TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-588
miRNA Sequence: UUGGCCACAAUGGGUUAGAAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr51463 --1581 --
NM_000084chrX106928 6182 6066 5746 5024 4470 4309 2796 2285 1645 12629 ----
NM_000110chr1----1193 --
NM_000112chr533673 1765 400 12065 23745 114 --
NM_000115chr1312093 12384 22500 1734 --
NM_000125chr673702 3298 3004 1368 1238 1125 432 --21050 137 --
NM_000163chr541711 573 359 303 1669 12290 --
NM_000176chr553263 2985 2791 1148 962 ----11460
NM_000216chrX33885 3706 1620 13618 13914 --
NM_000237chr81527 --11777 2214 188
NM_000259chr1535003 4263 1055 11135 1848 --
NM_000280chr112798 334 ------
NM_000314chr1023134 633 1449 --1375
NM_000332chr646773 4571 2880 29 26197 6050 --16224
NM_000337chr574823 2153 1973 1892 1625 1343 608 24287 527 12216 16318
NM_000346chr1711239 2258 32 21661 242 1232
NM_000390chrX23080 2436 11334 ----
NM_000408chr213104 1594 ----
NM_000430chr1733186 2668 247 ------
NM_000448chr1122589 2070 ------
NM_000489chrX13298 ------
NM_000555chrX77217 6747 5126 5074 4883 2449 1594 1704 ----
NM_000618chr1236567 6381 5498 34371 1523 942 ----
NM_000633chr18125162 5080 3712 3414 3257 1996 1356 1312 1143 1074 389 334 ------
NM_000726chr2--182 11386 --
NM_000792chr12993 904 ------
NM_000793chr1464752 4649 4419 4078 1248 1101 13936 ----
NM_000813chr565603 5409 2007 585 346 138 13905 1238 1682
NM_000826chr42899 868 ----12291
NM_000834chr122953 867 21164 495 ----
NM_000875chr15136440 6049 5997 4772 4664 4469 2360 2098 1922 1902 1841 424 412 26810 5543 24758 894 14405
NM_000921chr122441 113 ------
NM_000924chr123287 280 101 --1240 --
NM_000950chrX33267 2916 2453 22862 2284 ----
NM_000983chr121641 1406 ----11631
NM_001001481chr8--12844 ----
NM_001001557chr841790 525 330 229 ------
NM_001001852chr223599 593 45 ----1680
NM_001001994chrX----1194 --
NM_001002860chr1434261 3124 756 --14077 --
NM_001002876chr222135 51 ----1429
NM_001002909chr1721788 382 --11770 --
NM_001003674chr1864487 4389 2386 1880 1750 693 12810 --17058
NM_001003712chr1233840 3811 1017 1568 --1769
NM_001003800chr93788 710 620 ----13251
NM_001004304chr1283036 2712 2089 2050 1145 797 306 157 1978 1854 --
NM_001004419chr12----11683 --
NM_001005353chr11197 --21249 35 --
NM_001007246chr21--11476 --1596
NM_001007278chr1324890 1040 176 1982 --
NM_001007466chr664491 3805 3254 1192 916 255 34338 1297 72 ----
NM_001008220chr552990 2806 512 440 130 21019 947 13462 1854
NM_001008222chrX51240 1143 878 506 430 --11306 --
NM_001008239chr1833547 1407 868 ------
NM_001008701chr1962571 2407 1985 576 95 30 --22329 749 --
NM_001008703chr6----1119 --
NM_001009899chr344863 2316 2180 413 32137 1490 433 25565 5492 --
NM_001009958chr7----1173 --
NM_001010867chr1136366 5954 4377 2185 2020 1809 1627 1448 1417 498 321 278 218 --11157 --
NM_001010888chrX1617 23563 1430 1210 --
NM_001010891chr576783 6417 5665 4189 1484 880 421 ----34934 1748 23
NM_001010942chr1211015 ----11174
NM_001011537chr31610 --12087 --
NM_001011885chr1531493 1188 270 1230 ----
NM_001012426chr642749 2271 425 412 ----11164
NM_001013415chr411203 --1321 --
NM_001014797chr1058025 7353 7315 7104 536 3860 596 60 32424 2277 477 --
NM_001015880chr1021485 478 ------
NM_001017395chr353396 3181 709 545 317 ------
NM_001017981chr221582 --1766 --
NM_001018050chr2283475 3173 1298 1219 567 213 207 52 --13001 --
NM_001018054chr11271 11355 1435 --
NM_001018065chr943881 2342 1327 108 25651 1442 --25708 5243
NM_001018108chr1532109 1740 1395 1628 1661 --
NM_001024460chr61165 21236 81 --1108
NM_001024463chr151222 21012 211 ----
NM_001024649chr562880 2369 793 776 724 58 ------
NM_001024948chr1--13182 12308 --
NM_001025107chr132141 196 83 --12477 --
NM_001030055chr1411006 11350 13471 1659
NM_001031690chr752894 1958 460 242 226 1754 ----
NM_001031717chr33992 133 63 ------
NM_001031812chr511855 22197 1748 ----
NM_001032280chr621398 1258 ------
NM_001032296chr1342766 2679 2595 1097 1502 11078 --
NM_001032998chr2------1201
NM_001032999chr20105087 4623 4387 3619 3347 3257 1944 1567 883 683 22024 816 ----
NM_001033557chr2----11286 --
NM_001039350chr731728 1116 30 --1304 11331
NM_001039479chr1462224 1984 1890 1647 840 512 ------
NM_001039570chr2294135 3832 3450 3441 2973 1867 1365 1302 739 33273 1443 852 1318 159
NM_001039574chr12928 824 --1831 --
NM_001039618chr1134032 1399 1168 2927 458 14780 --
NM_001039693chr233126 1616 399 12556 1411 --
NM_001039762chr102690 523 ----11493
NM_001039937chr1332627 724 105 13896 ----
NM_001040110chr731287 1190 677 --2583 477 --
NM_001040142chr22261 163 12414 ----
NM_001040152chr723270 2009 1210 ----
NM_001040202chr4--11736 --1719
NM_001040272chr921463 34 12320 22120 1487 --
NM_001040402chr42927 150 12506 ----
NM_001040429chr131639 ------
NM_001040665chr714409 13290 14173 11542
NM_001042355chr1613283 --23859 570 14717
NM_001042406chr62978 413 ------
NM_001042413chr933269 1383 492 ------
NM_001042481chr14----11837 1533
NM_001042599chr287239 6766 5272 2334 1002 786 238 75 22343 573 ----
NM_001042603chr1244143 934 340 291 13248 ----
NM_001042749chrX----21944 1260 --
NM_001167chrX66025 5684 5343 4165 2059 1464 16105 16345 12579
NM_001186chr2142358 1270 674 380 12219 ----
NM_001191chr2061097 1091 1029 589 422 278 11364 ----
NM_001198chr62974 72 --31843 862 470 --
NM_001200chr202914 294 1838 1885 --
NM_001204chr267083 7067 6546 5275 4836 284 26621 4913 ----
NM_001259chr755494 5438 2311 1046 51 1625 26177 526 --
NM_001304chr1723520 339 1369 ----
NM_001356chrX--11004 ----
NM_001364chr1134714 2914 1876 11187 ----
NM_001390chr1843086 2971 2940 1160 --32211 1192 99 --
NM_001395chrX1369 ----1624
NM_001396chr2141981 815 694 328 11969 1789 --
NM_001401chr921133 349 --11438 --
NM_001402chr651995 1594 1478 1392 80 21810 316 1721 --
NM_001407chr341586 1425 1404 1284 ------
NM_001412chrX12504 --1506 22317 1210
NM_001419chr1964777 3914 1377 1271 1253 545 13172 ----
NM_001447chr541435 1386 1203 91 ------
NM_001448chrX11390 --1127 21735 233
NM_001482chr153824 287 24 ------
NM_001494chr101669 --1179 --
NM_001552chr1721082 951 --1909 --
NM_001627chr3--31808 1753 825 1969 --
NM_001709chr1142695 2604 2468 804 11090 12462 --
NM_001730chr131183 --11536 --
NM_001755chr1622270 1407 ------
NM_001759chr1245173 5088 4560 873 24843 3587 ----
NM_001760chr63944 867 688 --2200 27 1764
NM_001789chr331550 1515 183 1377 ----
NM_001854chr111546 ----1209
NM_001939chrX83702 3689 2489 1097 1056 1041 1001 294 ------
NM_002023chr111260 ----11685
NM_002126chr1732987 2532 853 --23212 186 --
NM_002137chr732132 622 291 ----11940
NM_002140chr9----1356 --
NM_002141chr7----1657 --
NM_002192chr7----1610 --
NM_002210chr21848 --13462 --
NM_002264chr384972 3909 3897 3836 1455 968 514 306 24676 4200 14380 --
NM_002293chr142233 543 443 419 12279 12254 --
NM_002309chr2252634 2190 745 142 79 ----11114
NM_002336chr1234936 4040 1746 14926 ----
NM_002359chr1774170 3294 2944 1607 1433 963 215 33343 2993 1593 33334 1578 401 --
NM_002372chr5195 1445 ----
NM_002373chr152849 58 ------
NM_002401chr1741856 932 850 176 --1630 --
NM_002499chr1551975 1895 182 164 129 --1313 --
NM_002509chr201637 ------
NM_002515chr1431425 767 647 ------
NM_002520chr5----1254 --
NM_002526chr611633 --11262 --
NM_002576chr1151156 1145 987 930 203 11042 ----
NM_002607chr71992 --1405 --
NM_002629chr101137 --1647 --
NM_002651chr11852 ------
NM_002655chr835257 5010 351 23597 579 ----
NM_002657chr2053452 3376 2928 2696 438 ------
NM_002687chr1421068 1039 ------
NM_002719chr1412335 ------
NM_002734chr1721556 684 12190 2402 96 --
NM_002740chr312419 1684 22774 2660 --
NM_002827chr2021813 1407 ------
NM_002833chr1531284 161 30 --1265 --
NM_002848chr1241328 510 492 81 ----1121
NM_002912chr6----1896 --
NM_002941chr3------11215
NM_002998chr831691 1640 793 ------
NM_003016chr1731333 802 320 ------
NM_003074chr352097 1963 1853 1694 231 ------
NM_003081chr202896 226 --1216 --
NM_003106chr32780 709 ------
NM_003150chr1752278 2145 1741 1667 606 1680 1270 --
NM_003156chr1131060 873 863 ----11104
NM_003170chr171485 ----1129
NM_003185chr202910 237 ------
NM_003189chr143118 1208 706 420 22481 1141 1430 --
NM_003211chr12----11320 --
NM_003234chr31367 1827 11591 --
NM_003320chr1144262 3808 3629 376 --34393 656 636 1497
NM_003340chr41499 ----1289
NM_003341chr3----1476 --
NM_003344chr731123 527 174 ----1266
NM_003406chr81288 --11529 1221
NM_003439chr743555 3543 2617 2254 32946 2335 420 ----
NM_003458chr353320 3018 2746 395 242 12929 23766 617 --
NM_003468chr231695 1203 381 ----23474 3424
NM_003483chr1222405 2344 22993 2441 --12580
NM_003507chr22436 383 ----1491
NM_003564chr12557 441 ----1588
NM_003583chr1223645 3240 --23913 3827 --
NM_003618chr2--11042 2845 410 --
NM_003629chr153083 3032 2656 1391 1205 23493 2833 11166 --
NM_003677chr1242085 1403 638 402 153 ----
NM_003704chr41628 ------
NM_003872chr232604 2028 1050 12467 --22766 213
NM_003913chr61365 ----12717
NM_003972chr1021200 479 ------
NM_004050chr1432109 439 32 12351 ----
NM_004100chr622504 1769 ----1350
NM_004113chr3------1128
NM_004136chr15----23078 439 --
NM_004162chr311047 ------
NM_004183chr111699 --1707 --
NM_004187chrX2383 290 --21389 111 --
NM_004227chr772671 2056 260 228 187 168 135 12570 --12299
NM_004296chr1472725 2553 1426 949 869 674 102 --33588 3127 519 --
NM_004302chr1232333 691 421 --2310 110 --
NM_004379chr241658 1602 1523 52 ----11580
NM_004430chr832138 692 679 --11764 --
NM_004438chr232234 526 467 12612 12275 --
NM_004459chr172668 132 1159 ----
NM_004474chr11335 ----1781
NM_004496chr1421019 879 1377 11050 --
NM_004504chr21674 1239 142 --
NM_004540chr21------1299
NM_004586chrX45047 1494 1276 618 24194 1574 ----
NM_004687chr1731908 1806 86 ----12040
NM_004709chrX--1156 11581 21415 72
NM_004748chr153864 817 82 1240 ----
NM_004776chr2052940 2090 1140 355 344 ------
NM_004822chr1753576 3209 3102 2693 2562 --1857 --
NM_004863chr14115243 4671 4461 3661 1571 1527 974 924 681 634 55 34749 1607 314 2134 93 --
NM_004932chr5----152 --
NM_004956chr743650 3260 3115 3086 --14405 --
NM_004985chr1254394 3178 1332 1158 575 ------
NM_004999chr623842 807 13920 ----
NM_005032chrX2435 99 --1959 --
NM_005057chr1147 11388 164 --
NM_005065chr142327 241 --192 --
NM_005096chrX----152 1957
NM_005109chr321805 265 --1196 --
NM_005116chr20134341 3705 3675 3191 1600 785 691 581 559 243 237 27 21 --23613 1577 1752
NM_005160chr2255920 5441 4574 4297 2357 12577 --15733
NM_005206chr1721197 368 11275 136 --
NM_005215chr18------1614
NM_005233chr33479 351 39 ------
NM_005249chr14----2846 683 --
NM_005276chr1241468 1085 694 368 ------
NM_005277chr41722 --1523 --
NM_005342chrX21967 366 --2974 180 --
NM_005386chr20------1757
NM_005392chr92401 176 --11799 --
NM_005400chr221927 552 32899 735 581 ----
NM_005479chr1021054 285 --31468 1423 344 --
NM_005491chrX51586 1492 790 737 555 1630 ----
NM_005502chr941210 1132 377 25 ----1622
NM_005509chr5------149
NM_005537chr133836 390 197 ------
NM_005563chr13336 284 63 ------
NM_005737chr22732 697 --12634 1894
NM_005759chr264595 3765 3337 1479 1058 742 --11403 --
NM_005828chr1731916 1833 154 24185 3306 24202 93 --
NM_005857chr11389 ------
NM_005859chr511306 1409 11094 --
NM_005885chr521628 463 ------
NM_005898chr114730 558 322 45 22446 591 ----
NM_005933chr1132450 2277 893 --12334 --
NM_005941chr824160 1503 ------
NM_006047chr2033467 2942 394 --13345 --
NM_006133chr1191834 1579 747 504 474 447 425 190 46 --11894 --
NM_006135chr11370 --156 --
NM_006197chr812200 --1131 --
NM_006224chr1731885 794 700 ----142
NM_006256chr11175 ----11048
NM_006275chr2012427 --12325 1137
NM_006282chr201197 23330 1177 34189 1659 616 --
NM_006310chr1721234 506 ------
NM_006315chr494131 3525 3109 1431 1423 1196 1037 944 672 24534 1635 23887 3081 13534
NM_006352chr1----11902 --
NM_006460chr17----1702 1324
NM_006493chr1321411 1316 1196 ----
NM_006494chr19------1807
NM_006544chr1423824 1715 14734 13864 --
NM_006549chr1262488 2401 2388 1942 496 452 --1205 11082
NM_006599chr1667320 6878 6802 3204 1487 942 1491 22219 1214 --
NM_006622chr53468 426 131 ------
NM_006646chr1342713 1006 271 55 --12814 --
NM_006690chr2071524 1463 867 640 454 80 37 11674 22210 309 --
NM_006699chr11966 --1253 --
NM_006738chr1574314 3929 3610 3514 1429 827 44 1496 13596 --
NM_006750chr1697086 5895 5746 5734 5173 2152 1143 596 184 37681 5826 2589 ----
NM_006769chr11489 ------
NM_006777chrX32425 781 688 12811 1660 --
NM_006788chr1841326 624 521 296 1753 1409 --
NM_006795chr1151535 1219 1037 458 317 --21308 218 --
NM_006838chr12----11482 1569
NM_006856chr1231014 803 384 --1164 --
NM_006885chr16----13261 13610
NM_006888chr1483384 2345 2294 2181 774 527 305 185 13057 --12144
NM_006899chr201104 --1254 --
NM_006902chr132870 720 28 42623 2156 816 83 ----
NM_006940chr1241352 1256 1180 384 ----172
NM_006981chr911015 ------
NM_007007chr1234774 3525 280 ------
NM_007011chr15106362 5394 5252 4591 2529 2426 2311 2198 1830 507 25473 5303 15053 --
NM_007107chr3143 11586 2691 74 --
NM_007137chrX75041 4588 4261 3979 1985 804 352 44858 4601 1439 823 ----
NM_007172chr2242631 2511 2439 2026 ----1145
NM_007249chr1336538 1656 362 18585 ----
NM_007364chr15------1605
NM_007368chr1321091 433 11537 ----
NM_007375chr132649 2623 919 12773 ----
NM_012081chr533243 3072 728 --12699 11303
NM_012083chr1031314 887 521 ------
NM_012104chr1142577 1004 242 63 1442 195 --
NM_012233chr22361 27 --11052 --
NM_012281chr72403 218 --1856 --
NM_012294chr733406 2612 2601 23998 2626 ----
NM_012300chr5152 --160 --
NM_012309chr1154411 1743 637 457 288 1807 13538 1739
NM_012316chr194938 4613 4405 2030 1749 1531 1390 969 932 14143 ----
NM_012329chr1711402 1249 ----
NM_012402chr1151276 1141 1129 212 24 21219 284 ----
NM_012471chrX21311 577 --1418 --
NM_013381chr1242156 1949 892 96 ------
NM_013382chr1441892 1868 1493 645 ------
NM_013411chr121858 531 --191 --
NM_014011chr222486 509 ------
NM_014112chr875344 5109 4006 3872 3839 539 396 2262 194 11043 14952
NM_014159chr32554 255 --132 --
NM_014240chr383686 3658 3537 3413 2975 2948 1292 69 13424 12560 --
NM_014253chrX41556 839 702 609 ------
NM_014325chr1231453 628 73 --12235 --
NM_014423chr534886 4402 1853 ------
NM_014460chr2261717 1236 1100 204 110 28 1492 31448 1071 150 --
NM_014469chr112826 601 1717 ----
NM_014491chr72884 307 1848 ----
NM_014494chr1621545 891 --1649 --
NM_014554chr121501 --1884 --
NM_014647chr1621987 629 ------
NM_014665chr892661 2600 2504 2335 1325 1313 620 581 555 --31337 1141 738 --
NM_014671chr71617 11586 2239 176 --
NM_014674chr353428 3130 2888 1229 515 ------
NM_014702chr653500 3251 2142 1180 297 --12867 --
NM_014747chr1114800 4635 4358 3925 1630 920 765 642 534 438 122 14721 ----
NM_014758chr1122137 124 --21930 412 --
NM_014819chr51570 --22513 1642 --
NM_014820chr32278 166 ------
NM_014824chr1161989 456 415 281 140 57 ----1742
NM_014874chr13485 102 87 11772 11417 --
NM_014877chr1777145 6109 5573 4712 1737 1593 425 --17398 --
NM_014917chr11344 --1666 --
NM_014932chr331707 1695 643 ------
NM_014989chr6------11963
NM_014991chr42776 593 33075 3033 849 1883 --
NM_015032chr1322716 229 166 1161 --
NM_015035chr20146507 6379 6044 5278 4970 4515 4380 4296 1698 1674 1169 1149 1090 31 --16196 --
NM_015064chr12133412 2890 2867 2624 2600 2582 2387 2351 2209 1388 662 630 559 13492 23032 2398 1343
NM_015069chr162474 128 ------
NM_015075chrX51467 1385 558 245 231 ----11423
NM_015094chr22104514 3117 3104 3061 2905 1328 1281 391 349 119 ------
NM_015100chr161965 1810 1661 679 550 225 ----1421
NM_015111chr573816 2722 1501 1492 537 494 250 --22476 501 13214
NM_015132chr742002 1854 1725 764 1378 ----
NM_015144chr1673399 2621 2577 907 837 351 231 --13621 --
NM_015155chr1073222 3190 2729 490 469 448 317 --23003 688 --
NM_015161chr161377 --1385 --
NM_015192chr2042611 2284 524 35 12047 ----
NM_015206chr1542687 823 785 429 1934 --13468
NM_015215chr13985 963 190 --11252 --
NM_015288chr593717 3318 2791 2608 2455 1206 1042 890 287 13328 13731 13222
NM_015328chr752741 2399 2277 1142 451 --1308 --
NM_015332chr793385 3332 2876 2476 2277 1080 591 539 216 --33576 3362 208 --
NM_015358chr21--11336 1146 --
NM_015375chr1104496 3346 3333 3272 3226 1793 1573 704 533 59 1782 ----
NM_015443chr1731108 460 444 ------
NM_015455chr521072 78 23669 1566 12830 --
NM_015477chr154885 329 144 126 ------
NM_015508chr331441 1081 333 11433 ----
NM_015526chr191507 ------
NM_015534chr12326 166 ------
NM_015569chr1--1710 12975 --
NM_015584chr1751247 1063 1012 329 34 11075 ----
NM_015622chr72204 55 --173 --
NM_015630chr2----1975 --
NM_015695chr641744 1596 833 88 --11687 --
NM_015879chr1877039 6097 5550 5498 3247 1339 1096 37367 1448 375 26843 864 --
NM_015886chr834830 4374 2124 ------
NM_015898chr1942402 1754 657 597 ------
NM_015904chr2----1188 --
NM_015981chr563095 2336 2259 2138 604 573 ------
NM_015995chr15104909 4189 4114 3990 3964 3769 1825 1476 1427 410 11940 11739 --
NM_016018chr852042 2018 979 107 32 2397 73 ----
NM_016083chr633454 3311 274 ----21569 1002
NM_016129chr4------1263
NM_016131chr232136 750 705 ------
NM_016170chr21356 ------
NM_016205chr4149 --11462 --
NM_016252chr21377 1750 ----
NM_016257chr193158 2779 2437 1247 549 362 235 44 29 ------
NM_016275chr332268 2041 499 12337 ----
NM_016315chr231797 1595 337 11230 11670 --
NM_016322chr922343 1132 ------
NM_016376chr1751297 1163 617 454 37 ------
NM_016424chr1711817 ------
NM_016441chr242152 1486 389 342 ------
NM_016519chr4----1145 --
NM_016605chr582721 2479 2428 2190 1759 369 177 50 --11709 --
NM_016626chr1831390 711 182 11702 ----
NM_016628chr10------1307
NM_016641chr1621513 127 --1443 --
NM_016829chr36517 328 315 290 271 61 1613 ----
NM_017488chr211523 --11285 1103
NM_017548chr3----1283 --
NM_017580chr1021943 767 11688 12241 --
NM_017590chr2272270 1956 1705 1662 928 741 513 --21757 1747 --
NM_017596chr184177 3978 3903 3798 3723 1702 1204 689 --23670 858 14185
NM_017628chr434936 4884 4795 1365 15297 --
NM_017637chr976509 6104 6040 3153 1065 942 649 --48973 8020 6650 138 --
NM_017709chr131593 1425 995 --14221 --
NM_017754chr663700 3253 1042 881 700 475 34676 4608 1903 14452 --
NM_017824chr1022575 1979 12178 ----
NM_017848chrX43323 2840 437 184 23372 208 11736 --
NM_018013chr632865 518 85 2601 107 ----
NM_018014chr221324 62 ------
NM_018027chr1031227 617 361 11093 ----
NM_018121chr1042816 2048 781 686 ------
NM_018133chr33886 524 304 --11506 --
NM_018157chr1252691 2473 1277 367 102 --12582 11127
NM_018227chr4----2779 210 1743
NM_018312chr1162129 1904 1881 1862 1839 1808 11398 ----
NM_018364chr153924 3850 3536 677 546 --12684 --
NM_018374chr724948 3404 ----24618 1090
NM_018427chr1621200 479 ------
NM_018440chr898150 7820 7408 6628 6149 3323 1584 1434 287 26229 5353 28467 2489 --
NM_018689chr153559 525 388 1220 22296 1058 --
NM_018847chr911218 ----1154
NM_018970chr743174 904 898 62 ----1254
NM_018999chr1034053 1198 1136 ----1138
NM_019004chr71377 12377 ----
NM_019071chr7------1252
NM_019072chr52741 44 --14120 --
NM_019096chr64372 351 271 61 11032 1173 --
NM_019106chr2222774 506 --13070 --
NM_019610chr121406 565 1684 ----
NM_020137chrX3456 383 342 ------
NM_020144chr731899 1878 1856 ------
NM_020163chr32569 358 11731 2672 24 --
NM_020205chr142773 2519 2449 969 ------
NM_020211chr1531272 610 572 11554 11035 --
NM_020336chr2033306 2870 2457 --21181 1055 13579
NM_020341chr20----1205 --
NM_020342chr242452 989 816 100 --1321 --
NM_020384chrX3450 134 30 --11266 --
NM_020416chr411769 ----22572 1966
NM_020463chr231356 417 32 ------
NM_020682chr101118 1198 1903 --
NM_020728chr732617 2605 1079 22697 163 ----
NM_020801chr521857 1766 12374 1437 --
NM_020808chr1----1717 --
NM_020809chr1121674 1472 --1525 --
NM_020850chr1693088 2913 2858 2786 2385 2302 1284 832 506 22097 931 13078 --
NM_020854chr18----11529 --
NM_020858chr153364 219 28 ----1118
NM_020871chrX22501 2200 ------
NM_020899chr1741733 710 517 461 ------
NM_020918chr1031078 960 728 ----12421
NM_020935chr223564 2880 --14471 --
NM_020962chr152551 289 --42156 351 302 67 11837
NM_021020chr893489 3326 2646 2439 1197 927 846 670 485 12874 1335 --
NM_021033chr131772 --12554 11022
NM_021047chr192568 531 ------
NM_021132chr1011248 ----1551
NM_021183chrX21958 24 1284 ----
NM_021260chr142430 420 ----11211
NM_021783chrX41918 1791 1497 334 12445 ----
NM_021914chr1441613 948 825 365 1374 ----
NM_021947chr1711240 --2494 108 --
NM_021949chrX41816 974 422 62 32744 2517 1132 --11871
NM_021961chr1156921 5155 1833 1813 1038 12184 11528 --
NM_021965chr9--1892 --11376
NM_022003chr114492 395 370 283 --21084 293 --
NM_022062chr1121551 1438 --21468 520 11964
NM_022131chr32965 201 ----11342
NM_022459chr1334516 4126 100 --1337 --
NM_022474chr1422034 1057 12385 ----
NM_022489chr142596 172 ----1796
NM_022719chr2263451 3260 3111 1271 953 754 --11528 --
NM_022728chr7----128 --
NM_022742chr7259 45 ------
NM_022898chr1434015 3683 983 --13012 --
NM_022912chr241866 1236 1215 693 ------
NM_022918chr11--21860 1506 1551 --
NM_024295chr821372 494 182 11633 --
NM_024524chr312085 ----12590
NM_024612chr17----1100 --
NM_024613chr8----135 --
NM_024617chr93887 807 31 ------
NM_024665chr33810 701 101 ------
NM_024674chr132443 1012 300 12521 12919 --
NM_024798chr1572805 2662 2326 1907 1793 664 264 ------
NM_024933chr24702 593 490 42 ------
NM_024949chr473922 3901 3290 3037 1974 878 680 ----14712
NM_024953chr1221951 617 12140 ----
NM_025054chr832923 1445 159 23228 727 ----
NM_025146chr3--12683 11028 --
NM_025160chr133012 1675 818 ------
NM_025219chr2042473 2322 1654 44 12164 32268 1527 21 --
NM_030571chr51407 11588 --1565
NM_030647chr755983 5045 4901 2511 1584 12488 12265 12384
NM_030756chr10----1121 --
NM_030786chr121466 180 ----11314
NM_030806chr198599 8412 6299 3050 2756 2683 2151 1775 925 21898 1745 39109 7078 2796 17465
NM_030918chr145166 4815 4030 122 25362 1985 1811 1662
NM_030964chr533114 997 901 --12517 --
NM_031445chr263392 2601 2100 842 322 48 --138 --
NM_031469chr613373 11062 23332 153 --
NM_031483chr2042786 2281 751 618 11145 12392 --
NM_031890chr2262372 2322 2092 1865 872 517 12502 1385 --
NM_031954chr1262213 2062 1895 1834 978 561 --11110 --
NM_032193chr1161870 1854 1801 1665 698 604 --2769 400 --
NM_032199chr1043264 2880 1234 330 21542 38 13355 --
NM_032213chr251093 1021 327 86 77 1280 ----
NM_032329chr2113767 3728 3700 3623 3415 3254 3155 3105 2888 1308 217 --43147 2762 672 118 --
NM_032412chr5--1246 --1301
NM_032458chrX32363 2352 2206 12400 ----
NM_032505chr362608 2120 1103 881 811 716 ----12068
NM_032514chr20----1406 --
NM_032560chr142315 90 ------
NM_032632chr1411683 ------
NM_032682chr323492 2341 11248 12462 --
NM_032786chr12----1415 --
NM_032801chr1122113 407 1133 ----
NM_032873chr1133079 1575 1334 ------
NM_032959chr741052 481 467 206 ------
NM_032973chrY23313 1403 14173 12780 --
NM_033089chr2031457 540 468 ------
NM_033127chr11296 --1648 --
NM_033136chr52412 138 --11594 --
NM_033141chr1431973 1617 557 --1218 --
NM_033224chr777245 6799 6650 5100 2624 1849 51 11002 22582 1082 --
NM_033285chr834340 4067 1683 ------
NM_033389chr1794739 3906 3765 3056 1341 974 691 606 107 ------
NM_033407chr11173 ----1129
NM_033512chr842235 947 561 411 22474 792 ----
NM_033668chr10------150
NM_052832chr812286 --12857 --
NM_052879chr121509 --23555 59 --
NM_052954chr21--12240 11780 11802
NM_052978chr143753 704 627 ------
NM_058170chr11324 ----1261
NM_058191chr21----1103 --
NM_080476chr201220 --1294 --
NM_080738chr1--11732 1505 11859
NM_080867chr1423766 1150 23260 652 23202 712 13270
NM_080872chr853874 3793 2910 1254 33 --12623 --
NM_101395chr2162649 1362 996 434 325 83 12637 ----
NM_138300chr151361 1305 438 287 127 --1262 --
NM_138316chr101330 ----1255
NM_138385chr451302 1122 571 297 165 --11157 11062
NM_138426chr732472 819 467 ------
NM_138927chr21--1118 --1374
NM_139244chr61156 --1757 --
NM_139283chr123495 291 108 --22492 945 --
NM_144571chr477031 5368 1667 1313 1124 1017 86 26045 637 ----
NM_144599chr1575235 4661 4221 1725 1322 126 57 ----15410
NM_144664chr1111012 --11944 --
NM_144982chr121529 187 --1672
NM_145052chrX1817 --1412 --
NM_145206chr1042853 2230 679 66 ------
NM_145207chr445376 4815 3487 498 45017 4675 1290 585 ----
NM_145799chrX83106 2935 1230 1215 1156 330 236 207 1215 ----
NM_152237chr2251747 1548 1202 280 192 ----11185
NM_152253chr22103794 3769 3577 3037 2900 2683 2648 1667 1358 184 --14039 13253
NM_152277chr51291 --11681 --
NM_152280chr133424 3161 430 --13139 --
NM_152344chr1731435 1390 57 --1364 --
NM_152371chr161718 1565 1465 1412 656 249 ------
NM_152446chr14--1349 1287 1690
NM_152519chr211736 ------
NM_152588chr12------11847
NM_152594chr1532117 700 247 ------
NM_152622chr552896 1233 777 734 402 ------
NM_152624chr556531 6069 5260 5195 1912 26716 5008 ----
NM_152660chr11649 --1329 --
NM_152721chr18------1176
NM_152780chrX21085 171 ------
NM_152835chr12166 70 12805 12531 --
NM_152890chr1137 2360 113 ----
NM_153354chr52668 387 ------
NM_153607chr522717 24 --11162 --
NM_153689chr2--11870 ----
NM_153812chr122235 498 11566 1645 12175
NM_170750chrX1111 ----1103
NM_172037chr8------11444
NM_172070chr2----1231 --
NM_173468chr436107 2281 344 ------
NM_173508chr13850 831 100 11240 ----
NM_173536chr433570 1920 1770 ----14278
NM_173595chr1244612 3879 3804 32 --21139 810 --
NM_173602chr1223196 105 23329 65 12385 12457
NM_173698chrX1114 --1520 --
NM_173822chr221847 96 1795 ----
NM_174911chr833687 3585 2552 --12899 --
NM_175061chr711767 ------
NM_175898chr1541375 1160 642 497 ------
NM_178126chr1731617 642 124 --12005 --
NM_178812chr8------11073
NM_181358chr173702 3517 3415 3187 3077 416 33 22788 2731 ----
NM_181706chr112959 828 --12123 --
NM_182485chr441320 1182 978 51 ------
NM_182527chr226735 341 203 177 85 44 --21742 1524 --
NM_182557chr1162086 1840 1468 742 551 514 ------
NM_182830chr14--1636 --1256
NM_197941chr522535 131 1412 --1748
NM_198081chr622004 128 ----11058
NM_198097chr72204 55 --173 --
NM_198098chr751712 1646 1615 1243 673 2141 103 ----
NM_198270chrX--23238 3056 --1515
NM_198859chr384671 3870 1918 1438 649 547 247 97 --11662 --
NM_198993chr1731368 137 59 11085 ----
NM_199044chr172937 2871 2565 2346 2192 654 617 22648 326 ----
NM_199262chr1731990 388 81 --12104 --
NM_199320chr42850 833 --22408 876 --
NM_201253chr11418 ----1448
NM_203282chr1921797 1505 ----1250
NM_203301chr1411254 1273 ----
NM_203382chr521574 37 ------
NM_203458chr111222 --13598 --
NM_206853chr664037 4019 3740 3260 2981 363 --1761 --
NM_207303chr1022960 191 ----1154
NM_207396chr141628 1195 600 296 1388 ----
NM_207497chr611459 ------