TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-586
miRNA Sequence: UAUGCAUUGUAUUUUUAGGUCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX76988 5912 2299 1239 1041 1031 696 ------
NM_000110chr11478 --1415 11173
NM_000125chr663141 3110 2736 949 325 105 14147 1508 --
NM_000129chr621502 1147 --11447 --
NM_000138chr151453 1752 1806 21044 707
NM_000163chr53673 385 211 ----1318
NM_000188chr10----1288 --
NM_000217chr1275105 4703 1534 1494 996 860 473 --44515 1156 464 144 11052
NM_000223chr17----1373 --
NM_000232chr462877 2843 2331 2027 441 55 --1455 --
NM_000248chr382973 2846 2174 987 580 556 391 370 --23029 470 --
NM_000252chrX31111 970 437 11018 21534 1343 --
NM_000259chr15155811 5644 4779 4737 4448 4196 3973 2376 2283 2271 2168 2086 2046 879 661 --24832 3955 1986
NM_000314chr1022938 1151 1218 22543 487 --
NM_000328chrX1381 ----146
NM_000332chr676464 5723 5064 4858 1630 927 748 26897 170 36443 6042 2006 16840
NM_000362chr221627 --13506 13582
NM_000376chr1243114 2897 2845 2600 --21223 355 --
NM_000390chrX82839 2608 2321 2172 884 384 296 267 ------
NM_000393chr251688 1540 1514 833 530 11497 ----
NM_000408chr283168 3144 3013 2854 2826 2172 1260 242 1382 12682 --
NM_000430chr1741071 905 163 44 11063 12810 13681
NM_000441chr772319 2132 1955 1629 769 649 523 1820 2465 59 --
NM_000448chr1173155 2914 2855 2544 2482 2396 657 --32488 2187 578 --
NM_000459chr92827 153 ----1312
NM_000461chr3124206 4177 4143 3994 3982 3513 3246 1399 1046 1019 545 165 --23867 1418 --
NM_000480chr1131486 1056 574 ----11230
NM_000489chrX11010 --11247 12706
NM_000531chrX------1303
NM_000538chr1341400 674 167 135 --21143 127 --
NM_000555chrX96451 6316 5881 4957 1700 1680 1486 1086 254 --47468 6903 6644 6580 12818
NM_000557chr20------1529
NM_000586chr4----182 --
NM_000598chr71625 --11461 --
NM_000599chr294639 4460 4401 3854 1690 1531 1434 456 196 1761 1665 --
NM_000600chr7------1385
NM_000609chr1043163 2192 936 875 ----13121
NM_000618chr1296505 6285 6271 5914 5343 1418 1100 682 622 --46562 5608 4555 313 15035
NM_000627chr21912 --165 --
NM_000633chr18124536 4523 4249 4231 4045 3750 3543 2030 1821 1758 1224 65 1605 ----
NM_000686chrX1130 ----11528
NM_000721chr162442 2322 1667 854 123 23 21019 505 ----
NM_000783chr10------196
NM_000788chr441304 1202 1008 242 ----11465
NM_000806chr511436 31960 767 518 1590 --
NM_000807chr42481 157 2114 31 ----
NM_000809chr468863 8170 7699 7608 6349 42 48204 7107 2914 1920 39280 7292 816 38642 8068 2939
NM_000813chr595419 5393 5337 4758 3910 3471 1528 1342 673 23424 1801 11831 --
NM_000814chr1523035 187 31034 1024 293 ----
NM_000824chr41836 2207 199 2753 365 --
NM_000826chr482238 2187 2147 2094 2076 1884 1735 991 12273 31854 775 108 --
NM_000828chrX41441 631 625 202 --11848 --
NM_000844chr31963 --31099 756 743 --
NM_000868chrX72454 2052 1985 1953 1944 1902 90 22469 315 11822 --
NM_000872chr1041253 1033 303 57 --1372 --
NM_000891chr1773084 2890 2871 2802 2563 2510 1373 --13245 1731
NM_000899chr12124211 3537 3481 3286 2948 1615 1503 1408 1185 1052 925 650 22981 2760 24218 3010 --
NM_000901chr431727 1685 901 2917 723 11691 --
NM_000912chr833517 502 150 --22700 2602 13477
NM_000949chr5183 ------
NM_000959chr153618 1556 827 486 345 12963 22909 1295 --
NM_000990chr1174061 2966 1154 481 294 259 94 --21339 885 33834 3663 2824
NM_001001132chr2141412 559 487 92 ----11021
NM_001001323chr1252713 2482 1158 801 420 12757 12507 --
NM_001001395chr1272670 2080 1841 1777 1055 324 215 --21007 300 --
NM_001001481chr852793 562 305 223 150 --32555 1391 414 12591
NM_001001484chr1072398 2227 2054 1854 1630 904 805 32162 2077 838 11779 --
NM_001001664chr264080 3500 1411 802 713 317 11153 12528 11357
NM_001001668chr1993871 3306 2694 2642 1343 1325 1130 1045 876 12819 22876 1474 --
NM_001001669chr541673 1081 941 258 --22397 2321 12203
NM_001001890chr2153516 1640 823 772 455 13814 1892 1523
NM_001001995chrX31249 143 98 21750 1295 11366 --
NM_001002243chr22896 203 ----1159
NM_001002259chr12------1238
NM_001002814chr831513 375 322 12567 12608 --
NM_001002860chr1463536 3477 1553 730 442 420 11720 --11362
NM_001003652chr18128607 8284 8270 8156 7914 6950 6538 2053 1965 1701 1154 38 --28117 318 1957
NM_001003674chr18126268 5510 4735 4630 2469 1538 1381 1076 986 938 541 321 15163 1805 15071
NM_001003712chr1293961 3929 3263 2554 2522 2499 1030 662 128 1278 --23397 3137
NM_001003794chr353067 2195 2127 1930 40 ----1820
NM_001003800chr983550 3504 2416 1382 1056 807 562 103 ------
NM_001004065chr993963 3676 3489 3461 2997 2666 1462 1211 99 ------
NM_001004106chr51254 ----1269
NM_001004317chr6103779 3445 3383 3275 3257 2857 1814 1165 289 228 --34380 4041 1553 --
NM_001004342chr185141 4670 4628 4468 3946 2403 1179 558 --25652 1017 --
NM_001004346chr431043 376 161 --1417 --
NM_001004419chr1284442 3831 3140 2828 1646 1517 1300 1157 ----1912
NM_001005290chr1----1549 --
NM_001005473chr586607 6268 6181 5357 4157 1743 734 569 --24026 2400 12362
NM_001005609chrX23148 3113 ----13786
NM_001005743chr1431294 338 21 ------
NM_001006600chr552267 1559 817 806 642 1491 ----
NM_001006610chr16--1222 ----
NM_001006635chr22241 136 --1127 --
NM_001006681chrX------143
NM_001007245chr73637 449 140 1205 158 --
NM_001007246chr215566 442 308 86 58 --21806 1306 --
NM_001007277chr11----11005 --
NM_001007466chr694824 4817 4658 1958 1241 703 545 461 124 14832 44998 4725 4012 1086 13556
NM_001008225chr73684 662 549 1627 --195
NM_001008388chr4----1204 --
NM_001008408chr7116338 6069 5157 5142 5049 4917 2070 1833 840 498 422 14571 25002 284 --
NM_001008491chr22197 70 1300 12005 --
NM_001008495chr841593 354 191 185 --1553 --
NM_001008660chr1141568 1393 1350 430 --11315 --
NM_001008707chr1461857 1381 1353 1330 1281 215 ------
NM_001008925chr493539 3291 2554 2490 1363 1087 786 273 116 23070 3032 ----
NM_001009552chr8163 ----1435
NM_001009554chr424401 404 125 --14482
NM_001009899chr386471 5808 4532 4386 1379 158 138 60 36328 5092 1811 26402 48 1599
NM_001009955chr1----1237 --
NM_001009993chr254550 1611 1177 411 348 --31511 425 293 --
NM_001010846chr184640 4183 3852 3713 1835 1582 1250 189 13415 ----
NM_001010861chr122187 754 --2965 679 --
NM_001010942chr1241179 1079 362 299 1864 ----
NM_001011513chr413728 23457 3043 23964 3091 13987
NM_001011515chr41196 --11001 --
NM_001011663chr10181 --21100 176 --
NM_001011666chr776610 6556 3983 2228 1936 1381 50 24242 2594 12497 --
NM_001011708chr262527 2081 473 299 182 83 --1368 --
NM_001012398chr161879 21024 137 1181 --
NM_001012418chr673457 3262 3222 1436 766 405 330 34252 4239 4179 ----
NM_001012423chr1582935 2864 2685 2607 2497 2010 1964 1850 2379 259 42304 1910 1902 992 --
NM_001012755chrX64058 3645 3547 3166 1625 845 14935 ----
NM_001013031chr1073227 3014 2940 2862 1053 319 156 13393 13482 13259
NM_001013406chr72639 43 21169 422 ----
NM_001013620chr12148345 8310 7469 5510 5133 3271 2875 2683 2445 1865 1436 1414 1063 376 1299 47136 6069 5882 671 1554
NM_001014449chr16----1161 --
NM_001014797chr10198254 7752 7558 7213 7094 5499 5441 5230 5110 2414 2382 1702 1588 1406 1299 920 612 454 305 35036 605 361 11933 --
NM_001014812chr151442 ----1300
NM_001015877chrX42201 2098 1167 394 23017 2418 22977 1948 --
NM_001017371chr231198 1104 274 1439 1297 11255
NM_001017926chr891494 1480 1397 1324 1144 569 546 238 200 ------
NM_001017969chr93628 468 455 --1150 1575
NM_001018037chr921178 245 --21221 1150 1580
NM_001018053chr181962 1895 1663 1649 724 708 366 360 ------
NM_001018067chr175114 4017 3894 2030 526 299 258 14798 1217 --
NM_001023567chr1521709 1565 1259 42234 1931 1580 1000 --
NM_001024647chr12127673 7360 7010 5896 5541 4725 2875 2079 1866 1256 630 225 1994 32510 2419 336 --
NM_001024649chr562764 2451 940 925 491 245 --1345 --
NM_001024847chr332446 2373 2205 ------
NM_001025076chr1075776 5631 3905 2333 1382 750 714 14504 23889 3769 --
NM_001025079chr374097 3854 3189 2615 1417 1304 896 11282 14064 --
NM_001025108chr2124000 3851 3824 3578 3519 3104 3096 2769 1174 1121 871 541 13175 34085 2988 674 13705
NM_001029863chr672922 2847 2425 1280 1229 1214 667 13236 12204 1942
NM_001029875chr53789 281 250 --22567 324 1679
NM_001029884chr661881 757 605 573 323 167 22553 82 22681 2151 --
NM_001029998chr431095 519 243 1407 1153 299 32
NM_001030007chr1673969 1477 1469 840 622 592 502 12901 13232 --
NM_001030051chr682157 2020 2003 1440 855 485 268 161 --127 --
NM_001030055chr1474591 3419 3314 3086 1706 765 57 33371 3150 1570 --14204
NM_001031623chr61228 1570 1106 --
NM_001031679chr12123331 3314 3192 3071 2920 2888 1161 1006 681 389 166 39 --13141 --
NM_001031684chr211277 1384 2483 173 --
NM_001031695chr2264139 1961 1359 857 232 182 12099 2376 282 --
NM_001031712chr6175 ------
NM_001031804chr1673929 2704 1599 1211 1129 1001 888 --11519 --
NM_001031812chr542211 824 757 739 11503 21602 784 --
NM_001032280chr611067 --21629 1327 --
NM_001032283chr121120 ----1299
NM_001032380chr1041771 1545 535 143 21880 239 21688 1634 --
NM_001032730chr1------162
NM_001033057chr341693 478 190 139 11937 11377 1220
NM_001033117chr384545 4096 3607 3108 3066 1391 1179 433 2384 370 23993 1813 --
NM_001033557chr221340 1065 --11400 --
NM_001033578chr852337 2038 1845 1608 516 189 1139 11590
NM_001033925chr1061558 1532 1510 1429 1356 851 --31779 1576 505 --
NM_001037132chr782094 2068 1643 1559 870 307 252 186 1498 1738 1195
NM_001037164chr731399 709 175 --21657 644 --
NM_001037339chr111737 --31851 1813 1748 --
NM_001037553chr2164101 3737 3695 2039 725 74 25090 3375 24430 4153 --
NM_001037954chr1151276 1238 1008 354 199 ------
NM_001039585chr143875 1084 743 602 13220 33166 1552 155 --
NM_001039590chrX43085 2770 2493 517 11573 --12750
NM_001039618chr1175302 3867 3783 3742 1921 1787 1035 --21663 466 --
NM_001039840chrX76067 5879 4286 691 612 581 227 22071 236 11380 11819
NM_001039937chr1373984 3431 2960 2662 1609 1469 96 13024 1467 --
NM_001040142chr242314 2091 1710 774 4826 798 790 782 12140 1122
NM_001040151chr1131780 1049 119 --34059 1502 761 11622
NM_001040152chr764708 4500 3732 3365 719 452 14736 ----
NM_001040159chr41428 21507 1014 11483 --
NM_001040214chr651841 1493 598 463 129 22011 1780 32341 1875 1852 --
NM_001040402chr412253 --1329 12946
NM_001040429chr1342986 2405 984 677 ----21260 1048
NM_001040450chr1532448 937 570 11994 12151 12422
NM_001040624chr862381 1089 1036 922 759 650 --21003 799 12274
NM_001040633chr74962 855 333 252 ----199
NM_001040712chr953160 2693 1276 1240 1095 43405 2849 2602 931 1577 11296
NM_001042355chr1655384 4685 4442 1156 351 21595 1242 34697 3956 274 --
NM_001042406chr62794 170 11094 ----
NM_001042414chr13----1100 --
NM_001042481chr1432054 254 205 12351 42060 1900 741 611 --
NM_001042494chr1553737 3210 1508 866 490 23606 3563 ----
NM_001042533chr342893 1183 799 158 140 2680 276 --
NM_001042537chrX22313 993 11913 21744 84 --
NM_001042550chr951865 1722 471 337 44 1221 11434 --
NM_001042555chr1283690 3428 3320 3071 367 158 134 57 24006 1825 ----
NM_001042601chr383103 3069 2828 2627 1169 980 447 349 12956 ----
NM_001042604chr354065 3112 1907 306 88 13953 24744 4047 --
NM_001042646chr341835 1730 1288 84 --31972 1768 697 --
NM_001042681chr11895 --1148 12544
NM_001042762chr721058 165 --1873 11085
NM_001043351chr1----11935 2410 249
NM_001044385chr2--179 2545 63 --
NM_001046chr542921 2830 2453 2371 --12481 --
NM_001071775chr1361843 1764 1257 431 262 76 1520 --11862
NM_001079874chr111839 --11649 --
NM_001099678chr385830 5300 4885 4315 2581 1938 1721 1556 34434 2316 2275 22002 718 11257
NM_001102566chr1170 ------
NM_001106chr3169698 9208 8464 8227 7833 7704 7324 7193 6565 2984 2581 2532 2068 1537 272 108 16887 27756 1759 --
NM_001116chr1672720 2710 2411 2375 2305 1077 691 12365 23082 1905 --
NM_001121chr1041750 1529 1396 1325 21759 1519 11680 11873
NM_001146chr84884 846 741 428 --11516 --
NM_001148chr442250 2169 1999 1742 --11431 1554
NM_001174chrX11881 ----22154 1869
NM_001198chr622420 2071 21543 1506 1454 --
NM_001200chr20----1241 --
NM_001201chr473835 3828 3563 2856 2429 563 196 23699 2706 22510 100 13912
NM_001204chr277017 6298 5742 5068 4783 2729 2139 27275 5897 1324 12884
NM_001222chr1061887 1628 774 327 277 144 --1782 --
NM_001231chr1----1463 --
NM_001241chr262419 2396 2011 792 580 505 --1933 --
NM_001259chr7115667 4658 4531 4439 3938 2378 1854 1304 715 411 182 --23909 1751 --
NM_001265chr13----1716 --
NM_001278chr1041028 383 343 226 ------
NM_001289chrX61610 1494 1486 1183 1120 593 ----21092 290
NM_001304chr1753461 2994 2634 1356 1216 --22333 1489 --
NM_001326chr11----1441 --
NM_001332chr551541 1355 1123 1014 620 145 2488 34 --
NM_001356chrX52369 1922 734 690 306 22451 703 ----
NM_001364chr1184418 4075 3555 1914 1903 1648 1293 133 34679 4653 4094 21019 806 1732
NM_001390chr1863122 3108 2711 1259 1091 215 ----1248
NM_001391chr182913 118 --31170 897 58 --
NM_001401chr961604 1587 1431 1158 992 552 --1561 --
NM_001402chr641257 644 509 384 --1123 --
NM_001412chrX83369 3308 2563 2434 777 275 214 101 --13032 13449
NM_001432chr493609 3363 3150 1552 1175 1075 1064 486 122 12940 33921 3620 2950 42986 2978 2725 178
NM_001438chr153581 1320 1149 720 696 11135 13550 --
NM_001451chr1631198 493 156 ----11319
NM_001453chr631547 1281 492 --11244 11152
NM_001455chr694862 4726 4509 4450 4050 3859 1983 1563 427 21453 693 14502 11519
NM_001495chr8--1999 11100 --
NM_001498chr621284 310 --2215 25 --
NM_001541chr11----1124 --
NM_001616chr253012 2739 2416 780 261 13191 13503 --
NM_001621chr742756 1955 1917 114 23001 586 12677 12306
NM_001627chr31853 2652 377 11613 11633
NM_001635chr72161 133 ------
NM_001650chr1863533 3194 3024 1422 842 828 1499 33834 2844 1146 12579
NM_001656chr521685 1443 21506 105 11740 --
NM_001663chr1482790 2213 2059 1879 1803 739 690 387 ----1986
NM_001664chr31785 ------
NM_001681chr126638 576 509 88 51 30 ------
NM_001690chr362454 2390 2337 2241 671 534 ------
NM_001695chr864155 2920 2625 1237 1183 303 ----13442
NM_001717chr15----11433 --
NM_001729chr4----1117 --
NM_001730chr1311087 ----2217 126
NM_001743chr2--1116 ----
NM_001755chr1632150 2021 1667 --21707 1452 --
NM_001797chr161504 --1650 --
NM_001806chr1952619 2569 2168 1931 451 --11037 11951
NM_001827chr9186 ----144
NM_001830chrX73059 1436 1293 1111 1025 844 93 --13376 11133
NM_001920chr122703 264 1132 ----
NM_001944chr1862377 2354 2032 1823 1676 329 --12291 --
NM_001949chr653129 2912 2245 2040 483 22642 2311 1439 12578
NM_001956chr1----1578 --
NM_001957chr432170 1480 1462 --22123 907 11531
NM_001977chr441652 1465 1285 1195 --11108 --
NM_001980chr1261662 1563 848 412 319 201 --42131 1469 1410 129 --
NM_001981chr132429 1907 1882 22011 1988 21892 491 --
NM_002024chrX61884 1808 1742 1661 1386 590 --1676 11558
NM_002025chrX129306 8562 7788 6080 2613 1940 1633 1513 1446 819 360 233 18074 29287 6479 --
NM_002048chr921228 1158 --21237 937 21081 881
NM_002054chr21317 --1449 --
NM_002061chr1------1341
NM_002069chr751624 1333 663 290 94 1515 3278 111 26 --
NM_002126chr1753937 3538 3437 1305 139 --32657 1487 840 --
NM_002128chr132336 94 12369 1907 --
NM_002137chr731631 737 165 22350 125 12147 --
NM_002140chr91444 ------
NM_002158chr243804 1061 417 329 ----23518 3059
NM_002196chr2031033 412 370 ----1749
NM_002203chr543279 1476 1245 1077 --23976 3461 13817
NM_002211chr103364 119 35 1130 1867 --
NM_002214chr7105748 5595 4787 4178 4115 3923 1213 694 588 276 14004 25687 5303 --
NM_002228chr121175 904 --11273 --
NM_002233chr11166 157 --1103
NM_002242chr21218 --123 --
NM_002245chr1185 ----1511
NM_002247chr1092252 2111 2075 1506 869 732 353 145 133 11985 ----
NM_002267chr1362224 2209 2171 1619 1600 789 1393 --1192
NM_002270chr561743 1622 1464 878 857 786 34784 4233 3700 44798 4510 4179 2087 --
NM_002293chr152728 2554 2271 624 322 --1475 --
NM_002310chr5106570 6507 6073 5022 2237 2092 1701 1382 546 164 --21953 1507 --
NM_002356chr682542 2271 2045 2020 1130 1048 781 535 22793 451 ----
NM_002376chr142511 173 ----167
NM_002384chr183814 770 230 --1804 --
NM_002397chr542198 1983 1721 86 --1287 21367 422
NM_002408chr141641 --1598 --
NM_002451chr933814 3775 1153 1514 21411 429 13498
NM_002470chr17------143
NM_002482chr1----151 --
NM_002500chr251274 1176 195 134 104 --1992 --
NM_002522chr1763876 3753 3588 3095 1404 995 --13559 13722
NM_002581chr955416 4996 4786 4428 2044 24954 352 25040 3585 14170
NM_002595chr1231600 619 477 --2401 296 11909
NM_002607chr791059 1019 939 855 824 808 430 368 180 ------
NM_002612chr741741 468 228 182 ----12064
NM_002645chr1172777 2707 2017 2011 1934 780 431 33072 2549 54 --12992
NM_002655chr894450 3300 2043 1877 1862 1799 1349 869 398 15021 45040 4613 1272 34 14345
NM_002670chr321082 70 --1395 --
NM_002709chr242913 2591 1051 259 ------
NM_002719chr1452407 1810 1628 1615 937 --12288 --
NM_002731chr113041 --13005 --
NM_002740chr352784 2117 1065 428 22 12676 22483 48 12843
NM_002742chr143632 581 140 --2504 265 1523
NM_002745chr2273538 3282 2916 1646 669 309 255 23951 928 11622 --
NM_002753chr42660 221 ----1334
NM_002763chr1----128 --
NM_002806chr14----176 --
NM_002814chrX1587 --3723 626 67 --
NM_002819chr19------11267
NM_002825chr71488 ----1169
NM_002828chr181884 ------
NM_002835chr71739 ------
NM_002849chr1241058 952 677 119 --2308 185 --
NM_002874chr942289 982 860 817 11873 2171 39 --
NM_002886chr354902 3506 1565 1421 1222 24770 263 23985 3532 14862
NM_002902chr151130 1575 1192 1599
NM_002906chr1112281 --2590 84 --
NM_002912chr64237 192 155 65 --1902 --
NM_002942chr341118 296 123 80 --11410 11231
NM_002956chr1231346 1265 1053 --11207 --
NM_002968chr166894 847 401 385 219 46 ------
NM_003010chr1751635 512 396 336 167 --12142 12251
NM_003011chr91458 11571 11040 21468 360
NM_003027chr15----1140 --
NM_003042chr352183 2160 1815 731 313 ----11646
NM_003068chr85879 821 788 758 328 1113 135 1810
NM_003099chr1566563 5695 4595 1952 1389 86 ----1292
NM_003108chr2107129 6004 5889 5781 5022 4714 1499 1312 721 681 46164 5944 4991 4708 17010 16284
NM_003112chr793197 3101 2814 2803 2450 2439 2169 2150 577 ------
NM_003115chr1----1459 --
NM_003122chr5----169 --
NM_003142chr2----1260 --
NM_003155chr852735 2584 2350 2192 757 12697 1408 --
NM_003161chr1773620 3603 3042 2977 2823 657 588 ------
NM_003174chr10------1691
NM_003205chr1522044 148 12323 1350 --
NM_003206chr61336 --1309 --
NM_003221chr643779 1612 1547 1529 ------
NM_003234chr342286 1934 1534 470 ------
NM_003257chr1561156 916 492 450 420 332 --1958 --
NM_003260chr19----1196 --
NM_003262chr385054 4817 4725 4458 1498 917 590 551 1390 34740 4114 120 --
NM_003272chr13710 258 156 ----1675
NM_003284chr2------1161
NM_003291chr133751 289 134 --190 --
NM_003298chr386171 5830 5319 4180 4135 4050 1352 940 24124 4115 16154 --
NM_003304chr331566 1136 360 ------
NM_003336chrX31126 1073 199 ------
NM_003337chr54694 600 425 168 ------
NM_003338chr1041673 462 283 210 ------
NM_003340chr451384 983 877 560 551 ------
NM_003350chr83717 191 77 2831 774 ----
NM_003360chr4----1189 --
NM_003392chr353836 3828 3096 3062 2790 --44186 3205 2895 1682 --
NM_003403chr14----1796 --
NM_003406chr851880 1270 778 706 692 2745 486 ----
NM_003410chrX63094 2444 1965 998 849 840 --12473 --
NM_003411chrY21415 576 ------
NM_003412chr342806 2105 699 664 ----1856
NM_003413chrX11562 --21877 479 --
NM_003418chr31837 1215 1711 --
NM_003468chr264339 4229 3763 3294 1006 255 33939 3755 1333 24358 3711 --
NM_003471chr351849 1557 850 791 371 11770 22269 856 --
NM_003483chr1251983 1917 1892 617 268 --1917 --
NM_003489chr2183011 3003 2902 2817 2506 986 302 234 52911 2864 2709 2488 157 33477 2987 330 12937
NM_003559chr1722454 955 --13941 --
NM_003566chr12113381 3228 3156 2869 2584 1016 384 374 337 266 57 13061 21308 297 --
NM_003583chr1243848 3751 2851 141 --23203 1393 --
NM_003590chr283834 3055 2620 1632 1507 1029 1016 437 13223 11408 --
NM_003591chr10----1326 --
NM_003607chr173255 1455 1241 977 666 551 314 1612 12714 2568 511
NM_003615chr353524 3326 2644 1121 164 --12930 --
NM_003618chr231175 360 298 11153 ----
NM_003624chr19----11441 --
NM_003626chr114974 469 384 328 2348 262 ----
NM_003629chr143510 3343 981 384 ----1720
NM_003655chr171775 ------
NM_003659chr221112 841 --11118 11127
NM_003668chr12------156
NM_003672chr151899 1768 1512 336 193 21837 1779 21296 280 --
NM_003677chr12102079 2052 2024 1961 1912 1819 1812 1531 484 368 8240 220 198 172 164 144 126 104 ----
NM_003679chr163397 703 662 248 175 130 --128 --
NM_003688chrX----2246 234 --
NM_003692chr92952 259 --1910 --
NM_003711chr54283 261 135 74 1274 1340 --
NM_003713chr131319 1296 89 --11280 11427
NM_003722chr362390 1690 842 651 500 399 ----1346
NM_003743chr242239 2078 2035 681 --11781 --
NM_003749chr1341651 1584 599 389 11778 22386 1512 32128 2095 1716
NM_003750chr10----1785 --
NM_003772chr1131249 1157 236 --1123 --
NM_003783chr161206 980 964 930 485 400 3836 258 56 1301 11199
NM_003797chr111132 --163 --
NM_003800chr632016 590 171 --11488 11610
NM_003877chr122764 49 --11000 --
NM_003885chr1772698 2570 2492 2475 2190 794 205 --139 --
NM_003887chr252262 2170 1668 1655 207 1600 ----
NM_003902chr13292 149 71 --1254 2857 307
NM_003913chr643708 3202 2860 1258 1852 24316 4105 2250 75
NM_003934chr941231 1137 1056 860 ----1222
NM_003941chr752423 1017 970 426 313 ----12507
NM_003948chr452474 2055 786 721 405 --11062 --
NM_003951chrX1302 --173 --
NM_003966chr587597 7356 6758 5347 4995 4797 3005 635 --27023 114 36798 5535 422
NM_003972chr1041145 1072 552 21 31136 936 924 1862 --
NM_003980chr611163 ------
NM_004079chr162845 2252 2171 1062 511 293 --12189 22082 1177
NM_004093chr1332387 2100 410 12265 32947 2495 896 1427
NM_004094chr1432961 2951 1965 12159 2637 384 --
NM_004100chr642433 689 547 440 12721 1979 --
NM_004113chr321856 1614 --11540 --
NM_004116chr22464 353 ------
NM_004133chr82641 282 ----22593 202
NM_004162chr361275 1067 973 832 489 175 1848 ----
NM_004171chr11149412 8941 8906 8436 8168 8122 8080 7908 7227 5871 5857 3749 1416 308 28558 2933 48714 6938 2740 1929 38139 3002 99
NM_004187chrX21443 1177 ------
NM_004229chrX21885 838 11758 21933 1772 --
NM_004232chr1873878 3331 3170 3104 2845 1376 330 ----1730
NM_004272chr561698 1574 1445 1257 695 286 1239 11838 --
NM_004296chr1453752 3515 3083 3016 1152 --43960 3450 3339 1235 --
NM_004311chr1042537 994 756 22 ----13114
NM_004316chr123452 316 307 11140 1977 --
NM_004330chr151300 2756 329 173 1448
NM_004342chr731779 692 534 2703 144 22266 2012 --
NM_004414chr2141166 1053 459 431 1517 11333 --
NM_004432chr942288 2067 1779 1679 22135 1866 ----
NM_004438chr263294 2812 2486 1288 1148 1082 22508 2188 --13062
NM_004440chr631651 668 308 170 --11360
NM_004449chr2151330 1199 922 351 34 --11338 1316
NM_004457chr231320 655 529 1361 21126 67 --
NM_004458chrX72536 971 964 422 339 194 92 --32584 2555 1852 --
NM_004464chr444336 3916 3317 385 43073 2700 2627 1706 ----
NM_004501chr123768 659 ----11206
NM_004504chr241022 906 820 547 2319 225 11005 --
NM_004516chr1911173 --1248 --
NM_004519chr8134 ------
NM_004521chr10------1133
NM_004529chr951191 497 335 115 21 ----1372
NM_004586chrX95381 4574 3787 2036 1788 1417 1062 659 643 --13516 1509
NM_004592chr12----1211 --
NM_004595chrX------1161
NM_004598chr553320 2138 876 654 320 1645 12849 13139
NM_004612chr9104475 4323 4255 3643 3300 3228 3195 1411 1243 462 --11403 --
NM_004630chr11------11090
NM_004637chr31537 ------
NM_004660chrY32237 1940 1609 --1688 --
NM_004663chr1541538 1341 1082 420 --11132 --
NM_004687chr17--1354 1588 --
NM_004712chr17----1492 --
NM_004719chr1252875 395 342 248 47 --42414 2402 449 372 2321 292
NM_004725chr1031519 1101 945 --31197 1048 183 --
NM_004734chr1352832 2577 2460 2359 2240 23256 496 --1444
NM_004738chr2022637 177 --2727 96 2708 206
NM_004745chr8107012 5616 5147 4741 4550 2600 2171 1894 1082 407 --32053 1878 902 --
NM_004768chr13958 392 280 1100 1904 --
NM_004774chr1762990 2714 2465 2069 957 435 13055 1384 --
NM_004779chr5------1332
NM_004788chr1132591 928 41 ----1994
NM_004801chr231145 1022 117 11294 --11031
NM_004815chr173615 3188 3129 3114 1835 659 422 1454 53752 3406 851 482 308 --
NM_004824chr621005 898 --11224 --
NM_004827chr431376 441 197 11223 21727 420 --
NM_004834chr293160 3083 2786 2480 1361 1142 799 540 226 --1983 --
NM_004842chr631771 1368 562 ------
NM_004852chr182314186 13168 12688 11659 11440 10764 10702 10370 10307 10232 10204 9763 9623 9017 8935 8871 4705 4507 4002 2430 973 920 210 310692 4536 1554 411767 9972 2964 961 --
NM_004902chr202687 159 125 1548 --
NM_004906chr61554 1593 --2635 72
NM_004926chr1431734 1699 1424 21575 261 11528 --
NM_004948chr1821142 198 3437 324 245 --11287
NM_004949chr1881977 1487 1318 871 516 506 350 198 --12007 --
NM_004950chr121155 --1464 --
NM_004956chr754123 2842 1174 1043 943 ------
NM_004985chr1264529 4242 1084 844 519 275 --14263 --
NM_004995chr14------11524
NM_005006chr24863 437 187 56 1872 ----
NM_005028chr1031869 1452 266 --1417 1919
NM_005045chr7----1619 --
NM_005063chr1032391 571 564 --23172 2766 --
NM_005065chr14114963 4622 4502 4368 3922 3671 3392 2107 1815 1699 381 1344 13902 --
NM_005066chr12627 167 ----1518
NM_005103chr11196 ------
NM_005121chr1733488 3415 2504 11224 11209 1467
NM_005126chr332051 1527 822 ----21942 60
NM_005156chr975210 4761 1582 1542 1358 1289 668 23773 535 15259 15253
NM_005164chr1252655 2211 1741 1718 234 1292 1180 2576 386
NM_005171chr1231304 992 923 2501 36 ----
NM_005180chr10--1454 1465 11068
NM_005233chr332562 2542 2061 12463 --11612
NM_005238chr1163445 3056 2232 1387 1089 476 13144 21132 946 --
NM_005254chr1521070 1052 1568 21151 188 1944
NM_005259chr221068 399 1962 1946 --
NM_005277chr451932 1909 1558 1486 292 --2717 36 --
NM_005349chr41166 ----1226
NM_005358chr1381720 1623 1222 729 545 536 446 218 --1432 --
NM_005359chr1876378 5013 2130 1264 1237 1081 263 24131 344 26222 533 --
NM_005378chr21805 1789 1769 1837
NM_005385chr321792 63 1274 22588 1762 --
NM_005400chr243042 2708 541 219 --22912 2825 --
NM_005406chr1831391 1145 223 --1993 --
NM_005436chr1064154 3638 3086 1085 855 161 --13790 21527 1320
NM_005443chr4----1199 --
NM_005450chr171175 ----1200
NM_005455chr151820 1704 1248 693 216 --2147 110 --
NM_005455chr151820 1704 1248 693 216 --2147 110 --
NM_005458chr922402 2359 ----12028
NM_005502chr962921 2505 616 409 156 141 ----13249
NM_005504chr12105952 5907 5859 5407 4298 1750 1515 579 362 243 1106 1598 --
NM_005512chr111275 --12057 --
NM_005522chr71445 --1873 1918
NM_005537chr131726 1444 --195
NM_005542chr731838 1765 1751 ------
NM_005587chr151135 1809 ----
NM_005593chr121534 --1522 1492
NM_005596chr986152 5609 5561 4157 2116 1385 1299 880 --25275 1934 --
NM_005603chr1821946 1896 --11726 12000
NM_005604chr652580 2259 2013 839 403 12230 --12358
NM_005614chr71299 1318 --1382
NM_005618chr6----1566 --
NM_005639chr1231203 161 102 21632 1338 ----
NM_005668chr544422 3536 1451 276 34069 4011 590 14309 33718 1660 245
NM_005669chr551948 481 397 257 198 --2432 230 --
NM_005685chr7149 ------
NM_005724chr151719 --1629 --
NM_005730chr1233584 3048 1227 ----12988
NM_005737chr241048 901 461 170 --12666 12926
NM_005739chr1552400 2369 2352 215 65 ----12339
NM_005749chr174615 534 142 34 --1563 --
NM_005759chr274575 4102 2903 1642 1219 575 247 13445 11760 --
NM_005772chr9------1759
NM_005786chr1851185 1127 1041 807 173 ------
NM_005801chr171106 --1782 --
NM_005802chr9----1179 --
NM_005842chr131232 2739 550 ----
NM_005870chr13----1118 11136
NM_005880chr1631308 1128 455 1123 11369 --
NM_005885chr531670 1067 262 --21203 112 1287
NM_005898chr1172947 2205 2156 2149 1986 663 528 22547 515 --22453 2286
NM_005902chr1554483 3976 3550 3352 2825 1923 13731 33989 764 753
NM_005904chr1841512 1389 1368 1327 --11256 --
NM_005924chr711107 ------
NM_005941chr863724 3636 3422 3252 2593 195 --11458 --
NM_005955chr174849 4825 4700 3838 1897 1597 1083 1307 ----
NM_005966chr252394 1966 638 484 304 1808 22145 312 --
NM_005977chr1341013 986 859 818 1913 ----
NM_005986chr135859 838 684 598 451 --1651 --
NM_006016chr612084 1128 11761 --
NM_006033chr181746 ----22293 1511
NM_006037chr224241 1260 11144 21221 1162 --
NM_006040chr1621431 463 --11271 1335
NM_006047chr2053297 3181 2976 2629 1164 --32818 2488 54 --
NM_006080chr7122997 2958 2632 2615 2599 2592 2552 2467 657 631 224 69 --32606 2212 1035 --
NM_006106chr1173312 2931 2694 2171 1301 1038 699 --2978 178 --
NM_006133chr111411 --12385 --
NM_006141chr1672460 1932 1065 987 950 532 167 147 21715 617 --
NM_006154chr1532885 1790 427 --42720 2587 2262 942 11071
NM_006166chr12102609 2438 758 672 595 575 425 271 122 96 22507 1654 ----
NM_006178chr1741617 1603 1197 144 1168 ----
NM_006186chr21384 ----1336
NM_006206chr472648 2071 2023 1153 1006 701 78 22641 1045 22887 496 --
NM_006237chr1342096 2020 1860 1754 11528 ----
NM_006238chr6------12007
NM_006241chr321663 768 ----1106
NM_006246chr1431282 1141 993 11158 1409 --
NM_006251chr572779 2656 2508 2251 1097 544 121 93308 2758 1355 1331 1321 1301 1234 215 44 --11120
NM_006256chr142705 2324 2247 781 1970 21086 989 --
NM_006267chr231834 1573 118 1458 11407 --
NM_006287chr221857 879 --22542 2464 12184
NM_006298chr652260 2236 2116 640 538 --23006 235 22306 958
NM_006300chr1932380 2333 238 --32104 1867 211 11960
NM_006306chrX125604 5150 2086 1868 1706 1693 1627 1451 556 360 342 330 --45166 4891 4120 3606 --
NM_006310chr173989 224 131 ----1493
NM_006313chr1251703 1626 1442 423 121 --21497 1247 --
NM_006357chr21503 ------
NM_006363chr202610 25 ----1469
NM_006364chr14--1472 1924 --
NM_006378chr9--1569 ----
NM_006379chr752282 2050 2016 1808 155 1209 --22087 443
NM_006380chr1793820 3158 2799 1527 998 844 736 674 617 1826 ----
NM_006390chr1251857 1840 1822 1731 1689 11398 1403 --
NM_006393chr1053188 1064 401 330 110 1978 2287 38 --
NM_006403chr62306 274 1208 21490 1303 --
NM_006420chr2022930 1007 23434 3358 33309 3233 2116 --
NM_006421chr811269 --11042 11143
NM_006451chr52960 373 --1125 --
NM_006460chr1741645 1113 380 56 --21779 275 --
NM_006496chr121847 1469 --11529 --
NM_006504chr1032923 473 398 --22787 189 12606
NM_006526chr2022072 471 --1523 11913
NM_006538chr241381 1032 748 215 1773 --12633
NM_006540chr82423 253 --3992 331 321 --
NM_006544chr1495833 4963 4792 4758 4671 4154 2250 1856 244 1864 35699 3819 1220 14317
NM_006547chr722098 549 12082 1193 1171
NM_006557chr921649 1606 ----1120
NM_006571chr81318 ------
NM_006572chr1742528 874 772 207 11130 13215 12674
NM_006575chr142935 900 --21207 506 1562
NM_006595chr1172030 1931 1443 1411 774 371 196 1714 ----
NM_006599chr1687313 7082 6341 6245 5988 3260 2666 1462 26125 708 17042 17256
NM_006624chr1042077 1564 1423 373 --12154 --
NM_006628chr1594512 3485 3177 1363 1355 1079 687 681 183 ------
NM_006682chr741898 1845 1817 935 12806 21975 166 --
NM_006717chr9103167 2810 2793 2672 2404 2183 1221 879 385 342 12515 32951 1107 45 --
NM_006726chr43500 332 83 ------
NM_006729chrX115388 5153 4089 2004 1726 1351 1318 1098 462 144 51 21567 1415 44257 3956 1601 103 --
NM_006734chr63637 586 336 ------
NM_006750chr1697645 7569 6470 6452 5529 2849 2570 2011 1126 37986 7965 2608 --26627 6181
NM_006754chr741031 965 795 311 --1184 11261
NM_006775chr6112863 2806 2703 2663 985 760 656 464 456 441 106 --52782 2751 2396 1232 902 --
NM_006805chr521299 1248 21600 1313 --11432
NM_006811chr203646 316 164 --2759 401 --
NM_006826chr231151 1120 354 --2465 281 --
NM_006827chr1463254 2535 2431 2079 952 883 11030 23132 1359 --
NM_006832chr143795 725 708 --31071 387 373 --
NM_006854chr751759 1321 1251 508 315 --1180 --
NM_006873chr233120 2372 506 12969 13202 --
NM_006888chr1463046 2779 2246 1207 318 173 --12913 --
NM_006898chr2----1499 --
NM_006914chr951298 1240 465 427 157 --21177 38 --
NM_006931chr1242178 1990 1820 1693 --11474 --
NM_007005chr91270 --11516 1486
NM_007006chr1673360 2330 2158 1363 1122 1085 786 ----13467
NM_007029chr8----189 --
NM_007034chr11409 21015 988 ----
NM_007038chr2195825 5778 5107 4519 4425 2164 1460 261 54 14352 54395 4160 2373 1034 943 24370 763
NM_007068chr222989 804 2302 207 1654 --
NM_007084chr1311390 152 --21348 126
NM_007106chr1332488 844 247 --11789 --
NM_007114chr373308 2878 2026 1136 472 324 35 ------
NM_007124chr631354 1286 546 --11274 1299
NM_007129chr13----1722 11052
NM_007146chr1742392 1893 519 485 --1503 11817
NM_007147chr1931008 834 129 3805 773 459 --11024
NM_007187chr131266 --3688 348 120 --
NM_007191chr12--1695 1604 --
NM_007212chr11399 --32287 1826 1659 --
NM_007217chr3----1352 --
NM_007231chrX72416 2079 1670 571 284 147 96 ------
NM_007246chr4----1884 --
NM_007249chr13179341 9266 9146 9078 8373 8299 8275 7015 6819 6712 6250 5908 3741 3050 2356 2248 987 19068 12934 --
NM_007269chr12582 90 ----1415
NM_007350chr1274039 3445 3050 2877 1661 364 191 21852 1844 44636 2990 863 301 --
NM_012062chr121920 ------
NM_012096chr373524 2968 2762 960 611 209 201 --22493 1067 13745
NM_012115chr61488 1456 1441 1601
NM_012120chr632766 2663 2623 21065 636 22572 1983 22299 438
NM_012154chr81848 --1697 --
NM_012158chr1341234 733 370 355 --142 11810
NM_012164chr9105430 5069 4684 2257 2090 1698 1017 895 265 122 17138 --17231
NM_012189chr18----1677 --
NM_012214chr2105952 5546 5294 4165 1801 926 816 602 569 64 --36197 5352 4551 --
NM_012223chr2149 --11265 11154
NM_012234chr333266 2699 202 --13419 --
NM_012238chr1021523 384 11412 ----
NM_012249chr262766 1423 1408 1073 693 672 23135 2365 33561 752 525 --
NM_012262chr165149 4455 4176 3196 1401 980 ----13541
NM_012281chr762462 2309 2117 1586 337 100 --32288 949 480 --
NM_012286chrX1545 --1572 1103
NM_012287chr3104498 4441 3349 3198 2855 1810 1285 784 570 350 1629 23125 620 24380 50
NM_012294chr783546 2852 1405 1375 975 917 609 371 13938 23704 3553 --
NM_012297chr451781 880 704 474 384 ----11011
NM_012309chr1194885 4828 3659 3515 1972 1878 1457 532 363 --14821 --
NM_012325chr2061503 1357 1135 445 338 137 --11443 --
NM_012333chr1----11134 --
NM_012399chr2241938 428 340 193 1202 1618 --
NM_012406chr122281 36 --31284 1267 959 --
NM_012414chr13695 676 156 --2760 54 --
NM_012428chr155991 956 355 325 303 11001 ----
NM_012434chr6----136 --
NM_012464chr421961 1886 138 12584 11943
NM_013231chr1484138 3254 3144 2831 651 508 118 109 --13193 12776
NM_013233chr231388 1285 566 ------
NM_013243chr1531295 1247 1181 --11011 --
NM_013255chr778844 7139 6214 2394 2319 1227 542 37172 6368 1450 48864 7709 2792 2728 13468
NM_013261chr4123695 3248 3001 2556 2331 1329 1218 1166 652 401 323 303 11117 ----
NM_013281chr2061514 1339 1178 958 431 117 1947 11287 --
NM_013302chr1694049 3881 3780 3425 1707 851 816 744 340 14575 ----
NM_013316chr741031 776 148 29 --1382 --
NM_013320chr12----1141 --
NM_013372chr1593209 3031 2750 2251 2170 2085 572 155 38 13037 ----
NM_013374chr392107 2014 1174 1102 987 896 817 118 94 1561 23150 592 --
NM_013381chr123351 301 78 3708 681 675 ----
NM_013437chr841391 905 438 104 --21259 204 --
NM_013444chrX41046 1023 473 139 11100 21160 31 --
NM_013943chr152943 2648 1036 947 437 1409 43246 2961 1055 415 --
NM_014011chr282331 2140 1926 1007 734 524 497 48 12397 12613 --
NM_014021chr172808 2247 1190 625 609 485 195 --12547 2387 240
NM_014023chr1031803 723 159 1211 12700 --
NM_014048chr1674904 4624 3741 1344 899 790 651 --13977 25195 770
NM_014112chr8145226 5066 4876 4842 4574 4195 3746 1702 1635 1589 1421 1322 594 566 --35410 3945 1506 23775 1118
NM_014141chr784901 4589 4522 3869 2030 1951 1636 402 1857 21375 635 1961
NM_014154chr31992 1648 1487 --
NM_014181chr242812 2373 1006 427 --2550 361 1607
NM_014253chrX62447 2367 2286 2197 1888 1680 1297 12177 --
NM_014264chr42141 131 1440 1499 --
NM_014319chr1281764 1758 1718 1657 1458 1430 1396 692 3723 584 553 ----
NM_014331chr487747 7661 6676 6023 5778 5539 1036 866 25740 2829 47096 6910 5914 5445 --
NM_014341chr6----1750 --
NM_014391chr103696 625 197 ----2719 711
NM_014409chr1----11168 --
NM_014421chr442025 234 187 87 --2799 55 12110
NM_014423chr5135486 5440 5356 4379 4031 3598 3533 1781 1375 1195 679 647 405 11351 34039 3745 754 --
NM_014445chr342416 1880 1854 1746 ----1367
NM_014494chr1641725 1583 1529 817 ----12210
NM_014548chr1571147 1131 1116 1055 647 540 236 1401 ----
NM_014572chr1321324 434 --11523 --
NM_014612chr951530 1292 1079 551 393 ------
NM_014615chr1663590 2699 487 217 179 121 1344 ----
NM_014635chr22232 142 --21460 1446 --
NM_014636chr944352 2777 1119 537 13487 23995 416 --
NM_014647chr1642068 1973 1603 860 ----1870
NM_014670chr241261 1238 1027 282 --11564 --
NM_014671chr7------11322
NM_014674chr363965 3378 3135 3067 3052 1375 --13911 --
NM_014682chr862226 1684 1596 1483 802 200 11909 ----
NM_014683chr1782094 1500 1379 1332 861 851 469 274 --1409 11574
NM_014707chr741522 713 596 100 1112 21918 430 --
NM_014717chr191824 ----1106
NM_014720chr1031677 1463 1426 --11551 --
NM_014729chr852328 2286 1920 1809 819 1781 ----
NM_014738chr171717 --1252 --
NM_014746chr274146 4114 3526 2953 1217 566 270 34238 4136 533 14335 --
NM_014751chr861944 1753 815 460 445 415 11762 1698 1314
NM_014755chr2124244 4077 4014 3868 3666 3167 2592 1716 1518 1377 772 78 1340 33150 3137 1634 --
NM_014774chr122773 1998 1473 --23176 328
NM_014782chrX----1138 --
NM_014784chr11376 ----11097
NM_014787chr122824 2380 ----12233
NM_014795chr221425 318 --21322 454 --
NM_014802chr123927 916 779 ----1954
NM_014803chr1062917 2794 1882 379 161 75 ----11126
NM_014819chr552430 2401 2365 935 371 --1208 --
NM_014829chr552355 1618 1493 230 44 11632 176 --
NM_014832chr1362079 2053 1827 1669 1363 646 1279 21486 439 --
NM_014835chr204899 644 575 376 ------
NM_014839chr11192 12169 12492 1302
NM_014848chr1562622 2489 1138 831 321 280 --22446 57 --
NM_014869chr321486 1444 ------
NM_014873chr194709 4491 4460 3630 1934 1252 741 726 62 --24778 949 11915
NM_014877chr17116977 6489 5823 5807 5795 5747 5707 5457 874 581 87 47071 2819 2808 2798 67783 7759 1092 839 443 340 --
NM_014893chrY4902 497 126 51 --12133 1617
NM_014897chr1722513 793 1724 33189 950 625 --
NM_014900chr2------180
NM_014904chr10104017 3730 3572 3434 2980 2717 2582 1166 622 493 --22635 2528 13847
NM_014917chr1----1790 --
NM_014946chr251152 900 298 185 179 11995 23119 783 --
NM_014947chr173125 2762 2629 2328 1049 963 801 --32927 2769 2693 --
NM_014950chr1421627 458 --11662 --
NM_014962chr20102910 2867 2859 2755 2380 2245 1023 602 171 38 ------
NM_014969chr161080 1008 959 781 394 133 --1317 --
NM_014978chr104619 548 501 227 --31850 1731 678 11511
NM_014982chr1475079 4247 3988 3456 577 480 295 14551 11952 11267
NM_014988chr4112832 2811 2607 2421 2334 2122 1960 1851 527 411 337 --1468 --
NM_014990chr1431265 1195 266 ------
NM_014991chr463259 3218 2983 2675 2441 901 22806 419 --12990
NM_014992chr142760 261 --2234 147 1172
NM_015000chr1242664 2599 2349 1089 1287 12699 --
NM_015017chr1----1877 --
NM_015026chr1243181 1874 1596 1171 --2701 537 14345
NM_015045chr1061927 1686 1450 1411 349 158 --11983 --
NM_015046chr952769 2581 2190 1886 643 --2660 130 22008 309
NM_015049chr273301 3146 3107 1129 1036 908 523 11012 ----
NM_015055chr1132868 1839 1148 --12790 12464
NM_015061chr92884 847 1831 ----
NM_015076chr6104417 4066 4035 2787 1548 1435 1408 1159 450 84 23471 1171 ----
NM_015091chr143822 663 639 ------
NM_015092chr1694250 4181 3438 962 936 897 831 457 102 14639 14603 14489
NM_015093chr641694 1431 591 573 1709 --11399
NM_015097chr3--21815 1597 11847 11649
NM_015100chr122066 1408 --1691 --
NM_015110chr952449 1950 1820 675 266 ----1462
NM_015137chr852628 2605 826 746 307 12441 11960 --
NM_015144chr1664006 2712 2451 569 511 268 --1157 12937
NM_015155chr1093351 3093 2806 2445 1198 1080 644 569 326 1239 12078 1408
NM_015156chr1473596 2727 2666 2503 1493 992 563 23743 405 23284 1192 --
NM_015162chr15------1565
NM_015172chr121096 238 11380 1267 1290
NM_015184chr31477 --1155 --
NM_015192chr2022895 2477 21010 486 2565 220 32936 1040 396
NM_015199chr353029 2059 1862 847 653 ------
NM_015205chr1395037 4931 4667 3842 3627 3381 3305 2000 670 14863 24957 2059 --
NM_015216chr561502 1493 1424 1175 1101 69 --11467 --
NM_015231chr111762 --1748 --
NM_015236chr431380 1085 930 ----1585
NM_015265chr272656 947 923 881 806 703 526 2418 412 --12407
NM_015271chr484179 3974 3823 2613 807 601 140 66 34066 1689 1124 33763 1482 1150 --
NM_015272chr1651419 1411 577 564 322 1720 --12091
NM_015275chr121761 ----1386
NM_015285chr1841777 1656 761 148 ----11913
NM_015288chr542984 2884 758 293 --33712 3633 2895 --
NM_015291chr153296 2772 2670 798 686 --12588 1560
NM_015305chr1451836 570 455 277 76 2447 432 ----
NM_015308chr112651 164 1138 1717 --
NM_015313chr1154675 3749 1476 340 86 13281 --1277
NM_015315chr523333 2549 ----23484 145
NM_015317chr231016 756 675 22804 430 ----
NM_015326chr112907 ----1845
NM_015330chr22----12610 --
NM_015335chr1252395 2212 2170 1899 570 12372 --11615
NM_015336chr1252120 1857 877 479 398 ----21663 763
NM_015339chr20--1987 ----
NM_015355chr1731354 1284 565 1186 1726 --
NM_015358chr2151134 1055 460 241 133 11019 ----
NM_015360chr5------1197
NM_015423chr1141257 1181 495 276 --11490 --
NM_015429chr32879 837 2458 98 1911 --
NM_015435chr871489 1477 1246 1083 535 331 119 11018 1204 --
NM_015441chr11133 --1418 --
NM_015446chr131591 1485 23 --21653 471 1257
NM_015455chr5113907 3726 3485 3085 2921 2599 1550 1339 997 978 815 --13952 --
NM_015458chr854906 4736 4698 877 130 --14966 --
NM_015461chr181210 ----192
NM_015464chr71215 11029 --11060
NM_015484chr14865 346 273 206 1172 --1285
NM_015564chr53825 619 517 --1258 --
NM_015567chr1321293 906 --1968 --
NM_015569chr124006 3100 23291 3265 1133 --
NM_015570chr751841 1658 1420 471 147 ----1136
NM_015576chr372903 2863 2115 1170 932 563 265 12096 3775 495 99 --
NM_015626chr172361 344 1315 11192 --
NM_015630chr23856 730 64 1152 ----
NM_015872chr1----1301 --
NM_015878chr872069 2032 1792 1482 696 525 492 --1202 1879
NM_015879chr18118555 8525 8216 8106 7103 3014 2675 1574 1518 700 183 --38617 7652 774 12144
NM_015886chr895723 4491 3641 1666 1503 821 759 363 257 35491 348 54 34886 4849 4014 --
NM_015888chr163224 2810 2514 2426 227 140 13120 ----
NM_015891chr631401 713 421 --2363 73 --
NM_015906chr124338 507 13757 34312 4003 3799 11695
NM_015984chr13501 179 101 165 1141 1189
NM_015995chr1595551 5458 5168 5155 5093 3578 1668 1015 92 14353 ----
NM_016018chr822725 2542 22376 2317 1624 1263
NM_016021chr622967 837 22357 892 22890 821 1414
NM_016059chr62310 281 1880 --1667
NM_016060chr17--137 145 --
NM_016072chr1262214 1855 1600 847 507 443 ------
NM_016073chr1521174 794 --11061 --
NM_016075chr13103065 2943 2579 2197 2092 2052 1987 611 233 117 12565 --12288
NM_016076chr153112 2100 823 784 515 --11143 --
NM_016081chr431975 1730 663 ----11553
NM_016083chr653888 3798 2825 1377 363 --33858 3413 431 1914
NM_016100chr201278 1421 --1406
NM_016107chr541383 1247 341 149 --21333 309 --
NM_016121chr1----1927 11056
NM_016131chr22663 236 --11963 1201
NM_016142chr1111312 ------
NM_016195chr10192 ----182
NM_016217chr661323 1296 694 428 259 220 21306 935 23666 457 11074
NM_016257chr112942 --13409 --
NM_016279chr5------1491
NM_016289chr22386 372 12254 1285 1598
NM_016320chr1121036 1024 11068 ----
NM_016376chr1764066 3921 3875 1313 778 669 11648 13807 --
NM_016396chr15102665 2191 2119 1991 1202 1131 690 522 229 41 22950 1094 22153 1926 --
NM_016410chr9------1615
NM_016472chr1441485 1392 1246 983 --2995 89 --
NM_016531chr473840 3621 3554 3309 507 333 278 43011 3005 1574 834 1362 --
NM_016604chr511238 ----11148
NM_016620chr131339 913 412 ------
NM_016623chr84613 544 243 62 ------
NM_016626chr1821454 662 11610 1523 --
NM_016641chr1641164 345 321 116 --1334 --
NM_016952chr1153344 1580 1573 488 361 --23226 146 --
NM_017420chr1453753 3006 2602 1480 636 43062 2676 476 119 1254 33640 697 338
NM_017426chr41440 --2540 37 1243
NM_017519chr641352 1233 1008 439 11026 1263 --
NM_017544chrX1946 ----1963
NM_017546chr2----2590 308 1100
NM_017580chr1021619 278 11759 ----
NM_017582chr121754 683 --31816 1804 421 --
NM_017590chr2232622 1965 478 11856 ----
NM_017594chr962830 2212 1215 670 354 127 42888 2823 1000 88 23021 1100 --
NM_017610chr1552102 2053 658 586 182 21313 164 11397 1439
NM_017628chr464588 3681 1559 1402 303 140 --1184 --
NM_017629chr151939 1429 1276 225 164 1402 21442 709 --
NM_017632chr4----1333 --
NM_017633chr663365 3239 3225 686 678 158 43348 2828 1077 658 23412 1554 --
NM_017634chr82416 351 21495 154 --11798
NM_017635chr1111003 ----11024
NM_017637chr9169173 8535 8453 7807 7745 7266 7047 6619 3603 3485 3256 2912 1804 679 126 118 48104 7411 6125 2718 26703 1925 19376
NM_017640chr6--1915 --1719
NM_017643chr1762882 2440 2364 771 371 272 ------
NM_017644chr3104099 3716 3411 1878 1585 1411 763 542 438 339 1356 ----
NM_017658chr14104675 4502 3378 3219 3203 3106 1823 1245 1216 993 13543 13646 1848
NM_017684chr1521629 453 1189 11988 11611
NM_017704chr11159 --2310 163 --
NM_017752chrX22114 1956 11748 1141 --
NM_017754chr654707 4006 3626 3365 1058 --35066 4955 1503 --
NM_017762chr1532177 1923 432 11989 --11900
NM_017769chr1443015 2986 2733 705 1499 12477 33059 2318 1085
NM_017770chr61875 1893 1137 22076 450
NM_017801chr311995 --22527 627 --
NM_017813chr8105265 4474 3793 3603 1991 1463 1264 748 163 90 35103 4102 1489 11073 --
NM_017824chr1062226 2166 472 323 290 76 --1509 --
NM_017831chr1894761 4438 4107 3688 3366 3152 1545 408 103 --1146 21361 1314
NM_017845chr41329 ----1196
NM_017847chr132268 1985 221 ------
NM_017860chr1----1888 --
NM_017864chr8------1188
NM_017944chr1173069 2710 2556 1138 866 431 207 --12948 --
NM_017953chr121094 339 --1151 11107
NM_017964chr2----1165 --
NM_017993chr131165 ----1375
NM_018017chr1072613 2411 2184 1941 1151 924 374 22669 2663 1160 22163 2102
NM_018046chr52418 368 ----11863
NM_018051chr7--3363 110 97 1337 --
NM_018071chr14----1528 --
NM_018084chr282867 1196 1051 912 853 843 595 485 12656 22074 1179 22976 2779
NM_018086chr271925 1878 1840 1475 1352 1213 26 11766 31795 733 170 --
NM_018121chr1073050 2722 2408 1064 559 227 107 --22570 743 --
NM_018126chr451275 1128 1085 559 534 --1126 --
NM_018151chr23584 223 206 2707 319 1689 --
NM_018157chr1253089 2369 2097 750 689 23186 1169 12048 --
NM_018184chr332063 1974 1898 --1531 1543
NM_018206chr161708 --2740 544 --
NM_018224chr71249 --1255 --
NM_018243chr443875 3339 712 437 14048 --11298
NM_018247chr692866 2621 2208 2176 1004 533 402 373 36 33036 1181 279 ----
NM_018254chr132055 656 474 32108 1851 521 ----
NM_018270chr20------1624
NM_018287chr1021213 351 --21294 71 --
NM_018293chr322794 2373 22279 449 167 --
NM_018296chr16----1107 --
NM_018318chr124892 844 814 388 --1928 --
NM_018335chr14------1126
NM_018351chr1264743 3221 3127 2883 916 66 --34639 782 468 --
NM_018362chr115849 785 583 313 255 1175 13742 --
NM_018364chr133692 3555 1288 11620 --34091 3892 1516
NM_018368chr6152 ----1265
NM_018403chr383785 3754 3309 3247 2572 1276 1169 645 --11034 --
NM_018433chr22228 199 ----1140
NM_018440chr868040 7233 6261 1536 1043 924 28444 2048 12883 11126
NM_018444chr852339 2185 1986 623 458 12312 ----
NM_018449chr91172 --1164 --
NM_018475chr41684 --1652 --
NM_018482chr86975 802 609 547 404 375 ------
NM_018557chr211572 21598 1505 11391 2671 35
NM_018566chr1125083 4942 4814 4352 4258 3793 3767 3160 2028 1440 839 829 11740 1763 --
NM_018569chr421197 181 11514 --21046 64
NM_018638chr1295283 5227 4673 4163 4125 3895 2128 1947 453 12069 35643 5261 1505 --
NM_018650chr131683 125 64 --1325 1441
NM_018682chr71490 ----1502
NM_018710chr831179 438 24 1111 --11342
NM_018834chr53856 660 293 1914 1645 --
NM_018847chr921975 606 1629 31818 176 163 --
NM_018898chr542183 1930 1530 1488 --12251 --
NM_018945chr672623 2241 1439 1126 585 445 171 --1909 12316
NM_018951chr731074 809 794 11051 11158 --
NM_018963chr2121101 278 --11305 --
NM_018970chr762671 2057 1057 978 909 801 --1921 --
NM_018976chr1272694 2399 1890 900 849 136 109 --22880 1109 --
NM_018993chr2041189 570 362 29 21341 299 --11130
NM_019003chrX------143
NM_019004chr742263 897 776 297 --1933 --
NM_019012chr122824 748 --1795 --
NM_019030chr5--1163 1204 --
NM_019035chr422091 165 135 21939 1558 --
NM_019045chrX6942 860 752 327 306 48 ------
NM_019049chr13236 221 45 --1159 1302
NM_019050chr441719 1418 442 227 --11871 --
NM_019059chr7----1173 --
NM_019063chr242274 1798 536 456 --11453 1729
NM_019072chr584306 4113 3867 1543 1096 787 646 612 --12904 1654
NM_019084chr1052453 1996 915 756 155 --12518 --
NM_019094chr1222347 1286 --33045 865 722 23039 3004
NM_019556chrX31457 1368 331 --21209 1111 1130
NM_019593chr2062538 2475 2263 1069 1049 705 1394 2754 435 21087 679
NM_019842chr6----1159 1410
NM_019843chr221133 ----1319
NM_019892chr91956 ----11041
NM_020121chr13----1164 --
NM_020122chr2115575 4649 4050 2034 1540 1297 1153 942 393 211 199 11229 35126 2236 1962 14314
NM_020135chr61380 ----1348
NM_020140chr12153 ----1196
NM_020150chr1021663 362 --22043 1697 12184
NM_020193chr1131177 1008 190 ----1981
NM_020208chr31712 --12508 11191
NM_020307chr3160 --1297 --
NM_020336chr2073850 3120 1484 850 717 326 307 ------
NM_020337chr473077 2927 2861 873 335 255 179 13087 --13010
NM_020342chr232606 2411 926 ----12163
NM_020346chr1151599 1533 1327 368 163 ----11334
NM_020354chr10----1935 --
NM_020357chr311516 --11104 21452 1038
NM_020363chrY1723 --150 1602
NM_020390chr374539 4181 3068 1413 1062 969 349 33383 1553 184 23271 1258 14198
NM_020432chr732192 1660 702 --11637 1745
NM_020443chr166763 4997 4555 4547 2065 1720 --16604 1796
NM_020474chr1811261 ----21708 1476
NM_020525chr12----1383 --
NM_020529chr14--1477 1442 --
NM_020640chr352061 1675 1522 1413 25 --1644 --
NM_020647chr832192 2048 476 --1368 22294 1964
NM_020648chr1842707 2073 1965 751 --12173 --
NM_020651chr231726 1678 1642 1397 11601 --
NM_020718chr16116601 6063 6010 5822 5039 4872 4395 4172 2079 1253 143 11599 16436 --
NM_020734chr1273382 3280 2463 2372 1115 730 698 12190 --12703
NM_020742chrX2966 144 12727 12202 22000 631
NM_020747chr51656 --1335 1908
NM_020748chr1762075 1935 843 523 508 413 ----11667
NM_020752chr1032000 1077 293 --32516 515 463 --
NM_020760chr2--21743 1404 1697 1611
NM_020768chr543262 3069 523 101 1561 13227 --
NM_020772chr17108161 8067 5718 3133 2624 2088 1451 863 779 305 16457 27118 2567 25316 1925
NM_020774chr1855467 5282 4821 420 140 26074 1213 135 --
NM_020782chr1264176 3457 3352 3323 1415 282 --1892 --
NM_020783chr1862144 1781 1775 1549 857 553 --32160 1561 1504 --
NM_020792chr372651 2382 1866 1815 1804 1759 191 --21030 448 12229
NM_020794chr141388 1231 225 194 ----1121
NM_020800chr331511 1207 176 31492 1190 922 1350 1449
NM_020801chr522483 575 12180 12336 12293
NM_020805chr1851906 1585 1494 1258 349 11576 183 --
NM_020807chr16----11809 --
NM_020826chr1163670 3260 2968 789 322 291 --1208 --
NM_020856chr192287 212 2589 171 1452 --
NM_020858chr153810 396 344 ------
NM_020859chr433918 2820 2554 13676 22534 342 --
NM_020861chr61169 21339 1299 2514 187 --
NM_020870chr4--1210 32094 784 466 11751
NM_020871chrX42573 2531 2148 297 --32407 863 642 12562
NM_020872chr351798 1171 726 81 69 ------
NM_020873chr31677 1660 1845 --
NM_020895chr19----1282 --
NM_020918chr1083653 3270 3126 3044 2829 2676 1069 348 --22535 2392 --
NM_020921chr1422976 2445 --22874 2337 1966
NM_020935chr253740 3126 1778 1769 1707 24636 1209 ----
NM_020940chr1042840 2253 1981 1078 22586 2578 12496 --
NM_020960chr974883 4330 3755 3561 3524 1788 1057 --1762 --
NM_020992chr10------1344
NM_021035chr2011297 ------
NM_021038chr383299 3116 1345 1174 538 499 381 294 2952 307 1930 --
NM_021072chr572477 2360 2256 1934 864 550 144 1322 22508 2242 12369
NM_021083chrX32523 1039 645 13083 13564 11201
NM_021111chr921360 993 11248 11088 --
NM_021132chr1051367 1327 1051 1004 365 1893 ----
NM_021136chr142762 619 --1258 1742
NM_021167chr742777 2758 2290 2275 --12261 --
NM_021183chrX42416 2392 2310 605 ----1159
NM_021239chr1441304 1182 482 356 --1541 --
NM_021240chr93685 609 489 --1644 --
NM_021249chr141458 --3573 373 121 --
NM_021255chr1463976 3140 2828 2694 1441 398 ------
NM_021572chr62367 321 11144 --1282
NM_021619chr9------11138
NM_021629chr361571 1554 1424 926 568 295 --14633 11676
NM_021813chr6105870 5557 5321 5315 5195 4811 4713 4359 3712 2118 --35573 5104 4703 --
NM_021814chr631132 375 360 --11567 11384
NM_021960chr142759 2209 2168 2092 --1682 12314
NM_021961chr11107336 6002 5491 4541 2261 1903 1226 1017 544 470 11167 27279 397 14873
NM_021964chr386414 6382 6169 5851 2160 1997 1551 1450 56055 5723 1403 721 656 36545 4602 220 34478 861 106
NM_021977chr683875 3698 3630 3610 1525 1145 86 77 12613 12489 13733
NM_021979chr142443 437 ----1431
NM_021998chrX41262 1188 1086 980 1258 --11195
NM_022037chr23876 261 95 --1114 --
NM_022045chr8----1186 --
NM_022048chr1555653 5413 4155 3994 1474 25857 798 --25767 3928
NM_022058chr282004 1942 1403 701 579 295 221 170 ------
NM_022075chr11833 ----135
NM_022118chr135580 520 493 452 66 ------
NM_022130chr521269 355 21444 475 ----
NM_022133chr831500 331 115 31366 276 123 11866 --
NM_022138chr63569 460 115 11149 31041 263 208 --
NM_022166chr1656335 6262 4150 3940 780 25886 2490 14703 --
NM_022351chr853818 3781 2996 128 36 1296 23631 2715 22635 1125
NM_022366chr1----1390 --
NM_022461chr31919 11421 --1457
NM_022484chr71370 --1997 1223
NM_022497chr373847 3600 3480 3316 3165 2693 676 ----13268
NM_022648chr254380 3912 1660 724 128 1690 24631 4576 --
NM_022658chr1241298 1048 522 413 ----11182
NM_022728chr7----1561 1730
NM_022758chr693108 3046 2785 2743 2423 2409 2076 942 180 ------
NM_022763chr351271 1046 1031 664 166 12584 --13127
NM_022764chr1611826 ------
NM_022781chr943270 2619 645 409 150 23337 3164 1556
NM_022782chr12------149
NM_022784chr15----1763 --
NM_022826chr21138 ------
NM_022843chr1331328 595 522 ----1559
NM_022893chr252867 2420 2344 2183 371 --2634 263 --
NM_022894chr231661 1244 54 --21165 1133 11382
NM_022898chr1483847 3826 3758 3477 3233 1644 1175 870 --13706 --
NM_022912chr253001 2338 2332 2054 447 --12009 --
NM_024007chr5122986 2491 2317 2265 2110 1988 1952 1265 983 670 616 191 --1576 --
NM_024016chr17----1721 --
NM_024019chr451073 1036 868 781 398 ------
NM_024080chr22880 682 --12130 --
NM_024122chrX1218 --1110 --
NM_024345chr985721 4872 4850 4419 4053 4032 1381 735 14266 24823 4101 14672
NM_024408chr153542 3152 1384 232 148 12624 12975 --
NM_024511chr4103218 3022 2962 2782 2426 2352 2142 978 366 260 --12913 --
NM_024512chr343565 3512 2885 253 --22535 326 --
NM_024524chr332849 2326 980 --12973 --
NM_024539chrX51260 1157 1072 457 445 --1970 --
NM_024546chr1331186 966 313 ------
NM_024665chr393961 3597 3504 3466 1758 1105 818 651 504 --1586 --
NM_024674chr1102951 2800 2580 2140 2005 892 697 203 109 83 ----12862
NM_024680chr11157 1420 1552 --
NM_024704chr204977 903 740 62 11029 11090 2999 790
NM_024715chr551819 678 288 215 196 ----1147
NM_024721chr892543 2411 1727 1672 1642 963 894 203 189 11037 11680 --
NM_024761chr931924 1861 362 23355 2064 31412 1227 760 11989
NM_024844chr17179 ------
NM_024884chr1443530 3481 973 55 23308 1758 --13551
NM_024911chr1187 3846 832 826 2753 203 --
NM_024913chr731537 1422 132 ----11254
NM_024920chr411435 ------
NM_024921chrX1214 ------
NM_024944chr213360 266 226 ----1367
NM_024947chr3169103 8630 8600 8574 8125 8101 7809 3789 3710 3463 3214 1397 1282 1186 813 175 --11824 19218
NM_024948chr101594 1584 1735 --
NM_024953chr1252548 2067 1900 978 735 1242 22693 117 --
NM_024969chr21873 ----1246
NM_024989chr2177913 7842 7360 7106 6496 6243 5921 5461 2727 2540 2228 2126 2085 1392 739 614 332 46009 2687 974 272 --27940 7820
NM_025009chr421651 226 1193 3427 312 244 11854
NM_025054chr884056 4010 3085 2608 1309 986 570 502 --43489 2907 1340 136 23611 3094
NM_025138chr1351415 1360 596 481 434 --11118 --
NM_025146chr321866 1695 --11993 --
NM_025154chr731436 1324 1245 --11459 --
NM_025160chr124167 2793 --1417 23523 2673
NM_025164chr1141984 1773 1388 864 ----22127 1421
NM_025191chr143509 3032 436 234 --1515 23486 3430
NM_025208chr1162458 2125 2003 1707 704 111 ----1793
NM_025235chr104707 502 293 172 --11615 --
NM_025244chr2----2113 79 1197
NM_030621chr1463993 3951 2651 1418 1387 748 31149 836 174 --14076
NM_030627chr5103555 3238 3122 3086 2803 2793 2650 793 759 43 14117 11363 32574 906 592
NM_030647chr765208 4522 3961 1383 566 299 2672 592 36313 5517 2519 11713
NM_030665chr17--11268 --1954
NM_030751chr1041828 1501 537 348 --21925 1595 --
NM_030791chr1411458 --31859 1710 146 1521
NM_030806chr1129061 8921 8696 7807 7345 7118 5897 3374 2607 1840 1795 686 ------
NM_030816chr172254 1152 938 682 558 488 225 2509 333 33608 1329 1304 11242
NM_030939chr63407 122 38 1754 1303 --
NM_030949chr61205 --11468 --
NM_030978chr91121 --1135 --
NM_031418chr1132581 2330 728 21990 111 21095 132 --
NM_031461chr841502 689 635 44 11595 2826 379 22135 129
NM_031469chr654110 3109 1513 1066 30 13895 178 --
NM_032021chr11----11189 --
NM_032124chr185830 788 415 133 34 --21067 403 --
NM_032132chr11481 192 1459 --
NM_032138chr131507 --146 --
NM_032145chr631626 555 500 1277 178 --
NM_032160chr1843661 3558 1576 1134 --23327 1224 --
NM_032172chr7------1644
NM_032182chr1021049 596 ----11649
NM_032199chr1043204 2908 853 450 ----1457
NM_032228chr1182940 2633 2461 2386 1180 383 60 51 21244 591 53426 3307 1208 979 961 169
NM_032239chr42207 162 11473 11082 --
NM_032246chr1521151 1042 11121 1265 1983
NM_032291chr141818 677 224 52 --11232 --
NM_032325chr1111310 22023 1987 12012 12004
NM_032352chr1421366 50 21409 483 176 --
NM_032373chr10105679 5279 5171 4796 4786 4573 4420 2219 1075 844 11059 65797 2198 1991 1506 877 675 --
NM_032379chr112852 820 --1612 --
NM_032439chr1021404 359 ----11178
NM_032446chr563884 3238 2903 2692 908 528 23546 1018 11248 --
NM_032457chr4103112 2651 1509 1294 1282 1165 935 746 186 37 --33825 1306 459 11476
NM_032458chrX32531 2428 724 23347 2748 23307 2278 --
NM_032505chr342402 2341 480 203 --32458 1985 23 --
NM_032532chr6--2601 593 1549 --
NM_032547chr431300 1250 368 11059 1203 --
NM_032557chr42339 22 --1171 --
NM_032558chr931319 1161 989 ----11484
NM_032626chr161312 --173 --
NM_032632chr1482023 1934 1702 1559 1461 379 368 311 ----1692
NM_032682chr333234 1361 231 --1593 13109
NM_032804chr1052588 923 790 600 439 12423 12054 --
NM_032810chr1031091 387 365 ----1405
NM_032840chr1211171 --11180 --
NM_032846chr1421559 964 1949 ----
NM_032859chr13103813 3643 3621 3542 3449 3301 2767 688 481 225 31269 769 523 1448 --
NM_032869chr821776 418 11740 --11702
NM_032873chr1154522 4006 1784 1380 921 21481 1071 11050 23307 2931
NM_032918chr1211187 11216 11256 11204
NM_032968chrX114058 3375 3153 3029 2803 2796 1434 1207 1166 906 721 33063 653 40 13933 11602
NM_032973chrY114050 3370 3148 3024 2798 2791 1434 1207 1166 906 721 33058 653 40 13925 11601
NM_033055chr111118 --1118 --
NM_033132chr1352212 2203 2071 730 332 22225 2107 11859 --
NM_033211chr522023 2004 --1420 --
NM_033224chr7117995 7755 7703 7455 5380 5224 5084 1913 1841 1313 565 --15745 12788
NM_033254chr3------1141
NM_033285chr874446 3659 2940 1690 777 551 50 14258 22897 632 --
NM_033393chr462841 2758 2341 2021 730 214 --12884 --
NM_033427chr71668 3612 343 331 1156 --
NM_033495chrX2967 366 --1209 1824
NM_033505chr2126694 6541 6077 4205 4194 2499 2404 2343 1649 1639 820 227 --45996 4332 2270 778 --
NM_033512chr853072 2546 619 465 416 --2840 352 --
NM_033631chr183859 3827 3240 2523 1149 1032 741 222 --13559 --
NM_033656chr2123728 1662 1448 31110 700 545 --
NM_052832chr842786 2236 2079 1865 --22963 1995 --
NM_052851chr1362252 1791 1531 274 157 71 12357 22206 334 --
NM_052879chr1242508 1643 1145 598 14034 --21341 782
NM_052885chr1254658 3920 1559 1357 832 1376 24690 3784 14611
NM_052892chr16----1202 --
NM_052896chr142405 1925 1030 559 ----12417
NM_052900chr841804 1581 1236 55 ----11735
NM_052904chr61204 ----11183
NM_052905chr251324 700 522 511 278 11744 21431 366 --
NM_052910chr1342165 1890 1462 730 --2793 471 --
NM_052927chr541535 780 370 225 ----1788
NM_052937chr862206 948 516 249 154 54 --22116 2095 --
NM_052940chr1------1180
NM_052958chr82732 41 163 1619 --
NM_052961chr6------1374
NM_053064chr1462930 2700 2589 430 169 136 1456 13078 --
NM_054108chr11----1129 --
NM_058237chr142985 925 ----11015
NM_080283chr1721158 1028 21099 993 2264 101 --
NM_080546chr9164 51737 448 123 117 95 --11499
NM_080678chr22561 444 ----2547 511
NM_080872chr853690 3496 3197 3178 1176 --34060 2608 342 --
NM_080927chr363224 3165 3079 2781 2506 274 12129 187 13333
NM_101395chr2183360 3288 3151 2425 2361 2338 1187 741 --1168 --
NM_130847chr1165386 4470 3871 3690 451 192 --25164 293 25107 4602
NM_133265chrX73283 3156 2921 2713 1230 702 142 23255 2820 13563 --
NM_133334chr496344 6306 4729 3918 2270 1522 1111 942 245 --25891 5679 --
NM_133367chr652975 2917 2691 2348 2340 ------
NM_133445chr962559 2504 2359 1280 793 154 --23585 2380 1718
NM_133468chr72537 218 2922 196 2568 490 --
NM_133477chr463287 2171 1213 1133 584 169 33254 3024 1997 22926 2862 --
NM_133496chr174577 3950 3289 1801 726 658 640 --23465 621 11057
NM_133638chr5----21338 514 1362
NM_138423chr152460 150 --22262 1438 1266
NM_138426chr762113 1814 1744 630 443 239 11698 22337 676 1549
NM_138444chr13134957 4786 4752 4694 4620 4401 3831 3497 3211 1625 1134 915 844 ----23625 1693
NM_138459chr673509 3433 3411 2862 2766 774 205 33243 2635 2565 23573 2590 12876
NM_138468chr285817 5763 4818 4077 2054 1792 756 608 15808 36238 4367 2551 --
NM_138473chr1265158 5012 3185 1585 454 56 --21563 112 --
NM_138612chr16----161 --
NM_138694chr623534 3435 1871 --12960
NM_138731chr1494222 4213 4016 3647 1585 1352 917 646 436 14115 23119 510 24079 570
NM_138798chr2----179 --
NM_138799chr261812 1642 1499 1455 819 538 --1289 --
NM_139015chr12197 ------
NM_139136chr1221084 306 ----1823
NM_139239chr19----193 --
NM_144563chr21580 --189 --
NM_144571chr485831 5581 5569 5416 2491 2373 1654 1042 36946 4777 156 ----
NM_144578chr1455455 4661 3559 1100 698 53997 767 179 163 50 44905 4645 1482 1460 166
NM_144593chr12------1393
NM_144600chr1661644 1354 1272 597 270 83 --11694 --
NM_144632chr241806 1746 751 642 1702 12080 --
NM_144642chr371040 909 423 362 272 110 94 21294 327 21173 531 --
NM_144664chr1132478 2423 36 12513 1271 2863 780
NM_144721chr432377 186 127 --22705 415 1449
NM_144726chr511070 --2215 199 --
NM_144778chr1352751 2330 1890 1853 345 --11759 12278
NM_144963chr852406 2287 2166 536 101 --12018 --
NM_144973chr1295123 4979 4222 3261 1291 1144 1056 488 381 15117 25201 435 --
NM_145025chr621098 65 --11162 --
NM_145049chr5------1332
NM_145263chr41704 21610 761 21688 795 --
NM_145268chr71308 --2385 355 --
NM_145284chrX22538 660 22566 970 ----
NM_145305chrX61286 1153 401 266 59 23 --11298 --
NM_145307chr1074618 4245 3510 3281 2896 1611 192 --13084 --
NM_145735chr1311810 22768 2734 ----
NM_145808chr773007 2771 2391 2136 1906 1160 474 1735 32295 2039 1190 --
NM_147128chr72560 533 1225 11502 --
NM_148894chr441199 397 303 104 --1885 --
NM_152261chr1252483 2267 2213 1634 574 1343 ----
NM_152263chr144459 1366 598 145 2853 835 14756 --
NM_152275chr211912 12061 12140 --
NM_152280chr182936 2684 2556 2486 2350 1057 601 276 --12537 --
NM_152332chr1462782 1995 1835 1781 469 164 22310 2063 32051 1869 136 --
NM_152347chr172207 148 2471 58 ----
NM_152380chr131591 1447 597 --11517 --
NM_152409chr552348 2238 1426 1369 170 12918 23339 774 --
NM_152462chr171754 ----1685
NM_152519chr251625 1553 547 108 33 --1523 --
NM_152520chr271239 1011 1003 924 896 292 115 ------
NM_152594chr1572276 2211 1576 523 447 378 317 1492 1184 11651
NM_152622chr573103 2399 1255 1166 1032 488 439 22382 128 ----
NM_152624chr5157441 6389 6032 5941 5031 4732 4541 2586 2098 1789 852 718 581 177 102 32895 2634 1062 31654 1108 303 11903
NM_152641chr1242915 1928 1121 1005 --12440 --
NM_152688chr6----1868 1951
NM_152699chr363264 3007 2733 839 541 387 1262 21336 920 --
NM_152734chr675412 4278 3637 2161 1345 1137 128 --15457 --
NM_152737chr641865 1748 1626 1553 ----11354
NM_152745chr741159 1058 1023 461 ------
NM_152753chr6----1818 --
NM_152754chr783860 3794 3588 3494 2465 1527 934 550 1797 1803 13834
NM_152756chr564369 3878 3732 3460 1443 1095 13763 --1782
NM_152758chr872697 2062 777 715 664 302 269 1700 12776 --
NM_152780chrX1136 --11256 11018
NM_152787chrX83913 3312 2989 2728 1358 891 754 262 --33243 2977 881 --
NM_152793chr773975 3537 1938 1825 508 410 327 13471 31974 738 344 --
NM_152857chr61156 ------
NM_153184chr341767 1756 1352 196 --2433 328 --
NM_153207chr1274033 3867 3745 3175 2533 1133 880 12933 --11172
NM_153208chr162292 167 --1964 --
NM_153261chr1631599 1046 264 11240 1319 --
NM_153262chr173185 2743 2556 2411 1272 799 598 22463 2457 13056 --
NM_153267chr92322 269 1732 1352 --
NM_153354chr53946 825 168 --1918 --
NM_153362chr61849 1775 --1164
NM_153365chr442559 892 652 528 --21971 980 --
NM_153456chr1356214 5583 4352 1976 1360 22541 1043 26082 230 --
NM_153607chr583031 2981 2767 2208 2145 2113 925 765 12639 1992 1745
NM_153634chr1241550 1505 1294 1051 --1291 --
NM_153689chr221882 932 1917 --12359
NM_153825chr421560 326 --21743 635 --
NM_170662chr34585 566 137 43 ----1652
NM_170665chr12104473 4411 4344 4193 3923 3886 3865 3024 1016 398 --24214 756 --
NM_172037chr821199 63 ----11367
NM_172070chr252123 2003 832 475 244 11864 31812 1463 409 1308
NM_172071chr147266 2748 2245 1994 16515 22889 187 --
NM_172127chr451867 1671 407 183 129 --21495 143 1174
NM_173083chr151246 1000 922 321 208 ----21291 1144
NM_173354chr2162183 2057 1515 805 497 412 --12161 --
NM_173468chr444918 930 577 481 25487 2204 25379 719 35994 5758 897
NM_173511chr243915 3829 1452 1030 --1636 12916
NM_173515chr6----1976 --
NM_173519chr841921 1623 747 232 --2403 387 --
NM_173552chr322395 1574 --11795 1894
NM_173591chr121248 --11032 --
NM_173647chr21960 ----1106
NM_173808chr143718 3587 1304 437 --11182 --
NM_173822chr21703 12023 11357 --
NM_174916chr1522363 2236 --1651 12335
NM_175061chr762182 1907 1845 1393 862 153 11748 22029 117 --
NM_175607chr34684 547 326 211 1270 ----
NM_175709chr2232704 2623 989 --12904 --
NM_175736chr1277714 6869 5427 5056 2623 879 406 27790 6185 17163 16918
NM_175854chr1311826 1700 --12296
NM_177968chr271905 1669 1579 781 647 499 311 --12256 --
NM_178011chr1032152 1061 753 --22050 308 1987
NM_178539chr1241678 1643 1368 378 22026 1756 --21321 650
NM_178812chr831008 603 516 --11201 1456
NM_178815chr1052620 2477 297 211 137 ----2786 218
NM_178826chr124741 590 560 94 1581 1106 --
NM_178868chr3----1219 175
NM_180989chr1342431 2278 1675 47 --1467 11951
NM_181077chr1542320 2070 1979 1563 1259 32227 1929 1578 --
NM_181358chr154247 4061 3172 2937 1644 --44264 3928 1456 1162 --
NM_181504chr5113910 3483 3042 2836 2591 1294 1280 958 852 582 292 33887 3873 3035 14176 13027
NM_181571chr101223 135 1356 --
NM_181656chr171950 --3939 898 205 --
NM_181670chr121500 ----31467 1279 1210
NM_181782chr652333 2295 443 388 296 1737 --21763 580
NM_181783chr1241827 618 282 183 2651 175 21990 581 --
NM_181836chr542516 1874 956 22 11002 --1139
NM_182485chr4112994 2402 2301 1261 1210 958 884 767 684 130 45 13180 32446 738 94 --
NM_182493chr16105356 5073 4821 4762 4622 4300 3772 1771 1655 724 22027 1428 13701 14576
NM_182503chr655486 1403 1243 1161 947 --25585 3606 2569 275
NM_182527chr2211823 ----22238 2188
NM_182691chr751229 1164 993 484 427 ------
NM_182765chr1042345 1792 1723 476 11758 --11989
NM_182767chr1211855 22100 1541 21999 817 --
NM_182976chr12107 49 --1608 --
NM_183397chr2064672 3817 3590 3119 1267 228 --21448 171 --
NM_183416chr132075 1677 674 11841 31714 755 662 --
NM_194247chr2114297 3710 1749 1675 1660 1247 773 757 441 235 219 --196 --
NM_194285chr1153026 2601 2397 507 196 13424 33183 2317 2078 1125
NM_194291chr882510 2495 2479 2454 2405 342 124 39 --11918 --
NM_194314chr165202 5118 1992 1966 614 203 12053 14492 --
NM_194318chr1332514 2433 140 ------
NM_197941chr542722 2421 2363 393 --3694 102 50 --
NM_198256chr2122 ----1528
NM_198270chrX42325 1254 1226 564 --23466 3130 --
NM_198273chr593072 3027 2435 2289 2267 714 347 266 40 22978 799 33058 606 285 --
NM_198401chr821666 1383 --21768 1155 --
NM_198402chr31303 ------
NM_198463chr3----1376 --
NM_198504chr3----1856 --
NM_198513chr83820 731 615 21880 459 ----
NM_198859chr363571 1902 1830 786 419 46 13757 13539 14957
NM_198904chr562086 1855 1416 734 672 342 12017 1580 --
NM_198991chr182578 240 --1739 --
NM_199000chr722273 1467 1899 ----
NM_199320chr442762 2551 2500 2319 --12537 1945
NM_201280chr631429 606 463 1439 11598 --
NM_201634chr511808 --21957 37 --
NM_203301chr1441306 1094 424 410 1133 1613 21727 197
NM_203394chr1272337 2164 1837 509 358 177 69 --1635 --
NM_203406chr592703 2525 2374 2211 1982 984 711 533 451 1942 12851 --
NM_203459chr162493 2339 2110 1950 168 146 ----1383
NM_206853chr664024 2718 2506 910 787 563 1580 23964 864 13777
NM_206854chr6125285 3979 3767 3709 3568 2048 1824 1145 1080 553 325 150 11841 35225 3307 2125 15038
NM_207303chr1034092 3174 590 21334 269 2968 514 11492
NM_207332chr8------1301
NM_207406chr4125671 5663 5096 4763 4756 4719 4579 4502 4489 4464 4342 1077 --15225 26307 4255
NM_207506chr83970 378 52 11322 1396 --
NM_212558chr984121 3542 3486 3240 1595 983 768 367 14133 ----
NM_213589chr2115207 5155 4016 2203 1611 1357 1047 633 418 198 151 2679 187 35315 3975 1079 --
NM_214711chr483716 3348 2771 1292 1018 708 338 44 33727 3705 3689 23494 2887 13399