TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-578
miRNA Sequence: CUUCUUGUGCUCUAGGAUUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX116458 6225 5962 5734 4961 2542 1272 1214 1189 608 245 56847 5131 4492 807 338 1777 --
NM_000109chrX62221 2197 2170 1681 997 585 ----2299 169
NM_000110chr121129 872 2473 423 --1409
NM_000112chr575039 4184 3753 3531 3491 1099 453 21153 344 14528 --
NM_000167chrX31337 1203 1146 --11372 11242
NM_000176chr523632 923 33443 2398 974 --21435 1211
NM_000217chr1295254 4549 4344 4309 4192 2024 1397 554 376 33632 839 683 --14899
NM_000248chr352526 2277 980 743 276 --12780 22560 850
NM_000252chrX--11256 --21364 166
NM_000259chr1575291 3901 1885 1518 1030 420 252 12371 21233 51 35326 4504 1533
NM_000267chr1742616 1094 1057 577 43367 1159 631 275 --1667
NM_000337chr5136169 5934 5716 5542 5334 4998 4642 4143 2465 1695 1431 1156 762 46322 4674 2566 2138 --35956 5869 4769
NM_000439chr522129 174 2950 457 --22396 884
NM_000555chrX117865 7536 7450 7403 6393 5223 4896 1735 1139 458 419 33057 1881 938 ----
NM_000633chr1864845 4730 4630 4321 3363 914 94705 3896 3224 1976 1122 859 743 246 110 --13779
NM_000719chr12106610 5124 4733 4405 4375 4105 2591 2428 2039 1392 46575 6174 5628 2293 46723 4804 2275 1501 15723
NM_000806chr531744 197 139 1743 --2289 146
NM_000813chr555470 2216 1918 1311 27 95627 4469 3787 3737 1413 1128 795 686 573 25537 1607 14386
NM_000826chr452474 1870 621 274 34 --42298 2136 178 55 --
NM_000861chr342317 1843 885 330 22702 229 12270 22277 53
NM_000875chr15146925 5672 5486 5417 4971 4675 2278 2167 2104 1623 1079 988 883 245 56787 5040 2525 1358 1048 25639 2244 --
NM_000899chr1283839 3458 2788 1565 1247 778 749 738 33855 1065 1057 --33639 3357 1333
NM_000944chr441785 1739 866 133 32240 1703 945 12097 11952
NM_001001323chr1272997 2628 2410 742 640 254 38 1843 --23019 1246
NM_001001323chr1272997 2628 2410 742 640 254 38 1843 --23019 1246
NM_001001395chr1242430 2286 2027 25 11811 42436 970 87 75 --
NM_001001481chr812336 32584 797 235 --21115 376
NM_001001668chr19104234 4123 4084 3543 2779 1419 1082 1051 453 251 34060 2690 844 24193 3917 --
NM_001002295chr103785 397 358 1300 --1712
NM_001003674chr18136568 6432 6067 2529 1919 1766 1660 1458 1190 843 612 545 42 66224 5701 4673 2652 712 678 15721 25991 5222
NM_001003712chr1211462 23126 2797 1174 1999
NM_001004065chr941493 1079 416 200 33063 56 48 12574 33586 2661 965
NM_001004317chr693646 3632 3271 1702 1529 1489 1319 378 204 43709 3468 3455 3117 11189 --
NM_001004419chr1264381 4081 1575 1391 1138 717 24575 1434 31223 474 435 24137 1242
NM_001005473chr586591 6131 5246 4185 4108 2480 1825 30 45522 5009 4021 1171 36146 5092 1564 --
NM_001006600chr532367 1626 36 32355 1555 461 12426 1783
NM_001007097chr944007 3621 3574 1040 54856 4494 4302 3433 243 23580 765 24845 3454
NM_001007278chr1364895 4142 1688 1627 1268 1136 21841 1276 13772 32034 1833 1474
NM_001008226chr1531180 533 424 2555 55 --2146 123
NM_001008392chr353271 2772 577 393 158 22506 194 1495 1893
NM_001008738chr52612 300 32444 1135 52 --22580 520
NM_001008925chr441273 1207 1109 856 --22879 2659 22772 2200
NM_001009554chr454428 4369 3589 1821 336 44523 1160 196 33 11457 13521
NM_001009569chr1041408 1052 346 185 2511 39 --21032 150
NM_001009899chr355953 5672 2487 1942 1853 46532 3988 1713 941 26364 5159 --
NM_001009993chr253992 3587 3299 3048 1093 14417 24539 1831 11449
NM_001010853chr673047 2742 2462 2291 2097 215 30 --12577 22199 1063
NM_001010895chr971622 1579 1509 1469 1319 764 303 21405 57 --1149
NM_001011666chr7116546 6536 5897 5265 5036 4921 4255 4061 1931 527 29 12363 34912 4036 1980 2705 176
NM_001011885chr152689 114 ----21772 320
NM_001012754chr133805 416 143 --51877 1784 1400 685 83 --
NM_001013620chr1268306 8249 6860 6138 5928 2687 35668 3257 160 26890 3314 66055 5803 5357 5328 5205 2215
NM_001014380chr1355178 1646 1631 1480 1245 14321 --14855
NM_001014797chr10207652 7565 7017 6874 6841 6661 6560 6516 6304 6097 6063 5616 5531 5168 5105 2866 2361 2309 927 241 46930 6621 6591 1174 48098 6915 5910 5762 36549 3269 3221
NM_001017930chrX41106 1042 1012 998 ----2517 504
NM_001018065chr9146071 5711 5261 4868 4413 4007 3851 3832 2423 2297 1058 263 158 41 15637 24559 1755 --
NM_001018111chr793881 3743 3698 3480 3423 3151 2688 1111 861 33714 3652 250 23578 3077 11287
NM_001024647chr1287062 4701 2794 2414 1872 1499 132 88 77489 5921 5883 5840 2555 2001 391 35398 1584 1337 --
NM_001024847chr332166 1618 70 42274 2261 407 234 21752 1746 1384
NM_001025076chr10106195 6032 5845 5414 5081 4881 4851 844 755 271 16102 --1628
NM_001025079chr393721 2959 1527 1338 975 823 762 537 293 ----1113
NM_001029863chr652831 2278 1994 1100 391 ----23019 2326
NM_001030051chr662317 1706 1639 946 806 350 1126 1508 1143
NM_001030055chr1443412 3178 3109 644 33406 1670 1623 11662 11901
NM_001031679chr1262329 2246 1366 1340 409 189 22882 2836 33556 2703 980 12160
NM_001031732chr473056 2491 962 863 574 561 251 33015 2977 1222 1167 13472
NM_001033045chr243502 1483 1131 617 14303 22787 1602 1805
NM_001033578chr852357 2018 1472 585 450 1159 1859 22400 1679
NM_001039538chr242385 1168 448 433 33417 2857 467 22747 202 --
NM_001039547chr3147373 7098 6926 6702 6362 6103 5666 5320 5163 5153 2581 2499 937 129 37564 7234 717 27768 1107 16310
NM_001039570chr2264560 4485 3389 1830 1620 628 14621 11024 14654
NM_001039590chrX73050 2783 1465 1146 962 787 723 23646 282 --13536
NM_001039618chr1145915 3652 666 461 11282 22377 920 11435
NM_001039840chrX85937 5868 5722 4366 4236 1797 1493 743 14088 --15115
NM_001039937chr1363539 3280 2946 1612 1115 61 64033 3994 3952 3881 1524 487 13457 13509
NM_001040142chr262380 1700 957 147 86 75 22148 1540 11693 --
NM_001040152chr774283 4069 1771 1000 202 195 46 31806 1552 715 13593 23899 1011
NM_001040402chr412175 12300 11202 32262 1080 425
NM_001040450chr1522532 56 ----22433 2168
NM_001042355chr16115280 4801 4720 3744 3566 3374 1957 1456 919 381 229 13951 21885 184 1844
NM_001042599chr2157744 7703 6534 5883 5654 4892 3011 2822 2815 2346 2221 1832 1346 566 420 31317 977 762 36835 5059 2388 1819
NM_001042601chr342758 2564 2355 1142 22666 2230 12093 12870
NM_001042603chr1264858 4671 4082 943 724 718 23605 542 24153 1353 14759
NM_001046chr512457 42329 2084 1159 874 22704 2356 1143
NM_001100108chr1138335 7415 6325 6036 2619 1963 1882 1578 1312 963 628 511 343 37726 3165 460 36425 532 172 16388
NM_001106chr3158800 8046 7482 7434 7350 6416 3368 3019 2599 2468 1188 1070 959 785 742 59120 6998 6067 598 548 22309 450 11559
NM_001167chrX116506 5444 5017 2596 2521 2430 2422 2331 1660 989 238 46695 6478 2089 1548 34282 1595 244 --
NM_001241chr272244 2141 2130 2014 1986 396 357 189 --1565
NM_001256chr17102638 2023 1970 1843 1003 819 654 631 447 193 22559 516 ----
NM_001259chr796108 5402 5039 4783 4241 2044 1040 239 185 45316 4435 2372 150 45679 4866 2024 496 11915
NM_001364chr1164771 4505 4477 3918 1796 614 33061 1757 277 1567 11398
NM_001609chr1054049 3268 1419 1204 194 21520 1182 44085 4061 3155 1592 11604
NM_001650chr1853656 3597 1483 1157 29 1457 23076 988 13221
NM_001701chr921109 373 11487 1312 1299
NM_001759chr1295066 4491 4481 4201 4099 4066 3670 1703 456 21147 404 24440 3300 1286
NM_001858chr6154772 4607 4594 3765 3457 3402 1452 1420 1378 1141 1111 1055 901 838 511 24627 606 33812 963 564 13789
NM_001969chr1462520 2424 1430 1220 597 448 1495 33840 1297 1253 1843
NM_002015chr1352801 2488 774 189 54 21049 404 13232 12222
NM_002025chrX99209 8720 8538 6098 3678 2536 2355 554 400 21250 564 47983 5914 5717 678 1897
NM_002086chr1751867 1742 1717 696 209 --21757 1461 2758 353
NM_002137chr751902 694 609 473 423 21959 742 11770 21966 795
NM_002214chr7115671 5140 5019 3904 3722 933 681 619 525 380 81 25427 3567 35098 4402 483 25179 2296
NM_002270chr531134 1061 422 14379 24318 352 24901 381
NM_002336chr1264903 4743 3673 1958 1000 348 53972 3927 3086 1823 488 1323 --
NM_002501chr1963568 3298 2755 2734 772 40 23816 333 23598 1381 13968
NM_002526chr621576 701 11367 --31723 1588 359
NM_002577chr333834 3057 1046 1152 146 23577 1390
NM_002581chr985441 4458 4424 3601 2131 1620 1343 148 64488 3752 2225 1999 985 299 45214 2231 2207 1321 14070
NM_002645chr1151188 1158 887 822 508 --33029 1005 991 22233 725
NM_002657chr2093801 3728 3308 2805 1500 905 752 389 137 12844 23333 2717 23351 2545
NM_002703chr451569 1251 347 314 49 --1554 11619
NM_002709chr252929 2900 2775 2634 1373 22877 548 1696 12833
NM_002725chr1103990 3710 3457 3178 3066 2770 1345 719 473 181 33209 737 451 --12715
NM_002731chr183190 2987 2772 2645 2496 2372 1971 177 2740 531 12395 --
NM_002737chr17126100 5974 4613 4605 4474 4153 1867 1341 927 767 432 184 45120 1166 447 398 46080 4653 1682 438 15727
NM_002760chrY115334 5282 5076 4453 3669 1911 1199 1138 842 728 178 11383 44392 4382 2350 215 14604
NM_002834chr1263505 3159 1470 1362 1077 69 53876 3112 1449 1280 82 1228 --
NM_002994chr41302 21739 364 2427 87 1471
NM_003030chr331258 615 488 ----21758 736
NM_003043chr3114133 3672 3335 3223 2765 1336 1281 1062 893 875 836 23552 3540 --24098 3971
NM_003099chr15145440 4700 4515 4429 4158 2047 1963 1801 1126 1036 969 746 648 470 --35669 5200 4895 46581 6379 4941 1352
NM_003108chr257276 5983 5795 4771 168 24881 4421 15347 25207 4832
NM_003298chr375246 4635 4382 1816 1440 543 24 35417 1600 566 24861 4375 1191
NM_003392chr373717 3200 947 468 252 149 108 44008 3743 598 213 2761 580 23428 1123
NM_003463chr632869 2371 410 22976 2410 --22551 331
NM_003483chr1242686 2594 1158 331 1785 --21958 394
NM_003489chr2143285 3231 2526 72 21319 815 22502 1023 12225
NM_003574chr1875447 5354 5290 5246 428 308 299 2946 419 35787 5593 5228 --
NM_003590chr274054 4021 3741 2716 2574 1277 590 13304 --1282
NM_003679chr132169 2132 1039 --13169 31282 984 947
NM_003799chr18104155 4014 4002 3977 3455 3323 1707 1457 1058 244 11222 1192 11487
NM_003966chr5107746 6201 6184 5694 5267 2226 2121 768 568 185 76753 6592 5785 5121 4965 2003 375 36371 3022 415 17536
NM_004093chr1372914 2450 2397 1065 936 665 339 --11989 22846 2003
NM_004113chr351387 1320 579 116 90 41891 1415 608 597 --1168
NM_004114chrX--1343 2854 205 2966 898
NM_004171chr11149102 9042 7414 7251 7208 6503 5883 3760 3672 2630 2575 2458 2336 1547 27322 6395 38801 7140 5916 48682 7258 1740 445
NM_004232chr1813137 12715 33869 2860 40 32974 2729 47
NM_004392chr1362561 2148 1862 505 439 306 1381 --1834
NM_004412chr1075724 4780 4616 1396 1350 1038 295 34402 547 128 12086 --
NM_004459chr1751962 1839 528 103 37 31295 290 250 --1180
NM_004598chr523060 2356 --12609 22145 799
NM_004612chr983732 3562 3276 3164 3125 3064 1739 1668 33876 1225 172 14443 14673
NM_004666chr611236 21341 1023 31448 324 299 11422
NM_004744chr431346 532 167 23569 3095 23338 1223 23864 295
NM_004788chr1152696 2300 2076 561 179 1209 2743 574 12616
NM_004834chr262256 2196 1318 1233 686 550 12299 21103 409 12927
NM_004852chr181913255 12874 11796 9641 9356 9170 5668 5444 5362 5226 5111 5018 4562 4106 3889 3874 1440 613 462 914125 14049 12269 8690 4404 4221 4191 3560 1151 613504 12625 11507 11039 1773 482 213984 12919
NM_004866chr544631 3608 701 351 34383 1172 145 1741 --
NM_004956chr764147 3749 3386 2831 350 53 33824 3582 980 34006 921 226 --
NM_004992chrX157510 5609 5247 5141 3213 2694 2627 2574 2314 2004 801 710 617 605 273 32349 1519 1470 138 1624
NM_005045chr7--189 --2650 276
NM_005063chr1052880 1238 1007 864 594 13637 33799 3534 839 --
NM_005065chr1444481 4384 3288 2009 54256 3616 3595 3425 1688 --25053 120
NM_005121chr1732374 2361 1448 128 --2974 39
NM_005156chr985033 4974 4286 4054 3939 3658 1433 726 64886 4145 2043 1950 251 236 --11606
NM_005160chr2274694 4625 4260 2321 2037 1487 748 14210 15552 15546
NM_005188chr1188026 6670 5826 5378 5328 2519 1880 412 27771 6263 15369 28142 7305
NM_005239chr2171768 1753 1370 791 378 250 123 3237 112 87 1564 --
NM_005261chr8--1199 1320 2963 398
NM_005399chr134208 1235 310 43050 1243 411 200 24324 548 23674 784
NM_005433chr1842172 2158 1773 573 32462 2329 2316 2669 70 11024
NM_005504chr12105158 5134 5075 2566 2486 2376 2264 1875 1014 659 46285 5851 4228 4091 35670 2423 138 25996 2383
NM_005530chr1541352 1046 421 332 2603 372 --2476 350
NM_005593chr12--1517 152 2577 151
NM_005596chr975543 5367 4003 3930 2258 1224 1149 24789 144 14098 15619
NM_005647chrX62274 1189 981 959 932 172 73439 3073 2789 1311 1172 1159 716 ----
NM_005665chr184959 4840 4136 4059 4028 1522 1136 244 34438 3970 1384 11466 23832 3411
NM_005668chr583467 3104 3082 2947 1508 364 264 228 24434 1615 --13112
NM_005732chr521469 1462 1948 1581 293 60
NM_005828chr1784852 4344 3344 3316 3223 1137 994 72 --15045 14312
NM_005904chr1831426 987 607 ----21351 1164
NM_005935chr4105288 4436 4428 3807 3370 2038 1865 1658 777 118 15335 13838 11047
NM_005941chr883680 3643 3148 3065 1176 1116 932 908 72825 2651 2643 2556 2540 1547 509 43401 3234 980 66 13228
NM_005966chr252263 497 300 194 159 1549 --22101 598
NM_005989chr741175 1012 452 368 ----21615 478
NM_006108chr1142286 1966 1869 1735 1927 12026 11497
NM_006241chr362379 1925 512 423 279 130 ----1580
NM_006252chr186515 5997 5972 5891 5129 4697 2450 1510 37316 6497 1155 26191 5557 --
NM_006330chr841581 1459 1397 202 31600 655 554 1497 --
NM_006371chr3105121 4893 4787 4697 4207 3942 1610 1363 1341 1196 41809 1408 1252 41 25078 4886 1699
NM_006380chr1763835 3681 1399 1304 703 677 23435 1330 --2569 256
NM_006544chr1465847 5719 2176 977 937 89 1736 26019 5938 25040 414
NM_006599chr1687109 7034 6868 5842 5358 5165 3079 2907 34986 2472 2320 47005 6951 6131 2359 --
NM_006609chr222325 2124 --42200 387 208 116 12598
NM_006620chr6104867 4120 3530 1942 1893 1836 1496 1352 1014 61 33463 1321 474 23720 522 24236 3245
NM_006729chrX45618 4293 995 163 31400 453 290 24430 2057 --
NM_006750chr16117580 7501 5670 2701 1899 1526 1306 1122 1014 792 115 22976 2552 11884 27134 41
NM_006814chr2072702 2161 2021 1040 642 635 363 1756 2621 332 --
NM_006827chr1452934 2836 2068 1139 853 11286 13161 1718
NM_006902chr153172 2626 2192 205 186 22940 117 --13270
NM_006914chr9--41500 1116 377 81 --21482 319
NM_006920chr261581 1568 247 205 146 74 ----1612
NM_006947chr4178 --11754 21293 526
NM_007011chr1576687 5349 5199 4823 4514 2751 2233 26770 5307 25708 5645 12542
NM_007249chr13128653 7689 7292 7239 5785 3193 2749 2699 2089 1917 1371 370 1135 21938 190 1875
NM_012072chr2084402 3401 3158 1678 868 622 614 458 13796 --23804 855
NM_012104chr11103249 2913 2820 2809 2800 2625 2405 1291 1185 833 23670 2875 33862 1400 1176 23378 2343
NM_012153chr1172503 1948 1595 655 620 305 296 --32203 1828 1681 1126
NM_012156chr2052587 2526 834 537 58 52308 1222 565 521 313 23190 856 3962 371 189
NM_012249chr283555 2782 2473 708 496 458 175 154 124 --1920
NM_012288chr695212 4395 3611 3519 1711 1658 558 505 56 15577 21619 23 25568 5055
NM_012395chr7102911 2740 2515 1175 1124 728 228 163 30 21 13265 --22243 147
NM_013231chr1463842 3343 2852 1252 780 512 21221 617 13638 1439
NM_013255chr7128292 6998 6768 6173 5590 2403 1871 1396 1325 1142 279 36 26281 5957 28308 1770 27308 1848
NM_013302chr1653852 3428 3040 1403 636 33700 3657 3449 --23287 645
NM_013309chr1572497 2156 1988 1824 912 481 323 1873 --11968
NM_013438chr911665 ----21455 575
NM_013943chr152715 1316 141 132 44 12568 12065 1426
NM_014005chr563126 2604 1085 848 789 625 1524 --2384 260
NM_014028chr641272 899 743 260 22575 108 31302 141 116 --
NM_014048chr1674378 4356 1305 1278 1084 654 41 23959 964 11850 13865
NM_014112chr854648 4544 1645 983 289 25298 4991 31767 1331 1317 14174
NM_014155chr11136419 5205 4856 4780 2631 2577 2556 2531 2420 2014 944 698 23 26721 901 47118 2509 627 29 14589
NM_014267chr11----1849 2863 217
NM_014388chr185692 5433 5088 4548 1467 1008 651 398 15477 --11855
NM_014421chr452116 1839 722 553 315 --2711 120 42009 570 473 109
NM_014458chr131239 428 158 21346 1224 1418 1527
NM_014674chr333437 959 745 ----23906 3768
NM_014747chr1105534 4685 4665 2323 2259 2128 1906 1883 1502 1441 23819 1840 35619 5090 1889 --
NM_014755chr253905 2998 1506 374 126 43527 3318 827 730 1306 22939 2704
NM_014810chr173172 2985 2570 2280 1349 894 89 53679 3137 2656 2497 2268 32834 1126 588 --
NM_014829chr531654 1608 470 1391 --2952 131
NM_014877chr1797258 5370 5205 2651 2473 2088 1402 778 284 25047 4745 ----
NM_014897chr1733195 1047 114 33128 1989 897 21193 161 22939 2920
NM_014932chr361631 1556 365 244 131 82 11760 --21326 306
NM_014935chr1103445 3329 3069 2922 2905 2672 1486 823 613 466 23505 2947 --23917 3637
NM_014962chr201567 --32044 843 383 12346
NM_015025chr262721 1669 994 820 530 126 3682 656 497 11971 --
NM_015051chr973349 3271 3085 2909 1078 607 589 12741 13385 1628
NM_015071chr595134 4418 2585 2543 2534 2457 1316 842 554 46064 2563 850 203 --15932
NM_015076chr6103704 3566 3462 3194 1621 1296 1209 806 753 390 11447 13249 --
NM_015097chr332167 1837 210 32058 1501 705 21442 352 12177
NM_015147chr293167 2961 2633 2518 952 394 268 85 73 ------
NM_015191chr1192601 2114 1833 793 782 742 459 448 295 2774 471 --1487
NM_015215chr172755 1112 845 751 468 318 235 21218 1151 1179 1403
NM_015271chr464287 3449 1500 1337 432 264 1816 --11671
NM_015310chr8107196 6363 5894 3291 2717 2543 1898 889 816 498 --36709 6142 1592 --
NM_015458chr8104987 4172 3356 1672 1664 653 617 464 353 27 35207 4441 579 ----
NM_015564chr583305 3010 2932 2691 2303 2197 1385 890 22604 2395 13532 1253
NM_016009chr184010 3751 3623 3248 1634 1252 627 201 13639 11521 --
NM_016083chr643089 2946 1329 294 53570 3121 2536 1399 1368 1681 129
NM_016248chr1353459 3036 1029 849 246 14031 --13388
NM_016271chr18------21606 520
NM_016396chr1542329 963 320 257 32357 1883 748 31215 763 432 12632
NM_017415chr584137 4128 3901 3042 3027 1267 1050 961 11619 44546 2840 1610 711 1873
NM_017420chr1483027 2594 1468 1409 843 244 169 63 23356 436 1773 42352 1194 881 126
NM_017628chr475218 4299 4276 4176 1472 884 354 13488 24248 1137 24372 1858
NM_017633chr693668 3243 3142 3018 2489 1163 905 724 44 23579 3274 --2479 293
NM_017637chr9169236 8862 8424 8297 8029 7811 7348 7232 7050 6399 6168 5984 5897 2526 839 174 48588 7631 5791 632 26820 3373 11884
NM_017650chr795700 4730 4632 4424 2117 1431 981 680 334 75449 5432 5064 4327 1055 880 39 11947 2892 749
NM_017754chr694801 4403 3898 3694 3472 1259 1126 184 30 84790 3504 3414 3281 1615 1514 757 210 1546 23486 498
NM_017801chr332456 2448 131 1482 --1787
NM_017813chr895112 5092 4781 4576 4372 1937 1603 1024 246 --44084 3687 884 473 --
NM_017847chr162132 1945 1901 1887 1817 546 1866 11658 32253 1545 1405
NM_018036chr1453655 1087 981 302 109 34023 3614 1370 34459 4384 1553 1764
NM_018048chr1231746 1722 473 --21643 570 2330 130
NM_018078chr42981 190 133 1230 2353 148
NM_018084chr273342 887 616 498 346 201 92 42726 2464 2244 173 --13232
NM_018121chr1042847 1135 420 47 2102 35 --31975 378 367
NM_018221chr22378 103 197 --1334
NM_018293chr332896 2097 1001 32959 2840 2136 22546 1158 161
NM_018327chr2031863 1824 740 21345 41 --2717 67
NM_018362chr1163893 3710 2691 1413 968 716 31308 455 94 11290 1195
NM_018409chr472603 1217 1162 1023 1013 688 188 22801 818 1908 --
NM_018440chr8118423 7787 7246 6408 5847 5638 3313 3016 2459 1075 342 77463 6569 6507 6069 3129 2349 481 48135 6119 3243 1212 13298
NM_018566chr174215 3457 3403 3393 1987 1659 1364 --1714 24924 4685
NM_018638chr1244158 2193 2136 400 34642 177 60 14290 1929
NM_020122chr285774 5443 5277 5068 3761 2144 1512 421 --25752 435 --
NM_020133chr6126223 6145 5395 5086 4483 4017 2055 2033 1763 1515 1483 1474 45915 5179 4856 439 --14259
NM_020205chr1113462 2399 2144 2134 1211 546 248 168 148 67 26 12828 ----
NM_020390chr334688 1894 263 33891 3437 254 --11937
NM_020466chr6104827 4603 3934 3586 3357 1823 1668 1655 1436 505 14088 14298 11466
NM_020673chr20107760 7303 7266 7095 6405 5448 4969 2426 1501 58 15549 16771 16957
NM_020734chr1253103 2580 1005 894 101 23275 2366 1439 33020 2985 979
NM_020742chrX4972 375 204 110 32581 1766 1689 --1675
NM_020752chr1082609 1820 1784 1148 414 378 162 82 2204 101 21122 65 12407
NM_020772chr1797376 5709 5645 3314 3197 1196 532 122 66 1227 48431 6232 5896 5796 12363
NM_020774chr1855916 4669 4441 2269 2262 35648 4520 984 35654 2081 538 1692
NM_020801chr562388 2232 1028 768 728 711 22592 1866 11008 1450
NM_020866chr133403 101 67 1393 1107 2196 175
NM_020871chrX42231 1590 951 205 11716 178 12359
NM_020921chr1472572 1216 1172 953 896 269 245 32663 2619 732 ----
NM_021033chr1363296 2699 2512 2410 931 724 1447 52518 2344 842 795 430 11339
NM_021038chr352867 2317 2088 1359 129 --22529 2176 --
NM_021097chr272445 2344 882 731 606 198 125 52752 2650 2263 636 506 --1709
NM_021255chr1443566 3354 880 325 1962 --24101 2611
NM_021813chr695693 5181 4293 4261 4215 3890 3827 350 99 35271 3754 220 21793 1209 14420
NM_021961chr1166249 6177 5890 2318 2244 492 1620 35744 5143 2950 26682 5590
NM_021963chrX--1181 2498 61 1124
NM_021964chr396262 6172 5768 4417 4064 1921 837 137 54 46392 5306 507 456 --16647
NM_022048chr1542475 447 427 314 75298 4123 2386 1827 1348 1121 980 25148 2222 14652
NM_022124chr102261 207 ----2521 227
NM_022351chr813402 53302 2509 1228 882 719 --12691
NM_022473chr1574436 4228 3684 2891 2716 1771 640 23279 2962 34455 4004 3018 --
NM_022497chr373708 3067 2926 1319 1230 1064 946 23542 1243 11344 13101
NM_022763chr332453 1181 506 --1873 22751 646
NM_022832chr452506 1878 937 685 660 32428 2210 752 1450 22170 1923
NM_022843chr131613 2380 311 1354 21283 944
NM_022898chr1464723 4666 3733 3360 1788 1105 34622 3763 3754 --21694 1427
NM_023934chrX61659 1496 592 573 302 278 1859 21456 255 --
NM_024513chr3103424 3297 3022 2943 2805 1394 1020 915 756 732 33418 3359 3228 22846 1191 138
NM_024563chr581895 1606 1522 1398 714 620 502 458 ----11202
NM_024749chr151734 1663 1525 94 23 --52060 2045 1581 811 649 --
NM_024947chr399557 7756 7247 7207 5988 3847 3185 818 604 48371 7686 2004 1206 28436 2421 19145
NM_024949chr484420 4282 3440 3408 3190 1498 951 637 35011 4080 1354 2655 649 23715 220
NM_024989chr287437 6375 6037 4962 1136 617 90 55 37331 2954 434 21185 304 --
NM_025054chr8104114 4101 4059 2712 2655 1691 952 827 730 601 33620 1647 1334 ----
NM_025160chr154006 3653 2657 1529 687 14200 13356 1851
NM_030571chr5272 51 21558 59 11193 --
NM_030621chr1473958 3675 3492 3431 1074 808 140 22934 1575 24007 263 129
NM_030806chr1179007 8808 8375 7214 7011 6836 5815 3603 3489 2823 2811 2653 2026 1443 893 653 346 78475 7854 6635 6067 3703 2371 745 --28983 6150
NM_030816chr163368 3186 3012 1324 1075 1009 33379 1453 34 22531 162 11112
NM_030962chr1121380 1238 21631 1022 --21362 556
NM_031483chr2083561 3013 2916 2447 724 562 385 32 13070 11180 --
NM_032042chr511917 11026 11112 21995 1981
NM_032228chr1123102 2276 21233 1064 22790 276 12656
NM_032373chr1085723 5670 5378 4487 4283 1891 1553 558 12129 --35158 644 421
NM_032457chr463402 3275 3088 1364 799 680 21159 981 --13485
NM_032622chr451406 1363 1279 1012 50 1121 1431 --
NM_032727chr102405 222 11569 --21201 160
NM_032818chr9112586 2539 2258 1807 1627 1032 929 791 723 630 57 41667 345 318 304 ----
NM_032859chr1353534 2620 2504 1001 578 11282 12419 1348
NM_032869chr861992 1494 785 590 384 375 1154 1651 11694
NM_033143chr484187 4137 4045 3991 3354 3323 1101 556 21667 29 ----
NM_033211chr511892 --21374 160 21704 554
NM_033224chr7167999 6522 6335 5937 5342 5281 2947 2651 2146 1475 1453 1244 865 620 608 599 87515 6447 6099 5676 5026 944 348 204 --1843
NM_033505chr2105845 5733 5280 4993 4909 2589 2169 980 552 127 46251 5508 1562 467 25821 1854 11881
NM_033515chr6162 --11317 21107 1081
NM_052879chr1253655 3008 1527 303 96 2751 733 22805 544 1108
NM_052885chr1244136 3196 1453 544 43449 3309 3249 1509 13834 31993 1353 184
NM_052917chr223288 674 32898 1113 269 1199 1526
NM_052937chr842545 2515 998 530 11723 12224 11043
NM_058172chr471714 1596 659 631 436 391 23 --1358 2716 288
NM_080738chr151795 1452 678 85 58 2758 229 199 2780 443
NM_080867chr14104849 4476 4214 3987 3462 1993 1826 1100 1073 757 ----34011 3969 3415
NM_133445chr983669 3202 1287 1041 779 577 558 216 --23003 2937 1350
NM_138288chr1421763 457 11738 --32042 145 83
NM_138426chr731620 1537 49 11681 2938 670 12462
NM_138459chr653544 3223 2503 2361 443 13352 --12870
NM_138468chr285492 5363 5294 5287 4419 4194 4043 1625 --11341 14426
NM_138731chr1461260 1133 1109 996 585 559 12625 1929 11347
NM_139207chr1251558 1459 850 499 481 ----1129
NM_139279chr273166 2506 2475 966 730 226 156 33226 2258 391 32758 2334 466 13440
NM_144571chr4126871 6433 5342 4754 4714 4700 4603 4589 2457 1401 1269 1175 56423 4866 4847 866 559 --21484 1345
NM_144578chr14125552 5336 4799 4465 4401 3542 3374 1861 1796 1582 1506 418 11632 ----
NM_144599chr1534101 3995 493 44356 3792 1890 1841 34419 4270 1416 --
NM_144778chr1352692 839 786 154 29 ----1951
NM_144778chr1352692 839 786 154 29 ----1951
NM_144975chr1761822 1190 1133 575 534 477 21234 22 --21226 201
NM_145011chr1031750 496 303 --31496 250 65 12209
NM_145206chr1051190 924 865 754 360 12338 --33245 686 566
NM_145207chr464259 4144 4132 3616 3414 884 25021 4803 24567 3346 11664
NM_145268chr76983 881 857 794 257 140 --1749 21102 338
NM_145307chr1074033 3354 1483 1308 1255 1035 218 33370 1241 454 24226 1126 --
NM_152275chr242155 1919 1686 121 --11765 11926
NM_152381chr241610 648 513 360 21276 373 --1688
NM_152407chr532511 673 633 12933 33243 1003 339 22903 2059
NM_152414chr831168 128 23 11460 11380 11064
NM_152424chrX84747 4057 4015 3237 3175 1498 1289 851 33105 1133 121 14451 11004
NM_152624chr586421 6095 4978 2741 2653 2020 997 141 25265 294 37021 4558 432 --
NM_152636chr1142559 2296 424 409 1745 22489 391 11902
NM_152695chrX2532 495 21773 453 31742 503 107 11504
NM_152756chr584225 4192 3524 2713 683 436 263 102 --21220 839 --
NM_152835chr132125 893 743 52831 2321 1886 1863 250 --1273
NM_153207chr1243317 3307 1312 986 43036 1406 885 496 13907 1572
NM_153456chr13115716 5131 4340 4062 1979 1750 1458 1132 849 333 260 34482 4251 2531 35217 2174 1332 11271
NM_153836chr242001 1527 1476 602 12139 21656 764 11975
NM_170672chr251823 1636 603 88 53 11451 21225 429 160
NM_172069chr231477 665 237 11765 --22307 489
NM_172071chr177455 6597 5322 5148 4781 1696 810 46807 5856 4873 117 36254 1418 942 15549
NM_173468chr41186 1288 --46079 4455 3879 1758
NM_173511chr253765 3670 2721 469 397 --21252 619 23953 232
NM_173531chr1922439 134 23805 515 12675 33291 783 375
NM_173602chr1293477 3462 3413 3358 3264 2999 2594 1131 987 33016 2733 1255 33598 1117 568 1159
NM_173642chr1129208 8140 8112 8086 7670 6763 6183 1396 1347 1302 1093 202 27407 6209 29198 2539 --
NM_173667chr542262 1903 1610 654 183 32145 1756 66 12176
NM_173851chr8103295 3098 1484 1350 1301 1115 815 743 441 226 34027 3692 352 ----
NM_175061chr721369 758 32165 1850 27 11752 1524
NM_177538chr2138486 8224 7114 6959 6716 5616 5555 3458 2399 1833 1067 864 753 46795 3297 1920 1082 12952 --
NM_178812chr831558 1344 259 --31252 1043 242 11519
NM_181705chr575799 4849 4524 1805 1500 1025 828 11624 24078 2104 35198 4307 211
NM_182485chr422782 1352 1528 11109 21224 32
NM_182515chr1964869 2241 1902 1053 967 105 22014 223 24805 2593 1641
NM_182765chr102923 518 --21901 686 11763
NM_183376chr152759 423 22490 651 --22580 84
NM_194071chr7104846 4741 4722 4598 3923 3874 3535 2098 1651 357 13711 11366 14547
NM_194247chr254366 3208 1569 1199 356 21113 59 11052 24561 173
NM_194314chr134794 3482 404 54417 3414 1577 866 136 24339 509 2751 696
NM_198270chrX42831 2778 2587 367 12222 --12333
NM_198281chr452604 1018 921 455 90 32958 2492 2414 1492 2656 207
NM_198465chrX42651 2629 757 378 22890 460 1648 22598 2275
NM_198581chr234717 2965 1544 1948 11527 26081 2128
NM_199000chr742328 1856 459 86 52269 1998 790 777 290 42159 1527 720 135 --
NM_199320chr432611 1948 227 32513 990 542 --11136
NM_203458chr153490 3253 1522 1330 518 43341 2493 1468 1282 43112 1436 1312 949 --
NM_203463chr294972 3212 1872 1429 1204 975 830 437 218 34501 3683 1032 --33839 1343 816
NM_206853chr633771 3626 321 34112 3241 428 --23074 859
NM_206854chr685032 4887 1582 1272 1264 781 745 681 35373 4502 1689 --24335 2120
NM_213589chr223851 2088 1599 25097 1853 45192 4548 1647 1527