TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-581
miRNA Sequence: UCUUGUGUUCUCUAGAUCAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000109chrX2493 135 1167 --1997
NM_000138chr1542541 2179 490 470 11791 1386 --
NM_000176chr553197 2929 1064 574 468 11433 22904 1308 --
NM_000217chr1284378 3874 1703 1438 1198 882 845 553 --22023 1430 --
NM_000222chr42744 725 --12051 1403
NM_000248chr362812 2789 2116 2072 616 29 1743 12714 --
NM_000259chr1596063 5141 4647 2286 2056 1670 1649 1168 771 11232 14704 --
NM_000321chr1321568 1178 ----1201
NM_000351chrX114085 3040 2983 2697 2666 1486 1004 763 461 285 87 12725 32906 1028 488 --
NM_000362chr2252863 1058 639 434 425 21343 610 22223 1036 --
NM_000369chr1431385 504 464 2623 414 --1521
NM_000533chrX81940 1873 1812 1398 1367 1232 663 50 ----11696
NM_000555chrX116635 6096 5978 5858 5396 4966 3098 3068 2852 2737 1317 --1432 --
NM_000618chr1286196 5730 1814 1634 1085 639 438 61 1582 21000 147 --
NM_000633chr1875106 3901 3209 949 765 162 142 13222 24444 3794 --
NM_000719chr12116713 5863 5160 4871 4797 4731 4710 4640 4541 1812 1432 25721 1392 25229 4259 11500
NM_000806chr541894 1681 1427 471 ----1287
NM_000813chr5175427 5389 5173 4580 4304 4266 4256 4106 2244 2085 2026 1325 1030 1017 953 821 740 --21586 216 15536
NM_000814chr15154189 3998 3412 3134 3042 2599 1527 1442 1346 1222 811 418 384 125 89 1287 198 1211
NM_000838chr662422 1043 619 340 323 268 --12705 --
NM_000875chr15196967 6822 6386 6296 6216 6205 5491 5422 5216 2728 2327 1633 1533 1430 993 798 744 371 91 25638 2243 36242 4791 752 --
NM_000891chr1783646 2728 2416 2288 973 407 134 116 11100 22795 603 --
NM_000899chr1273751 3213 2694 1512 1415 645 392 ----13355
NM_000933chr2051093 428 286 252 53 ------
NM_001001323chr1252409 2005 1988 1175 741 11244 ----
NM_001001395chr1282312 1112 793 671 557 501 319 30 1969 --286 74
NM_001001433chr2072201 2140 954 906 667 390 238 --12995 --
NM_001001668chr1964187 2860 1620 1097 186 77 34084 3916 1419 24048 452 --
NM_001003665chr183537 3495 2675 2209 1005 735 589 69 --11192 --
NM_001003674chr18107070 6874 2622 2033 1761 1611 1521 1226 611 186 36067 5720 1190 12085 15220
NM_001004342chr185977 5241 4644 3907 2329 2230 1059 46 --21139 868 21954 933
NM_001004360chr231278 613 364 --3663 635 161 --
NM_001005404chr1774038 3711 3023 2980 2960 1464 874 31395 987 600 ----
NM_001005463chr1062612 2211 1818 1808 1798 1739 ------
NM_001005473chr5146022 4698 4075 2098 2086 2060 2030 2023 1974 1536 1457 1400 1262 803 11563 ----
NM_001007565chr31164 ----1379
NM_001008392chr363189 2848 2410 2294 445 118 2891 577 23041 2497 --
NM_001008405chr761849 1707 1682 1549 651 405 --1203 --
NM_001008738chr562795 2524 2433 1940 844 62 ----1612
NM_001009569chr105451 367 315 162 143 21408 1030 ----
NM_001009993chr274122 3869 3288 3130 1339 313 128 13992 --11447
NM_001010846chr184319 4306 4246 3418 2936 1812 1633 59 --12895 --
NM_001010853chr693261 3010 2874 2539 2429 2196 2136 1100 568 22742 2576 12423 11061
NM_001012393chr11124976 4238 4048 4004 1885 1782 1698 1661 1114 1100 393 332 ----14983
NM_001013031chr1063523 3439 953 526 123 49 43421 557 428 409 12815 --
NM_001013629chr103740 295 56 1589 2618 389 --
NM_001014286chr133337 233 136 ----140
NM_001014797chr10188204 7850 7795 7692 7666 6989 6336 5969 5935 5908 5709 5504 5121 2507 2282 2125 1928 87 25616 3267 47564 6656 6303 926 12309
NM_001017415chr1145 ----1570
NM_001017440chr7157510 7362 7332 7042 6326 5979 5426 3151 2853 2694 2616 1847 1773 375 78 15900 26711 3094 11163
NM_001018054chr131394 587 296 --1449 11430
NM_001025076chr10106037 5762 4940 4536 4352 3849 2354 1614 873 434 25414 4881 24255 2199 --
NM_001025266chr3114823 4498 4197 4056 3595 1850 1291 1252 719 602 411 --1444 --
NM_001025580chrX83981 3726 2948 2853 2811 2722 2664 1401 13178 --13216
NM_001029863chr6103253 2988 2461 2421 2349 2126 2003 492 321 225 ----22324 1994
NM_001030055chr1443877 3860 1297 914 ----11661
NM_001031679chr1273397 2620 2232 1426 1283 737 240 ----13555
NM_001031716chr221072 967 --1352 1427
NM_001031812chr542188 1958 540 429 ----12034
NM_001032282chr841294 1124 981 176 --1280 1217
NM_001033044chr171862 1849 1764 1722 643 563 265 ----11511
NM_001033117chr353840 3610 3149 1808 648 --34019 3752 1304 --
NM_001033564chr621544 677 --11742 1201
NM_001033602chr1362069 1997 1984 1843 693 604 --21960 820 --
NM_001037553chr2185016 4485 4469 4312 4140 4057 1549 68 --24986 4624 --
NM_001039538chr242967 2481 1436 1396 11168 32546 2384 1025 --
NM_001039577chr184539 4189 4019 3756 3148 3066 2987 669 23492 1781 23557 2853 12926
NM_001039577chr184539 4189 4019 3756 3148 3066 2987 669 23492 1781 23557 2853 12926
NM_001039590chrX84033 3978 3253 3088 2979 2792 2602 316 --12824 --
NM_001039618chr11115614 5181 4653 4084 3651 1597 1544 1182 736 665 162 --13630 --
NM_001039840chrX115702 5597 5022 4645 4226 2172 1949 1656 1317 976 608 --24547 2183 --
NM_001039937chr1353346 2944 1591 680 48 23456 1115 --161
NM_001040142chr272077 1942 843 761 732 585 437 186 ----
NM_001040152chr774631 4276 4152 3963 1937 1542 643 23897 46 ----
NM_001040272chr952354 635 158 52 39 12300 --1432
NM_001040429chr1393407 3094 3023 2806 2682 1285 471 420 147 11410 2955 586 --
NM_001040712chr963457 3122 2771 953 612 135 1371 13581 --
NM_001042404chr181865 1668 1654 1560 485 333 204 79 --1494 --
NM_001042533chr383356 3346 2716 2030 1311 517 475 265 --12658 --
NM_001042599chr2157743 7448 7307 6881 6384 6226 6077 5861 5493 5314 2486 2249 1461 1434 803 26834 5654 11314 12822
NM_001042603chr1262133 1351 903 717 623 497 ------
NM_001042749chrX11538 ----11429
NM_001099678chr396142 5651 4860 4304 3972 2343 1334 1090 202 35328 4397 935 12522 11979
NM_001100108chr1128334 7278 5808 5535 5474 2783 2125 779 685 558 510 276 16036 47155 6623 2731 186 --
NM_001106chr3128778 8180 7646 5972 5891 3630 2771 2221 1043 936 371 102 1959 18045 1449
NM_001148chr452254 2193 2023 1818 683 1456 ----
NM_001149chr1051333 917 895 564 28 ----1270
NM_001167chrX146137 5599 5568 5301 5085 5075 5057 4648 4344 4144 2564 2330 411 268 11660 12450 --
NM_001186chr2142362 2206 1169 124 1171 12272 --
NM_001204chr2135852 5627 4946 4918 4885 4770 4750 4733 4701 1921 1872 1698 433 32932 847 652 27314 2550 --
NM_001304chr1752448 1001 800 417 31 1926 ----
NM_001310chr1243032 2873 608 556 12891 --1273
NM_001364chr1174633 3768 3427 1395 1156 711 141 14505 ----
NM_001390chr1873289 2850 2750 1049 940 385 104 1950 23279 356 --
NM_001432chr473712 3141 3015 2855 2817 1577 1332 13858 1228 11099
NM_001438chr163216 2850 2743 2606 1230 706 ------
NM_001455chr693742 3387 3204 1655 1225 1184 652 578 536 ----21412 54
NM_001701chr951386 1207 1077 599 588 ------
NM_001709chr1162926 605 372 273 202 65 --12839 --
NM_001718chr63860 260 237 21290 502 --11256
NM_001759chr1264572 4131 1587 1485 1118 216 14439 24072 665 13299
NM_001858chr674536 3837 3179 3127 3121 1825 837 33811 3402 1141 24134 3456 --
NM_001957chr472308 841 772 640 455 147 59 ------
NM_001981chr152363 1972 1641 1509 101 ------
NM_002015chr1333273 2848 870 --12219 13231
NM_002128chr133450 283 61 ----1936
NM_002158chr2123682 3022 2688 2511 2453 1076 1028 971 594 535 446 46 ----1461
NM_002214chr7125538 5323 5127 5108 4269 2266 2180 1598 851 757 539 379 2933 81 ----
NM_002267chr1341824 534 502 273 --21679 399 --
NM_002270chr595661 4730 4571 4280 1329 1164 649 536 405 --34316 3773 1529 --
NM_002271chr1342292 660 370 135 --22453 310 --
NM_002501chr1983695 3370 2786 1637 1629 909 479 418 33597 1380 772 12849 33966 3568 2734
NM_002526chr651585 1472 1355 356 338 ----1701
NM_002613chr1654907 1543 201 176 102 43971 3909 1214 835 ----
NM_002655chr884685 4327 4111 3883 3855 1511 632 117 13622 24826 4145 1721
NM_002705chr164744 708 562 310 ----1804
NM_002834chr1243271 3248 2793 1260 --23504 1566 180
NM_002869chr1152250 2217 1923 1664 167 ----1714
NM_003043chr321679 664 43969 3672 893 875 34168 3532 3334 --
NM_003108chr265882 5382 2541 927 509 181 25983 4830 25924 5372 --
NM_003112chr763161 3126 2302 1115 256 176 ----1666
NM_003128chr252488 2164 954 783 572 ----1627
NM_003157chr34711 660 611 326 --1929 --
NM_003161chr1763376 3312 3138 2347 1345 845 ----1135
NM_003205chr1582368 2315 1924 1525 942 279 92 59 ------
NM_003221chr694198 3912 3205 2988 1421 1054 926 126 40 23946 1458 --1330
NM_003298chr385787 5677 5076 2171 1732 1689 980 58 15246 33932 2248 1853 1189
NM_003320chr1194321 4249 3970 3510 3290 3183 910 876 860 54366 4001 1113 334 245 23208 760 --
NM_003337chr571679 1429 1115 1094 636 415 88 --11162 --
NM_003392chr354067 3856 1425 926 843 --13073 23426 252
NM_003463chr652886 2689 2103 2060 366 12549 --1329
NM_003478chr1142184 925 371 106 ----22622 1073
NM_003483chr1252915 2906 1992 256 166 --1248 22686 1158
NM_003603chr442047 1645 503 477 11409 --1738
NM_003648chr242239 665 213 205 --12595 11959
NM_003794chr351105 160 102 92 52 ------
NM_003966chr5156903 6761 6555 5565 5527 4991 4820 3054 2763 1762 1487 1444 1127 1077 691 1414 26458 5941 --
NM_003971chr172403 107 ----1454
NM_004064chr1241077 832 286 149 2942 533 11152 --
NM_004113chr341733 1518 1433 219 ----1116
NM_004171chr11118995 8354 6621 5892 3461 3331 2700 1144 1125 792 393 58800 7139 6503 2458 443 28852 6086 11738
NM_004229chrX12251 ----11765
NM_004392chr1341860 1662 821 227 --1831 --
NM_004464chr472835 1571 1565 1311 1030 230 91 --1492 --
NM_004501chr1114109 3887 3879 3562 3311 3112 3106 2927 2784 1462 1224 298 50 ----
NM_004529chr931420 397 297 2928 362 --1304
NM_004598chr573272 2778 2639 1206 983 965 34 12143 124 --
NM_004612chr934206 3303 555 24671 4442 14189 --
NM_004745chr8106053 5161 4483 2591 2461 2256 1516 1336 974 138 --55706 5405 4599 4452 567 --
NM_004834chr293343 3278 3032 2469 2316 1298 1155 580 406 32256 2196 1102 12956 22925 1233
NM_004852chr182014181 13463 12004 11759 11220 10375 9467 9392 8931 5122 5110 4335 3164 1269 916 775 576 454 123 25 313503 12874 5444 313123 13041 9169 312624 11506 5668
NM_004956chr7104388 4077 2933 1821 1723 898 751 672 296 122 12831 --1350
NM_004985chr12113648 3589 3163 3145 2971 1689 1140 634 449 381 40 --11660 --
NM_005065chr14125334 5283 4953 4496 4421 4216 3647 1282 953 884 346 116 ------
NM_005233chr372607 2332 2214 1713 1685 755 450 --12243 --
NM_005259chr261053 965 613 540 125 86 ----1198
NM_005359chr1894757 4687 2071 1705 1313 1257 787 430 56 11558 25579 4448 --
NM_005458chr972362 2039 2022 1862 1601 875 690 11734 ----
NM_005475chr1293241 3165 3080 2955 1279 1223 1058 542 47 12161 11271 --
NM_005504chr1276458 5421 4194 4056 2349 1140 1008 32566 659 137 15002 --
NM_005530chr1541351 440 432 405 1474 ----
NM_005578chr394921 3647 3317 1462 1051 930 528 386 136 --1575 145
NM_005596chr9176304 6117 5038 4542 4517 4467 2271 2249 1912 1541 1223 1075 767 298 199 129 74 --12183 --
NM_005602chr311202 ----1371
NM_005604chr682583 2568 1983 1684 1582 805 518 397 ------
NM_005668chr594408 4018 3834 3712 2996 1306 1154 658 369 23467 264 ----
NM_005748chr12133458 2877 2607 2410 2193 1222 1051 1010 836 303 126 103 54 13306 1419 11349
NM_005779chr573176 2997 2424 2273 2258 674 162 --12829 --
NM_005853chr163553 172 150 --1398 --
NM_005935chr475022 4962 3421 1685 1370 1346 531 45288 1865 777 118 24549 326 13837
NM_006108chr1131718 1458 944 ----21735 1495
NM_006187chr1252579 2188 2121 764 608 23064 3038 32973 2597 2274 --
NM_006206chr452880 2743 1032 729 321 ----12612
NM_006251chr593256 3011 955 886 873 315 232 132 90 1976 1291 --
NM_006256chr162327 2072 2004 1874 520 429 137 ----
NM_006306chrX135541 5432 5365 5316 5122 4997 4637 4485 4081 4016 2221 2113 2063 ----11836
NM_006320chr42911 793 1125 11141 --
NM_006380chr1751148 933 917 566 549 --1486 --
NM_006393chr1043444 3114 2773 1820 --23089 137 13787
NM_006526chr2061624 1605 1512 851 210 132 ------
NM_006544chr1465781 5718 4564 2127 1127 106 189 --15937
NM_006547chr741771 776 584 102 1430 --11342
NM_006595chr1131934 796 666 --31554 733 26 --
NM_006599chr16137688 7049 6535 6319 5084 3282 3196 2746 2641 1663 1236 980 591 27109 2358 26748 3078 --
NM_006626chr931974 678 129 --150 12716
NM_006628chr1573779 1746 1262 823 741 465 434 1811 22954 215 --
NM_006717chr9103325 3281 1009 919 870 697 521 442 170 60 1612 1449 12499
NM_006750chr16167190 7013 6840 6559 6334 6242 5859 5274 5227 3113 1734 1594 1295 1080 336 71 27132 39 17283 --
NM_006775chr622857 2770 --21223 943 --
NM_006813chr65339 283 136 103 32 ------
NM_006826chr22995 386 --2813 243 --
NM_006873chr262937 2279 2230 1264 496 422 12887 1872 --
NM_006914chr941552 1395 996 222 11480 --1317
NM_006981chr952387 2285 2207 1830 960 --12721 12328
NM_007011chr15126203 6052 5241 5152 4946 2360 2261 1674 1411 705 543 458 25349 5199 24822 4513 --
NM_007106chr1332493 439 355 1732 --11053
NM_007107chr352346 954 494 464 384 22221 263 --2742 91
NM_007124chr631417 1409 434 ----1375
NM_007249chr13187536 7491 6183 6044 5982 5926 5724 3684 3643 3445 2974 2714 2302 2286 1628 872 226 92 18653 ----
NM_007345chr1842197 760 746 544 1619 1471 12104
NM_007347chr1563222 1164 768 747 612 114 1739 13136 --
NM_012081chr543687 2393 1218 489 13538 11291 11119
NM_012104chr1193844 3443 2376 1268 1196 654 569 79 67 32800 2625 1399 ----
NM_012193chr1195039 4501 4197 3758 1991 1615 1493 1004 514 21162 486 1651 --
NM_012207chr10--3722 314 278 123 1760
NM_012214chr275364 4259 1607 1521 1382 1321 431 ----1276
NM_012234chr393583 3270 3007 2939 2907 1394 794 564 297 --1906 --
NM_012249chr262907 2738 2189 1167 568 371 22782 918 ----
NM_012288chr694813 4588 3847 3839 3807 2091 1483 1155 905 ----15053
NM_012302chr141073 931 194 175 ----1389
NM_012382chr543917 2814 1052 547 ----12985
NM_013231chr1494104 4024 3758 3513 3420 1622 998 104 69 11252 13493 --
NM_013372chr1543076 3040 877 205 12165 22247 743 --
NM_014048chr1694849 4377 3877 3525 1801 1083 667 489 210 21849 1305 15186 --
NM_014112chr863727 1409 1329 1315 982 930 24172 289 ----
NM_014117chr1622122 1883 ----11798
NM_014141chr7155221 4925 4784 4670 4663 3398 3361 1405 1057 1024 728 668 659 235 112 24297 3267 11786 --
NM_014253chrX51783 1741 1549 722 53 11012 1232 --
NM_014456chr1071800 1557 728 708 366 112 69 ----11773
NM_014548chr1551588 1090 668 505 117 ----1451
NM_014554chr1282235 2168 1518 585 542 482 464 148 --11483 --
NM_014636chr973812 3724 3306 1303 1160 435 83 1549 --13866
NM_014682chr841912 1624 1586 377 1657 2922 786 --
NM_014707chr761696 1661 790 761 425 220 ------
NM_014810chr113142 32985 1349 1125 12241 12833
NM_014873chr144463 3005 1746 55 11592 11168 13922
NM_014877chr1796770 6471 6454 5139 2931 2764 2568 1183 542 --12100 17258
NM_014932chr361948 1649 460 363 273 170 21324 82 1560 --
NM_014936chr651789 1038 932 874 21 12655 ----
NM_014946chr231887 254 175 ----2367 54
NM_015025chr272633 2351 2321 1969 1872 401 381 1126 ----
NM_015026chr1273408 1795 1694 1376 1100 748 601 24629 1406 ----
NM_015027chr1642027 1789 620 130 --2723 316 11949
NM_015049chr2113201 2975 2890 1044 854 848 712 589 289 276 105 12941 21305 31 --
NM_015059chr1562888 1537 922 781 767 472 --43977 3860 3184 2455 21079 1072
NM_015076chr674151 3877 3755 3552 3452 945 42 --21611 440 --
NM_015077chr1764745 4083 4013 3669 1769 1543 33871 1839 703 14457 13499
NM_015144chr1663685 2852 2745 2528 634 61 --146 --
NM_015192chr2042213 2137 971 200 11110 ----
NM_015206chr1543289 3022 563 274 --13541 1414
NM_015236chr441389 429 353 127 ----1441
NM_015265chr252491 2216 1777 802 394 2300 180 32007 1912 779 --
NM_015268chr31709 --1204 1217
NM_015271chr454315 3856 3004 1419 949 1432 12671 --
NM_015286chr1562329 2162 969 770 681 447 12501 --12292
NM_015288chr563648 3404 2745 511 346 46 23465 955 --13524
NM_015317chr282397 2209 1950 1936 727 645 410 76 ------
NM_015328chr742580 2420 2233 334 ----2466 69
NM_015335chr1272504 2216 1954 1034 658 365 220 21747 338 ----
NM_015541chr31301 2424 139 --2221 168
NM_015554chr1582888 2815 2544 650 613 438 209 42 1679 12599 --
NM_015569chr153419 3344 3214 1661 570 23522 507 --11652
NM_015906chr154448 4364 1734 147 63 --24381 3055 --
NM_015912chr832382 1923 1656 --2651 406 --
NM_016009chr174456 4317 1155 838 749 721 51 24010 1634 34621 1251 941 --
NM_016076chr162948 2543 1187 1057 551 420 1840 22016 257 --
NM_016083chr653240 2927 2569 399 279 127 13772 11329
NM_016206chr3218808 8546 8404 7664 7063 6742 6668 6637 5924 5759 3576 3235 2038 1868 1617 1340 1192 927 920 412 95 48485 6095 5661 5605 27543 373 12433
NM_016277chr641303 1078 306 80 11050 1274 --
NM_016289chr222013 587 1580 12206 --
NM_016322chr963102 1162 835 821 807 147 --23006 557 --
NM_016396chr1552693 2503 2448 847 785 22329 1214 --22630 320
NM_016531chr443695 2956 1666 310 ----12644
NM_017420chr14123693 3615 3298 2797 2579 2495 2430 1191 1149 441 389 68 ----21468 124
NM_017551chr1072413 1886 1743 1652 219 112 79 ----165
NM_017594chr953267 3187 3171 2826 517 --33326 3095 849 12847
NM_017596chr194565 4196 3925 3824 3031 3009 2985 1429 333 1732 13846 --
NM_017628chr484888 4529 4288 4275 4201 4068 4011 4002 21136 354 24537 1752 --
NM_017633chr653826 2845 2608 1086 633 --1919 22489 291
NM_017637chr9219378 8874 7479 6876 6550 6167 6069 3575 1906 1580 1245 1168 1050 1043 1026 1004 985 955 838 804 325 --16314 --
NM_017643chr1763132 2857 2795 2296 2168 2021 23095 2028 11209 146
NM_017658chr1464096 4080 3545 296 185 85 --14307 --
NM_017666chrX62022 1949 680 627 503 87 --1449 --
NM_017694chr221522 412 21348 481 158 1158
NM_017704chr1141034 1004 730 641 1837 --1301
NM_017776chrX31326 565 556 --1312 1383
NM_017813chr885782 5558 5110 4763 4584 3578 1562 317 1472 1245 --
NM_017847chr172094 1823 1773 1483 874 455 158 --32199 1462 648 11901
NM_017902chr1064948 4865 1464 729 690 674 22142 1919 12083 22170 710
NM_017919chr9105491 4612 4239 4149 4032 2160 1426 642 485 473 45738 5243 5063 3994 21858 89 --
NM_018027chr1063066 2637 2626 1150 967 722 --22709 802 --
NM_018092chr1631398 1131 478 --21316 472 --
NM_018105chr83940 491 437 --1968 --
NM_018243chr494070 3482 3404 3155 3117 2697 2518 1002 440 12509 ----
NM_018293chr342247 1942 1163 1142 11157 ----
NM_018327chr2041862 1578 64 26 2740 715 ----
NM_018364chr164017 3111 2676 2497 421 160 ----11371
NM_018416chr1262603 2353 2257 1979 1858 898 ------
NM_018440chr8168229 8141 7941 6929 5763 5742 3490 2630 2145 2050 1343 1210 1005 896 493 79 25638 3296 11195 13242
NM_018490chr1121862 1672 2337 301 11429 1550
NM_018557chr261448 1331 1315 1297 618 511 ------
NM_018566chr194854 4839 4009 3763 3645 1452 1331 661 99 24922 1364 13901 --
NM_018638chr1254170 3534 3510 1627 903 --21596 1410 --
NM_018704chr151925 713 606 562 436 --21486 533 --
NM_018717chr4102747 1975 1968 1007 792 673 490 477 415 196 --12217 --
NM_018847chr941512 1295 640 589 --11647 --
NM_018993chr2051468 1268 1192 1078 135 --31300 327 169 --
NM_019083chr171431 1303 605 528 473 307 292 --11335 --
NM_020122chr2125308 5087 5040 4958 4763 4233 2259 2018 1623 561 499 459 25751 2144 35644 1801 433 15443
NM_020140chr12------2256 238
NM_020144chr761885 1835 1772 1389 568 81 ------
NM_020182chr20103635 3556 3348 3236 3048 2387 1063 905 367 172 ------
NM_020337chr442515 2304 2147 752 ----1233
NM_020390chr374026 3096 3051 1913 688 475 93 11935 ----
NM_020466chr694758 4357 3546 3508 3039 1059 422 259 76 11823 13356 --
NM_020640chr362146 889 798 339 284 48 1372 1845 --
NM_020673chr2066962 6785 6374 4735 3033 2968 11501 27108 2910 --
NM_020699chr185182 4890 4344 4058 1201 1068 1054 474 ------
NM_020752chr1042423 1775 598 339 --21174 835 11121
NM_020772chr17158047 7959 6818 5656 3256 2871 2786 2101 1791 1431 1412 1387 827 134 109 22361 122 35839 3467 65 --
NM_020783chr181755 2567 217 --1720
NM_020791chr1751406 1384 1164 1123 1045 ------
NM_020796chr542027 1884 462 357 --2691 151 --
NM_020801chr551852 1830 965 682 443 ----22388 1007
NM_020830chr253302 3047 2053 639 356 --1772 --
NM_020850chr1683266 2946 2515 2001 809 632 422 225 12890 12500 --
NM_020871chrX51871 1797 1679 906 444 12357 ----
NM_021033chr1393389 2866 2832 2724 1402 1353 1124 723 336 31337 931 429 ----
NM_021038chr352550 2527 1003 848 110 1129 ----
NM_021083chrX53118 3013 225 65 26 --22582 84 --
NM_021097chr272969 2368 2291 1084 1005 706 49 --11193 --
NM_021116chr7228812 8770 8359 8195 8130 8123 7912 6963 6714 6628 6363 5706 2979 2731 2573 2487 2005 1628 1580 1273 566 542 12212 161 --
NM_021205chr152625 2149 1028 954 701 --22769 424 --
NM_021240chr91150 ----1662
NM_021255chr1443732 2515 1107 527 13566 24086 2608 --
NM_021961chr11115444 5319 5127 2383 2299 2176 1639 1221 483 421 391 15142 34844 443 108 --
NM_021977chr653701 2420 1360 511 210 23276 3138 13433 --
NM_022048chr1596098 4885 4855 4715 2528 2220 2198 2180 2023 15147 1620 --
NM_022143chr751283 492 247 240 46 ----1417
NM_022459chr1396281 5633 4666 4425 1999 1433 1363 1167 915 --25523 794 --
NM_022473chr1552977 1402 585 418 139 13017 33683 3648 66 14454
NM_022841chr1552607 2358 1704 1057 736 1274 1787 --
NM_022843chr132553 23 1353 --1942
NM_022898chr14114575 4090 3277 2944 1940 1820 1104 1079 996 944 378 24723 1788 34406 1933 754 --
NM_022912chr282539 2481 2086 1087 769 655 454 147 1824 12575 --
NM_022918chr1152076 1967 849 270 66 ------
NM_024007chr532234 2075 1093 --32575 342 69 --
NM_024090chr481677 1669 1560 1490 420 411 121 71 --1486 --
NM_024639chr6--1259 1272 12376
NM_024646chr1103907 3530 3386 3307 3214 3184 2857 2796 2592 958 22419 33 1364 --
NM_024674chr183263 3234 2553 2526 2501 2493 1224 1078 22924 1161 13192 --
NM_024721chr882374 2202 2111 1079 675 570 431 251 ------
NM_024749chr162198 2065 1783 1702 830 550 31580 1525 810 --1648
NM_024761chr9105299 4848 4198 3734 3724 3717 1843 1107 935 271 11941 15084 --
NM_024817chr15105884 4984 4534 4318 4238 3908 3640 2002 1127 541 14917 25772 3947 25080 179
NM_024887chr161607 816 799 579 334 216 --21891 679 11404
NM_024913chr751579 1448 1417 580 152 ----11282
NM_024939chr1661634 1540 1130 1109 1090 587 11101 11176 --
NM_024949chr493136 1993 1649 1631 1262 751 685 660 242 13713 14332 13190
NM_025054chr873675 3388 3329 2927 1393 1251 478 1952 14167 --
NM_025160chr151428 1207 1071 776 665 12657 --1849
NM_025179chr184936 4768 4326 3564 1059 716 622 276 23103 3018 14087 --
NM_025191chr163433 3232 3157 3078 1221 953 ------
NM_025235chr1051559 384 366 344 104 --21742 905 --
NM_030621chr1453429 3044 1113 1085 219 1262 --13492
NM_030625chr1051766 423 395 379 237 ----1704
NM_030806chr1129056 8813 6610 6328 3580 3501 3132 3035 2586 1784 1289 1122 26836 1443 ----
NM_030809chr1241765 1725 1645 394 22071 288 12405 21854 340
NM_031442chrX62744 2698 2460 981 358 191 --12485 --
NM_031445chr243161 1376 561 524 33194 2317 779 22417 1109 --
NM_031483chr2033123 2490 233 33561 2916 1179 --1385
NM_032153chr362510 2114 833 216 90 22 --1255 --
NM_032160chr1864363 4056 3427 3175 909 474 --11240 --
NM_032217chr451239 1055 401 261 54 --21285 956 --
NM_032268chr1662884 1202 1048 905 699 418 ------
NM_032373chr10205571 5432 4704 4560 4451 4153 4015 3850 3580 2257 2006 1774 1580 1433 1196 970 640 588 214 97 25723 419 ----
NM_032457chr483800 3381 2936 2786 2527 1301 730 357 ----13088
NM_032505chr382765 2414 2378 2102 1005 711 437 63 1849 ----
NM_032509chr862598 2456 2072 1848 495 116 --21656 541 --
NM_032727chr1031667 1648 1134 ----1405
NM_032804chr1072552 2068 1714 1614 592 323 54 11731 11762 --
NM_032818chr952412 2166 1972 392 275 12539 --1791
NM_033224chr7116732 6534 6425 3032 2790 2145 1878 1825 1789 863 138 1841 ----
NM_033225chr842540 646 452 136 --1711 12364
NM_033505chr275655 5135 4850 4383 1924 1606 1125 ----11853
NM_052867chr1341045 1030 247 158 1116 --21491 579
NM_052917chr22639 124 --1745 1198
NM_052937chr842649 865 703 145 ----1530
NM_080546chr971744 897 558 450 238 140 56 --11503 --
NM_133334chr485288 5265 4968 4913 4808 4010 3931 131 11983 --1501
NM_138426chr752072 1900 899 773 439 --12459 --
NM_138782chr582395 2266 1722 801 504 431 410 353 ----11792
NM_139321chr20124236 4191 3884 3795 3631 3125 850 783 769 374 150 31 ------
NM_144599chr1574765 4341 3626 1803 1433 1003 888 14101 ----
NM_144710chr271510 1153 347 277 196 161 38 --1174 --
NM_145011chr1041863 1645 698 421 ----31495 303 64
NM_145251chr1431430 464 246 --190 157
NM_147128chr751287 599 436 374 228 --1240 --
NM_147156chr1051364 523 318 253 237 ------
NM_152409chr553334 3264 2190 1329 83 1480 ----
NM_152519chr261766 1570 702 431 349 171 --2748 572 --
NM_152624chr597368 6009 5678 4977 4952 4577 1089 1074 223 --1160 1431
NM_152636chr1133077 2898 2074 32488 424 409 12612 1390
NM_152680chr451684 1549 594 530 85 ----1119
NM_152695chrX42330 291 222 30 --2600 501 11502
NM_152723chr1141101 389 270 107 ----1202
NM_152756chr573872 2973 2963 1510 1411 1085 364 ------
NM_152787chrX42413 1232 586 269 --13623 1748
NM_152903chr1342379 649 476 314 22445 2354 11875 --
NM_153365chr452465 2268 2249 2105 1794 22341 181 1483 --
NM_153487chr6114708 4651 4419 3747 3501 1666 775 721 601 253 235 13852 11394 --
NM_153607chr552958 1108 560 348 144 12118 12260 --
NM_153634chr1241054 1034 526 309 21143 489 ----
NM_153686chr472444 2265 2012 1943 1698 601 294 22025 530 12457 --
NM_172071chr197454 6956 6206 5756 5590 5560 5252 4565 140 26253 5547 ----
NM_173359chr341835 590 448 226 1355 ----
NM_173531chr1983792 3720 3598 2978 2703 1524 215 48 1373 22838 485 1134
NM_173559chr62440 201 ----1469
NM_173602chr1293501 2843 2753 1183 1095 884 577 471 370 ----2567 157
NM_173683chr881801 1559 1462 1194 611 440 212 95 ----1279
NM_173698chrX51524 1492 1346 656 337 11990 ----
NM_173808chr174258 4171 3418 2719 1634 1023 623 11048 23032 387 11674
NM_173825chr353044 2762 2285 785 630 13034 13055 1529
NM_175061chr751734 1589 757 539 468 11751 --11369
NM_175768chr671735 1710 1670 1618 384 232 118 --1111 --
NM_175921chr553521 2950 2931 2697 1331 --23099 333 --
NM_177968chr252021 1960 1679 1665 376 --179 --
NM_178566chr961849 1786 1760 548 299 232 ----1181
NM_181504chr574076 3566 3119 3110 716 551 270 --12587 12951
NM_181784chr252208 1988 1700 967 40 --12539 11597
NM_181836chr552225 2142 2104 798 628 --22308 923 --
NM_182485chr483411 2475 2317 694 584 478 312 157 11222 --11108
NM_182734chr2042460 2384 1218 447 1185 12078 --
NM_182765chr10102207 1744 874 652 561 455 385 289 275 187 2923 685 21912 421 --
NM_182830chr1462276 2165 1905 1707 352 203 --1714 --
NM_194285chr1123309 2641 --11337 13429
NM_197941chr532828 2175 1182 --1251 21933 881
NM_198859chr343530 661 587 219 24919 4273 --14442
NM_199320chr452412 2278 2263 347 106 1227 --12611
NM_203458chr1103833 3617 3294 3155 1044 912 897 592 382 332 1948 2542 361 --
NM_203463chr264254 3991 3172 1304 864 663 --24792 217 --
NM_207015chr35684 610 542 351 44 --11881 --
NM_207380chr1583655 3338 3115 3093 1135 978 550 306 32744 2707 2316 --13148
NM_212554chr1051363 1234 159 140 129 --11420 1199