22144 1361 --
NM_014613chr542753 2339 1217 690 --2592 526 --
NM_014614chr231099 1041 394 --11108 --
NM_014615chr16103580 3421 2891 2829 2804 829 651 509 277 55 148 ----
NM_014616chr3123503 3156 2930 2449 2245 1389 1372 1336 1113 817 447 252 23210 590 33188 2159 244 12279
NM_014620chr121237 2293 71 1296 --
NM_014629chr81412 --11369 1460
NM_014630chr1553989 2975 1325 991 259 23483 221 33145 3129 3012 --
NM_014632chr11------1198
NM_014633chr111403 --1437 --
NM_014634chr221748 --33491 885 803 --
NM_014636chr984329 3904 3329 2755 2691 1339 1315 1260 --22732 1296 --
NM_014647chr1622013 219 12217 22113 2079 1600
NM_014660chr7----1844 --
NM_014663chr111095 ------
NM_014666chr551283 1078 497 268 97 --31303 871 866 --
NM_014670chr231408 318 249 --21186 135 --
NM_014671chr741527 1471 1055 164 21561 184 41568 1415 1181 556 11565
NM_014674chr374021 3996 3710 1311 924 736 388 --33757 3345 399 13754
NM_014682chr852023 1700 1544 524 387 3760 491 222 102110 2058 1538 811 763 396 340 246 225 137 31986 1784 315
NM_014683chr1771876 1860 1812 1694 1554 845 605 11395 21794 1398 21435 790
NM_014689chr21598 --2543 88 --
NM_014699chr161337 ----1367
NM_014701chr1533373 2929 227 21198 763 43186 1350 1265 1201 23225 2178
NM_014702chr6113414 2976 2791 2595 2480 2315 2125 981 738 653 158 12881 1833 1424
NM_014707chr752195 1800 810 304 252 --21939 661 --
NM_014709chr2296 75 --1570 1513
NM_014711chr1682025 1726 1699 1593 1342 592 109 32 --32082 2068 243 22005 54
NM_014720chr1051742 1524 1174 560 548 1316 ----
NM_014725chrX----21109 1038 --
NM_014727chr19------1266
NM_014729chr852016 812 501 176 93 --32024 702 648 12079
NM_014730chr1274369 3383 1669 1180 624 613 556 --14631 14343
NM_014746chr284355 3688 3551 3146 1572 1458 850 456 --33802 1565 1449 --
NM_014754chr81137 ------
NM_014755chr274100 3726 3479 1593 1561 1269 368 23061 410 33091 1076 548 1348
NM_014757chr582372 2271 1521 615 577 428 359 49 ----11981
NM_014764chr122945 451 --31135 1130 1125 --
NM_014765chr142673 2554 1085 255 11989 42521 1046 611 168 2165 156
NM_014772chr1853124 3094 2382 695 560 --23111 706 --
NM_014774chr172405 2262 2159 964 623 307 158 12371 22394 2132 --
NM_014779chr321086 236 --2953 430 2996 442
NM_014783chr1531635 1142 226 11162 21550 168 11166
NM_014787chr172839 2621 2273 2163 1749 702 345 11755 12057 --
NM_014793chr15------1613
NM_014795chr261355 1172 1127 898 869 404 --21181 1014 21011 978
NM_014802chr123808 70 55 --11150 1715
NM_014803chr1052685 991 828 818 509 --62761 2672 2545 1948 977 730 --
NM_014806chr9------3476 472 468
NM_014810chr163031 2957 2482 2394 761 211 1964 21011 513 --
NM_014811chr9--1206 --1155
NM_014819chr552444 2346 2262 2113 1842 --42243 2202 1821 317 --
NM_014820chr33773 200 127 --21856 1396 21618 1518
NM_014824chr1132009 1798 1608 --11852 --
NM_014827chr191657 1578 1524 637 374 329 218 197 138 ------
NM_014828chr1461961 884 698 567 546 35 ----11545
NM_014830chr1233487 1142 1113 1555 33332 2751 1506 23921 1503
NM_014838chr224689 611 339 197 --22890 2456 --
NM_014839chr132376 828 552 1105 12291 1760
NM_014840chr1222653 2323 --33428 3193 3183 23203 3141
NM_014841chr62413 227 11227 1554 --
NM_014858chr11985 1276 31037 998 775 2772 768
NM_014864chr173601 3541 3284 1114 1036 995 798 --34229 3873 414 13108
NM_014873chr194677 4553 4508 4181 3831 823 671 135 67 --64604 4422 3859 3726 919 837 13354
NM_014877chr17207713 7530 7354 7230 6949 6502 6308 6228 2951 2529 2456 2379 1325 1082 982 700 514 450 381 180 27295 2248 67617 7611 7595 6585 4829 4800 36876 5464 332
NM_014892chr61656 --2211 94 --
NM_014893chrY32259 1529 507 --42214 1673 1571 674 --
NM_014897chr1763000 2764 2367 2334 2289 573 --21173 556 --
NM_014898chr1942300 427 269 223 ----21748 128
NM_014899chr552663 1254 990 134 35 11191 23044 588 13050
NM_014903chr1242387 1546 1534 358 12486 32223 769 200 --
NM_014904chr10123909 3716 2848 2771 2754 1623 1558 1487 1345 1264 1200 121 33884 3259 2990 53297 2694 2609 2495 837 --
NM_014905chr251942 1824 1290 577 107 22042 2026 1289 1821
NM_014906chr17104121 4072 4001 3767 3503 3445 2668 1013 692 339 21064 743 53745 1645 998 917 406 --
NM_014912chr10123391 3328 3316 3166 3022 2803 2709 2322 2244 400 280 138 1155 73372 3226 3034 2307 1190 606 246 --
NM_014917chr12716 155 --1824 --
NM_014918chr1521130 496 21218 38 31599 1252 46 11161
NM_014920chr683770 3470 3426 3366 3168 759 240 214 1441 53173 2616 1420 1413 1131 13676
NM_014925chr122957 773 ----1926
NM_014926chr331073 437 269 --1371 --
NM_014932chr321797 423 12001 21809 409 --
NM_014934chr1371550 1087 834 814 762 709 492 12750 54018 2506 2499 1256 783 11533
NM_014935chr143644 3029 2464 1097 ----23663 3096
NM_014936chr632854 966 893 12560 32778 2125 1089 12219
NM_014937chr102382 241 11293 --137
NM_014941chr22----1182 --
NM_014943chr81441 --2511 431 --
NM_014946chr283110 3031 2246 1096 1003 942 788 442 --62460 834 628 562 485 385 --
NM_014947chr153054 913 834 806 441 1533 2202 174 --
NM_014949chr12664 176 --2362 227 --
NM_014950chr1451735 1680 1138 1123 319 11104 11107 --
NM_014951chr1082518 2325 2307 2120 2105 1934 660 188 21850 1815 32440 2436 1818 11976
NM_014962chr20122703 2569 2513 2494 1886 1118 909 736 516 389 354 304 12792 --12423
NM_014969chr121190 926 11051 31072 1016 976 11069
NM_014977chr141531 --2523 517 --
NM_014978chr1031783 1490 704 --31463 563 44 --
NM_014982chr1474633 4388 4081 3890 3798 1240 388 1637 84562 3877 3515 1779 1253 1166 1130 516 44974 4332 1003 610
NM_014989chr652014 1856 730 501 392 51838 1828 1485 690 154 21672 438 --
NM_014990chr142911 417 31030 522 355 2464 288 --
NM_014991chr4103039 2999 2826 2788 2499 2152 1023 963 587 346 11234 23210 525 12537
NM_014997chr71691 21169 117 12316 159
NM_014999chr1221537 90 ----1656
NM_015000chr12122955 2669 2651 2617 2580 2519 1071 900 828 587 224 206 11982 32942 2862 1018 --
NM_015017chr13909 256 116 --41033 126 100 91 --
NM_015020chr1643110 3001 2372 739 --32456 905 276 --
NM_015025chr292682 2537 2508 2457 2371 2009 1062 947 700 --42570 1003 554 91 --
NM_015026chr12224495 4404 4290 3505 3453 3325 3284 3253 3224 3089 3000 2978 1879 1749 1654 1586 1431 1268 970 692 591 372 34250 1573 458 13877 43853 1627 1312 544
NM_015027chr1621376 253 1178 21825 1604 --
NM_015032chr13112804 2601 2383 2034 1017 817 799 789 683 581 349 --32123 1784 315 --
NM_015037chr10----1238 --
NM_015045chr1041705 1431 623 306 --22150 1677 --
NM_015047chr12952 769 1878 1881 1395
NM_015049chr293294 3260 2994 2576 2508 1239 661 412 267 12722 22563 2044 --
NM_015051chr983051 2488 2347 2283 2194 1358 1317 1202 --32860 2494 100 1668
NM_015055chr1131975 1958 1120 21884 482 31809 584 485 --
NM_015057chr133649 543 191 1463 2447 201 --
NM_015059chr1543983 3087 2987 651 --23993 3833 13967
NM_015060chr7----1224 --
NM_015070chr1311614 1121 41632 1353 1185 157 --
NM_015073chr1952046 2036 1912 1817 626 --1682 --
NM_015074chr154831 4321 3632 3613 1879 13588 14817 1695
NM_015076chr654286 4075 3163 1141 170 21579 1336 34521 4125 346 1560
NM_015078chr341308 1256 1231 1216 31289 1241 828 51292 1266 1206 1069 909 5906 902 898 894 890
NM_015080chr11----2301 279 --
NM_015082chr5----21696 591 --
NM_015091chr141700 1562 2865 127 --
NM_015092chr1674474 3630 3346 3056 3009 1275 262 24046 845 23771 725 --
NM_015093chr651779 688 596 514 96 11862 41702 1350 520 380 --
NM_015094chr2264688 4188 4175 1775 910 661 --13390 --
NM_015097chr361830 1462 824 764 425 401 22189 644 31694 777 289 1673
NM_015101chr142495 1026 748 425 1998 21001 498 1511
NM_015110chr972394 1624 1003 833 588 519 105 11601 1775 1781
NM_015122chr19----1229 --
NM_015124chr221160 ----12508
NM_015130chr431320 1148 104 --21270 237 --
NM_015137chr882482 2409 2386 2001 924 634 481 267 --32576 2013 362 1908
NM_015147chr273314 3302 3244 3173 2804 2176 1219 --1523 1184
NM_015149chr132151 1468 120 --1504 12075
NM_015155chr1082397 1266 1213 1154 1123 301 278 208 11230 --11299
NM_015156chr1463222 2960 1320 924 907 543 23368 2466 33972 2565 1563 12746
NM_015163chr1441887 1692 1478 1270 21663 1530 --31684 737 290
NM_015170chr852137 2020 1813 1605 224 --21642 840 --
NM_015172chr141333 1145 517 511 11618 ----
NM_015173chr441652 1395 687 590 ----1727
NM_015176chr131559 1305 1110 11433 1468 --
NM_015186chr93470 450 333 1159 1315 --
NM_015187chr42980 378 ----1959
NM_015192chr2082494 2243 1078 1001 895 587 469 341 22927 406 1928 2961 545
NM_015193chr8----11338 --
NM_015194chr1711686 --12100 --
NM_015199chr332418 1016 361 ----12799
NM_015205chr1324836 2050 35228 4553 4537 65174 5146 5010 4825 4556 1709 --
NM_015206chr1563584 2925 2915 1134 553 518 23621 1151 --11210
NM_015213chr112543 244 --1171 2691 687
NM_015215chr172447 2438 2308 1123 1087 526 461 --33048 1137 562 --
NM_015226chr1623315 713 13205 2477 447 1637
NM_015230chr461753 1505 1290 496 286 31 11618 41871 1354 652 192 1124
NM_015236chr441338 1301 942 386 --11359 11356
NM_015239chr9----2188 58 --
NM_015245chr612737 12536 32621 2546 1988 21913 925
NM_015252chr23821 750 332 ----1929
NM_015254chr81718 --21042 760 1751
NM_015260chr19----11593 --
NM_015265chr2102544 2421 2278 2149 1998 1761 937 859 633 260 --42313 621 125 119 11026
NM_015271chr473664 3100 2793 2698 1712 1043 131 23498 1081 ----
NM_015272chr1641917 859 686 469 --3651 338 175 --
NM_015275chr1251772 1696 1378 792 361 --11966 --
NM_015277chr182564 540 11763 2504 402 11272
NM_015278chr683247 3145 3108 2777 2552 2441 746 241 23433 622 2591 247 11139
NM_015282chr242958 2010 1893 117 --12667 12703
NM_015288chr543567 3230 367 169 --33592 2936 131 --
NM_015291chr153508 3418 3332 225 149 --32539 2358 1315 33063 2884 2203
NM_015294chr173116 105 74 --1786 1288
NM_015296chr134954 396 264 160 ----11189
NM_015310chr8128320 8238 8121 5560 5165 3229 3050 2956 1978 1186 1179 164 22185 1695 58115 5433 2635 2391 1550 11683
NM_015313chr1164184 3789 3736 3618 3098 3056 11050 83995 3975 3652 3008 851 434 387 346 21716 1712
NM_015315chr533288 3089 531 --2731 726 --
NM_015317chr282493 2405 2062 1972 1078 450 131 122 1622 1880 12740
NM_015328chr762385 2356 2162 1923 690 667 2540 138 11015 1142
NM_015330chr2212063 --11994 11991
NM_015335chr1242248 2175 1780 621 --42263 2253 644 607 22031 604
NM_015336chr1292586 2298 2031 2016 1847 1713 533 379 155 11943 32548 2492 1794 12565
NM_015339chr201147 --41005 917 278 273 --
NM_015344chr882013 1973 1687 1554 1529 760 645 140 2415 227 11613 1752
NM_015349chr662242 2146 1924 1118 486 476 12334 32980 2860 293 --
NM_015352chr2063786 3561 3427 3254 1298 1153 --13804 13825
NM_015355chr1751654 1429 539 304 197 --21990 1595 --
NM_015358chr2161076 1060 959 866 277 169 --21222 1090 --
NM_015359chr832836 2826 2796 --42944 2068 1914 1900 --
NM_015367chr2221553 1100 --11531 --
NM_015375chr164842 4749 4699 309 81 36 13920 24706 3898 --
NM_015379chr7----2217 76 --
NM_015382chr14----2582 555 1740
NM_015393chr452623 2585 1464 1122 374 --21519 502 144
NM_015423chr1111782 --31748 1632 92 --
NM_015429chr35731 446 372 168 139 1282 1979 --
NM_015432chr162571 521 1562 1643 --
NM_015435chr841385 1097 396 209 --11390 --
NM_015440chr61257 --2358 286 --
NM_015444chr3------1492
NM_015446chr111331 21401 1108 11180 --
NM_015447chr91554 192 ----
NM_015455chr573961 3536 3459 1520 1228 241 130 12837 ----
NM_015458chr8145182 4706 4226 4212 3646 3568 3414 3220 1042 933 836 609 573 299 24425 890 64666 4287 1830 1604 668 245 --
NM_015464chr71859 1676 1659 --
NM_015469chr91564 --193 1654
NM_015475chr23934 758 168 --1192 --
NM_015496chr8195 --1123 1228
NM_015497chr1511100 1220 --2416 412
NM_015508chr341526 1349 992 26 21382 200 31592 1385 521 2404 400
NM_015541chr32962 318 11360 --11364
NM_015542chr10----1923 --
NM_015548chr63947 172 130 145 4870 155 150 142 --
NM_015550chr763531 3467 2992 1248 907 840 --43457 3452 3228 3053 --
NM_015553chr635169 4015 35 22038 1021 34461 3771 967 --
NM_015554chr1542440 2367 865 782 21795 389 22376 808 11159
NM_015560chr362819 1982 985 918 304 66 --21958 720 12584
NM_015565chr21112143 2104 2048 1421 778 721 674 608 533 492 132 1447 12034 --
NM_015578chr1961869 847 541 501 329 108 --22037 1455 11342
NM_015601chr1031011 891 391 --2975 962 --
NM_015608chr101138 ----1664
NM_015626chr1731054 784 80 2834 164 11168 1108
NM_015630chr22945 215 --3785 353 197 --
NM_015633chr1231081 418 168 --189 --
NM_015635chr931434 699 679 1469 61513 1508 1503 1498 1478 352 --
NM_015638chr201686 --1733 --
NM_015658chr1--1135 1138 --
NM_015678chr1351670 1413 513 271 253 21394 451 --11328
NM_015691chrX42893 503 229 31 --3283 77 45 1349
NM_015695chr622147 2006 --22025 1860 11770
NM_015702chr23304 277 265 --2109 95 --
NM_015713chr893512 3401 2739 2731 2698 2548 2407 2290 340 23371 2207 42790 1375 989 200 12336
NM_015832chr182219 190 --2138 44 --
NM_015850chr8----1834 1906
NM_015852chr723263 3110 23124 2391 12771 --
NM_015886chr8175608 5310 5074 4825 4783 4690 4237 4065 3974 3795 3753 3725 2295 1604 849 690 619 34197 3761 1965 45433 4715 3707 1399 34722 2046 151
NM_015888chr153332 3130 2360 2218 1045 --43308 2833 996 259 12642
NM_015891chr621448 469 1194 ----
NM_015898chr19----1680 --
NM_015901chr10----1895 --
NM_015906chr1124834 4543 4122 4068 3440 3186 3086 3008 1856 1834 1656 1136 34721 1670 711 43836 1599 970 605 --
NM_015939chr201453 --2562 523 1154
NM_015946chr52668 253 --1733 --
NM_015949chr7----1734 1947
NM_015967chr131034 297 221 --2303 277 3934 920 755
NM_015982chr17----1335 --
NM_015986chr1761393 1271 1230 1157 514 343 --41345 1256 1199 203 --
NM_015995chr1555598 5533 4803 4310 3609 ----14605
NM_016009chr194891 3901 3777 3632 1419 929 572 371 229 14711 33914 1588 412 --
NM_016018chr892807 2793 2705 2509 2367 1992 1746 170 56 --32598 2252 1046 --
NM_016040chr122350 2169 --52656 2371 2275 2134 816 --
NM_016045chr2021131 71 --21293 64 --
NM_016048chr5183 --2936 276 1240
NM_016061chr251311 1187 660 595 417 11086 11686 11365
NM_016072chr1242420 930 811 672 32391 1802 44 1345 --
NM_016073chr1541084 965 300 220 162 1915 1912
NM_016076chr163223 3013 2033 2026 1037 217 --2809 240 --
NM_016078chr1721060 407 --2833 168 1130
NM_016083chr663640 3328 2885 769 736 74 --43881 3606 2963 661 --
NM_016087chr741665 1359 1204 457 --1168 --
NM_016101chr1671393 1263 1080 1012 356 313 93 1126 ----
NM_016107chr561151 314 298 244 167 92 11128 2255 250 --
NM_016131chr241837 852 505 172 --62230 2008 1982 786 365 138 --
NM_016132chr15143420 3389 3125 2675 2424 2370 2240 2099 1197 1123 1090 932 579 316 22932 2574 23131 2728 11075
NM_016138chr1621195 353 --2318 313 11432
NM_016156chr1142375 2231 1605 795 2773 601 1123 1120
NM_016206chr3258238 8164 7070 6707 6356 6267 6047 6004 5969 5936 3408 3267 3171 3127 3066 3035 2873 2381 2282 2137 976 771 543 265 255 15754 87892 3486 3272 3180 3104 2189 207 199 --
NM_016217chr662586 2408 906 795 50 33 22823 2515 23398 2826 --
NM_016218chr54841 514 285 45 11254 1439 195
NM_016230chr62188 25 ----140
NM_016231chr1721474 1374 ------
NM_016248chr13103945 3616 3109 2512 998 905 857 647 295 208 --43967 3777 1236 765 33545 3541 3067
NM_016252chr23720 681 609 --4327 322 317 197 1160
NM_016255chr6103351 3161 2768 2393 2306 2122 1266 1234 442 357 --23355 348 --
NM_016271chr1872330 2310 2128 944 873 345 284 --52349 2196 2077 2067 268 11580
NM_016272chr2222485 2122 1919 32223 2154 224 --
NM_016274chr1------177
NM_016277chr631497 1465 1311 --31538 1391 649 --
NM_016279chr5------1442
NM_016281chr123833 469 158 --2975 474 --
NM_016282chr931676 1584 500 --41469 571 138 123 --
NM_016287chr151828 1723 178 101 47 1490 21913 1590 1334
NM_016306chr32383 52 --191 1125
NM_016308chr162019 2008 1931 1530 1276 511 22054 1567 21414 1330 --
NM_016312chr123529 515 405 --1377 --
NM_016315chr281676 1626 1540 1325 705 609 344 60 --31817 1471 176 --
NM_016322chr9123177 2991 2700 2271 2181 2121 2017 1993 703 625 428 79 --41118 606 575 340 --
NM_016341chr102293 83 ----1437
NM_016374chr131226 992 215 ----1401
NM_016396chr1562479 2417 2263 1003 581 123 --102976 2957 2540 2513 2422 1966 1932 614 456 359 21857 169
NM_016410chr9----2141 65 1628
NM_016422chr1153225 3008 2409 565 141 32608 2443 226 52712 2486 876 229 120 --
NM_016436chr2032103 1014 880 --12482 1368
NM_016441chr2102389 2226 2209 2202 2106 1973 1878 1857 1511 401 --31996 1906 686 --
NM_016451chr111286 ------
NM_016454chr15--146 1233 --
NM_016499chr111514 --1545 --
NM_016506chr111616 --1571 --
NM_016530chr1584092 3755 3096 2746 2607 798 277 254 --43963 3829 1113 583 1492
NM_016531chr443675 3226 3179 3018 24085 73 11271 --
NM_016546chr1231772 1679 553 1598 41763 1758 1415 516 --
NM_016562chrX41614 1245 1228 202 --21463 1049 11218
NM_016575chr1265421 5352 2172 1892 876 633 14146 25446 121 1960
NM_016586chr143424 375 87 --2317 121 --
NM_016588chr62904 298 --4724 683 182 158 --
NM_016599chr43579 322 209 --1304 11456
NM_016605chr522746 2112 ------
NM_016607chrX31718 1327 1281 --1218 21351 1347
NM_016614chr62496 293 --1806 1172
NM_016620chr13970 360 81 --11296 --
NM_016626chr1831165 1150 115 1191 51752 1309 1256 1249 471 --
NM_016644chr53444 421 182 --1493 --
NM_016647chr8------11454
NM_016929chr673999 3944 3924 3798 3214 2826 1356 --54622 4312 3243 2846 2831 12843
NM_016932chr21308 --2940 182 --
NM_016946chr152619 1323 1171 236 97 12524 33016 2668 101 --
NM_016952chr1153961 3293 3199 617 605 44094 3846 176 113 54017 3449 3378 2685 116 --
NM_017412chr841053 997 250 52 --31216 461 254 --
NM_017413chrX1639 11969 --22490 2411
NM_017420chr1483828 3545 3486 2447 2329 1450 1143 1009 --43801 755 687 544 1938
NM_017423chr432163 310 286 --1358 21638 439
NM_017426chr42562 553 --1652 --
NM_017437chr142628 58 21494 405 1608 --
NM_017439chr71582 --2543 514 1554
NM_017440chr12153 1520 1442 124
NM_017508chr1192372 2270 2263 2019 1817 947 432 421 268 11887 42216 984 934 306 12055
NM_017519chr621308 78 --2922 916 --
NM_017542chr141510 443 365 343 --1695 1692
NM_017544chrX2936 128 ------
NM_017545chr20132 --1153 --
NM_017548chr3----21849 779 --
NM_017549chr751256 1090 461 421 362 --21337 1325 11410
NM_017550chr19------11095
NM_017577chr31659 --21150 154 21547 522
NM_017580chr102417 229 11980 2712 525 21988 1984
NM_017581chr41111 1278 1124 --
NM_017582chr11363 11857 31298 482 353 --
NM_017594chr943259 2525 2310 1189 --22907 649 13292
NM_017596chr141237 866 505 105 24624 1223 11243 --
NM_017599chr1252017 1912 1678 1632 1616 21493 1480 31841 443 237 --
NM_017610chr1521532 390 --31358 744 716 12133
NM_017617chr9----2213 169 4354 238 196 156
NM_017628chr4135189 4420 4028 3892 3694 3665 3390 1029 750 725 382 228 61 1651 33644 3496 148 --
NM_017629chr141302 666 552 214 --1570 --
NM_017633chr653954 2633 1409 879 860 --53030 2987 2797 2654 884 --
NM_017635chr1161373 1325 1202 1061 491 184 --21447 462 --
NM_017637chr9239477 9417 9406 9278 9053 8226 7428 6756 6139 5952 5740 3570 3362 3054 2150 2131 2039 1893 1824 1586 1213 870 466 --59245 2760 2469 2258 1995 --
NM_017641chr1251114 384 295 247 235 ----2838 810
NM_017643chr1762620 2239 1976 1100 555 536 --52925 2496 1123 791 611 1983
NM_017644chr3114930 4806 4411 3515 3476 2042 1539 1229 591 509 366 11955 54691 4035 3386 1788 347 24920 1342
NM_017649chr101287 --2346 267 --
NM_017650chr7115039 4972 4517 3891 2420 2140 2066 1924 1747 725 302 35579 5387 1658 24304 1632 15277
NM_017651chr6--11055 21058 1016 1459
NM_017658chr1474618 4237 3575 3502 1487 1427 621 11406 84606 4545 4263 3749 3340 1710 507 347 14551
NM_017660chr1923296 2368 --1920 --
NM_017662chr941944 1834 1656 401 --41662 813 359 354 --
NM_017666chrX42203 1709 543 181 11819 52158 1691 1676 1640 332 --
NM_017672chr1551376 1207 878 376 361 --11181 --
NM_017676chr531846 1575 1261 41407 526 487 144 2593 129 --
NM_017691chr151376 --2388 40 --
NM_017693chr1321040 489 1281 11443 --
NM_017714chr203955 852 670 1797 2376 86 --
NM_017724chr34741 629 105 64 --3730 242 235 --
NM_017736chr16123117 2953 2913 2876 2757 2376 1981 1151 1029 940 838 762 1924 42888 2770 2010 98 --
NM_017742chr1851872 1818 1663 1401 1264 --11683 193
NM_017752chrX62150 1786 1558 1451 398 230 31545 518 479 31979 843 90 --
NM_017753chr94972 817 363 269 ----1109
NM_017754chr694595 4587 4387 4226 4187 4054 3605 3595 859 24486 1703 14638 --
NM_017758chr1721027 367 --11455 1332
NM_017762chr1582463 2335 2232 1982 1833 1750 257 170 --31937 1812 272 12282
NM_017768chr11286 ----3666 343 196
NM_017769chr1473133 3091 3065 2264 2061 1044 384 22242 987 52245 2145 1197 413 62 1286
NM_017770chr622733 2446 32987 1020 565 32743 1821 630 --
NM_017779chr11553 11828 2795 345 2709 276
NM_017780chr81656 1197 1871 --
NM_017784chr341126 897 325 186 --21183 1100 --
NM_017801chr352560 1809 916 221 143 --22593 405 --
NM_017811chr953056 2741 2722 2564 795 --33100 3095 778 --
NM_017813chr8125192 4709 4281 4202 4039 2317 1943 1823 1320 951 205 145 14889 95186 4507 4448 4442 2221 2215 1948 1428 211 35183 4504 4258
NM_017824chr1062564 2484 868 531 337 240 --32460 2448 2240 1644
NM_017848chrX74518 4368 4112 4041 3901 3879 604 --63343 3148 2863 623 616 276 32860 985 273
NM_017849chr222073 2004 --22922 2230 12893
NM_017864chr8----127 --
NM_017913chr9----196 --
NM_017921chr1731621 503 440 --51963 1918 1885 668 369 1665
NM_017924chr141149 ------
NM_017944chr1152971 2383 1167 731 310 --33035 570 421 --
NM_017946chr711300 --2108 73 --
NM_017964chr2------156
NM_017974chr221023 813 --31253 1046 962 11250
NM_017987chr1061876 1792 627 530 445 267 12008 2471 123 --
NM_017988chr122280 31 1340 1314 --
NM_018000chr211850 --21929 1691 --
NM_018013chr672134 2011 1954 778 640 620 595 --22904 2403 --
NM_018014chr231376 1233 371 ----1175
NM_018017chr1062921 2877 2426 1959 1921 610 12898 32631 1851 455 32906 2902 980
NM_018018chr1261894 1850 1591 1245 174 73 --21842 697 --
NM_018031chr3----1226 --
NM_018036chr14104277 3772 3565 3195 3072 2818 703 600 521 93 --34295 4168 3689 11002
NM_018051chr71273 --1129 --
NM_018061chr191434 1379 1348 1167 1087 697 531 233 166 1518 11625 --
NM_018066chr1----1292 --
NM_018072chr1----161 --
NM_018078chr431010 903 77 --3945 750 109 --
NM_018079chr2----2145 33 --
NM_018084chr273182 3030 2427 974 588 536 384 11209 21156 78 --
NM_018092chr1661500 1187 1167 675 643 150 11448 1406 --
NM_018098chr321076 912 --31042 782 225 --
NM_018105chr831169 950 382 --21039 503 --
NM_018112chr931062 796 240 147 ----
NM_018120chr841220 1023 1009 146 --2512 312 --
NM_018121chr1083044 2939 2636 2538 1124 460 347 326 12391 22781 2234 11958
NM_018126chr421476 1345 11383 21364 589 --
NM_018133chr341985 1865 1713 729 --11724 21751 801
NM_018157chr1242376 679 271 36 --23198 1048 2997 993
NM_018169chr121483 --2559 394 1341
NM_018177chr42222 98 --2796 57 --
NM_018178chr151833 1512 1396 1321 186 11634 21968 425 11280
NM_018184chr332125 2009 740 --41984 520 515 126 11964
NM_018192chr3--1242 166 135
NM_018200chr1551834 1605 897 445 385 11738 32617 2476 1031 --
NM_018202chr11365 --1225 --
NM_018207chr1------11715
NM_018214chr641000 823 511 319 --2516 279 --
NM_018217chr20----122 --
NM_018221chr21448 --1457 --
NM_018227chr463153 2925 2068 1169 1044 983 1192 52627 2562 2253 2073 1029 23228 788
NM_018243chr463363 3282 3242 1576 1172 575 13334 63915 532 101 96 91 86 23749 1215
NM_018244chr201499 --11303 11160
NM_018247chr6113169 3093 2656 2435 1219 1196 928 600 557 543 257 --32402 1969 1201 --
NM_018254chr152169 2126 1873 1837 1762 --1316 --
NM_018287chr1031102 931 226 11070 178 --
NM_018290chr431245 1050 878 1930 11270 --
NM_018293chr362877 2225 2089 1928 1028 416 1956 32747 2735 2063 --
NM_018318chr122328 206 --2911 172 --
NM_018321chr51150 --145 --
NM_018325chr931572 1555 1134 11537 1658 11248
NM_018330chr1011512 ----11247
NM_018332chr16----11352 --
NM_018335chr142454 97 ----1167
NM_018351chr1254689 4102 1264 1238 229 34422 573 191 23703 696 --
NM_018352chr44854 675 661 159 --21014 698 --
NM_018362chr1194024 3524 3008 2886 2863 1182 903 264 109 34053 3812 1524 12704 1843
NM_018364chr1124143 3938 3601 3531 3433 3032 2531 1383 1228 1161 351 87 33262 620 499 23385 341 33862 3858 1005
NM_018371chr841428 1324 1267 579 ----1623
NM_018373chr1496480 6324 6166 5009 4984 4860 1988 904 705 --26089 4649 1424
NM_018374chr7174814 4763 4388 4373 4277 4098 3973 3505 3460 2097 2041 1544 1456 1031 1006 564 556 33282 3269 297 64016 3706 3414 3306 1859 1279 33758 1495 1190
NM_018375chr1471934 1673 1303 1296 413 225 92 --21657 1526 --
NM_018383chr231937 640 348 21729 523 --11427
NM_018403chr393863 3224 3136 2814 1440 1128 979 822 526 --23807 1184 --
NM_018409chr483232 2771 2452 2230 1268 626 291 82 1371 63058 2578 2413 1293 1123 409 --
NM_018413chr122203 84 1299 152 --
NM_018416chr1242466 986 930 224 --22670 1764 --
NM_018427chr1631465 1389 376 --31219 513 473 11235
NM_018431chr201525 --2637 168 --
NM_018434chr5----1114 --
NM_018437chr92428 109 --1540 --
NM_018440chr8118693 7737 7544 7336 5798 3166 3059 2006 1774 1222 678 27759 2718 77552 5551 3427 3004 1054 745 740 18052
NM_018444chr862072 1964 933 562 427 239 1908 51729 1643 1619 728 477 1684
NM_018445chr152572 518 --1450 1548
NM_018448chr12----21003 176 11208
NM_018456chr3----150 --
NM_018477chr141695 --31049 1044 735 --
NM_018482chr862418 2382 1694 1020 522 478 --12411 --
NM_018489chr132082 1590 687 --32071 1955 528 --
NM_018490chr1131795 1417 520 --21403 141 11634
NM_018557chr241436 1325 1059 410 11742 31224 153 111 11258
NM_018566chr1114634 3782 3288 1747 1501 1485 1445 1152 1110 949 850 24067 3233 34051 3245 1597 15096
NM_018584chr13891 307 95 21026 457 1868 --
NM_018590chr1051747 1721 1589 1211 242 11538 1106 152
NM_018638chr12105183 4864 4257 4050 3959 1557 1473 951 911 110 23941 293 75599 5563 4899 1847 1251 1214 446 --
NM_018639chr1211101 11039 --11480
NM_018644chr1112013 --11447 11974
NM_018650chr192287 2254 1822 1767 1754 1693 1416 563 537 3499 366 304 1806 --
NM_018652chr151894 --3292 225 195 --
NM_018657chr33761 667 108 --4718 283 250 169 --
NM_018660chr843127 3032 2554 2538 --32991 956 179 --
NM_018670chr15----1246 1243
NM_018672chr174882 829 327 79 1764 1316 --
NM_018682chr71476 --2677 203 --
NM_018686chr12----2295 61 1292
NM_018688chr8----2681 241 1975
NM_018689chr1542726 2561 2496 1925 ----12677
NM_018700chr521245 344 --1285 11233
NM_018704chr12865 363 187 190 --
NM_018710chr82312 293 21256 80 ----
NM_018717chr472929 2563 2467 2415 2208 2080 908 --32589 2315 891 12702
NM_018724chr12244 165 1135 --1262
NM_018845chr1----1199 --
NM_018898chr542229 1520 786 170 32040 2002 1962 --21673 907
NM_018932chr52669 614 ----2716 699
NM_018934chr52286 150 ------
NM_018939chr51166 1250 2216 83 --
NM_018945chr643382 934 630 186 23516 3326 13438 11392
NM_018964chr2111033 2969 909 --1913
NM_018970chr753087 3055 1200 1135 936 53130 2635 2112 853 834 12894 12473
NM_018976chr1272387 922 509 436 288 252 185 32661 2315 2188 11775 11136
NM_018979chr1262390 2245 1788 1732 224 116 32622 2470 2311 21610 490 22100 261
NM_018999chr1093757 3562 3506 3410 3120 1656 1118 1083 926 13037 43871 3158 3087 1289 13003
NM_019002chr21322 ----1132
NM_019004chr742424 2299 910 888 --72111 1927 1798 829 495 425 166 11865
NM_019009chr1122546 2229 --22066 1990 --
NM_019022chr1882598 2417 1232 1217 1098 962 550 58 --63056 2896 2169 798 538 193 12221
NM_019035chr45779 500 493 178 106 2748 602 2571 245 --
NM_019040chr11----1224 --
NM_019042chr741082 934 139 120 --21191 71 --
NM_019049chr1170 --1281 1287
NM_019050chr451876 1678 505 386 353 --82144 2107 2051 1927 1559 898 851 733 1848
NM_019057chr5----1317 --
NM_019064chr17----1126 1632
NM_019071chr71242 1192 1747 --
NM_019072chr5114133 3687 3154 1706 1248 1131 986 709 548 325 183 23932 488 24200 3326 --
NM_019074chr151995 --2927 897 --
NM_019080chr1331545 1501 524 31425 1385 558 21364 983 --
NM_019083chr151588 1448 1084 654 641 --2377 347 1364
NM_019084chr1072366 2075 1885 1723 959 637 454 --31017 470 380 --
NM_019087chr541697 436 240 218 --41731 1638 466 72 1472
NM_019091chr2--1971 1168 1902
NM_019094chr12133614 3561 3425 3353 2695 1269 1157 1046 835 575 537 300 260 2876 270 32451 589 327 --
NM_019098chr871741 1652 1594 482 362 309 146 --21694 1422 --
NM_019113chr19----171 139
NM_019114chr97984 821 722 628 609 429 170 1667 12155 --
NM_019117chrX93270 2897 2495 1259 1141 983 752 675 409 12612 23018 1392 --
NM_019555chr371737 1649 1460 1387 1167 583 147 ----11565
NM_019556chrX51059 393 285 225 180 --168 21083 956
NM_019593chr2082814 2757 2560 2518 1995 1036 905 220 --32363 2305 1189 11061
NM_019605chr1----2691 65 --
NM_019852chr14------194
NM_019891chr12431 294 --2979 310 --
NM_020116chr461413 1402 1333 1162 1132 334 --1355 --
NM_020122chr2106030 3863 2241 2180 1967 1200 1011 891 855 830 45242 4327 937 417 22414 1207 25231 1060
NM_020123chr101462 --11149 1326
NM_020130chr841418 1406 366 351 2574 536 2913 577 --
NM_020137chrX----4316 311 306 301 --
NM_020143chr22408 241 --3921 249 24 --
NM_020144chr762122 2004 1934 1353 617 283 --31992 1339 664 --
NM_020148chr1852907 2613 2499 1215 799 --22845 991 194
NM_020159chr491247 1195 1146 496 450 429 398 356 329 31401 1278 1125 21682 616 --
NM_020177chr5103272 2961 2565 2505 2350 2062 1231 424 417 244 --22455 524 --
NM_020184chr252282 2001 1610 604 518 11532 52324 2223 2184 2018 941 1331
NM_020186chr72398 366 --1122 --
NM_020189chr81162 --134 --
NM_020198chr1741511 238 229 128 ------
NM_020199chr541266 386 262 248 11301 2168 37 --
NM_020205chr173499 3449 2866 2838 2822 1184 998 12209 42847 2737 2291 661 12702
NM_020211chr1511585 11543 11436 --
NM_020225chr4----1168 --
NM_020232chr18----1200 --
NM_020244chr12------181
NM_020246chr7----1365 --
NM_020307chr32350 304 --1391 --
NM_020311chr21769 ----1573
NM_020315chr221253 1955 --1959
NM_020336chr2093821 3601 2954 1490 1276 1239 902 895 878 33890 2655 840 22810 2451 12676
NM_020337chr463125 3055 2367 2092 1145 775 --32958 2889 384 12084
NM_020338chr1043677 3654 2849 1092 --33254 3092 2881 13602
NM_020342chr242075 1669 1636 301 --12085 11813
NM_020346chr1131750 618 442 --31405 1064 24 11506
NM_020347chr391993 1921 1660 1642 1558 781 632 103 84 22028 1953 1460 1868
NM_020363chrY41573 1539 684 614 --41738 699 345 235 3707 539 271
NM_020376chr11--1318 1321 --
NM_020390chr393984 3315 1859 1559 1493 1400 1263 887 518 44638 4481 1387 1125 44896 4603 4379 288 --
NM_020403chr1361694 1492 1472 656 397 251 11781 1265 1639
NM_020405chr1733671 3109 720 --13340 14493
NM_020423chr11616 1469 1472 --
NM_020429chr732954 738 127 --32966 2894 2853 --
NM_020432chr732020 1921 473 11742 71716 1598 1422 665 203 183 154 --
NM_020437chr222374 127 --1378 --
NM_020438chr941322 1279 386 137 --21328 374 --
NM_020443chr177026 6151 5768 5354 4350 2007 1218 26877 1693 86720 5469 4243 2698 2648 873 837 824 --
NM_020452chr122024 353 --2518 508 11979
NM_020456chr1362148 2141 2058 863 536 355 1226 22279 744 22211 215
NM_020463chr2----21426 1103 --
NM_020474chr1831893 1842 127 11312 32012 1331 678 --
NM_020525chr122426 388 --1529 2442 414
NM_020529chr142483 457 --159 --
NM_020533chr19--170 ----
NM_020638chr1222099 328 12090 21885 1792 21789 1785
NM_020640chr362089 1564 831 310 274 194 ----1743
NM_020647chr831636 803 769 2921 830 1833 32270 2220 662
NM_020649chr171183 1223 173 --
NM_020651chr251769 1629 1531 1455 1188 --31800 1536 418 11816
NM_020673chr20116296 4957 4780 3073 2550 2348 2330 2065 1603 1316 482 1503 57502 6453 2555 1719 1333 --
NM_020698chr1233106 2763 2537 --43068 2677 700 42 --
NM_020699chr155409 4445 2094 918 42 14818 45205 4904 1679 191 --
NM_020715chr1432271 2038 221 32094 1900 649 32160 1589 1444 --
NM_020717chrX64308 4285 3668 3138 1903 892 --24958 875 1872
NM_020718chr1696622 6479 6254 4914 2585 2543 2291 1434 1166 36464 2486 2304 76542 6467 6422 2509 2064 1688 27 34117 48 44
NM_020728chr763186 3069 2981 1206 304 86 --1762 22428 2109
NM_020734chr1272796 2644 2520 2450 2078 547 404 --23321 932 13344
NM_020738chr241652 1625 1409 1391 21431 1362 11523 --
NM_020742chrX82659 2474 2329 2085 2030 688 525 120 --12679 --
NM_020748chr1772183 2119 2101 1703 808 653 103 --2793 376 --
NM_020752chr1072848 2437 1924 955 882 788 91 --22079 2070 --
NM_020760chr2----31548 1252 771 --
NM_020770chr11344 --21310 1097 --
NM_020771chr631505 1231 278 21289 465 2946 222 11334
NM_020772chr17198616 8540 7843 7595 7526 7427 7239 6977 6186 6092 5579 5467 5451 3478 2931 1629 1400 1184 1008 36404 244 171 77555 7477 5288 3231 656 642 220 26072 5556
NM_020773chr442696 2450 1899 379 --1289 12644
NM_020774chr18186025 5995 5477 5179 5112 4589 4362 4355 3822 2477 2228 2201 2100 2069 1312 1064 1055 866 34965 1720 1137 76167 6123 6000 4649 2390 2239 1292 --
NM_020782chr12124421 4315 3786 1943 1734 1637 1503 1268 931 910 689 197 1777 44338 3825 1889 1242 24055 695
NM_020783chr1881655 957 617 561 547 474 394 190 --22237 403 --
NM_020787chr1741441 359 251 96 --51186 559 471 398 301 --
NM_020792chr372680 2630 2593 2519 2199 2188 244 21053 772 11039 --
NM_020794chr131393 1312 998 21241 967 11288 --
NM_020796chr533023 1107 406 --72179 2148 2138 1951 1944 1939 839 2948 705
NM_020800chr31929 1577 131 1408
NM_020801chr542303 2023 1622 994 1558 42554 2319 2102 920 2612 511
NM_020803chr41902 32059 1958 111 21918 694 1972
NM_020805chr18----41796 1789 1519 700 --
NM_020808chr1--2915 905 2857 335 --
NM_020809chr1162091 1560 1445 665 191 152 --11449 12134
NM_020815chr4----1149 --
NM_020820chr2021605 1238 --11124 1641
NM_020825chr1643833 3699 3076 2784 23771 3729 13097 --
NM_020834chr14----11916 --
NM_020845chr1211588 ------
NM_020856chr1941591 1029 566 103 11229 11343 --
NM_020860chr41395 1176 1266 --
NM_020870chr422189 422 --21907 316 --
NM_020871chrX92430 2341 2296 2181 1865 1611 868 781 262 22207 415 2884 41 --
NM_020872chr381803 1790 1567 714 468 392 101 37 21630 23 11757 --
NM_020873chr34702 258 222 56 --2716 263 --
NM_020890chr3--1118 2481 157 155
NM_020895chr191214 --1293 --
NM_020897chr13906 853 465 ----1841
NM_020909chr253977 3672 3660 2972 93 13071 44074 3969 3137 2872 --
NM_020917chr1993536 2793 2716 1279 1088 971 264 230 220 1345 22809 161 --
NM_020919chr211230 2119 32 --1267
NM_020921chr1433699 2275 126 23505 2582 73073 2800 1025 992 988 399 221 22797 1111
NM_020925chr12554 540 --1966 --
NM_020927chr1631721 1537 621 12313 1117 12023
NM_020929chr11152 ----1137
NM_020935chr2114672 4479 4024 3919 3872 3797 3370 3057 1460 850 643 --54561 3825 3215 2990 244 34066 1222 1218
NM_020937chr141238 --183 2137 107
NM_020944chr9--1186 1189 --
NM_020958chr14----1341 --
NM_020959chr19--1222 2240 225 --
NM_020962chr1542283 2238 1667 397 --32382 2378 1891 --
NM_020964chr1863962 2969 1549 1139 992 237 --64703 4595 4545 4225 1924 1812 --
NM_020971chr191251 --1583 --
NM_020972chr4----21077 934 --
NM_021012chr1723154 3120 ----32431 2427 2423
NM_021020chr823413 1235 --23469 1392 13525
NM_021021chr8------1808
NM_021025chr5------2514 500
NM_021033chr1353524 3418 1313 1064 201 --22588 387 23543 3251
NM_021038chr373334 2911 2501 1028 922 699 268 --43306 2211 2151 429 --
NM_021044chr12--1282 2274 269 --
NM_021072chr552273 2097 890 794 66 1283 52604 2203 2065 665 286 --
NM_021078chr17----1531 --
NM_021083chrX103418 3331 3128 2476 2408 2297 1219 1187 927 36 12620 33134 1392 1026 12771
NM_021097chr2102878 2583 2554 2022 967 757 570 494 350 87 --62883 2505 2399 2254 980 341 --
NM_021106chr91774 ------
NM_021114chr4------1251
NM_021116chr768975 7467 7371 5983 5904 2397 39088 3515 3444 48987 3447 3413 2798 --
NM_021127chr18----41227 1203 1159 230 21415 1224
NM_021145chr751090 1073 1036 822 782 --11182 11042
NM_021146chr11289 --2804 307 2759 341
NM_021147chr5----1163 2221 160
NM_021148chr772418 2187 1882 1826 1715 1705 1589 11697 21841 279 22503 2499
NM_021167chr762769 2185 2178 2014 596 262 21922 1054 22296 1057 --
NM_021183chrX52429 2325 2252 350 241 11840 1993 --
NM_021191chr1231750 1706 782 32062 2048 1724 22144 2074 22066 334
NM_021201chr1121324 349 1155 12049 --
NM_021222chr141077 479 427 403 1225 21442 251 --
NM_021238chr1241839 1600 676 308 --11309 21930 1926
NM_021239chr141327 21332 1066 21129 76 1912
NM_021249chr1431481 1378 488 1332 31042 295 52 --
NM_021255chr14103322 3213 2982 2856 2801 2633 711 363 93 29 --54057 3188 1633 856 562 11351
NM_021260chr141914 --21075 243 --
NM_021268chr93253 235 47 ----1228
NM_021619chr921316 1240 ----11204
NM_021627chr31311 --2914 445 --
NM_021629chr344846 3848 1581 234 1119 64877 4721 4666 4448 2042 1008 --
NM_021637chrX21125 1110 --21368 94 191
NM_021639chr13774 661 184 1676 ----
NM_021649chr531895 1249 344 --31398 1204 731 --
NM_021784chr20------1590
NM_021785chrX297 84 ------
NM_021804chrX----1190 --
NM_021813chr685648 5610 5582 4867 3675 2136 1594 531 1654 43577 1970 698 572 15827
NM_021814chr61667 --1675 --
NM_021815chr222084 554 --32858 802 796 1622
NM_021914chr1422245 1997 1393 22281 1845 1151
NM_021931chr20----31095 1033 1005 --
NM_021935chr331063 232 167 --31044 870 134 --
NM_021938chr19----171 1338
NM_021954chr1322968 777 11111 23149 762 --
NM_021960chr162813 2173 1810 941 601 588 12199 12603 --
NM_021961chr11177343 6548 6437 6382 6268 6202 5682 5433 4761 2683 2535 2107 1545 931 664 560 507 1809 47527 7194 2619 1147 --
NM_021964chr3116399 6220 6136 5816 4938 4720 4612 4350 4312 1697 1323 12549 65091 4726 4702 2106 1783 1173 11710
NM_021970chr43528 89 31 1203 ----
NM_021973chr4------1135
NM_021977chr683533 3263 2584 2494 2378 1396 1344 737 1707 ----
NM_021978chr11----1532 --
NM_021979chr14----1354 --
NM_021992chrX----1364 --
NM_021998chrX31526 1480 592 --21365 300 --
NM_021999chr132304 79 1331 1286 --
NM_022037chr22881 80 --1747 1121
NM_022048chr1586360 5671 5551 4740 4688 4454 4254 1568 15684 46232 5687 5023 409 --
NM_022049chr151805 1470 1460 658 587 --21224 321 --
NM_022051chr1----1541 --
NM_022058chr232095 823 519 190 2844 112 --
NM_022075chr1------1746
NM_022080chr2042633 953 825 496 22413 911 22022 49 12541
NM_022091chr642228 1815 1742 931 --2981 894 22706 2053
NM_022095chr20----1232 --
NM_022100chr11188 1494 --1664
NM_022114chr134440 4126 1451 --21712 1456 --
NM_022117chrX1171 --1140 --
NM_022121chr641187 813 364 188 --3937 473 182 --
NM_022130chr541311 1241 1233 491 --31458 1217 915 11025
NM_022133chr841903 1350 529 199 31829 1598 1190 21193 722 --
NM_022143chr721468 474 ------
NM_022162chr1621116 157 --1766 --
NM_022164chr1----1667 --
NM_022165chr19------170
NM_022166chr1665711 5139 4877 2447 1676 273 21591 1210 26153 5521 26205 6004
NM_022336chr252372 2157 1558 749 597 ----12379
NM_022338chr11----1189 --
NM_022351chr893584 3548 2983 2726 1137 676 457 158 78 155 11259 13857
NM_022361chr62541 143 1455 1458 --
NM_022367chr11731 --1725 --
NM_022373chr72711 301 1763 ----
NM_022444chr781955 1917 1883 1820 1765 1721 1603 360 21709 1619 1661 11713
NM_022459chr13136172 6127 6009 5911 5420 5171 4844 4469 2466 2117 1138 1030 359 15401 55120 4785 2451 2436 1814 25101 4616
NM_022461chr381347 1309 1288 1165 1042 959 933 41 171 ----
NM_022475chr46687 595 574 532 114 50 --3750 745 44 1701
NM_022482chr203678 217 157 --41946 1747 849 721 12495
NM_022483chr531408 639 231 21632 106 2504 267 --
NM_022484chr731409 906 338 1297 31078 130 86 --
NM_022491chr1283104 2217 1323 845 720 352 344 181 1704 43344 285 277 50 --
NM_022495chr14----2485 44 --
NM_022496chr12188 1399 2449 379 --
NM_022552chr2----1296 --
NM_022566chr15----1616 --
NM_022658chr1251269 1135 1077 1003 162 --31277 388 190 --
NM_022726chr641559 642 399 379 31145 405 291 1193 1179
NM_022739chr173916 898 482 --1796 --
NM_022753chr192832 2770 2555 2424 1940 1839 906 764 682 --2487 106 1125
NM_022755chr912459 --22524 2492 --
NM_022757chr321034 279 --2735 250 --
NM_022763chr372783 2571 2511 2063 956 529 57 22166 542 22493 796 --
NM_022766chr2272679 2545 1743 947 917 910 146 --1105 --
NM_022771chr123852 710 168 --3928 771 246 --
NM_022776chr331375 1245 267 --11055 11052
NM_022780chr241861 738 358 194 --31312 499 409 --
NM_022781chr963024 2990 2449 2206 820 745 21233 573 23284 2587 --
NM_022817chr231949 744 421 1266 32334 522 446 --
NM_022824chr551848 1454 1375 313 279 --21427 781 --
NM_022826chr22431 45 --1934 --
NM_022832chr441968 1940 813 718 12080 2773 184 --
NM_022840chr1851344 1325 1262 1007 908 11430 179 --
NM_022841chr1592746 2682 2464 2423 2264 2120 820 386 243 12365 2291 58 --
NM_022842chr353327 3082 3050 2464 434 2464 442 1445 --
NM_022843chr1351434 1242 1206 1042 543 --11121 1332
NM_022893chr2113184 3176 3146 3077 2961 2917 2645 2428 2034 1280 699 --53029 3013 2936 1011 521 13042
NM_022894chr251312 1177 1106 576 440 --1383 11090
NM_022898chr14144711 4700 4640 4591 4509 3772 3417 3037 2927 581 540 283 276 235 --54564 3747 3645 3639 1298 13592
NM_022900chr72899 828 --11064 11061
NM_022912chr21982 --3414 243 222 --
NM_023004chr22----1246 --
NM_023016chr282840 2735 2653 2542 2298 2019 871 614 1885 42010 1063 39 35 1759
NM_023034chr8----1397 1394
NM_023072chr1911050 --11125 --
NM_023076chr1652998 2862 2084 1888 511 --12152 1585
NM_023927chr531219 985 915 --1521 11086
NM_024007chr542535 1224 646 241 1626 32594 629 315 --
NM_024014chr7----1156 --
NM_024015chr1721018 1001 ----1175
NM_024019chr421062 1005 1874 1877 --
NM_024028chr51357 --1245 1242
NM_024029chr19----1146 --
NM_024036chr11198 ----1255
NM_024050chr19----2580 160 1178
NM_024063chr15----1167 --
NM_024077chr9--1793 2796 637 --
NM_024089chr13----1207 --
NM_024297chr17----1387 --
NM_024315chr7----1333 --
NM_024329chr111579 --21360 1306 --
NM_024345chr9155677 5443 4709 4472 4277 4160 4006 3992 3824 2413 1970 1472 913 805 655 24410 1897 25504 2126 26085 537
NM_024420chr11393 ----1423
NM_024430chr1811288 11780 21872 720 --
NM_024490chr15161 153 1152 --
NM_024496chr143778 714 160 --2550 284 --
NM_024511chr42283 26 22473 1365 22663 142 145
NM_024512chr383432 3364 3151 2645 2500 1294 723 282 13546 33284 2611 2549 --
NM_024513chr343784 3694 2513 1476 23710 1198 33821 2392 659 --
NM_024519chr16------1282
NM_024524chr352318 2273 2155 868 128 --22703 651 12359
NM_024529chr14958 896 107 54 --1738 --
NM_024539chrX----21080 346 --
NM_024546chr134492 395 242 32 2437 354 1201 1512
NM_024551chr1221711 1688 --1318 --
NM_024554chr11708 --1685 --
NM_024561chr1371417 1272 336 328 284 195 138 ----11309
NM_024563chr541732 1684 1261 444 11362 11803 1270
NM_024586chr1----1571 --
NM_024590chr441940 1490 795 45 --41900 1874 742 234 --
NM_024594chr541670 1633 1395 80 11567 1266 --
NM_024612chr1741016 837 382 71 --21028 456 --
NM_024613chr831854 1325 257 --21262 246 --
NM_024617chr91786 1186 --1909
NM_024624chr211345 ------
NM_024638chr312393 199 1487 12299
NM_024639chr632600 2087 1896 21137 40 32301 979 532 --
NM_024645chr81337 --11577 --
NM_024646chr164015 3546 3275 3037 1155 213 --21278 169 --
NM_024653chr7------1317
NM_024666chr1521140 460 ----11789
NM_024667chr1221448 374 --1379 1348
NM_024674chr1--11145 23129 612 1609
NM_024675chr16----1287 --
NM_024692chr281604 1587 1542 1287 517 446 407 112 --21731 1163 180
NM_024699chr82890 116 --165 --
NM_024700chr13868 813 801 ----1382
NM_024702chr171553 --1508 --
NM_024721chr852627 1853 1808 1656 503 12369 22588 1928 --
NM_024725chr112207 139 --2711 185 3708 678 98
NM_024745chr164458 230 111 90 --1138 --
NM_024749chr142246 1893 1419 89 --21968 110 11776
NM_024806chr11--1212 1215 --
NM_024816chr16----1498 --
NM_024817chr1545517 5060 4146 881 15153 35864 2305 1579 25194 571
NM_024828chr941508 1175 545 95 1411 3315 159 76 11104
NM_024830chr5------1624
NM_024884chr1464616 3863 2924 1591 1323 592 44261 1784 1447 865 2927 900 21788 924
NM_024893chr201154 --2364 144 --
NM_024899chr184688 639 499 87 ----1449
NM_024900chr432316 1860 797 --31909 1903 1638 --
NM_024927chr17--1207 1167 --
NM_024939chr16----11663 11559
NM_024944chr2131217 212 164 1351 2449 324 --
NM_024945chr931139 956 118 --41151 902 885 796 1980
NM_024947chr3158848 8034 7890 7406 7168 6598 3455 3093 2956 2859 2225 2037 1764 1121 310 --69067 7666 6418 2332 1728 1505 59568 6280 2534 653 521
NM_024949chr494990 4760 3467 3396 1420 1157 1008 582 23 23096 1941 41911 1508 783 135 43559 1929 1925 1814
NM_024953chr1242740 2727 2045 858 --32653 2493 627 --
NM_024969chr2--139 ----
NM_024989chr2197788 7426 7276 7228 6864 6826 6635 6329 6123 6117 5801 5747 1930 1820 1636 550 404 341 291 47387 2944 2923 2569 47117 1440 1435 1150 --
NM_025004chr112703 227 --1621 --
NM_025009chr42341 257 --31908 1824 1771 1139
NM_025010chr312126 --21972 959 12816
NM_025047chr31120 --1171 --
NM_025049chr15----1635 --
NM_025054chr894239 4092 2945 2768 1579 1358 1113 707 35 1485 83279 3255 1610 1597 1141 960 835 448 --
NM_025057chr14--1419 11006 --
NM_025069chr8------1152
NM_025077chr1----1203 --
NM_025090chr1711225 --21345 1319 --
NM_025106chr121624 611 --21492 1446 1641
NM_025109chr171408 ----1456
NM_025134chr1662582 2576 2527 1958 1882 118 ------
NM_025146chr342510 2339 2317 207 12051 11787 --
NM_025147chr221090 178 --11199 11017
NM_025152chr1442012 1985 1525 665 11283 31277 247 112 --
NM_025154chr71968 11121 11425 --
NM_025160chr143505 3184 3099 893 1490 23067 316 1385
NM_025179chr144780 4550 4151 1219 ----3863 770 361
NM_025181chr2----1337 --
NM_025182chr93360 334 139 --1343 1340
NM_025191chr143411 2794 1387 310 --11401 21398 622
NM_025196chr41580 --2803 510 1776
NM_025208chr1172473 2405 2347 2202 2173 1724 768 --1428 12111
NM_025216chr2----1495 --
NM_025235chr1041954 1847 1516 244 21783 1657 42144 1505 1412 633 21960 438
NM_025237chr17--11496 11478 --
NM_025251chr8----1792 11089
NM_030579chr1653440 3275 2663 2406 996 13551 63673 2946 2299 1381 1220 394 1593
NM_030621chr14104082 3686 3607 3578 3222 1268 886 742 506 227 21070 62 53913 3706 3246 3066 1687 --
NM_030623chr271669 1605 1264 1141 697 586 39 11715 11241 --
NM_030625chr1062228 2027 1920 866 717 448 1678 12141 --
NM_030627chr5113962 3927 3570 3409 3145 1528 1371 916 817 387 233 43849 2906 2610 801 63684 3612 1478 1269 727 496 1805
NM_030629chr1631548 1519 707 1593 21640 1376 --
NM_030637chr141550 --2633 569 1147
NM_030645chr1------11428
NM_030647chr775359 5023 4678 1946 1832 576 460 11119 166084 5364 5281 4868 4795 2529 2243 2213 2063 1600 1562 1372 1233 609 395 274 1338
NM_030648chr485298 5242 5226 4442 4184 3567 673 449 --43898 3813 1364 64 --
NM_030650chr2113555 3189 2838 2645 1585 1392 1367 1234 987 820 261 1765 73932 3482 3369 3209 1620 1254 657 --
NM_030661chr7--1581 21619 236 1535
NM_030751chr1081705 1385 1253 1216 1169 474 438 397 --21258 365 11402
NM_030755chr1472941 2606 2432 2246 1045 443 346 23061 1977 32956 928 693 --
NM_030758chr221500 --1970 --
NM_030759chr104776 683 313 304 ------
NM_030763chrX3932 800 77 ----1179
NM_030773chr201259 --21838 713 --
NM_030774chr1161536 1105 363 71 54 27 11444 31570 1451 1259 --
NM_030777chr2082508 2354 2347 2192 1855 1675 782 748 12288 52387 2176 2079 738 618 --
NM_030780chr831290 527 281 --3503 487 482 41378 1078 500 496
NM_030791chr1461823 1280 1261 1200 733 152 1121 1685 1468
NM_030799chr572029 1950 1886 1747 1591 845 314 --32036 1791 1773 --
NM_030806chr1119417 9304 8715 8160 3449 3433 3418 2637 1818 1427 779 --36558 2494 1217 28725 8450
NM_030809chr1262437 2373 1735 108 51 42 1690 --157
NM_030816chr153622 2680 1130 1094 910 43493 3456 2720 1186 1197 --
NM_030817chr1253790 2797 809 310 256 --33183 2970 1449 31505 1446 1401
NM_030820chr61915 --1120 --
NM_030821chr43195 108 91 ------
NM_030885chr351865 1705 1551 661 324 21645 288 21845 301 11834
NM_030913chr1------1158
NM_030918chr175470 4415 4190 3374 2074 1090 715 1104 45313 5263 1523 481 13886
NM_030920chr141821 699 515 421 21940 349 2736 643 1241
NM_030945chr542667 2657 1917 235 --22480 2445 22630 2341
NM_030949chr61162 --21411 476 11501
NM_030952chr11524 1857 31136 536 530 3551 547 543
NM_030962chr1121448 420 --11622 --
NM_030963chr61664 ----1176
NM_030965chr11592 ----1527
NM_030978chr9----1142 --
NM_031271chr861622 1077 655 622 392 205 --21639 1362 --
NM_031283chr2181 --1888 --
NM_031296chr4102311 2292 2202 2129 761 747 569 310 161 121 125 42543 2378 2238 1963 --
NM_031372chr43529 181 97 11270 1234 --
NM_031427chr1475999 5961 3775 1156 1081 878 593 55934 5622 3919 74 33 64944 4839 3850 3755 2142 241 14836
NM_031431chr1341832 1749 1661 454 1469 11676 --
NM_031435chr1273037 2994 2772 2517 2288 2253 1297 188 73327 2686 1364 1025 1001 265 173 23080 2269
NM_031438chr521855 1230 130 21500 269 11462
NM_031442chrX63124 3091 3031 2873 2118 457 22705 973 --12469
NM_031445chr2113249 3135 3026 2919 2790 2455 2192 1184 485 295 209 --72225 2220 2215 2210 2197 2168 1123 --
NM_031469chr634087 2614 793 --54102 2932 2765 1386 698 1835
NM_031476chr1642722 2634 2367 717 1472 32403 67 61 --
NM_031478chr16--1495 1498 2508 504
NM_031480chr61235 ----1224
NM_031483chr20113182 2877 2551 1412 997 591 270 253 110 52 40 13365 1148 --
NM_031882chr5----1178 --
NM_031911chr462676 2657 2290 2121 995 135 2493 356 11077 --
NM_031918chr19--1755 1758 --
NM_031935chr121010 217 --1782 1223
NM_031942chr211247 --11217 1321
NM_031948chr161158 ----1164
NM_031953chr42436 374 --2446 106 --
NM_032016chr73684 626 122 --1522 1146
NM_032017chr1----21696 559 --
NM_032021chr1111155 --31095 1074 45 --
NM_032042chr531803 1014 156 --22581 1782 --
NM_032047chr321809 858 21964 173 21967 414 --
NM_032102chr1193027 2546 2499 1254 1183 1175 1013 727 206 --63084 1199 1064 946 280 274 1467
NM_032109chr511483 ----11431
NM_032128chr41276 --1367 --
NM_032144chr231130 611 72 147 21819 227 --
NM_032146chr31340 1182 1329 --
NM_032160chr18114329 3984 2903 2836 2758 1019 752 724 709 467 81 34282 4163 3965 51163 1158 929 230 186 1313
NM_032181chr21773 --1671 --
NM_032182chr101535 11690 31620 1556 1491 11065
NM_032199chr1083651 3455 3139 2926 2625 1523 756 651 23102 1005 13312 13106
NM_032208chr263424 2740 1372 1338 1243 904 12510 1324 --
NM_032221chr2051938 1518 1448 673 502 21494 197 --21875 1498
NM_032228chr11113502 3344 2932 2816 2735 2305 2204 1358 1171 907 88 22583 2270 43543 3432 3398 400 22859 1118
NM_032229chr1331091 945 183 --31052 950 847 --
NM_032246chr151954 --21279 1192 --
NM_032283chr11497 --1123 11826
NM_032289chr51314 21876 1556 11879 11213
NM_032299chr11----1240 --
NM_032305chr1162 --2398 152 --
NM_032307chr931085 794 748 --31072 802 419 1893
NM_032320chr113650 584 534 --1523 1694
NM_032352chr1441233 901 366 187 1505 2336 305 --
NM_032373chr10165547 4976 4822 4446 4214 3740 2362 2211 1917 1853 1639 1164 882 447 392 229 2867 132 35781 3667 1123 35224 2186 2067
NM_032410chr85901 867 361 205 91 --1185 11170
NM_032435chr151713 1548 710 411 317 22396 2245 52248 2080 2052 966 848 --
NM_032439chr1041534 1439 243 75 2498 489 31481 1318 564 --
NM_032440chr10112858 2623 2429 2358 2285 2170 2026 1910 978 799 424 ----1625
NM_032446chr5103588 3478 3119 3000 2924 1228 1045 818 652 491 13043 1848 --
NM_032449chr122457 810 --11795 21005 1001
NM_032457chr4113780 3770 3287 2999 2921 2764 2503 1386 1240 668 489 11411 53918 3007 2775 2559 1011 --
NM_032458chrX63412 2875 2687 1379 317 214 11323 33375 3040 1250 11286
NM_032466chr831636 1281 1102 11047 21060 669 1666
NM_032471chr611004 --21104 1065 1311
NM_032499chr1541754 686 387 299 --41735 1685 1348 712 --
NM_032505chr372603 2482 2086 1802 1752 1021 54 --32546 1918 1779 --
NM_032521chr2053220 3150 2895 2044 1972 12139 42736 2687 463 249 --
NM_032539chrX1184 ----1789
NM_032552chr91269 ----11975
NM_032557chr41159 --2143 91 1348
NM_032581chr741873 687 246 191 2298 157 1751 --
NM_032582chr1761802 1510 1351 1335 449 105 31586 1269 406 51272 1170 567 536 181 11707
NM_032590chr12----174 --
NM_032622chr43549 528 460 --31321 1263 71 --
NM_032632chr1441810 1261 771 51 --11252 1670
NM_032638chr321519 1392 --31466 1452 340 --
NM_032663chr121658 --31948 694 378 1349
NM_032673chr2----174 --
NM_032682chr353611 3471 3121 3000 728 --33043 2305 2275 13242
NM_032701chr19----1647 --
NM_032758chr221612 --1674 --
NM_032772chr10--2550 371 ----
NM_032804chr1052525 1807 1745 828 726 --2620 381 1964
NM_032833chr12547 323 --52538 2054 860 612 475 --
NM_032842chr741360 1292 685 268 --21565 1142 1691
NM_032844chr101245 1104 1237 1234
NM_032846chr1421013 25 --31167 1067 956 --
NM_032852chr1----185 --
NM_032859chr1393832 3721 3461 3108 2542 1012 910 532 462 11143 23846 3418 --
NM_032864chr121492 308 --1136 --
NM_032869chr872024 1355 659 518 511 329 255 --1124 --
NM_032873chr1184303 3694 3398 3317 3179 937 860 240 --34381 3151 431 11253
NM_032876chr1441497 1419 803 765 11567 11900 --
NM_032885chr19----139 148
NM_032892chr152317 224 --1345 --
NM_032900chr1083893 3848 3776 3354 1208 1146 825 628 13438 2558 468 --
NM_032905chr1031294 961 235 --21279 154 11251
NM_032918chr122962 817 1491 31286 1155 523 --
NM_032961chr42404 83 --11111 --
NM_032968chrX113656 3597 3590 3577 3307 2735 1409 1377 1370 386 300 13189 --13551
NM_032973chrY123648 3593 3586 3573 3302 2730 1409 1389 1377 1370 386 300 13184 --13547
NM_033027chr331063 899 800 --41197 460 447 161 1158
NM_033030chr25549 511 384 344 276 2567 205 2395 325 1531
NM_033055chr14888 252 215 106 1980 --1871
NM_033056chr10195 --3704 618 240 --
NM_033083chr363410 3296 3108 3099 3026 2290 --33308 2934 500 --
NM_033102chr131249 1159 506 11295 --11299
NM_033103chr19--1231 21296 1178 --
NM_033114chr125753 339 316 257 173 1732 2296 147 --
NM_033132chr1392251 2162 1894 1570 1454 692 650 375 133 --31996 1592 892 32180 2124 1702
NM_033161chr941577 655 433 395 --1145 --
NM_033211chr551912 1799 1504 1281 798 11767 41323 711 608 482 --
NM_033215chrX1328 --1364 --
NM_033224chr7157687 7118 7021 6394 6288 6211 5950 5577 2487 1805 1758 1742 1721 1225 260 --17174 --
NM_033225chr833135 942 748 32448 705 126 31151 1063 860 --
NM_033254chr3----191 --
NM_033260chr65810 748 623 322 308 1568 3753 736 279 --
NM_033274chr573632 3208 3201 3168 2577 2193 1274 --33486 2662 1003 --
NM_033285chr883459 3220 702 417 392 225 122 84 12879 43467 2882 2821 355 23618 3087
NM_033389chr17114803 4673 3298 2943 1242 1151 651 622 270 212 82 --34892 1100 994 1224
NM_033394chr231501 607 90 11551 31554 1330 1130 --
NM_033397chr102816 223 22240 1958 --11962
NM_033407chr14552 434 207 21 1258 ----
NM_033426chr1452773 2757 2738 2167 996 --32785 1068 946 12877
NM_033450chr6----1282 --
NM_033495chrX3887 311 148 2996 255 21065 906 --
NM_033502chr6------1168
NM_033505chr296563 6140 5412 4837 4487 2131 1825 971 591 26742 4099 106014 6009 4824 2251 2056 1254 1205 913 319 188 --
NM_033512chr863029 2519 2360 2138 1116 307 1262 42216 1239 757 542 --
NM_033515chr621018 995 ----11380
NM_033540chr321057 69 --1852 1413
NM_033549chr52686 379 --11025 --
NM_033631chr153438 3393 2549 1420 22 --12599 --
NM_033656chr21205772 5622 5535 5432 5249 5065 4787 4420 4029 3895 3711 2098 1220 1199 1117 682 359 347 154 75 41615 1481 1366 1011 2160 83 23639 1909
NM_052832chr8132973 2943 2557 2344 2325 2072 1973 1883 1004 349 288 210 30 --62621 2538 2247 303 275 270 1924
NM_052847chr19----13685 1546
NM_052864chr462233 2043 1475 517 297 209 21854 668 --1601
NM_052876chr19----1987 --
NM_052879chr1243964 3129 3041 1196 11406 83831 3737 3674 3093 2643 2521 1495 1089 12640
NM_052885chr12134891 4746 4346 4172 4080 3657 3521 3029 1984 1153 1103 989 474 21140 30 54569 4314 3532 1250 1188 13444
NM_052886chr83640 175 80 31566 594 44 42146 239 203 151 --
NM_052897chr121321 --1308 --
NM_052900chr841622 1177 1119 279 11610 1236 21297 514
NM_052905chr271766 1462 1216 1180 712 655 264 --11637 21811 488
NM_052906chr22--15106 14970 --
NM_052910chr1332201 1480 682 12171 52174 867 862 857 838 1743
NM_052911chr182198 90 2922 246 --1236
NM_052913chr62282 240 --2721 207 --
NM_052925chr191846 --2187 98 1838
NM_052927chr572243 1632 1590 843 836 635 387 --32128 1875 680 1864
NM_052934chr122221 1669 ----12247
NM_052937chr852732 2140 1894 1684 87 --62408 2246 1871 1805 989 977 22198 417
NM_052953chr3----1278 --
NM_052954chr2121941 397 22216 730 11762 1734
NM_052958chr83660 547 110 ----179
NM_052964chr4----174 --
NM_052965chr151056 529 320 299 29 1219 31332 1313 77 --
NM_053002chr331115 825 469 --2988 396 --
NM_053023chr1173328 2220 1260 935 573 456 212 1854 23120 2237 --
NM_053025chr341718 1547 1430 498 --31567 1448 303 --
NM_053042chr452722 2144 2066 42 31 --42262 2081 1952 1232 --
NM_053064chr1452652 1977 995 649 387 12491 22875 2452 --
NM_054111chr6----1831 1828
NM_057175chr462671 2460 2082 1827 145 61 --42208 2053 2049 358 --
NM_057749chr841221 1046 337 180 --41353 1285 1169 316 2894 520
NM_058164chr19------1419
NM_058237chr141722 --4802 684 668 323 1729
NM_080546chr971874 1411 602 436 391 277 196 --1734 1347
NM_080617chr2061049 879 833 792 171 97 11084 2991 319 --
NM_080650chr1571192 1165 874 459 307 158 109 --3469 267 89 1415
NM_080651chr8--185 298 88 --
NM_080654chr1151274 1254 1123 1075 67 11353 --11180
NM_080678chr22614 231 --146 1556
NM_080723chr63437 292 29 1930 1361 1380
NM_080737chrX21002 517 --2339 264 --
NM_080743chr682595 2550 2514 2391 2035 888 804 583 --11600 31899 237 205
NM_080829chr20----11056 --
NM_080862chr321329 959 --1946 11028
NM_080867chr14124745 4184 3440 3210 2020 1979 1892 1858 1698 1658 1017 723 --45021 4417 603 57 24859 4368
NM_080872chr8104066 3926 3442 3374 3313 3306 3241 2874 1377 1363 21017 954 24024 3319 --
NM_080923chr12799 86 --126 --
NM_080927chr3103354 3231 2745 2639 2439 1358 1012 941 513 308 12854 1858 12698
NM_130446chr343996 3979 1567 289 ----14351
NM_130468chr15------1731
NM_130809chr593059 2758 932 886 767 627 576 334 111 --22144 695 11033
NM_130898chr1----1230 --
NM_133264chr1732731 2704 2599 --42881 2387 1334 548 --
NM_133265chrX63237 2753 1045 345 131 64 --33422 907 612 --
NM_133329chr251781 1610 1396 1335 292 11768 31821 667 589 1237
NM_133334chr4136135 5447 5380 5171 4699 4347 4262 4222 4182 2058 1054 723 548 13864 36319 2490 892 53880 3876 3872 3868 3857
NM_133452chr19----1444 --
NM_133468chr771748 1020 944 782 632 591 338 22087 1718 --1456
NM_133473chr1961892 1339 1206 706 637 172 --11275 11878
NM_133493chr6134656 4627 4494 4259 3901 3580 3494 3428 3406 3341 2983 1461 1272 11042 44351 3776 3322 1140 --
NM_133496chr184409 3924 3898 3368 1502 1118 1067 279 --74096 3318 1127 686 679 667 288 --
NM_133638chr51579 148 1123 --
NM_133646chr275329 5178 4166 3583 1428 1331 349 15139 64726 4261 1775 341 165 63 --
NM_138288chr1431731 682 494 --31943 521 178 1218
NM_138333chr952646 1786 502 421 75 ----1314
NM_138335chr43794 654 219 --1897 1661
NM_138340chr181628 --2216 28 --
NM_138355chr17----1150 --
NM_138357chr1071659 1645 1191 1154 727 625 217 --21622 469 --
NM_138370chr2----1779 --
NM_138376chr141366 --3427 421 405 --
NM_138390chr242008 1542 1343 72 ----31357 1353 248
NM_138395chr241155 474 300 47 --262 55 --
NM_138400chr763265 2726 1230 282 158 112 --13462 --
NM_138423chr1552011 1429 294 280 61 --21444 889 --
NM_138426chr772363 2100 1789 1749 760 623 361 12517 22207 1612 --
NM_138444chr1394640 4607 4161 3711 3687 3555 1949 1391 85 --23884 1293 --
NM_138468chr2106026 5974 4229 4032 2002 1895 1751 1314 976 335 34086 1725 1000 14235 15648
NM_138473chr1285074 4331 4284 4201 1626 1454 586 533 --65093 4833 4064 3797 3325 672 --
NM_138694chr673214 2659 2365 2331 2271 839 450 22284 254 23011 558 12724
NM_138731chr14134134 3962 3638 3474 3348 1698 1649 1597 1364 1284 869 737 250 54011 3231 1241 392 191 53700 3427 3247 980 842 --
NM_138770chr21181 --2264 167 --
NM_138771chr741586 1381 1261 179 ----21202 353
NM_138779chr13----1235 --
NM_138782chr541952 283 232 58 12302 21556 735 --
NM_138805chr3----1319 --
NM_138927chr21--1884 21072 1016 --
NM_138959chr1106728 6281 6266 5638 5602 5473 4265 394 217 24 --66011 5644 5545 2439 2150 157 15320
NM_139126chr63870 208 102 147 1625 --
NM_139177chr17----11535 --
NM_139265chr1541109 751 450 384 1456 2464 459 --
NM_139283chr1242062 983 849 696 12241 11930 21713 1590
NM_139318chr14------1237
NM_139321chr2053452 3006 1023 505 481 13962 --12971
NM_144567chr152709 2493 2413 2223 222 --132715 1730 1722 1141 1124 1095 755 750 745 739 454 305 89 2736 732
NM_144571chr4156674 6215 6150 5931 5473 5421 5266 2760 2343 1852 1638 1379 1189 1156 683 24565 1575 56663 6179 2426 2136 1603 1741
NM_144574chr141538 --1461 --
NM_144578chr14125270 4937 4754 4179 3885 3782 3576 3408 1971 729 582 366 34656 1438 1138 44077 1558 617 228 --
NM_144579chr21359 --42242 2135 353 347 --
NM_144590chr1052042 1845 1026 969 448 --1934 21031 159
NM_144599chr15155541 5506 5351 5271 4110 3489 3380 2128 2102 2036 1304 1244 858 668 403 24389 311 35159 1736 1249 --
NM_144600chr16--159 126 11266
NM_144604chr16182 --1521 --
NM_144629chr211153 1389 2859 766 11065
NM_144631chr21278 ----1270
NM_144633chr341439 1407 538 319 --11491 1566
NM_144635chr311274 --11248 --
NM_144642chr32478 432 --11014 1957
NM_144664chr1172214 2200 1929 1677 611 512 215 12418 21760 996 1706
NM_144677chr1711531 --11508 --
NM_144721chr442806 1975 1106 1069 11877 22786 1880 1993
NM_144722chr55910 839 434 226 60 1168 11321 1270
NM_144726chr5----21191 1186 11117
NM_144775chr1784631 4612 4515 4321 3820 3162 1933 1369 --34827 3782 500 --
NM_144778chr1342394 2053 754 320 --11706 22323 2319
NM_144963chr842218 2179 1705 344 --2802 754 11711
NM_144979chr42567 120 --178 --
NM_144982chr122574 51 --2310 284 --
NM_145000chr51235 --1470 1256
NM_145011chr1031525 491 182 12256 22108 166 --
NM_145025chr671167 1129 1121 1111 1082 454 185 --21033 98 --
NM_145037chr32385 194 --11116 1606
NM_145175chr211131 --21459 1180 --
NM_145176chr653448 2910 2361 581 372 23315 804 23412 2776 33365 1335 751
NM_145185chr1941580 680 670 437 --21747 1731 11738
NM_145203chr133682 617 256 --3978 344 138 --
NM_145235chr10------2108 104
NM_145243chr1----1159 --
NM_145244chr431682 1207 26 --11181 11776
NM_145246chr1021116 342 1224 4347 240 117 90 --
NM_145251chr1431143 1105 253 --2575 325 --
NM_145259chr2127008 6878 6846 6601 5954 5143 2479 2447 1627 1005 854 817 24826 2300 86949 5910 5273 4877 2813 2144 319 214 56852 6102 2357 2304 247
NM_145263chr472381 2292 1948 1558 1476 852 597 --32242 2101 198 --
NM_145279chr121908 1898 --11872 --
NM_145284chrX31972 523 413 22173 861 62297 1957 1769 1732 495 450 --
NM_145291chr4--1399 1413 --
NM_145305chrX--11073 11400 --
NM_145307chr10124325 4264 4238 3399 3104 3056 3041 1739 1637 1399 422 264 1814 34493 4338 3772 --
NM_145313chr101143 --31571 292 187 --
NM_145647chr8--2142 74 --178
NM_145659chr16------2217 190
NM_145735chr1372103 978 951 604 408 282 81 11105 22672 2441 --
NM_145808chr742726 2116 871 331 22582 2287 1896 1684
NM_145891chr1631225 542 420 --31390 425 150 --
NM_147156chr1051554 1335 991 361 98 ------
NM_147161chr1----193 --
NM_147166chr73825 220 24 ----2559 237
NM_147189chr892265 2074 1683 1554 1541 1466 898 754 350 12058 31982 1800 1689 --
NM_147202chr9----12649 --
NM_148894chr451111 972 950 863 445 --61185 1069 483 473 427 197 1424
NM_148957chr1342540 2159 585 356 --12684 --
NM_152261chr121584 21885 485 62132 2061 2045 1784 212 101 --
NM_152265chr11359 --31555 1458 1237 --
NM_152272chr81412 168 41369 500 308 127 --
NM_152275chr221988 917 --31975 92 61 11756
NM_152277chr531867 1652 539 1636 32002 1997 262 --
NM_152285chr9----1217 --
NM_152292chr472289 1732 1646 1576 1541 707 98 12136 2743 88 12281
NM_152332chr1482249 2017 1905 1156 596 412 176 100 --31913 1084 735 12027
NM_152344chr171292 11537 31255 561 279 --
NM_152375chr122521 1632 --12562 --
NM_152383chr2----1124 1131
NM_152384chr2----11988 --
NM_152389chr261604 1295 1227 1028 644 24 --21444 1355 --
NM_152390chr21483 ------
NM_152392chr2----195 --
NM_152407chr5123133 2958 2859 2747 2641 2098 2010 935 870 846 716 233 --32740 2734 133 160
NM_152409chr583579 2634 2435 2207 1226 899 576 541 13197 52422 2406 1244 472 71 13441
NM_152412chr841497 1432 1062 103 --21437 336 --
NM_152414chr851674 1525 1330 1260 627 11280 175 --
NM_152415chr82442 367 ----1219
NM_152417chr861201 961 520 419 278 230 21230 529 --21021 999
NM_152422chr951580 676 590 331 297 1163 41884 239 166 108 21239 236
NM_152423chrX91382 1329 1192 1178 1158 519 378 120 25 --31435 1140 344 --
NM_152424chrX84546 4405 3860 3513 1820 1580 1118 561 13467 43925 3789 3536 1340 --
NM_152434chr11----151 --
NM_152437chr1292448 2432 2348 2210 2028 1925 710 516 399 --1670 --
NM_152442chr123974 334 176 --2915 871 --
NM_152446chr142774 24 187 3678 674 219 1671
NM_152448chr152462 444 --133 --
NM_152450chr1531561 511 477 2644 488 2267 211 --
NM_152470chr1823937 3872 13865 34058 2647 700 23913 3909
NM_152487chr141418 1231 1116 963 1514 1983 --
NM_152519chr272160 1692 1678 1520 1471 714 220 1674 21745 1403 --
NM_152522chr23897 646 127 2786 425 3857 750 695 --
NM_152527chr252331 2273 2051 1550 778 ----12366
NM_152554chr6--1468 1471 --
NM_152556chr762575 2344 1035 653 456 165 --2572 519 1796
NM_152574chr9--1310 1313 --
NM_152588chr1221758 1318 --11239 21439 1435
NM_152594chr1592001 1893 1756 839 689 655 462 351 242 1810 ----
NM_152608chr192594 2444 2295 2273 1988 1021 1005 848 453 31915 938 335 82182 2042 1858 813 489 484 479 195 --
NM_152614chr2----1140 --
NM_152622chr5113464 3266 2695 2619 2547 2462 2441 880 821 772 148 23167 2136 21185 508 --
NM_152624chr5116789 6655 4626 2969 2034 1826 1516 1377 964 554 253 --86795 6774 6320 5390 4891 2603 1865 276 26435 2093
NM_152630chrX41389 1312 1068 113 --192 --
NM_152638chr125903 807 395 238 67 1877 21194 920 --
NM_152641chr1272674 2635 1808 1778 1023 249 111 1578 22227 116 22642 387
NM_152665chr121166 284 --11002 1199
NM_152678chr342215 2103 658 609 12190 42620 2563 2461 741 --
NM_152682chr41183 --11352 --
NM_152695chrX52100 1589 921 543 472 --179 1180
NM_152699chr343122 2536 2431 245 --1138 13708
NM_152705chr1331353 1321 475 --1257 11381
NM_152721chr18--1254 --1188
NM_152725chr10----2160 100 --
NM_152727chr16----1115 --
NM_152731chr6----1906 --
NM_152737chr652137 2094 724 670 455 --174 12120
NM_152742chr71598 --1188 1230
NM_152744chr743605 2607 948 527 --23271 887 11202
NM_152745chr761071 1017 967 934 846 325 --11140 --
NM_152748chr71336 1474 1477 --
NM_152754chr793501 2722 2598 1167 1149 1131 555 343 283 22871 2521 22743 2737 33333 2856 1080
NM_152756chr5124231 3482 3232 3204 3158 2825 2690 1385 1295 1134 611 370 13101 33350 2815 748 34067 3018 1543
NM_152758chr892956 2297 1915 1132 1116 1059 886 733 602 --32499 2172 721 --
NM_152763chr1----1218 --
NM_152765chr842267 1586 723 716 --22337 2257 --
NM_152774chr732299 1022 481 --2517 99 --
NM_152787chrX73599 3358 3164 3153 2768 782 333 43730 3175 1297 1152 13044 --
NM_152793chr744471 1980 1463 231 14455 --34487 1004 960
NM_152835chr1102918 2640 2574 2224 2145 1093 667 558 491 173 --22479 2197 31150 966 822
NM_152890chr11423 --1799 --
NM_152896chr9----1273 --
NM_152902chr181941 1933 1831 1626 1420 686 444 68 --22013 1441 --
NM_152996chr12762 308 ------
NM_153015chr82787 306 --2110 88 --
NM_153020chr631494 1406 142 21677 1203 21114 306 11270
NM_153035chr172824 2217 2088 2068 1243 1142 536 12100 22050 646 11253
NM_153184chr331571 1523 1445 11811 21885 798 --
NM_153207chr1243512 1416 789 446 12588 33674 3298 432 23367 3058
NM_153223chr511232 1159 31566 192 148 1559
NM_153259chr11355 1104 11091 11051
NM_153261chr1641359 1333 1051 150 --11569 --
NM_153262chr183175 3100 2679 2541 2209 2118 2088 643 22396 395 33001 2281 526 --
NM_153331chr3----1116 --
NM_153346chrX41816 1463 1422 467 21698 1449 2560 391 --
NM_153362chr61828 1650 --1738
NM_153365chr442773 2599 1716 310 --32172 2093 2034 2622 100
NM_153367chr1053389 3340 3322 738 151 12990 32676 2516 1052 --
NM_153377chr121272 ----2124 56
NM_153442chr10105919 4785 4739 4587 2485 1366 907 893 625 194 11648 11581 11326
NM_153449chr12171 --3511 478 191 1475
NM_153453chr61355 ------
NM_153456chr13146261 6170 6068 5088 4713 4362 3884 2456 2212 1397 1339 1297 762 152 14548 56196 5988 4839 2011 141 11388
NM_153607chr542805 2087 1117 43 11084 42613 1180 1063 904 11271
NM_153634chr1231375 581 336 --31351 1268 460 11644
NM_153646chr1462609 2329 959 952 652 233 11009 32305 336 153 --
NM_153686chr462244 1778 1594 717 504 68 --5875 736 284 106 30 12477
NM_153687chr1231614 1332 157 --21277 1272 --
NM_153689chr242294 2236 830 823 12040 11939 --
NM_153704chr81329 --3316 140 124 --
NM_153809chr91571 ----1584
NM_153810chr1084736 4561 4500 4126 3754 3695 3207 3140 --33714 1563 1430 1243
NM_170665chr1274507 4370 3585 867 762 454 53 54420 4300 4126 1701 738 24480 1179 1742
NM_170672chr2195 --1201 1438
NM_170707chr11161 ----1662
NM_170710chr442993 2940 2494 2351 13171 42539 2117 847 614 1832
NM_170721chr1711124 --31302 1095 931 --
NM_171998chrX32428 2127 940 ----12509
NM_172020chr711578 --21377 442 --
NM_172069chr272135 2074 2056 1795 1593 1585 391 --52340 2245 2170 1567 145 11543
NM_172070chr21846 11837 31926 348 51 --
NM_172071chr1167313 7258 7014 7001 6756 6217 6089 5919 5507 5164 2083 1443 1008 590 577 46 11615 157464 7394 6475 6465 5944 5658 5539 5224 5029 4642 1933 685 672 274 25 11744
NM_172193chr1421341 1124 ----21302 85
NM_172240chr122283 113 --31390 1177 999 --
NM_173078chrX1460 --1381 138
NM_173083chr131167 388 197 --2814 187 --
NM_173354chr2122132 589 --32137 152 141 --
NM_173355chr22743 157 11039 176 --
NM_173359chr331498 488 26 --11862 11877
NM_173463chr421098 506 --43897 3641 3408 765 --
NM_173468chr4125972 5473 5165 4538 4468 1791 1479 1438 1345 608 142 97 21806 1728 55542 4480 973 222 83 15129
NM_173469chr1521018 258 --21524 1506 --
NM_173470chrX32945 650 222 1316 4864 713 535 319 12517
NM_173475chr1651682 656 512 198 189 11213 ----
NM_173494chrX2786 92 --1629 --
NM_173496chr10102940 2812 2655 1012 1005 926 826 246 160 25 11968 32821 978 780 --
NM_173497chr101134 1252 21365 147 --
NM_173508chr131109 379 127 1940 1474 --
NM_173510chr22102938 2814 2798 2284 2251 2105 807 251 163 147 1313 32608 2328 194 --
NM_173511chr243295 3110 1065 209 12579 23796 3040 22831 2493
NM_173515chr63703 671 646 1137 2418 243 --
NM_173517chr7171 --154 --
NM_173519chr882054 1709 1289 697 611 585 501 275 11396 ----
NM_173531chr19103885 3867 3244 3165 3144 2809 2601 2511 1133 1050 11149 23861 3133 22850 2753
NM_173547chr17----1497 --
NM_173552chr352444 2406 2305 2021 1627 1692 32179 2174 775 --
NM_173560chr62423 388 ----1616
NM_173564chr7--1711 --1809
NM_173576chr103773 203 113 --42127 1910 1424 907 11538
NM_173582chr11166129 5973 5738 5558 4684 4659 4564 4500 4333 4229 3814 1726 1135 1028 942 930 11186 72451 2207 1905 1189 1037 985 128 --
NM_173587chr11----1597 --
NM_173591chr124859 302 185 60 --11024 --
NM_173595chr1245317 1823 1652 878 --41959 1953 1023 782 23544 55
NM_173602chr1253518 3442 2536 1382 1039 12486 33793 3709 2518 33706 1501 302
NM_173630chr18--1319 1291 --
NM_173644chr2071996 1907 1720 1649 1574 1540 275 21939 1855 11763 --
NM_173647chr221059 112 --162 21143 200
NM_173654chr352316 1842 1614 195 87 --42390 2097 1584 891 --
NM_173683chr82644 336 --21722 1652 --
NM_173685chr8----1193 --
NM_173794chrX1333 ----1361
NM_173808chr184214 3977 3703 3509 3393 1445 1010 487 13989 43802 1338 1078 643 --
NM_173829chr5146089 5835 5815 5503 4189 4112 4051 4001 3915 3899 2032 1106 881 865 36109 5776 5157 55688 5187 2251 966 961 1843
NM_173834chrX2167 88 --175 193
NM_173851chr853303 3015 2847 2818 610 11606 33267 1367 632 42677 576 139 131
NM_173854chr12847 134 12360 5820 797 417 403 299 12438
NM_174887chr17146 --159 --
NM_174890chr103792 508 77 --1169 --
NM_174900chr441244 1198 340 312 --2219 194 2229 204
NM_174911chr863620 3129 2756 1208 925 470 13534 43777 3751 3219 524 --
NM_174916chr1572352 2216 2170 1572 956 501 242 --42036 1741 275 260 --
NM_174921chr42434 424 --2848 165 --
NM_174938chr91190 ------
NM_175709chr22192 --33060 3004 2212 23048 98
NM_175736chr1297151 6706 6265 6151 6002 5412 5328 5085 546 25119 1172 36945 2748 897 11360
NM_175747chr631099 839 710 --21065 1005 --
NM_175854chr1342342 1812 944 210 12434 22325 225 --
NM_175856chr53147 85 65 --4687 563 251 113 1799
NM_175861chr12175782 5395 4889 4467 4117 2371 2350 1992 1937 1670 1662 914 883 810 719 647 343 35277 1217 473 75898 5280 4906 4437 1220 1204 1014 1567
NM_175866chr141457 1442 388 298 ----1115
NM_175875chr19----1656 --
NM_175876chr152806 2593 2370 2153 292 156 31931 1783 1017 --
NM_175907chr1832651 2421 2208 --178 1627
NM_175921chr5114263 3504 3158 1649 1032 912 621 549 363 348 314 11270 ----
NM_176814chr741509 1456 1134 541 --31123 557 418 --
NM_176815chr342964 312 129 109 --22910 547 --
NM_176816chr5------21945 502
NM_176823chr143880 3408 2504 75 22628 2591 12489 13871
NM_176824chr451300 905 849 423 395 --21125 204 --
NM_177424chr13638 336 185 1454 1466 --
NM_177531chr841078 841 400 239 1320 1211 --
NM_177968chr271761 1591 1530 1414 886 504 279 1519 --11467
NM_178011chr10113253 2962 2679 2598 1992 1246 1013 959 804 547 434 --32972 2698 2615 52711 2292 2164 1096 573
NM_178013chr141149 --13124 12516
NM_178034chr1551026 1014 970 935 817 --2925 756 1753
NM_178135chr421309 561 1340 3462 279 77 --
NM_178140chr511757 --32325 2321 302 12637
NM_178161chr101134 2285 124 1305 1128
NM_178313chr271886 1410 1369 605 510 229 196 --21561 1340 21811 208
NM_178439chr2----1418 --
NM_178450chr5------2657 243
NM_178454chr1--1279 1227 --
NM_178470chrX31296 528 313 1682 1669 --
NM_178496chr31393 --31041 501 413 1498
NM_178505chr1033649 2588 632 23065 2632 82855 2830 2467 2270 1392 1083 642 255 --
NM_178509chr1793840 3326 3255 3002 2567 1574 994 607 558 --34075 2939 397 12752
NM_178565chr821362 667 2579 167 1377 --
NM_178566chr931694 1642 1211 --2306 142 1361
NM_178568chr17----159 --
NM_178815chr1092572 2500 2051 875 759 611 289 251 33 --32165 1057 712 2644 640
NM_178818chr1642396 2316 1989 435 162 --1969
NM_180989chr1362235 2192 2124 1815 1654 1624 21906 127 21897 556 --
NM_181077chr1552192 1922 827 501 119 --1149 --
NM_181291chr14----1626 --
NM_181354chr851650 1541 683 536 132 11443 1157 --
NM_181356chr61978 --3355 344 101 --
NM_181358chr1113920 3455 2888 1323 1196 901 852 808 615 545 228 --64189 4170 2684 510 388 333 --
NM_181457chr21479 11124 11127 --
NM_181504chr593609 3381 2829 2773 2710 2567 1129 838 499 --23191 1236 --
NM_181670chr1231380 1366 1351 --11449 --
NM_181672chrX42064 2016 417 88 --41923 1683 1420 1374 --
NM_181701chr912271 12248 22251 799 --
NM_181705chr595787 5316 4210 4114 1393 1266 1174 581 502 34826 4541 1221 22248 920 22245 2241
NM_181706chr1182019 1920 1700 492 257 106 90 68 1174 1177 --
NM_181711chr12------235 31
NM_181714chr661748 1618 1487 1411 315 62 --21976 334 --
NM_181723chr882322 2003 1864 1423 797 494 436 321 11494 21853 650 32253 1484 330
NM_181782chr641732 520 400 362 --1306 1500
NM_181787chr853862 3541 1391 1327 1105 2983 388 21397 1333 --
NM_181836chr552479 1685 1657 995 939 12049 21010 174 --
NM_181844chr1731718 514 346 --3638 532 330 --
NM_181874chr33884 846 119 170 1255 --
NM_182485chr4133626 3340 3270 3135 3075 3032 2835 2572 555 448 349 258 137 --83615 3526 3489 3325 3214 3209 3003 2630 --
NM_182487chr953185 1544 604 597 92 --34390 4369 758 --
NM_182488chr136944 922 914 754 300 53 1675 2678 187 --
NM_182493chr1694395 4361 3574 2074 1092 922 437 377 116 --24711 4348 --
NM_182501chr263260 1036 805 501 108 102 --3632 460 305 --
NM_182503chr6115221 4426 4137 3972 3674 1601 1571 1464 907 780 647 1637 25595 5539 15625
NM_182515chr1996401 6371 6241 5635 5493 2216 2041 2026 1494 --75542 5036 5023 4304 2506 1561 1113 12202
NM_182524chr47616 598 580 162 153 96 87 --1702 --
NM_182569chr171115 --1174 --
NM_182603chr11----3852 670 114 --
NM_182663chr12728 61 1426 21963 42 --
NM_182691chr741428 1344 1330 1098 1958 41288 438 194 121 --
NM_182700chr721650 1449 --31969 785 287 --
NM_182755chr101209 ------
NM_182765chr1092215 2101 1999 1968 1573 600 411 284 263 --42277 2028 1806 615 12025
NM_182830chr1462251 2192 1911 1552 621 611 1566 1466 11587
NM_182854chr161107 --185 --
NM_182944chr141128 1174 --1178
NM_182976chr12264 256 1753 1320 --
NM_183050chr622268 383 --22165 976 --
NM_194071chr7135360 5353 5321 4576 4257 1854 1706 1673 1386 1152 739 252 65 --23804 1472 14609
NM_194247chr264533 4479 3942 3451 2823 1344 11041 33919 292 277 13948
NM_194285chr1173456 2277 1295 1115 802 352 314 --23209 3174 1763
NM_194286chr1275360 5293 4999 4788 4577 2243 1554 24767 2154 54778 4461 2109 2084 1240 62158 2106 2098 2094 2090 2081
NM_194291chr882877 2465 1870 965 776 581 318 247 32078 1069 276 22922 2185 11083
NM_194298chr1051954 1679 1502 1361 141 11962 11482 --
NM_194314chr1135544 5229 4705 4314 3591 3541 1779 1727 1706 1346 630 534 325 1231 43988 3982 1138 816 --
NM_194317chr242497 1808 1043 277 --22676 2083 --
NM_194449chr181164 ------
NM_197941chr582941 2875 2197 898 575 339 186 161 --1478 11109
NM_198270chrX32644 2518 491 31260 522 286 23414 1330 --
NM_198279chrX41083 942 260 66 --21013 127 --
NM_198281chr452947 2740 2681 353 331 --33152 2349 2271 --
NM_198317chr1--2153 144 1147 3136 132 120
NM_198401chr821419 531 11208 2624 419 1442
NM_198463chr3----2410 283 --
NM_198465chrX2869 856 12532 42495 2311 1927 95 --
NM_198489chr11----1136 --
NM_198507chr53472 348 165 --131 --
NM_198513chr831544 1450 768 21819 1752 1212 12053
NM_198552chr11248 --1505 2627 502
NM_198563chr3----1556 --
NM_198567chr5--1117 ----
NM_198578chr1241416 1201 327 135 --2349 62 11290
NM_198581chr2227544 7246 7053 6247 6041 5172 5007 4757 4615 2827 2216 2070 2018 1806 1440 1148 604 557 538 416 300 247 35459 2198 1628 75773 5476 5462 5149 2271 771 92 45473 5469 5146 89
NM_198584chr852178 2122 1904 506 495 12071 22102 175 --
NM_198715chr1186020 5680 5618 5455 5327 5128 4949 4772 4246 3952 2442 2407 1902 1787 1413 1223 1011 390 35314 2238 1913 34722 1936 608 33915 1982 1290
NM_198719chr16878 652 170 142 104 27 --3912 126 118 --
NM_198844chr1751017 973 391 244 226 2785 418 2421 347 --
NM_198859chr3124929 4313 4300 4096 3655 3279 1870 996 524 373 319 195 1400 23273 745 --
NM_198881chrX1391 --1403 --
NM_198935chr2083198 3157 3130 3016 953 648 309 260 --43149 2426 2230 943 12489
NM_198963chr2----1542 --
NM_198990chr742515 2226 2106 1266 12341 22326 1333 1255
NM_198993chr17----31285 336 170 --
NM_199000chr731778 1460 480 --22173 1870 11898
NM_199005chr9--140 1974 --
NM_199072chr742908 2094 1232 345 22549 1143 42823 2513 770 377 23119 2410
NM_199133chr53814 770 93 --1835 --
NM_199136chr72359 174 192 2429 76 2145 54
NM_199168chr1021345 253 ----11532
NM_199229chr271572 1255 1166 592 579 233 205 --31730 1707 347 --
NM_199247chr17----185 --
NM_199262chr171110 --12298 11566
NM_199280chr21131 131 134 --
NM_199320chr452652 2303 2032 1976 184 --42928 2838 2488 431 11967
NM_199328chr2131116 296 257 ----1390
NM_199355chr1671787 1667 1644 1621 1556 1329 578 --21824 558 --
NM_199461chr1083012 2996 2868 2777 712 502 471 345 --22917 208 1298
NM_201280chr651549 1493 535 371 216 --11402 --
NM_203282chr1961753 1720 1711 1564 1557 1262 --21582 461 --
NM_203288chr7--1428 1431 --
NM_203301chr144674 489 317 258 --31624 1527 281 --
NM_203364chr1161192 1103 1008 351 251 77 --11013 --
NM_203390chr841760 1600 1416 29 31209 468 95 1111 --
NM_203394chr1252580 2542 1978 604 580 32646 2612 481 1484 1862
NM_203403chr931242 488 47 --41253 1065 180 87 1209
NM_203406chr592342 2235 2166 2112 2056 804 607 538 327 42732 2380 726 407 22961 1059 12200
NM_203458chr183804 3085 2840 2782 2566 2549 1247 818 1938 43737 1161 1064 761 --
NM_203459chr1102324 2155 2104 1994 1025 621 430 392 314 98 --32431 454 354 --
NM_203463chr2104920 4605 3664 3528 3395 3127 1811 1767 842 408 31695 1328 258 53771 1816 1370 1069 261 --
NM_203467chr143239 36 29 ------
NM_205855chr7------1964
NM_206853chr6164162 3796 3710 3697 3359 3332 2695 2666 2623 1661 1498 1474 1434 1126 1062 386 2852 408 33216 3183 728 --
NM_206854chr6155423 5057 4971 4958 4620 4593 3956 3927 3884 3677 3489 1647 1113 1036 313 32113 1669 733 44477 4444 1989 1231 13760
NM_206855chr6196388 6022 5936 5923 5585 5558 4921 4892 4849 4642 4454 3920 3887 2078 2001 1278 522 167 54 11698 75442 5409 2196 344 339 328 117 14725
NM_207009chr1011007 --3370 339 122 --
NM_207043chr121533 1429 --1177 1174
NM_207303chr1054182 4026 2633 801 639 --21558 463 --
NM_207317chr51340 --2409 352 --
NM_207325chr1931444 767 747 1418 21770 821 --
NM_207352chr482720 2575 2406 2382 2019 1882 1827 26 12302 3511 201 45 --
NM_207354chr11------158
NM_207366chr722281 63 12039 72330 2193 2051 1933 1859 1798 1599 1624
NM_207371chr102510 117 --11595 --
NM_207372chr1052451 1940 1875 447 267 2632 576 22314 2304 --
NM_207377chr14----187 --
NM_207396chr12720 698 --2101 94 11814
NM_207413chr83410 300 187 1451 --1472
NM_207422chrX31394 218 155 1280 2356 232 --
NM_207435chr1221002 144 --1957 --
NM_207491chr441367 1312 1044 281 --11319 11400
NM_207517chr1521749 1372 --11774 1666
NM_207578chr11646 --154 2587 264
NM_207645chr111233 --11134 --
NM_207647chr962445 2288 1630 894 559 132 2786 410 42415 1580 511 380 1942
NM_212551chr12171 138 --4928 412 398 370 --
NM_212554chr1041279 1178 1064 573 --11614 --
NM_212558chr9113715 3625 3378 1678 1563 1101 1013 796 773 716 604 13305 73343 3106 2955 2902 1617 1148 728 --
NM_213606chr10102757 2731 2615 2210 1743 1697 1690 1074 1038 584 12642 22494 82 --
NM_213720chr22----1164 --