TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-589-3p
miRNA Sequence: UCAGAACAAAUGCCGGUUCCCAGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51504 ------
NM_000037chr82382 376 12402 --1407
NM_000038chr552080 1652 1535 420 245 --1136 --
NM_000045chr62113 97 ------
NM_000052chrX33313 682 220 --23403 1035 --
NM_000061chrX------1407
NM_000072chr7158 ------
NM_000074chrX1334 ------
NM_000084chrX46156 6009 2708 2356 --14555 25506 5471
NM_000090chr22206 62 ------
NM_000092chr264267 3934 3492 1690 1628 700 --21414 125 --
NM_000093chr922079 566 1706 ----
NM_000108chr731398 1293 504 ------
NM_000109chrX82539 2495 2415 2299 2285 1952 1880 93 --32485 518 244 --
NM_000112chr5135497 5333 5290 5001 4744 4243 3878 3862 1697 1687 868 493 307 --15558 --
NM_000115chr1352014 1807 1681 927 597 ------
NM_000117chrX2291 111 ------
NM_000125chr664172 4083 4020 3729 3267 804 11097 ----
NM_000134chr451549 1435 594 324 184 --1488 --
NM_000139chr1121956 217 ------
NM_000141chr1031206 531 300 --21337 1194 --
NM_000151chr1731781 1691 422 --1478 --
NM_000158chr31573 --143 --
NM_000161chr1482005 1818 1748 1727 1457 624 576 385 ------
NM_000163chr52784 309 --1664 --
NM_000165chr651697 1582 1069 373 326 --11686 --
NM_000167chrX41864 1525 616 556 --21530 1433 11565
NM_000168chr783034 2779 2102 2078 682 487 89 79 22851 214 71323 871 476 469 464 369 71 13015
NM_000176chr543296 109 94 87 --23851 123 --
NM_000183chr22377 352 ----1165
NM_000192chr1241332 1322 1314 359 --1208 --
NM_000194chrX3458 79 72 --2463 137 --
NM_000202chrX53417 3218 3033 1584 78 --23002 1462 --
NM_000208chr1974739 4672 4128 4042 3450 325 276 1996 ----
NM_000210chr242308 2226 1878 1439 --41712 1654 1586 362 11616
NM_000212chr1742400 1835 1697 331 ------
NM_000214chr2031470 416 379 1123 11604 --
NM_000216chrX113382 2914 2846 2650 2626 1587 1189 1070 974 469 263 11561 14015 --
NM_000217chr1253644 3401 1948 1485 1100 13707 14983 --
NM_000218chr111919 ------
NM_000222chr422090 1846 12125 ----
NM_000232chr493022 2128 2077 905 541 271 215 129 70 --12313 --
NM_000237chr82752 494 --21693 267 --
NM_000240chrX21457 316 22013 1524 12274 --
NM_000245chr731472 692 527 ----12222
NM_000248chr363053 2759 1141 950 907 813 ------
NM_000251chr2167 ------
NM_000252chrX41237 1195 602 217 --11080 --
NM_000259chr1555586 4979 4845 4342 1467 24991 1709 1939 --
NM_000264chr943285 2412 2328 2268 --23144 675 11190
NM_000268chr2253773 2387 2283 1470 235 --11445 --
NM_000276chrX62141 1723 471 233 225 114 --1414 --
NM_000278chr1022216 1582 12254 11553 --
NM_000280chr114816 758 660 346 ----1922
NM_000288chr6--1146 ----
NM_000297chr421850 1296 ------
NM_000304chr1711066 --3968 346 326 --
NM_000314chr1073039 2327 2153 1224 893 471 146 22306 171 1355 12131
NM_000321chr133603 384 86 ------
NM_000325chr42670 638 ------
NM_000328chrX1121 1152 ----
NM_000329chr13902 137 24 ------
NM_000332chr6117140 6678 6473 5272 5134 4771 2533 2483 2467 1494 120 12000 46808 5935 4380 4375 --
NM_000333chr351111 1042 292 151 101 1792 2366 299 --
NM_000337chr565252 2341 1733 1147 1089 506 --1870 --
NM_000340chr361495 1367 1102 274 106 55 11319 1539 --
NM_000345chr4----1775 --
NM_000346chr1771943 1479 1390 1260 681 106 98 --21900 120 11540
NM_000351chrX73799 3181 3083 2917 1139 1085 868 1890 24295 3224 --
NM_000362chr2222748 100 22377 208 12755 --
NM_000368chr974823 3903 3564 802 631 448 241 1610 14881 13176
NM_000386chr172321 309 ----1571
NM_000389chr631373 274 108 --11461 --
NM_000390chrX52672 1158 1023 925 591 11123 1514 --
NM_000393chr222008 1893 --11571 --
NM_000396chr11442 ------
NM_000397chrX52372 1762 902 722 629 1192 --11660
NM_000399chr102732 316 --11019 --
NM_000401chr1141056 892 305 204 ------
NM_000408chr2103332 3185 3097 3032 2991 2938 1387 1370 912 253 --1264 --
NM_000421chr172314 284 --1241 --
NM_000430chr17103754 3701 3350 2527 2520 1078 981 937 884 346 --1595 --
NM_000439chr552203 1827 1000 967 957 --2245 83 --
NM_000446chr731140 1053 79 --11147 --
NM_000448chr1133203 2691 1182 --13043 --
NM_000452chr1321368 212 --21424 73 11457
NM_000459chr92373 202 1855 ----
NM_000461chr334524 4371 3095 --14442 11055
NM_000462chr1531461 651 568 ------
NM_000474chr7----1653 --
NM_000480chr1121035 509 11575 1666 --
NM_000484chr2121090 241 ------
NM_000489chrX152879 2565 2522 2434 2273 2239 2181 2172 1346 1277 1160 1111 952 494 244 --22492 2328 --
NM_000492chr721090 990 11414 1259 --
NM_000495chrX41120 847 825 27 ------
NM_000503chr821769 237 ------
NM_000522chr731148 493 181 ------
NM_000523chr23250 218 130 1192 1260 --
NM_000525chr11----11545 --
NM_000527chr193882 110 62 1267 ----
NM_000533chrX42014 1679 1605 1507 --21793 1740 11799
NM_000534chr22133 44 ------
NM_000546chr172271 73 --2943 180 --
NM_000555chrX107830 7308 6739 6696 6649 6221 5547 4760 899 847 --26120 2907 --
NM_000565chr131547 853 502 --12107 --
NM_000582chr42467 363 ------
NM_000594chr63650 574 306 ------
NM_000601chr71156 --1167 --
NM_000609chr1063151 2631 1158 831 635 311 --1125 --
NM_000610chr1192222 1926 994 893 886 879 873 575 143 --1153 12856
NM_000615chr1162687 2541 2415 2290 965 716 22297 1856 ----
NM_000618chr12125098 4860 4408 4402 2590 2572 2514 2072 891 726 455 243 --24872 4599 --
NM_000618chr12125098 4860 4408 4402 2590 2572 2514 2072 891 726 455 243 --24872 4599 --
NM_000627chr2----2617 301 --
NM_000633chr1864996 4966 4895 3717 3440 1840 --24638 350 14943
NM_000663chr1632846 292 78 --12038 --
NM_000675chr222852 814 1190 ----
NM_000681chr1021278 1030 1537 ----
NM_000684chr1021259 207 ------
NM_000686chrX41550 1402 176 140 ------
NM_000700chr92226 193 ------
NM_000701chr11246 ------
NM_000719chr1266240 1536 851 777 759 80 12075 31881 1021 710 --
NM_000721chr12987 219 ----12393
NM_000724chr1041526 1319 1232 311 --1258 --
NM_000726chr231414 1177 247 --11094 --
NM_000729chr31213 ------
NM_000756chr81321 ------
NM_000758chr51281 ------
NM_000767chr193576 231 225 ------
NM_000793chr1465126 4768 4758 1968 1139 30 ------
NM_000800chr521650 1510 ------
NM_000801chr204947 900 262 33 --1151 --
NM_000806chr551828 1781 1587 492 57 --1499 --
NM_000807chr4----156 --
NM_000809chr4178920 6013 5928 3211 2690 2246 2152 2121 1719 1646 1584 1247 1233 1018 630 183 63 13296 11576 18771
NM_000811chr55775 656 531 57 41 ------
NM_000812chr4149 ------
NM_000813chr595257 5130 5124 5118 3511 1982 1836 1050 878 ------
NM_000814chr1564117 3868 3340 1680 578 429 --13967 --
NM_000817chr251179 1020 386 181 159 1794 ----
NM_000826chr442631 2114 855 517 ------
NM_000827chr572560 2489 2428 1752 409 333 195 ------
NM_000828chrX71820 1689 874 704 691 544 367 --31701 1696 573 --
NM_000838chr622732 2258 ----22699 1919
NM_000840chr7130 ------
NM_000842chr111508 ------
NM_000844chr35968 906 801 442 320 1369 ----
NM_000855chr112307 228 ------
NM_000859chr531352 1112 580 1321 11677 --
NM_000865chr61189 --3159 154 149 --
NM_000868chrX82389 2304 2137 1917 1631 772 504 116 1872 1430 --
NM_000872chr1041563 1027 1019 179 ------
NM_000875chr15126905 6532 5933 5552 5474 5453 5299 4879 4725 1506 1288 322 15286 ----
NM_000882chr32433 169 ------
NM_000891chr1793315 3229 3219 2655 2454 2424 650 342 259 --2253 248 --
NM_000895chr121102 --1118 --
NM_000899chr1274401 3955 3845 3273 1474 181 130 13558 ----
NM_000901chr441604 354 166 80 ------
NM_000903chr1641197 351 260 95 ------
NM_000905chr71121 ------
NM_000919chr54641 559 143 79 ------
NM_000922chr111796 --1452 --
NM_000935chr341172 1123 960 804 ------
NM_000944chr452139 2059 937 316 94 --1501 --
NM_000950chrX103637 3513 3165 2439 2231 879 715 468 149 133 --1654 --
NM_000956chr141311 ------
NM_000958chr521246 1164 --11232 --
NM_000959chr153747 3064 2885 665 193 1148 22751 2629 --
NM_000961chr2053848 3519 2563 1142 672 11075 1878 --
NM_000963chr122354 222 1248 --12071
NM_000964chr171512 ----1538
NM_000989chr8175 ------
NM_000990chr1124048 693 12654 23825 3634 --
NM_001001132chr212582 406 ------
NM_001001323chr1252837 2440 2292 1266 1017 22989 1080 ----
NM_001001330chr1041308 868 196 147 ------
NM_001001331chr342688 2277 922 406 ------
NM_001001344chrX52475 2366 2114 1712 790 ------
NM_001001389chr1192222 1926 994 893 886 879 873 575 143 --1153 12856
NM_001001390chr1192222 1926 994 893 886 879 873 575 143 --1153 12856
NM_001001391chr1192222 1926 994 893 886 879 873 575 143 --1153 12856
NM_001001392chr1192268 1972 1040 939 932 925 919 621 189 --1199 12902
NM_001001395chr1252828 2183 1820 1749 616 --1806 --
NM_001001396chr154312 4050 3978 2831 755 ------
NM_001001419chr565207 2037 1753 1015 621 44 --1473 14408
NM_001001420chr565207 2037 1753 1015 621 44 --1473 14408
NM_001001433chr2093010 2943 2872 2597 2373 2072 1282 254 193 --12863 12989
NM_001001436chr163816 684 358 --2221 182 --
NM_001001481chr853380 2885 1249 1143 338 --11254 23096 634
NM_001001483chr11137 --1423 --
NM_001001484chr1082168 2153 1989 1679 1527 867 417 292 --1659 --
NM_001001547chr7158 ------
NM_001001549chr762881 2513 2113 1761 949 415 1487 42843 2562 2352 756 --
NM_001001550chr762881 2513 2113 1761 949 415 1487 42843 2562 2352 756 --
NM_001001555chr762881 2513 2113 1761 949 415 1487 42843 2562 2352 756 --
NM_001001556chr15----193 --
NM_001001664chr243583 3205 1653 1387 --11405 --
NM_001001740chr12127 117 ------
NM_001001740chr12127 117 ------
NM_001001790chr91461 --1400 --
NM_001001852chr221937 ------
NM_001001875chr93446 423 95 --1280 --
NM_001001890chr2153749 3426 2875 867 677 --33393 693 688 --
NM_001001928chr2298336 6006 1922 1513 1273 1265 1167 945 165 139 22603 927 --
NM_001001933chr11484 ------
NM_001001937chr18248 38 ------
NM_001001938chr941611 1576 633 367 1429 --13156
NM_001001971chr1021233 128 184 ----
NM_001001974chr103902 764 251 --32120 2068 1589 21595 927
NM_001001994chrX1464 --1431 --
NM_001001996chrX1464 --1431 --
NM_001002000chr14----1363 --
NM_001002002chr14----1363 --
NM_001002026chr321616 773 --12475 --
NM_001002032chr173628 153 104 ------
NM_001002033chr174728 253 204 29 ------
NM_001002244chr17----194 --
NM_001002245chr17----1129 --
NM_001002246chr17----1129 --
NM_001002247chr17----1129 --
NM_001002248chr17----1129 --
NM_001002249chr17----1129 --
NM_001002255chr62362 37 ----1233
NM_001002257chr253451 3363 2317 918 51 ------
NM_001002295chr103917 439 111 --11094 --
NM_001002762chr1022535 1800 11885 ----
NM_001002800chr321045 124 ------
NM_001002838chrX41730 560 217 89 ------
NM_001002860chr14144449 4152 3905 3897 3800 3357 3083 3076 1533 1402 535 462 174 122 11181 13413 --
NM_001002919chr22451 146 ------
NM_001002926chr772369 2105 1970 706 666 262 65 12048 21939 835 --
NM_001003396chr6--131 ----
NM_001003397chr6--131 ----
NM_001003406chr2232378 544 440 ----13303
NM_001003652chr18228542 8364 8295 7622 7430 7339 6937 6763 6634 6292 6124 5309 3447 2806 2766 2311 1593 1379 1361 1222 674 664 26547 2622 18051 --
NM_001003656chr101577 ------
NM_001003674chr18157043 6515 5886 5862 5732 5433 4975 4724 2452 1168 635 622 573 475 373 12157 --36177 4863 1995
NM_001003675chr18157043 6515 5886 5862 5732 5433 4975 4724 2452 1168 635 622 573 475 373 12157 --36177 4863 1995
NM_001003681chr2242055 2045 1906 660 --1318 --
NM_001003688chr43845 488 407 ----1397
NM_001003712chr1293846 3669 2672 1592 1348 1303 1234 885 804 11092 23954 3800 1340
NM_001003792chr331225 457 124 ------
NM_001003793chr331225 457 124 ------
NM_001003799chr73738 654 568 ------
NM_001003810chr44714 571 244 205 ------
NM_001003940chr1553817 2473 335 117 96 11520 ----
NM_001003942chr1553817 2473 335 117 96 11520 ----
NM_001003943chr1553821 2477 339 121 100 11524 ----
NM_001004051chrX2320 80 ------
NM_001004065chr953820 3442 2878 2506 1534 11525 12614 12620
NM_001004106chr531049 1013 67 ------
NM_001004196chr321144 1018 ------
NM_001004304chr1253093 3086 2149 1045 384 --1374 --
NM_001004317chr694344 4250 4238 3829 3699 825 749 183 21 ------
NM_001004342chr196012 5037 4745 4197 3778 1607 1094 667 327 25159 1374 --15765
NM_001004360chr241829 524 278 251 --21604 304 --
NM_001004419chr1254067 1275 519 269 245 ----13354
NM_001005158chr33486 387 349 ------
NM_001005159chr33486 387 349 ------
NM_001005209chr21697 ------
NM_001005242chr1241628 1240 559 540 11561 2437 387 --
NM_001005266chr15--1198 1116 --
NM_001005267chr15--1198 1116 --
NM_001005268chr15--1198 1116 --
NM_001005269chr15--1198 1116 --
NM_001005335chr19170 ------
NM_001005366chr126964 836 666 359 275 202 --1170 21012 370
NM_001005375chrY31179 284 253 1131 ----
NM_001005386chr282378 2188 1989 1650 1639 776 627 571 12403 2899 560 --
NM_001005404chr17144407 4354 4224 3887 3600 3293 3186 3008 1441 1310 1140 1122 239 232 ----13723
NM_001005463chr1042559 2458 2071 1656 --1875 --
NM_001005473chr586600 4794 4593 4331 2649 674 473 261 --14357 --
NM_001005476chr21127 ------
NM_001005526chr22133 109 ------
NM_001005743chr1431129 1095 375 ------
NM_001005744chr1431129 1095 375 ------
NM_001005745chr1431129 1095 375 ------
NM_001005746chr231414 1177 247 --11094 --
NM_001005747chr231414 1177 247 --11094 --
NM_001005752chr13786 564 130 ------
NM_001005753chr262330 2270 786 163 142 110 ------
NM_001005849chr172432 37 ----1234
NM_001005861chr341014 982 919 666 ------
NM_001005862chr17----1497 --
NM_001005910chr31640 --1461 --
NM_001005911chr31640 --1461 --
NM_001006115chr322612 136 ----161
NM_001006117chrY1183 ------
NM_001006600chr562019 884 717 624 425 269 ------
NM_001006605chr121156 901 ------
NM_001006605chr121156 901 ------
NM_001006610chr1651001 919 902 328 286 ------
NM_001006618chr91199 168 ----
NM_001006624chr122020 216 ------
NM_001006636chr21808 ----1986
NM_001006657chr2123012 2961 2168 2089 1976 1055 1018 887 804 263 230 95 --13187 --
NM_001006681chrX----1140 --
NM_001006682chrX----1140 --
NM_001006683chrX----1140 --
NM_001006684chrX3416 402 111 ------
NM_001006946chr21511 --11446 --
NM_001007023chr1465126 4768 4758 1968 1139 30 ------
NM_001007024chr1774359 4278 3399 2918 1385 210 190 --11488 --
NM_001007025chr1774359 4278 3399 2918 1385 210 190 --11488 --
NM_001007026chr12----1358 --
NM_001007067chr81750 ------
NM_001007068chr81750 ------
NM_001007069chr81750 ------
NM_001007070chr81750 ------
NM_001007072chr15----1189 --
NM_001007097chr945048 4943 4559 1472 --54969 4340 4133 4052 786 11575
NM_001007098chr14848 736 711 297 --1611 --
NM_001007099chr11149 --1325 --
NM_001007100chr11149 --1325 --
NM_001007102chr641601 1164 221 51 --11618 --
NM_001007156chr1541803 1386 165 83 --11403 128
NM_001007214chr131623 621 405 ------
NM_001007237chr132820 474 245 ----11750
NM_001007257chr171406 951 944 540 438 375 314 --11144 --
NM_001007267chr21843 ------
NM_001007277chr1121027 422 1757 ----
NM_001007466chr6174936 4704 4066 3644 3495 1766 1586 1580 1574 1567 1554 1541 1125 935 686 360 299 ------
NM_001007468chr22----1259 --
NM_001007553chr11890 21135 68 1407 --
NM_001007559chr1882017 1623 1616 1609 1603 1497 746 704 1669 2601 531 --
NM_001007595chr151290 ------
NM_001007794chr12764 33 ------
NM_001008222chrX21330 111 ------
NM_001008225chr71516 --1571 --
NM_001008226chr1541778 479 195 46 1600 ----
NM_001008239chr1863802 3646 3231 1347 1316 658 --33468 1337 745 --
NM_001008392chr372559 2534 2376 2333 1276 1046 857 --22889 146 --
NM_001008401chr1931321 1216 1083 ------
NM_001008408chr7106200 5161 5117 2565 2281 925 823 298 256 127 --55841 5510 4750 2189 261 --
NM_001008495chr871914 1902 1509 725 419 263 252 --2472 467 --
NM_001008539chr855280 5127 3420 1822 311 --14404 11198
NM_001008564chr1352123 1846 1688 305 202 1111 12140 22028 239
NM_001008660chr1121500 1368 ------
NM_001008707chr1421691 1665 --183 --
NM_001008711chr86485 279 243 154 143 58 1200 11485 --
NM_001008723chr10----1167 1460
NM_001008738chr562508 2499 2372 2179 804 449 --42885 2832 2742 2339 --
NM_001008744chr1431276 1246 566 1482 21589 217 --
NM_001008783chr62720 65 --1675 --
NM_001008801chr1941895 1760 1635 1467 ------
NM_001008925chr41717 --1291 23503 401
NM_001009183chr141342 --3398 353 327 --
NM_001009185chr5------1632
NM_001009552chr82526 210 ------
NM_001009555chr471729 1489 1392 1321 1274 323 72 ------
NM_001009567chr103579 157 82 ------
NM_001009880chr22104774 4254 4052 3688 3679 1910 1249 1156 523 426 13298 24901 1817 --
NM_001009881chr13449 419 195 ------
NM_001009882chr13449 419 195 ------
NM_001009899chr394721 4002 3972 2389 1822 1767 814 754 626 --16301 --
NM_001009959chr242463 2078 1814 1724 ------
NM_001009993chr244284 2828 1030 835 --1209 --
NM_001010000chr1883444 3317 3273 3193 2677 2450 951 343 ------
NM_001010853chr662949 2924 2309 521 454 82 --1429 --
NM_001010854chr141188 ------
NM_001010861chr142583 2110 746 546 ------
NM_001010867chr1106564 6039 5454 5143 4948 1961 1243 730 710 197 ------
NM_001010888chrX54583 4501 4006 3517 3358 ------
NM_001010891chr5176720 6670 6548 6431 5925 5457 5090 5084 4927 4864 4485 4258 2669 2267 2170 2127 1219 16186 24893 1380 46613 6244 5420 335
NM_001010895chr931897 413 351 1281 11964 --
NM_001010932chr71156 --1167 --
NM_001010934chr741176 1055 792 151 ------
NM_001010942chr1231309 1048 940 --11298 --
NM_001010971chr11901 ------
NM_001010984chr162465 2228 2020 1986 1829 1677 --11931 --
NM_001010989chr162451 365 ------
NM_001010990chr162451 365 ------
NM_001011513chr442587 2529 1625 1513 198 14048 --
NM_001011515chr41262 --31062 906 171 --
NM_001011516chr41262 --31062 906 171 --
NM_001011537chr352315 1892 1878 352 207 --12051 --
NM_001011666chr7126283 6165 6091 6011 4979 4128 2556 2309 1957 1750 860 669 12128 22547 1180 12414
NM_001011708chr232502 373 140 11851 1851 22817 760
NM_001011713chr1441413 1213 1000 194 --11260 21596 178
NM_001011722chr11148 --1174 --
NM_001011722chr11148 --1174 --
NM_001011724chr132249 130 --1216 --
NM_001011725chr132249 130 --1216 --
NM_001011885chr1541593 559 553 121 ------
NM_001012393chr11104112 3585 3296 2071 1508 1243 796 134 123 99 11288 13458 --
NM_001012418chr654216 3903 3170 1392 690 2755 84 ----
NM_001012420chr1532055 930 357 --2696 417 12706
NM_001012423chr1532055 930 357 --2696 417 12706
NM_001012426chr621131 418 --13330 --
NM_001012427chr621131 418 --13330 --
NM_001012514chr23980 802 242 ----2914 850
NM_001012516chr23980 802 242 ----2914 850
NM_001012614chr41530 ------
NM_001012751chr1041605 1289 120 86 ------
NM_001012754chr1362096 1956 1859 1844 1768 129 ----11349
NM_001012755chrX84698 3893 3314 3237 1818 1788 1561 981 ------
NM_001012761chr561986 742 233 222 191 167 --1214 --
NM_001012968chrX72445 2149 2022 994 963 422 59 --1203 --
NM_001012977chrX21414 1114 ------
NM_001012989chrX1668 --141 --
NM_001013031chr1093460 3096 2945 2619 2498 2476 1210 977 851 --13090 11272
NM_001013415chr461614 1451 1216 517 372 105 --11090 --
NM_001013437chr18173 ------
NM_001013438chr34981 742 642 632 ------
NM_001013439chr33827 588 275 ------
NM_001013620chr12158473 8324 8142 8024 7440 7382 7374 7098 6207 5437 2829 2808 2525 1617 233 --47506 7154 3170 291 11158
NM_001013629chr1042135 2119 1815 219 --11911 --
NM_001013699chr121564 ------
NM_001013843chr155885 263 195 174 102 ------
NM_001014286chr13179 --1356 --
NM_001014380chr13105811 5466 4539 3984 2216 1959 1546 1097 927 759 --13936 14397
NM_001014434chr12859 690 ------
NM_001014442chr13166 ------
NM_001014797chr1088263 7229 5946 5740 3164 2079 948 495 --37349 2607 1473 --
NM_001014809chr45863 699 359 238 72 --1286 --
NM_001014812chr151134 ------
NM_001015045chr452199 2000 1888 952 353 --22065 874 --
NM_001015048chr1473120 3005 2469 2265 987 617 540 --2435 33 --
NM_001015049chr1473120 3005 2469 2265 987 617 540 --2435 33 --
NM_001015508chr81216 ------
NM_001015877chrX112934 2876 2577 2167 2046 1067 1046 971 569 156 72 --12474 12150
NM_001015880chr1021709 1296 ----11255
NM_001015881chrX51286 1174 431 67 43 --21041 1036 1936
NM_001017371chr221135 200 ------
NM_001017395chr373478 3200 2683 2617 2343 920 138 13254 23618 2747 23091 1029
NM_001017396chr22738 434 11921 --1383
NM_001017424chr121379 265 ------
NM_001017425chr121379 265 ------
NM_001017440chr7128184 7446 7425 7381 6823 5322 5250 2467 2444 2152 1312 226 27623 966 ----
NM_001017923chr142153 27 ------
NM_001017926chr861627 1604 1283 1199 193 98 ------
NM_001017930chrX61454 1334 1321 1209 967 115 ----11224
NM_001017963chr142896 73 ----2918 346
NM_001017969chr93244 182 143 --1560 2225 47
NM_001017977chr11395 ----134
NM_001017999chr14526 362 356 350 --1914 --
NM_001017999chr14526 362 356 350 --1914 --
NM_001018000chr14526 362 356 350 --1914 --
NM_001018000chr14526 362 356 350 --1914 --
NM_001018001chr14526 362 356 350 --1914 --
NM_001018004chr15136 --246 41 --
NM_001018006chr15136 --246 41 --
NM_001018007chr15136 --246 41 --
NM_001018020chr15136 --246 41 --
NM_001018037chr911256 ------
NM_001018057chr1151206 902 367 298 175 --1500 --
NM_001018064chr972138 1934 1926 1697 1580 568 559 ------
NM_001018067chr1135387 5349 5291 4807 4379 1874 1637 1447 1031 366 235 202 149 14957 31694 1668 928 --
NM_001018068chr1135387 5349 5291 4807 4379 1874 1637 1447 1031 366 235 202 149 14957 31694 1668 928 --
NM_001018069chr1135387 5349 5291 4807 4379 1874 1637 1447 1031 366 235 202 149 14957 31694 1668 928 --
NM_001018074chr543296 109 94 87 --23851 123 --
NM_001018075chr543296 109 94 87 --23851 123 --
NM_001018076chr543296 109 94 87 --23851 123 --
NM_001018077chr543296 109 94 87 --23851 123 --
NM_001018100chr154861 768 749 253 ------
NM_001018108chr1561987 1500 1429 814 720 224 --1806 --
NM_001018113chrX138 1130 ----
NM_001018159chr161104 ------
NM_001018160chr161104 ------
NM_001018676chr81476 ------
NM_001018677chr81476 ------
NM_001020658chr151285 1164 426 236 81 ----11312
NM_001020658chr151285 1164 426 236 81 ----11312
NM_001020818chr1961903 1610 1600 243 100 45 --41530 1525 519 225 --
NM_001020819chr1961903 1610 1600 243 100 45 --41530 1525 519 225 --
NM_001020820chr1961903 1610 1600 243 100 45 --41530 1525 519 225 --
NM_001020821chr1961903 1610 1600 243 100 45 --41530 1525 519 225 --
NM_001023560chr6--1313 1882 --
NM_001023567chr1532360 938 326 --1417 12093
NM_001024024chr1441059 872 802 781 ------
NM_001024070chr1441055 868 798 777 ------
NM_001024094chr543296 109 94 87 --23851 123 --
NM_001024218chr141318 ----1205
NM_001024226chr111132 --11120 --
NM_001024227chr111132 --11120 --
NM_001024228chr111132 --11120 --
NM_001024372chr842074 1851 1839 1738 ------
NM_001024649chr542956 2810 879 288 --2679 518 --
NM_001024660chr311396 --11377 1604
NM_001024668chr122950 915 ------
NM_001024688chr871794 1582 1489 787 511 453 112 --2230 181 1731
NM_001024808chr1222024 1851 ----11119
NM_001024809chr171512 ----1538
NM_001024847chr332243 893 311 --12233 1799
NM_001024855chr321627 220 ----11777
NM_001024934chr63515 507 181 --191 --
NM_001024935chr63515 507 181 --191 --
NM_001024936chr63515 507 181 --191 --
NM_001024947chr51299 ------
NM_001024948chr173486 3253 3232 1259 1164 1146 267 ----12766
NM_001024956chr1165775 4770 4586 1967 1312 1220 ----1490
NM_001025068chr321851 648 ------
NM_001025069chr321851 648 ------
NM_001025076chr10106172 5878 4234 4036 1886 1573 1298 1050 967 832 25579 1426 65916 5857 4837 1502 1175 646 --
NM_001025077chr10147530 7236 5592 5394 4710 2931 2656 2408 2325 2190 1394 993 656 568 26937 2784 77274 7215 6195 2860 2533 2004 255 --
NM_001025079chr363813 3607 2844 2831 840 695 --12724 11201
NM_001025201chr24568 144 50 31 ------
NM_001025248chr1571282 1114 991 973 916 499 225 11028 288 80 --
NM_001025249chr1571282 1114 991 973 916 499 225 11028 288 80 --
NM_001025252chr873026 2923 1279 1058 602 422 303 --1528 13130
NM_001025253chr873026 2923 1279 1058 602 422 303 --1528 13130
NM_001025366chr631648 1219 659 ------
NM_001025366chr631648 1219 659 ------
NM_001025367chr631648 1219 659 ------
NM_001025367chr631648 1219 659 ------
NM_001025368chr631648 1219 659 ------
NM_001025368chr631648 1219 659 ------
NM_001025369chr631664 1235 675 ------
NM_001025369chr631664 1235 675 ------
NM_001025370chr631648 1219 659 ------
NM_001025370chr631648 1219 659 ------
NM_001025389chr1121035 509 11575 1666 --
NM_001025390chr1121035 509 11575 1666 --
NM_001025579chr1741011 859 853 447 ------
NM_001025580chrX124054 3921 3746 3737 3098 2820 610 481 350 339 309 198 14282 ----
NM_001025595chr421251 1227 ----11502
NM_001025780chr921106 83 --21515 1241 --
NM_001029835chr71328 ------
NM_001029858chr643390 2770 2284 47 --23147 351 --
NM_001029860chr83314 268 36 ------
NM_001029863chr632209 987 142 ------
NM_001029875chr592867 2418 2398 1979 1166 1087 816 218 105 ------
NM_001029882chr13619 450 36 ------
NM_001029882chr13619 450 36 ------
NM_001029998chr411420 ------
NM_001030001chr141440 ------
NM_001030002chr171354 ------
NM_001030006chr1742646 2630 2049 409 ------
NM_001030007chr1613675 --13665 12635
NM_001030055chr1484775 4463 4427 4377 4245 2884 1724 1454 --14638 --
NM_001030059chr101309 ------
NM_001030287chr12995 978 ------
NM_001031623chr651669 1236 552 121 70 --1156 --
NM_001031679chr122467 110 ------
NM_001031684chr231382 1028 933 --11479 --
NM_001031685chr13787 356 278 ------
NM_001031690chr742909 2624 2019 446 ------
NM_001031692chr72298 32 ------
NM_001031695chr22105447 4740 4542 3787 3729 3698 1744 1719 1148 170 --24664 1709 --
NM_001031700chr452404 2308 1561 906 53 3381 298 186 12224 1390
NM_001031710chr741089 933 694 84 --197 --
NM_001031711chr531813 1338 641 --1155 --
NM_001031712chr61164 ------
NM_001031716chr23371 336 148 ------
NM_001031732chr4102942 2537 2435 1277 1151 1069 820 488 324 284 --1749 --
NM_001031743chr61156 ------
NM_001031804chr16104062 3620 3439 1405 1290 1088 823 493 313 239 --33340 2849 2844 13308
NM_001031812chr51213 --12242 --
NM_001032221chr941439 450 390 197 --11584 --
NM_001032283chr123818 305 176 ----1716
NM_001032284chr123818 305 176 ----1716
NM_001032296chr1372921 2778 2326 1908 784 251 25 12697 ----
NM_001032363chr151669 1578 1552 1396 503 --1169 --
NM_001032363chr151669 1578 1552 1396 503 --1169 --
NM_001032380chr1022004 1462 --1563 --
NM_001032393chrX1203 ------
NM_001032394chr652843 2669 2456 1130 1056 ------
NM_001032395chr652710 2536 2323 997 923 ------
NM_001032999chr2045351 1350 797 704 11670 1905 --
NM_001033025chr12386 274 1559 11482 --
NM_001033030chr33257 211 102 ------
NM_001033031chr33257 211 102 ------
NM_001033032chr33257 211 102 ------
NM_001033044chr121807 701 --1719 11829
NM_001033047chr452602 1739 1006 581 492 --1648 11788
NM_001033056chr121807 701 --1719 11829
NM_001033057chr331837 1721 315 --11402 --
NM_001033059chr651987 1833 1542 521 419 --41859 1854 1849 1844 11755
NM_001033081chr141782 1692 224 25 ------
NM_001033082chr141782 1692 224 25 ------
NM_001033087chr2053074 2861 2284 1290 1011 ------
NM_001033112chr51785 ------
NM_001033503chr51114 ------
NM_001033507chr151414 1212 706 655 116 --11597 1782
NM_001033557chr221136 292 ------
NM_001033561chr176878 783 748 678 155 87 --1766 --
NM_001033566chr173853 734 69 ------
NM_001033568chr173853 734 69 ------
NM_001033578chr842234 916 340 295 ----1187
NM_001033602chr1352590 2261 825 769 255 1394 ----
NM_001033756chr631582 1153 593 ------
NM_001033756chr631582 1153 593 ------
NM_001033910chr142104 2098 1973 590 ----1372
NM_001033925chr1051929 1663 579 361 171 --22077 1567 --
NM_001034025chr12----1813 --
NM_001034837chr51792 --1244 180
NM_001034838chr51792 --1244 180
NM_001034841chr16115522 5336 5296 4408 4398 4028 4022 1544 1430 1042 974 24329 1636 23576 267 --
NM_001034850chr561615 1421 1300 1142 272 124 ------
NM_001034852chr1422080 285 --1158 --
NM_001034954chr1052108 2082 1155 871 715 --12048 --
NM_001034955chr1052108 2082 1155 871 715 --12048 --
NM_001034956chr1052108 2082 1155 871 715 --12048 --
NM_001034957chr1052108 2082 1155 871 715 --12048 --
NM_001035chr141061 1029 1022 118 ------
NM_001035003chr42340 131 --11223 --
NM_001035004chr42340 131 --11223 --
NM_001035254chr962438 2391 2273 1895 1810 1620 ------
NM_001035260chr1051505 1474 1386 1148 606 ------
NM_001035267chr121290 ------
NM_001037164chr741940 1772 1447 1435 --41422 674 335 123 11378
NM_001037165chr7198919 8879 8859 8820 8717 8567 8345 8336 7664 7314 6621 3130 3094 2579 1838 1402 1216 1160 1023 --27330 7325 --
NM_001037172chr341373 1249 894 71 ------
NM_001037174chr272138 1909 1768 1669 1662 1472 612 ------
NM_001037317chr142583 2110 746 546 ------
NM_001037334chr1832166 1590 386 ------
NM_001037535chrX31544 969 547 --199 --
NM_001037536chrX31544 969 547 --199 --
NM_001037540chrX31544 969 547 --199 --
NM_001037553chr2154474 1603 1390 933 688 11473 11785 --
NM_001037558chr11----1224 --
NM_001037582chr421118 139 --21184 211 --
NM_001037631chr221108 723 ------
NM_001037954chr1173415 3403 3070 2987 1405 665 247 --11312 --
NM_001038628chr361703 1608 560 481 429 383 ----1572
NM_001038702chr532760 2705 1921 --177 --
NM_001038707chr182193 1826 1717 1709 1603 808 349 22 ------
NM_001038707chr182193 1826 1717 1709 1603 808 349 22 ------
NM_001039199chr2044661 4152 985 464 --33211 1693 276 14954
NM_001039350chr731580 464 151 --1658 --
NM_001039459chr721022 989 ------
NM_001039465chr141446 ------
NM_001039538chr243643 2461 1294 1010 --23690 258 13352
NM_001039547chr396325 2993 2934 1733 1400 1225 872 825 357 16000 17215 --
NM_001039550chr2--1896 ----
NM_001039569chr273380 3370 3284 2188 884 623 302 --12801 --
NM_001039570chr2254609 4170 4123 3527 1261 ------
NM_001039571chr2254609 4170 4123 3527 1261 ------
NM_001039577chr184200 4194 4010 3893 3810 950 515 497 ------
NM_001039585chr154004 3321 3142 922 450 1405 23008 2886 --
NM_001039590chrX53567 3450 3273 1491 1414 --2985 199 --
NM_001039591chrX53567 3450 3273 1491 1414 --2985 199 --
NM_001039618chr11165685 4974 4705 4692 4626 4117 4054 3972 3922 3884 2167 1590 1552 1473 1339 1164 24661 3751 35812 1611 395 --
NM_001039619chr143334 318 47 ----1326
NM_001039709chr2045351 1350 797 704 11670 1905 --
NM_001039762chr1072411 1961 1911 1899 1582 917 205 ----11599
NM_001039802chr13479 466 280 --31152 415 410 --
NM_001039840chrX145615 5558 5542 5493 5348 5093 4809 4758 2435 2371 2088 1169 713 494 11069 35290 1836 196 23897 308
NM_001039916chr1221201 440 --1996 --
NM_001039917chr1221201 440 --1996 --
NM_001039918chr1221201 440 --1996 --
NM_001039919chr1221201 440 --1996 --
NM_001039920chr1221201 440 --1996 --
NM_001039937chr1344137 3126 1039 1020 --32766 1008 420 --
NM_001039960chr1231428 1219 54 ------
NM_001040001chr651374 1322 1270 390 380 11578 --11996
NM_001040057chr731501 1175 107 11064 ----
NM_001040058chr42467 363 ------
NM_001040060chr42467 363 ------
NM_001040092chr82153 58 ------
NM_001040110chr761617 1606 1584 1505 1338 111 ------
NM_001040135chr72734 80 ----1559
NM_001040142chr252220 749 636 366 110 ------
NM_001040143chr252220 749 636 366 110 ------
NM_001040152chr744533 3451 3338 1757 13778 ----
NM_001040153chr133835 354 110 --2976 379 --
NM_001040157chr432898 2885 319 12574 11029 --
NM_001040158chr54415 176 157 112 ------
NM_001040159chr421297 563 1252 ----
NM_001040181chr33901 465 81 ------
NM_001040182chr33901 465 81 ------
NM_001040183chr33901 465 81 ------
NM_001040199chr33901 465 81 ------
NM_001040200chr33901 465 81 ------
NM_001040202chr442419 2283 1934 1590 ------
NM_001040272chr921744 174 --22272 440 --
NM_001040280chr671461 1453 1396 1258 1171 1071 441 --21037 420 --
NM_001040284chr16135967 5562 5157 4589 4139 3691 2150 2139 1935 1873 876 687 457 --15238 --
NM_001040402chr472742 1293 888 780 563 177 45 --11009 --
NM_001040429chr1351450 1186 896 814 155 1202 13467 --
NM_001040441chr175464 4836 4237 2143 2137 2125 1474 ------
NM_001040458chr531902 1791 605 --31368 191 84 --
NM_001040619chr131445 1428 1052 ------
NM_001040624chr852754 2334 1890 842 290 --22509 778 12109
NM_001040625chr852754 2334 1890 842 290 --22509 778 12109
NM_001040626chr852754 2334 1890 842 290 --22509 778 12109
NM_001040627chr852754 2334 1890 842 290 --22509 778 12109
NM_001040628chr852754 2334 1890 842 290 --22509 778 12109
NM_001040629chr852754 2334 1890 842 290 --22509 778 12109
NM_001040630chr852754 2334 1890 842 290 --22509 778 12109
NM_001040633chr741015 895 204 61 --11027 --
NM_001040665chr744931 3948 1893 909 --44069 240 235 230 25005 3718
NM_001040666chr71633 ----1707
NM_001040668chr191117 ------
NM_001040709chr152531 2279 2152 1987 1834 ------
NM_001040712chr963490 3397 3383 3248 3233 3196 1783 21185 841 --
NM_001042355chr1645225 4863 605 75 1624 31174 1065 617 --
NM_001042388chr182908 724 ------
NM_001042404chr131413 745 729 ------
NM_001042412chr1645225 4863 605 75 1624 31174 1065 617 --
NM_001042413chr993878 3669 3495 1462 775 745 614 132 61 --13887 --
NM_001042424chr432869 2008 335 ----12489
NM_001042453chrX21748 253 31759 1220 1171 ----
NM_001042475chr6----1125 --
NM_001042481chr1492487 2400 2244 2234 2213 1963 1831 1623 1074 --22383 1850 --
NM_001042493chr6101991 1629 1585 1579 1381 689 409 323 262 93 142 1381 --
NM_001042494chr1553827 3743 1342 718 32 --33842 653 108 --
NM_001042495chr1553827 3743 1342 718 32 --33842 653 108 --
NM_001042496chr1553827 3743 1342 718 32 --33842 653 108 --
NM_001042497chr1553827 3743 1342 718 32 --33842 653 108 --
NM_001042533chr343129 2267 1029 313 --12586 12498
NM_001042537chrX52512 2323 2169 1696 221 --1256 --
NM_001042543chr441331 1254 1024 250 ------
NM_001042548chr23793 317 235 1655 1670 --
NM_001042550chr991852 1576 1340 690 684 391 235 120 34 --11658 --
NM_001042555chr12114302 4157 3796 3731 3522 3441 3116 3086 2958 1892 807 2991 933 13234 --
NM_001042599chr267125 6603 2968 2961 1109 629 1105 37818 1992 661 --
NM_001042601chr342430 1269 340 143 --1709 1209
NM_001042603chr12164618 4294 4118 3580 3501 3443 3385 3327 2144 1945 1915 1567 1560 1180 1143 1105 --35350 4279 1665 12011
NM_001042604chr3124713 4368 4233 3740 3563 3451 3356 1837 1648 1348 599 521 ------
NM_001042646chr351701 812 752 620 349 --2739 653 --
NM_001042681chr152614 1758 921 796 512 --31829 1022 938 --
NM_001042682chr152614 1758 921 796 512 --31829 1022 938 --
NM_001042682chr152614 1758 921 796 512 --31829 1022 938 --
NM_001042683chr661832 1744 1717 1527 1138 399 --1135 --
NM_001042749chrX81915 1844 1788 1768 1642 524 473 159 ------
NM_001042750chrX81915 1844 1788 1768 1642 524 473 159 ------
NM_001042751chrX81915 1844 1788 1768 1642 524 473 159 ------
NM_001042762chr73715 172 109 --1842 --
NM_001043318chr1444135 3605 3190 300 1271 ----
NM_001044305chr61459 ------
NM_001044385chr254061 3420 2932 835 54 --22752 551 --
NM_001044387chr1964138 4050 2579 806 781 469 --13885 --
NM_001044388chr1964138 4050 2579 806 781 469 --13885 --
NM_001044722chr51213 --12242 --
NM_001044723chr51213 --12242 --
NM_001046chr542975 2166 1040 413 --1502 11195
NM_001049chr1422194 497 --12267 --
NM_001050chr1721088 351 ------
NM_001078chr11488 ------
NM_001079874chr142055 1582 464 266 11399 31993 1753 1665 11320
NM_001083620chr452629 2112 854 516 205 ------
NM_001094chr17--1784 2752 747 1792
NM_001099678chr354049 1736 640 303 259 --25371 1948 --
NM_001100108chr1168222 8189 7320 5376 5082 3180 2438 2403 2396 2378 1837 1747 1499 79 73 63 --38354 7373 1395 37524 1936 927
NM_001106chr3149651 8808 8098 7460 7214 6257 5987 3248 3115 2744 2093 1235 1172 533 36303 3011 2712 273 68 --
NM_001113490chrX53301 3052 1454 536 113 --32403 1039 430 178
NM_001117chr183339 158 91 ----21761 378
NM_001119chr421513 1317 ------
NM_001121chr1031652 1591 601 --11495 --
NM_001123chr101323 ------
NM_001126chr13430 395 349 --1987 --
NM_001128chr1613675 --13665 12635
NM_001128144chr22133 44 ------
NM_001148chr421371 440 ------
NM_001149chr1031297 1272 485 ------
NM_001153chr22362 261 ------
NM_001156chr103608 489 186 ------
NM_001160chr1252116 1959 585 433 195 --22860 2632 12752
NM_001165chr112580 204 --1125 --
NM_001167chrX166490 5509 4995 4877 2442 2365 2212 1785 1499 1456 1045 708 494 472 140 33 --32465 853 420 16619
NM_001173chr1484775 4463 4427 4377 4245 2884 1724 1454 --14638 --
NM_001174chrX42117 2083 1961 1513 ------
NM_001177chr1222141 197 --1501 1540
NM_001186chr2183227 2978 2549 989 557 249 100 48 ------
NM_001187chr211505 ------
NM_001191chr201342 ----1411
NM_001200chr2051058 1040 946 793 419 ------
NM_001201chr493593 3012 2572 782 500 464 319 276 69 1406 11433 11486
NM_001202chr14------1209
NM_001204chr2146667 6613 6507 6291 2283 1983 1977 1926 1724 1511 834 419 206 196 26796 1117 27429 500 --
NM_001206chr9112969 2715 2471 2324 2111 2055 1929 484 297 291 163 --2982 860 --
NM_001222chr1021714 207 ----11938
NM_001233chr772351 2182 862 580 394 262 97 --178 1762
NM_001237chr43914 215 23 --2869 849 --
NM_001237chr43914 215 23 --2869 849 --
NM_001238chr192528 166 --2480 349 --
NM_001241chr21478 1846 11858 12262
NM_001241chr21478 1846 11858 12262
NM_001253chr61254 ------
NM_001256chr1772498 2205 2039 1897 399 387 260 --12856 --
NM_001258chr171180 ------
NM_001259chr7166400 5246 5153 5018 4760 4469 2353 2196 2075 2033 1999 1616 1469 1296 973 967 15220 35185 1361 1005 22388 172
NM_001263chr44401 318 112 64 ------
NM_001269chr12995 349 1904 ----
NM_001270chr531025 311 230 ------
NM_001271chr154562 346 233 101 ------
NM_001273chr121373 ------
NM_001278chr105744 448 389 246 66 1179 ----
NM_001282chr1742646 2630 2049 409 ------
NM_001293chr111398 --1524 --
NM_001304chr1763818 3219 3128 3089 1396 359 22630 163 ----
NM_001310chr1272771 2472 1986 1878 622 409 385 --12216 --
NM_001313chr45863 699 359 238 72 --1286 --
NM_001316chr20------1341
NM_001326chr113454 422 383 ------
NM_001328chr41530 ------
NM_001329chr1021228 1024 21477 1195 21549 1091 --
NM_001332chr521584 1102 --170 --
NM_001338chr2131236 1012 985 ------
NM_001343chr521296 419 21267 89 31670 1306 1301 1374
NM_001351chr33318 189 158 143 ----
NM_001356chrX32185 996 721 22083 613 --1384
NM_001357chr1169 ------
NM_001363chrX3623 185 114 --1531 --
NM_001364chr1174459 1643 1242 1221 764 104 87 ------
NM_001378chr22384 338 --1179 --
NM_001379chr19166 ------
NM_001380chr103851 788 734 ------
NM_001386chr852063 2019 1822 868 95 --12055 --
NM_001387chr543033 2782 596 186 ----23145 49
NM_001390chr1873657 2704 2653 2647 1007 752 231 --33534 2413 1172 1905
NM_001392chr18----158 1221
NM_001395chrX1953 ------
NM_001396chr2142442 397 53 36 --4457 452 447 442 --
NM_001400chr121285 378 ------
NM_001407chr331144 483 224 --11719 --
NM_001408chr161694 1660 1647 1315 1150 1036 ------
NM_001412chrX93570 2907 2300 1151 1145 1138 1128 535 205 ----32669 767 319
NM_001415chrX51791 1577 1558 300 284 --1311 21935 1671
NM_001416chr17----1457 --
NM_001417chr1251957 1770 1290 542 493 --11280 --
NM_001418chr111100 1592 ----
NM_001418chr111100 1592 ----
NM_001419chr19104457 4447 4314 4255 4239 4188 4170 1573 1164 1153 --51220 1204 1125 1120 977 --
NM_001422chr1121375 1326 --11052 --
NM_001427chr751958 1946 1939 1473 582 21359 130 ----
NM_001430chr25656 358 227 208 70 ----1219
NM_001431chr63283 277 217 --11052 --
NM_001432chr463552 3163 1443 393 149 137 ------
NM_001438chr143064 3040 2758 840 --11027 --
NM_001439chr12386 274 1559 11482 --
NM_001443chr2163 ------
NM_001448chrX51290 1122 305 169 155 --11103 --
NM_001449chrX2805 518 ------
NM_001451chr1611128 --11271 --
NM_001452chr61586 ------
NM_001453chr62484 259 --11652 --
NM_001461chr12165 26 ------
NM_001463chr22798 258 ------
NM_001482chr152623 315 1787 ----
NM_001491chr652758 2707 568 330 60 --22727 1833 --
NM_001494chr102579 166 ------
NM_001495chr82295 113 ------
NM_001498chr671267 1102 1024 881 370 302 110 ------
NM_001511chr42669 559 1172 1461 --
NM_001527chr694800 3768 3634 1787 1442 1419 1305 146 63 13780 11826 --
NM_001530chr1421066 179 --21141 838 --
NM_001533chr19170 ------
NM_001539chr92124 103 ------
NM_001540chr7192 ------
NM_001541chr111167 ------
NM_001542chr132820 474 245 ----11750
NM_001543chr5104873 4800 4464 3612 3545 3495 3285 3184 951 586 ------
NM_001546chr661191 1079 988 982 554 271 ----1389
NM_001554chr12528 513 ------
NM_001560chrX42456 2077 2059 334 --12070 --
NM_001565chr43600 260 108 ----1275
NM_001584chr1141101 442 360 226 --1429 --
NM_001587chrX62141 1723 471 233 225 114 --1414 --
NM_001604chr114816 758 660 346 ----1922
NM_001609chr1064441 4108 1384 1162 440 249 12874 23036 1321 --
NM_001612chr11------125
NM_001616chr273085 2204 1085 840 800 752 429 --33371 666 514 12885
NM_001619chr11161 ------
NM_001620chr111530 1722 1673 --
NM_001621chr752923 2342 1169 1092 903 1380 ----
NM_001621chr752923 2342 1169 1092 903 1380 ----
NM_001629chr134313 285 253 29 --1267 --
NM_001634chr651987 1833 1542 521 419 --41859 1854 1849 1844 11755
NM_001635chr731061 1004 676 ------
NM_001642chr1131209 1170 1077 --11216 --
NM_001650chr1864158 3481 3165 1356 821 226 ------
NM_001655chr1122016 713 ------
NM_001656chr53602 63 30 ------
NM_001658chr111132 --11120 --
NM_001659chr1232733 2293 422 ------
NM_001660chr34722 587 324 299 --1733 1292
NM_001663chr1442730 1689 862 128 22641 725 ----
NM_001664chr31733 ------
NM_001668chr152185 1775 1671 365 52 12089 11815 --
NM_001674chr12995 978 ------
NM_001677chr151074 876 734 395 381 ------
NM_001682chr1272551 2154 2006 1132 1121 980 731 22703 794 ----
NM_001683chr342688 2277 922 406 ------
NM_001684chr154029 3767 3695 2548 472 ------
NM_001690chr372396 2178 1951 1902 1875 186 147 ----12200
NM_001695chr821495 571 1797 73771 2877 2872 2867 2862 839 376 --
NM_001701chr921505 1493 ------
NM_001709chr1152902 2879 2702 567 450 1923 72581 2576 2571 2261 890 587 561 --
NM_001713chr51175 ----11127
NM_001718chr6----11147 --
NM_001723chr62915 255 ------
NM_001730chr1321372 1283 --11502 --
NM_001730chr1321372 1283 --11502 --
NM_001735chr9171 ------
NM_001742chr741747 1594 664 480 ------
NM_001743chr22585 145 ------
NM_001744chr51104 ------
NM_001746chr542956 2810 879 288 --2679 518 --
NM_001754chr2153749 3426 2875 867 677 --33393 693 688 --
NM_001755chr1651857 1769 866 532 207 --3879 507 462 --
NM_001759chr12135259 3757 3516 3412 3355 2044 1911 1883 1123 644 83 74 68 25296 4646 33866 1665 692 --
NM_001760chr62725 345 ------
NM_001777chr363813 3607 2844 2831 840 695 --12724 11201
NM_001791chr13479 466 280 --31152 415 410 --
NM_001792chr1831046 962 718 11163 ----
NM_001794chr201274 ------
NM_001796chr16191 ------
NM_001798chr1211023 ------
NM_001800chr194565 480 182 144 ------
NM_001806chr1982889 2496 821 746 712 547 527 279 --22810 2364 11846
NM_001821chr134434 3709 1448 --128 1881
NM_001822chr24568 144 50 31 ------
NM_001839chr12700 39 ------
NM_001854chr121336 1191 182 ----
NM_001858chr6165006 4987 4902 4085 4037 3953 3560 3321 2017 1847 1813 828 761 750 613 486 15177 34024 3546 215 13622
NM_001859chr953967 3920 1153 298 203 ------
NM_001880chr21309 ------
NM_001881chr102357 25 ------
NM_001882chr51506 ------
NM_001884chr52160 57 ------
NM_001893chr171374 ------
NM_001896chr161333 ------
NM_001901chr631000 688 108 ------
NM_001902chr12379 283 --1350 --
NM_001903chr51897 ------
NM_001904chr35915 683 283 232 178 --1987 --
NM_001918chr1108980 7479 6433 6123 2822 1735 1417 1396 251 149 13023 39183 8993 8988 --
NM_001931chr1121312 390 1367 11089 --
NM_001935chr23355 281 51 ------
NM_001936chr731580 464 151 --1658 --
NM_001938chr161948 1652 1584 619 465 40 --1639 --
NM_001940chr12----1358 --
NM_001945chr511243 ----1943
NM_001948chr1571282 1114 991 973 916 499 225 11028 288 80 --
NM_001949chr693196 2819 2800 2792 2786 2264 803 678 636 --12225 --
NM_001951chr83592 506 125 ------
NM_001955chr6----11078 --
NM_001962chr53424 125 103 ------
NM_001966chr3--11413 --197
NM_001968chr42821 676 ------
NM_001969chr1421480 663 11353 2981 367 --
NM_001980chr1252290 2014 1729 751 536 ----1666
NM_001981chr122309 520 --31490 359 240 --
NM_001982chr1211076 ------
NM_001987chr12103401 2964 2629 1454 626 392 333 327 321 315 ------
NM_001992chr522211 597 --11381 1664
NM_001993chr111082 1167 ----
NM_001995chr431462 1071 576 11427 11278 --
NM_001999chr551489 1481 1399 1066 463 ------
NM_002006chr485829 5519 4872 3901 3557 1795 1747 1569 --11452 14717
NM_002009chr1582781 2557 2551 2289 929 866 165 60 11884 1946 --
NM_002015chr1362727 1106 811 481 371 331 ------
NM_002017chr1141021 320 131 99 1290 1397 --
NM_002019chr13------1779
NM_002024chrX82191 2168 2110 1374 860 747 741 390 --31872 754 456 --
NM_002025chrX179200 9193 9151 9136 9012 8940 6984 6132 5793 5766 5657 2990 2574 1118 733 293 116 --13305 17222
NM_002026chr21670 --1222 1329
NM_002027chr81476 ------
NM_002030chr1921090 74 1785 ----
NM_002035chr1882764 2696 2571 1510 1190 908 808 100 --12488 --
NM_002039chr43883 642 355 --1307 --
NM_002040chr21102893 2823 2743 2555 2543 2422 2325 2040 1055 769 --1832 --
NM_002041chr15------149
NM_002044chr15----193 --
NM_002051chr103917 439 111 --11094 --
NM_002052chr831411 1390 321 ------
NM_002056chr22871 784 ------
NM_002063chrX31168 1060 255 ------
NM_002065chr121807 701 --1719 11829
NM_002069chr741702 613 600 582 --2141 136 --
NM_002073chr2211078 ------
NM_002074chr161527 1461 1265 1235 1097 251 --1387 --
NM_002076chr1283291 2984 2330 1208 1125 1036 624 259 ------
NM_002082chr531012 976 30 ------
NM_002086chr1742165 2118 435 394 ------
NM_002089chr43682 564 178 ------
NM_002092chr4114989 4158 4152 4146 3174 1882 1469 1166 350 294 272 14702 32031 632 127 --
NM_002106chr42320 259 1243 ----
NM_002114chr6----1148 --
NM_002120chr61408 --196 1159
NM_002126chr1793462 2620 1656 1543 1170 1128 978 704 564 ------
NM_002128chr1342114 1687 811 115 12488 2418 362 --
NM_002130chr511196 11509 --11578
NM_002133chr222492 416 --1485 --
NM_002137chr742279 2168 2155 2043 1390 ----
NM_002138chr44714 571 244 205 ------
NM_002140chr931036 758 197 --21160 149 --
NM_002145chr171309 --1102 --
NM_002148chr21140 --2672 126 --
NM_002158chr253843 3239 2562 1411 690 --12631 12429
NM_002160chr9----1226 --
NM_002165chr203386 374 362 ------
NM_002188chr51690 ------
NM_002196chr20----1432 --
NM_002196chr20----1432 --
NM_002199chr41844 --148 --
NM_002202chr52811 145 --11020 --
NM_002210chr273497 3172 3159 838 598 381 211 13366 23553 3022 --
NM_002211chr1031092 454 146 1112 ----
NM_002214chr7125734 5589 4541 4196 3786 3544 1990 1647 1355 1068 980 864 --22164 664 --
NM_002221chr132147 2140 692 --22876 2829 12655
NM_002222chr321135 346 21217 72 ----
NM_002224chr62721 699 ------
NM_002232chr1175 --21322 179 --
NM_002235chr1231406 1325 345 11380 --11358
NM_002239chr211182 --1900 --
NM_002247chr1052298 1762 1701 427 87 1406 11717 --
NM_002264chr364239 4132 4095 3864 3437 101 ----14923
NM_002265chr173785 774 750 --1755 --
NM_002267chr1382443 2163 1725 1655 1569 985 937 215 12259 --2769 117
NM_002268chr341389 1242 1229 746 11528 ----
NM_002270chr545120 4770 3857 3806 13483 52150 2145 2140 2135 513 --
NM_002271chr1351753 961 882 776 714 --175 1931
NM_002293chr132750 1047 848 ----12126
NM_002296chr171730 1718 1519 1304 445 412 352 ------
NM_002310chr5126558 5978 5624 5351 4817 2216 1805 1481 1460 706 687 334 1955 34094 568 342 --
NM_002332chr122707 479 ------
NM_002336chr12124555 4328 3586 3351 1367 1263 1255 1155 1024 950 897 543 --11182 --
NM_002345chr122238 38 --1121 --
NM_002350chr811139 ----1841
NM_002355chr1241388 555 331 188 1928 ----
NM_002356chr6112668 2655 2514 2063 1751 1057 977 798 307 163 79 12168 22056 1083 --
NM_002358chr44681 631 619 82 --1593 --
NM_002374chr243643 2461 1294 1010 --23690 258 13352
NM_002376chr144555 502 482 43 --1496 --
NM_002380chr81382 ------
NM_002381chr21952 ------
NM_002382chr1421143 1110 ----1827
NM_002387chr555113 4950 1723 1310 25 --54661 4297 2026 903 246 --
NM_002395chr631312 1221 516 ------
NM_002397chr522248 774 --1133 --
NM_002398chr221091 373 ------
NM_002401chr1752144 1636 721 699 406 12207 --12009
NM_002408chr143743 658 629 1790 1562 1552
NM_002416chr431302 212 42 ------
NM_002425chr11133 --1102 --
NM_002430chr2252597 1900 982 820 518 --2644 359 --
NM_002438chr103579 157 82 ------
NM_002442chr121421 --11458 --
NM_002444chrX32005 1976 1642 --11259 --
NM_002449chr521284 192 --1166 11109
NM_002451chr953553 3224 3189 2929 744 12548 --23791 3445
NM_002460chr653814 3684 3311 2671 1263 11397 1414 1279
NM_002467chr81428 ------
NM_002480chr124535 203 196 176 ------
NM_002481chr1118002 7874 7714 7101 6450 5866 5306 5087 993 896 183 37903 7349 5557 26280 100 15996
NM_002482chr14660 284 193 37 --1198 --
NM_002485chr871794 1582 1489 787 511 453 112 --2230 181 1731
NM_002493chr92272 123 ------
NM_002499chr1532465 542 454 ------
NM_002501chr1933453 2649 2549 --23993 1187 1750
NM_002505chr611308 ------
NM_002507chr1731806 1788 1427 --21502 1497 --
NM_002509chr202671 653 --1661 --
NM_002515chr144729 605 163 28 11979 1205 --
NM_002518chr231202 489 483 --11010 --
NM_002519chr1131217 334 321 --1397 --
NM_002522chr1723297 146 --165 --
NM_002524chr1121 --1837 --
NM_002527chr122292 80 --1206 --
NM_002536chrX41281 508 452 284 --1209 --
NM_002537chr1541007 276 166 140 --1400 --
NM_002538chr52491 122 ------
NM_002539chr21313 187 ----
NM_002544chr171255 ------
NM_002545chr11104112 3585 3296 2071 1508 1243 796 134 123 99 11288 13458 --
NM_002553chr71455 ------
NM_002556chr1151653 1551 670 640 594 ------
NM_002569chr1511445 ------
NM_002572chr111290 ------
NM_002577chr384052 3791 3772 2791 2482 1599 1345 963 --21556 1350 13901
NM_002578chrX3468 415 348 ------
NM_002581chr9125579 5566 5552 5374 5206 4108 3482 3476 1411 1337 388 307 24041 3469 ----
NM_002583chr124566 469 252 143 ------
NM_002588chr51569 1447 21618 675 --
NM_002592chr202294 125 ------
NM_002594chr2012326 12212 --1508
NM_002595chr1251811 1579 445 425 160 ----11655
NM_002601chr21372 ------
NM_002605chr1521100 1052 ------
NM_002607chr731285 1214 127 --11260 --
NM_002610chr282785 2733 2338 2265 2202 985 411 241 ------
NM_002612chr722075 289 ----11431
NM_002618chr21358 --1122 --
NM_002624chr12175 ------
NM_002633chr1----1514 --
NM_002645chr1152303 748 360 332 223 --12644 --
NM_002648chr631183 850 342 ----21224 865
NM_002655chr864893 4158 4075 4040 3806 1145 14909 ----
NM_002656chr621067 42 --1220 --
NM_002657chr2033878 3228 945 ------
NM_002660chr2021161 851 --1180 --
NM_002664chr21527 21180 643 1398 11610
NM_002670chr351612 1505 1484 1101 342 ------
NM_002687chr1431004 881 483 ------
NM_002690chr8186 ------
NM_002706chr21134 --183 --
NM_002707chr23269 66 35 ------
NM_002709chr2103611 3516 3226 3105 3016 2389 2288 963 596 406 --1392 --
NM_002710chr122932 402 --1204 1688
NM_002714chr631098 1036 1006 ------
NM_002715chr551184 1033 1011 467 117 1458 ----
NM_002716chr1193695 3397 2618 2577 2343 853 798 180 64 --23268 580 --
NM_002718chr362689 2308 1752 809 138 67 ------
NM_002719chr1482383 2256 2240 482 474 372 354 314 ------
NM_002720chr161257 ------
NM_002721chr91383 ------
NM_002729chr103820 751 559 --2604 52 1223
NM_002731chr163143 2969 2748 1991 1274 482 12208 21068 1063 --
NM_002734chr1722202 1400 ------
NM_002736chr772070 1939 1651 805 681 476 339 ------
NM_002737chr1764852 4314 4289 4277 1224 1111 --11197 --
NM_002738chr162802 75 --21093 465 --
NM_002740chr382742 2544 2495 2428 1952 1742 457 162 --12508 --
NM_002742chr14--1530 ----
NM_002745chr2223098 53 23562 3292 44339 3242 1292 1140 --
NM_002747chr1851904 1744 693 586 525 ------
NM_002748chr1541086 1073 295 132 --148 --
NM_002755chr15--1701 ----
NM_002756chr174979 888 690 635 ------
NM_002763chr12195 171 ------
NM_002767chr171510 --1529 --
NM_002772chr211385 ------
NM_002786chr112245 117 ------
NM_002806chr141329 ------
NM_002814chrX3594 211 180 ------
NM_002816chr172293 256 ------
NM_002819chr191137 --11057 --
NM_002821chr63796 790 784 --1772 --
NM_002822chr1251729 1552 1319 237 144 ------
NM_002824chr121507 ------
NM_002825chr72606 463 ------
NM_002826chr11291 ------
NM_002828chr182699 329 1970 ----
NM_002830chr21154 ------
NM_002835chr72623 310 ------
NM_002836chr202192 103 --162 --
NM_002837chr1263217 2940 2900 370 282 53 1707 14462 1383
NM_002839chr963490 3397 3383 3248 3233 3196 1783 21185 841 --
NM_002840chr151585 1435 1236 660 649 --1443 --
NM_002841chr31499 1126 ----
NM_002843chr1153102 2198 983 659 81 --2117 112 --
NM_002848chr123400 345 63 --21074 875 --
NM_002858chr151235 1219 1009 960 404 ------
NM_002859chr122652 620 --21144 436 --
NM_002868chr1252372 1769 1701 545 397 --12379 --
NM_002869chr1111959 ------
NM_002874chr911856 12158 22272 721 --
NM_002880chr32833 97 ------
NM_002882chr22184 ------
NM_002886chr383753 3620 3286 2057 1953 942 936 917 12008 ----
NM_002887chr5130 ------
NM_002892chr1441737 1342 445 248 ----11143
NM_002893chrX1266 ------
NM_002902chr152503 421 ------
NM_002906chr1161607 1552 824 703 329 26 ----11967
NM_002911chr1961592 1185 559 504 329 92 11708 1541 --
NM_002912chr64932 908 355 229 --1744 --
NM_002920chr121350 ------
NM_002924chr11621 ------
NM_002928chr151385 1305 444 331 89 --2465 408 --
NM_002938chr431766 1497 748 --11855 --
NM_002941chr331666 1560 314 --11070 --
NM_002943chr151186 ------
NM_002945chr172868 804 ------
NM_002946chr13529 419 163 --1174 --
NM_002951chr20----1280 --
NM_002956chr1231041 881 224 --11413 --
NM_002958chr341014 982 919 666 ------
NM_002959chr174046 3525 2984 1518 1510 291 285 --23610 353 --
NM_002968chr16----1725 --
NM_002971chr351136 302 295 185 175 ----11177
NM_002973chr12199 ------
NM_002979chr11149 --1325 --
NM_002984chr171275 ------
NM_002994chr441641 1359 275 121 11863 ----
NM_002997chr21511 --11446 --
NM_002998chr841745 862 92 85 --1203 --
NM_003010chr1741530 885 696 83 --1356 11857
NM_003012chr883071 3045 2799 2404 1989 937 448 136 12922 --13099
NM_003015chr10194 ------
NM_003016chr1731683 729 254 ------
NM_003017chr64966 319 117 77 ------
NM_003028chr962773 2678 1203 1177 742 362 --12763 --
NM_003030chr371818 1738 1732 1722 1609 598 255 1696 ----
NM_003031chr1651001 919 902 328 286 ------
NM_003035chr13921 852 331 ------
NM_003038chr252599 2037 1712 553 383 --12653 --
NM_003042chr352146 2109 1774 525 361 ------
NM_003043chr354188 3848 3810 1013 447 --23839 189 1195
NM_003045chr1354767 4724 3796 3719 1869 --1379 --
NM_003046chr855280 5127 3420 1822 311 --14404 11198
NM_003048chr232726 2699 2628 11077 22552 1125 --
NM_003051chr13709 623 225 --2235 230 --
NM_003060chr521273 837 ------
NM_003068chr81916 11032 ----
NM_003069chrX--1263 --1544
NM_003070chr91645 ------
NM_003071chr321849 1782 --11839 --
NM_003073chr22----1259 --
NM_003074chr331746 1428 422 --21753 794 --
NM_003076chr1241568 1550 1379 649 ------
NM_003079chr173859 53 24 --1678 --
NM_003092chr20------155
NM_003095chr12160 ------
NM_003101chr141336 1063 605 521 --21562 310 --
NM_003107chr642446 2245 473 182 --1599 --
NM_003108chr2136741 6643 6020 5564 4846 2856 2129 1998 1799 1522 1066 1009 348 --16615 --
NM_003111chr221135 200 ------
NM_003112chr783231 3092 3040 2348 1124 1041 798 105 --53206 2610 2205 2132 899 --
NM_003113chr23739 132 112 --1733 --
NM_003115chr12402 331 ------
NM_003118chr521343 483 11977 2346 92 --
NM_003128chr262838 2420 2393 1998 1129 652 ------
NM_003133chr12889 175 --1999 --
NM_003136chr141249 ------
NM_003137chr662228 1819 802 719 504 120 --1786 --
NM_003140chrY199 ------
NM_003144chr612175 1753 1819 22145 825
NM_003155chr82833 270 169 ----
NM_003156chr1131190 526 481 1334 151 --
NM_003161chr1752873 2716 1320 915 487 1337 13547 --
NM_003162chr22163 145 --1105 --
NM_003174chr102703 88 ----1581
NM_003178chr34668 316 208 133 11511 22141 719 --
NM_003182chr73461 371 175 --1441 --
NM_003182chr73461 371 175 --1441 --
NM_003184chr82976 203 --3782 734 195 --
NM_003185chr2011318 ------
NM_003188chr61855 ----1109
NM_003194chr62434 367 --169 --
NM_003199chr18195675 5662 5654 5400 5170 4913 4556 4413 4376 4236 4230 4224 4206 3753 3687 3679 2005 1980 1846 --24214 1855 --
NM_003201chr104988 809 706 418 --1399 --
NM_003202chr521915 1360 ------
NM_003206chr61417 ------
NM_003211chr1251634 1544 1413 706 88 --11195 --
NM_003217chr1241970 1250 786 780 --186 --
NM_003221chr684219 4129 3902 3514 3046 993 747 32 --11506 --
NM_003223chr163866 701 320 --2708 657 --
NM_003224chr203854 677 129 ------
NM_003234chr32921 528 ------
NM_003242chr332243 893 311 --12233 1799
NM_003246chr1541710 1407 1368 1323 --11911 --
NM_003247chr661862 1409 1388 1382 1376 535 --21908 1661 --
NM_003250chr171361 ------
NM_003253chr2131892 618 118 1137 1569 1455
NM_003257chr154976 935 902 346 ------
NM_003262chr3114717 3995 3730 3459 3228 1696 1405 1153 899 833 207 --15257 15263
NM_003270chrX41151 1098 1052 243 ------
NM_003274chr21102713 2696 2221 2179 1135 921 798 169 159 77 ------
NM_003285chr11451 --194 --
NM_003286chr203389 249 24 ----2802 239
NM_003288chr201196 ------
NM_003291chr133300 202 95 ------
NM_003292chr161895 858 408 261 133 49 ------
NM_003295chr131157 ------
NM_003298chr376064 5948 5716 5202 5124 2048 197 24334 2198 12494 --
NM_003299chr12----181 --
NM_003304chr351183 650 423 408 283 --1337 --
NM_003305chr41156 ------
NM_003309chr631512 580 103 --41788 1314 477 214 --
NM_003315chr171238 ------
NM_003318chr63302 209 200 ------
NM_003319chr22241 108 1280 ----
NM_003326chr132632 2442 2233 --11843 --
NM_003336chrX11054 --11043 --
NM_003338chr1051873 1659 1429 1347 327 ----1646
NM_003340chr41887 11126 11274 --
NM_003342chr1753212 3177 592 230 67 ----1549
NM_003344chr741619 1504 1337 701 --21078 676 --
NM_003345chr163564 517 485 ------
NM_003347chr2262334 1838 1490 223 210 203 ------
NM_003348chr1231413 658 341 --141 --
NM_003350chr81168 ------
NM_003358chr91121 --1110 --
NM_003360chr41219 ------
NM_003367chr191475 ------
NM_003369chr1142635 2566 2407 633 11789 ----
NM_003370chr191664 ------
NM_003372chrX191 --1934 --
NM_003373chr1011700 --11959 1464
NM_003374chr52741 595 ------
NM_003375chr101310 ------
NM_003376chr631648 1219 659 ------
NM_003376chr631648 1219 659 ------
NM_003379chr63886 733 178 --2738 384 --
NM_003384chr14276 38 --1254 --
NM_003385chr2----1331 --
NM_003387chr252728 2447 2371 2274 368 ------
NM_003390chr1141110 1058 863 777 --2874 789 --
NM_003392chr353646 3545 3337 2806 1220 11667 --13972
NM_003400chr24665 622 134 21 --1189 --
NM_003403chr142560 238 ----1140
NM_003404chr2031864 806 293 1220 ----
NM_003405chr221541 1602 1772 1241
NM_003406chr871919 1908 1488 1372 1331 670 204 ------
NM_003407chr19----1678 --
NM_003409chr1871306 1290 1196 1155 575 565 508 1184 11362 --
NM_003410chrX52823 2390 2305 1193 1161 --12870 1178
NM_003411chrY1670 ------
NM_003412chr32560 355 ------
NM_003413chrX41987 1225 690 148 11526 2801 201 1748
NM_003420chr34334 238 212 76 ----1640
NM_003423chr1932392 1898 702 1524 --12462
NM_003427chr6----1644 --
NM_003432chr5--1216 ----
NM_003439chr762852 2700 2183 1393 1086 662 12320 1153 --
NM_003442chr113851 711 671 ------
NM_003452chr95979 928 897 709 670 --1999 --
NM_003453chr132503 108 --3508 495 490 1102
NM_003454chr1631515 1374 1203 166 1425 11243
NM_003458chr323803 188 ------
NM_003462chr121764 1454 ------
NM_003468chr23631 66 53 24073 3572 13769 --
NM_003470chr1631816 1346 199 --11823 --
NM_003472chr631548 1504 172 ------
NM_003477chr111613 ------
NM_003478chr1133042 2774 423 --1218 1723
NM_003482chr1262769 2743 1922 986 838 578 --22683 1929 21935 710
NM_003483chr1252815 2657 1935 759 286 11151 12901 12943
NM_003487chr172283 61 --1255 --
NM_003489chr2182811 2324 2295 1342 978 822 575 23 --23416 2300 12395
NM_003498chr1652421 2059 999 678 287 32200 2174 1082 1946 --
NM_003505chr721887 1681 ------
NM_003506chr82906 894 --21318 68 --
NM_003507chr241859 1326 789 593 --12001 --
NM_003513chr6129 ------
NM_003557chr141491 1473 1403 1289 ------
NM_003558chr92724 699 ------
NM_003566chr1273213 2247 1023 850 621 564 415 22735 1189 ----
NM_003567chr1173 ------
NM_003574chr18115803 5670 4184 4164 4048 3939 1932 1046 939 818 278 1928 --11509
NM_003576chr1372921 2778 2326 1908 784 251 25 12697 ----
NM_003580chr82447 435 --1396 --
NM_003583chr1293803 3631 2633 1493 1277 345 223 163 86 --1704 12828
NM_003590chr263685 1270 793 684 255 119 --42749 1088 601 374 1690
NM_003591chr101116 ------
NM_003592chr71470 ------
NM_003597chr232245 2171 1493 2904 138 31500 337 216 --
NM_003603chr432065 844 386 ------
NM_003607chr144102 2981 2770 812 1145 11166 --
NM_003615chr373604 3281 3200 2976 2846 1613 815 --23609 251 --
NM_003616chr142311 300 --2367 322 --
NM_003617chr164499 4022 3799 3616 714 422 24205 430 11712 --
NM_003618chr241331 1204 1109 155 ------
NM_003622chr1242410 2196 1747 212 ------
NM_003628chr21127 ------
NM_003629chr163371 3021 2984 1125 465 235 --42324 418 270 98 --
NM_003631chr101673 --1213 --
NM_003633chr552544 2077 1900 754 605 ------
NM_003636chr1------173
NM_003644chr1766268 4856 4533 4150 1705 304 --15156 12371
NM_003648chr242628 2474 1866 1670 --12603 --
NM_003654chr111786 147 ----
NM_003659chr21133 --2301 152 --
NM_003663chr3103418 2826 2723 2521 2254 2139 1108 531 480 118 --13486 12867
NM_003668chr122263 22 ------
NM_003670chr351448 1326 1179 1158 1089 ------
NM_003671chr933088 2979 2802 ----12717
NM_003672chr171676 1367 1360 720 691 478 29 ------
NM_003676chr11646 ------
NM_003677chr1231678 1591 322 1904 1304 --
NM_003684chr11699 ------
NM_003685chr192896 836 1820 3188 79 60 --
NM_003687chr521223 1065 ------
NM_003692chr961029 727 243 185 178 155 ------
NM_003701chr132952 917 ------
NM_003705chr23787 250 222 ------
NM_003711chr5137 ------
NM_003713chr181602 1586 1132 494 483 249 140 26 --1488 --
NM_003714chr542453 2365 2289 2157 ------
NM_003716chr31876 ------
NM_003722chr322611 2005 --1458 --
NM_003735chr51569 1447 21618 675 --
NM_003736chr51569 1447 21618 675 --
NM_003740chr651799 1354 1330 1314 188 ------
NM_003741chr31379 ------
NM_003743chr232072 784 186 ------
NM_003744chr1431129 1095 375 ------
NM_003749chr1342215 1806 293 233 --2243 238 --
NM_003750chr1031002 963 385 ------
NM_003757chr1--1360 ----
NM_003758chr1531348 1311 83 ------
NM_003758chr1531348 1311 83 ------
NM_003759chr463050 3015 2785 1130 354 192 1939 23770 3111 11191
NM_003760chr11255 ------
NM_003763chr2093010 2943 2872 2597 2373 2072 1282 254 193 --12863 12989
NM_003764chr6----1712 --
NM_003766chr17166 1218 150 --
NM_003772chr1151331 1056 927 828 151 --31295 410 24 181
NM_003774chr1253304 3240 971 234 220 ------
NM_003781chr361703 1608 560 481 429 383 ----1572
NM_003786chr171358 ------
NM_003787chr1831186 511 232 --11707 1576
NM_003794chr341063 915 427 205 ------
NM_003795chr63603 228 136 --2146 141 --
NM_003796chr191472 --1198 --
NM_003799chr1884409 3221 2966 2824 2787 1146 418 239 14208 136 --
NM_003816chr831237 336 71 11476 ----
NM_003822chr123090 2618 --1693 1682
NM_003829chr9----1275 --
NM_003831chr1831574 1547 1516 --21752 403 --
NM_003845chr12186 ------
NM_003850chr132561 78 --166 --
NM_003861chr1452729 2647 1085 598 317 --1445 --
NM_003864chr4272 52 ------
NM_003872chr251021 887 860 570 240 --11930 --
NM_003873chr1082309 2224 2062 1785 1602 1012 601 516 --32342 2235 940 --
NM_003877chr121956 ------
NM_003878chr81194 ------
NM_003884chr331713 1429 1316 1560 ----
NM_003885chr1742370 2014 589 69 ------
NM_003887chr291587 1563 1557 1480 1444 359 171 131 110 --1779 --
NM_003895chr2132064 2009 658 2430 204 ----
NM_003901chr1052373 2072 1974 256 154 ------
NM_003902chr13729 215 102 --1333 --
NM_003905chr161104 ------
NM_003906chr21148 ------
NM_003908chr2031174 1060 532 --1865 --
NM_003909chr863081 3019 2438 2380 2189 285 12297 22889 864 --
NM_003913chr6174123 4086 3723 3715 3679 3576 3522 2654 1374 1248 1208 1005 987 652 563 323 210 13468 23596 177 14202
NM_003921chr141814 1263 1154 44 ------
NM_003922chr152402 169 ------
NM_003924chr421399 1252 --11334 11235
NM_003927chr181843 ------
NM_003930chr732421 2135 100 ------
NM_003931chr63515 507 181 --191 --
NM_003932chr2241777 727 658 207 ------
NM_003934chr941258 463 326 310 --2114 109 --
NM_003939chr1044023 3760 1293 1287 --54134 1316 1311 1306 358 --
NM_003946chr161563 ------
NM_003948chr472704 2646 2630 2508 2396 2064 422 1102 ----
NM_003953chr122186 254 --11818 --
NM_003957chr1131013 828 822 ------
NM_003966chr5127800 7363 6628 5851 5670 5363 3110 2688 2662 1554 544 280 --46894 6362 2464 711 --
NM_003971chr171572 ------
NM_003972chr103387 364 285 --21289 1265 --
NM_003980chr651376 1186 936 460 421 ------
NM_003982chr141254 ------
NM_003983chr1674164 3247 3174 3107 1571 1297 896 --22777 1490 1853
NM_003987chr1022216 1582 12254 11553 --
NM_003988chr1022293 1659 12331 11630 --
NM_003989chr1022152 1518 12190 11489 --
NM_003990chr1022152 1518 12190 11489 --
NM_003993chr11293 ------
NM_003994chr1274401 3955 3845 3273 1474 181 130 13558 ----
NM_003998chr41614 ------
NM_004006chrX82539 2495 2415 2299 2285 1952 1880 93 --32485 518 244 --
NM_004007chrX82539 2495 2415 2299 2285 1952 1880 93 --32485 518 244 --
NM_004009chrX82539 2495 2415 2299 2285 1952 1880 93 --32485 518 244 --
NM_004010chrX82539 2495 2415 2299 2285 1952 1880 93 --32485 518 244 --
NM_004011chrX82539 2495 2415 2299 2285 1952 1880 93 --32485 518 244 --
NM_004012chrX82539 2495 2415 2299 2285 1952 1880 93 --32485 518 244 --
NM_004013chrX82539 2495 2415 2299 2285 1952 1880 93 --32485 518 244 --
NM_004014chrX82539 2495 2415 2299 2285 1952 1880 93 --32485 518 244 --
NM_004015chrX82539 2495 2415 2299 2285 1952 1880 93 --32485 518 244 --
NM_004016chrX72453 2409 2329 2213 2199 1866 1794 --32399 432 158 --
NM_004017chrX82539 2495 2415 2299 2285 1952 1880 93 --32485 518 244 --
NM_004018chrX72453 2409 2329 2213 2199 1866 1794 --32399 432 158 --
NM_004020chrX82539 2495 2415 2299 2285 1952 1880 93 --32485 518 244 --
NM_004021chrX72453 2409 2329 2213 2199 1866 1794 --32399 432 158 --
NM_004022chrX72453 2409 2329 2213 2199 1866 1794 --32399 432 158 --
NM_004023chrX72453 2409 2329 2213 2199 1866 1794 --32399 432 158 --
NM_004028chr1864158 3481 3165 1356 821 226 ------
NM_004034chr103608 489 186 ------
NM_004035chr1794749 4607 4295 1236 1051 953 426 366 177 14161 22048 1191 34839 4143 915
NM_004040chr231261 965 849 11087 11051 --
NM_004046chr18248 38 ------
NM_004050chr1422168 727 --1206 --
NM_004060chr541303 1193 863 57 ------
NM_004061chr51196 --2257 249 --
NM_004063chr831070 982 955 ------
NM_004067chr721010 91 ------
NM_004075chr122511 449 ------
NM_004080chr721428 1421 ------
NM_004081chrY31179 284 253 1131 ----
NM_004086chr141566 ------
NM_004087chr352058 1580 1395 1300 654 ------
NM_004089chrX51286 1174 431 67 43 --21041 1036 1936
NM_004093chr1353261 3146 2519 838 509 --32921 2605 2592 --
NM_004094chr1463067 2863 931 780 659 134 ------
NM_004096chr1061893 1550 1488 1401 771 306 --32138 2060 1971 1629
NM_004097chr21308 ----1294
NM_004098chr101497 --11221 --
NM_004113chr33815 639 441 ------
NM_004114chrX3469 453 366 --1417 --
NM_004117chr632220 2178 458 22006 777 ----
NM_004119chr132665 158 ------
NM_004124chr1463226 2565 2366 1381 1366 1026 32501 2341 713 12521 --
NM_004125chr93850 382 220 ------
NM_004126chr72289 47 ------
NM_004133chr842477 2040 974 298 ----11877
NM_004136chr1573019 2667 2564 2274 1229 1065 350 --11159 12019
NM_004156chr82526 210 ------
NM_004157chr31793 ------
NM_004161chr231281 1029 207 ----2648 308
NM_004162chr3------1152
NM_004169chr172548 151 ------
NM_004170chr931311 543 173 --1347 --
NM_004171chr11159642 9516 8747 7363 6711 6699 5827 3834 3473 3118 2781 2391 1760 1102 416 18639 48899 8192 2502 887 18913
NM_004175chr22----3169 164 159 --
NM_004180chr22417 180 ------
NM_004183chr11----1505 --
NM_004185chr1----1580 --
NM_004200chr1133077 3061 627 11302 --13290
NM_004205chr111534 ------
NM_004215chr81211 ------
NM_004225chr871437 1250 1147 596 380 313 212 --1102 --
NM_004229chrX52207 1643 1468 319 272 11855 3470 362 330 --
NM_004232chr1842770 1402 1041 897 --23811 2446 --
NM_004233chr671461 1453 1396 1258 1171 1071 441 --21037 420 --
NM_004234chr193744 511 147 --1214 --
NM_004236chr15----1156 --
NM_004237chr55909 720 579 330 181 --1822 --
NM_004238chr21305 ------
NM_004240chr192260 218 ------
NM_004241chr10----1231 --
NM_004242chr61286 ------
NM_004253chr9143 1717 ----
NM_004261chr13806 783 80 ------
NM_004267chr3------1157
NM_004272chr531871 1566 646 --1417 --
NM_004274chr1452606 1037 356 257 173 11064 22947 2112 --
NM_004279chr761986 877 796 768 334 177 1571 1154 12361
NM_004280chr65455 177 162 153 41 ------
NM_004290chr561332 1295 1132 924 869 36 --11088 --
NM_004291chr51422 ------
NM_004293chr952387 677 562 100 46 ------
NM_004299chrX167 --134 --
NM_004302chr1242909 2808 2673 1986 ----11929
NM_004311chr1032004 1977 87 1437 --12077
NM_004316chr1241150 1114 886 772 11062 ----
NM_004319chr163051 2399 2267 1071 828 176 1640 12228 --
NM_004326chr181175 1123 1033 1026 756 381 375 203 ------
NM_004327chr2222138 954 1551 ----
NM_004329chr1031442 945 46 --11315 --
NM_004330chr151464 --11124 --
NM_004331chr83961 450 113 11676 ----
NM_004337chr851937 1629 1598 785 62 ----12202
NM_004338chr18157043 6515 5886 5862 5732 5433 4975 4724 2452 1168 635 622 573 475 373 12157 --36177 4863 1995
NM_004342chr731500 878 382 --32176 633 74 --
NM_004343chr191139 ------
NM_004346chr441218 1115 523 385 ------
NM_004349chr831124 419 83 1875 ----
NM_004352chr162459 116 --2481 476 --
NM_004354chr41729 ------
NM_004360chr1621885 386 11911 21804 394 11242
NM_004364chr1921134 1057 --21051 1046 --
NM_004370chr631963 831 605 1292 1656 --
NM_004379chr241364 1269 1241 687 ------
NM_004380chr1651010 979 276 249 36 ------
NM_004384chr51213 --12242 --
NM_004385chr5126 ------
NM_004386chr1962228 2005 1612 732 604 489 11713 12248 --
NM_004392chr1362544 2374 2262 730 320 127 --22296 898 --
NM_004393chr342361 2328 397 372 --11724 --
NM_004395chr51735 ------
NM_004396chr172219 31 ------
NM_004397chr1194212 3559 3198 2990 2798 2656 1530 260 57 --13031 --
NM_004407chr42916 153 --21013 702 190
NM_004412chr10115898 5701 5040 4123 4090 3758 1851 1538 841 710 431 --64429 3788 3783 3778 3773 3768 175
NM_004414chr215574 499 314 298 165 --1288 --
NM_004417chr52496 450 ------
NM_004423chr322644 2017 --11845 --
NM_004429chrX51362 938 419 369 113 --11427 --
NM_004430chr852785 2510 2254 2240 1819 --21890 1885 11896
NM_004432chr922387 2265 11556 ----
NM_004434chr1421691 1665 --183 --
NM_004437chr151309 629 590 261 251 21193 927 13136 --
NM_004438chr243178 2412 1061 947 1302 12748 --
NM_004440chr641889 1722 1263 454 --11606 1631
NM_004447chr12259 32 1805 --1307
NM_004448chr17----1497 --
NM_004449chr2121162 1021 1393 1539 --
NM_004454chr342134 815 83 73 --4780 768 763 740 --
NM_004456chr7----1191 --
NM_004457chr231583 1576 563 11207 1319 11621
NM_004458chrX62647 2641 1626 283 254 179 --12502 --
NM_004459chr1762080 1998 1497 1347 1332 81 ------
NM_004464chr474077 1723 1380 595 427 413 159 23633 71 ----
NM_004472chr5----2549 77 --
NM_004480chr145549 525 519 513 258 ------
NM_004481chr112391 --12518 --
NM_004482chr21695 --1295 --
NM_004491chr1934267 4255 2998 ------
NM_004500chr1471716 1408 1288 729 569 206 117 ------
NM_004501chr174084 3323 3276 3033 2942 1631 63 --21073 730 12851
NM_004503chr12------1107
NM_004504chr262810 2048 1168 1111 647 639 --1587 --
NM_004505chr1732024 1694 569 ----11430
NM_004506chr61694 --1101 --
NM_004516chr1931008 976 402 ------
NM_004520chr5----1115 --
NM_004529chr941301 964 82 39 ----11320
NM_004535chr2061434 527 499 482 322 250 ------
NM_004538chrX4803 794 749 733 ------
NM_004561chr1141831 1760 1385 516 ----1225
NM_004566chr1012197 --22468 347 --
NM_004569chr142207 192 --1491 --
NM_004571chr2173398 3274 2840 1284 1045 352 77 ----1711
NM_004575chr451605 1512 1489 1459 354 ------
NM_004577chr71533 ------
NM_004578chr12906 701 --1142 --
NM_004583chr171746 ----1650
NM_004586chrX85436 5311 4294 4230 3810 1150 458 55 ------
NM_004593chr33770 208 160 --1225 1935
NM_004595chrX3309 303 184 --2363 316 --
NM_004598chr543084 1103 204 29 --11164 --
NM_004599chr222566 452 ------
NM_004600chr161513 1456 1330 614 377 276 ------
NM_004612chr974047 3717 3438 591 469 268 76 11308 33529 3403 769 13765
NM_004615chrX2747 41 ------
NM_004619chr142104 2098 1973 590 ----1372
NM_004627chr211137 --4653 635 600 78 --
NM_004630chr11----2997 969 --
NM_004635chr31121 ------
NM_004642chr124627 460 228 88 ------
NM_004643chr144865 713 689 683 --2701 664 1559
NM_004654chrY21224 202 --11376 --
NM_004655chr1761300 1214 901 895 880 561 ----1461
NM_004660chrY22091 529 22008 609 12103 1382
NM_004663chr1541237 975 555 95 ------
NM_004670chr1021709 1296 ----11255
NM_004673chr151446 1360 990 457 250 ------
NM_004674chr85497 396 83 63 53 ----1626
NM_004681chrY2709 136 1608 1740 1209
NM_004687chr1721850 1621 ----21915 1436
NM_004690chr6--169 --161
NM_004694chr171203 --3175 170 165 --
NM_004697chr93254 95 52 ------
NM_004703chr1742153 1958 805 524 --11798 --
NM_004707chr561621 1388 1379 539 495 341 172 ----
NM_004710chr172776 251 ------
NM_004715chr181165 ------
NM_004718chr22256 28 --2617 142 --
NM_004719chr1272671 2610 2219 2181 2039 1094 641 1107 22692 143 --
NM_004725chr1011327 2271 258 ----
NM_004726chrX165242 4892 4459 4255 4203 3968 3655 3539 1839 1832 1700 1567 1412 676 344 165 --34952 4387 1080 32139 1794 66
NM_004730chr532001 1814 1466 ----1754
NM_004734chr1373220 2766 2047 1199 724 383 240 ------
NM_004736chr142146 1553 794 250 1390 31976 1924 1919 --
NM_004737chr222885 110 11022 1334 --
NM_004738chr2082656 2358 2330 1650 1014 905 742 481 ----12235
NM_004739chr111656 --1247 --
NM_004740chr17137 ------
NM_004742chr341649 1373 554 207 ----2718 104
NM_004744chr493801 3753 1575 1454 1043 848 621 538 308 --23885 114 --
NM_004745chr826665 288 --24762 2373 24405 1331
NM_004747chr1031501 1405 1328 ------
NM_004748chr1553794 3034 2570 1271 1058 --23677 2713 --
NM_004760chr762397 1973 1608 740 576 443 11737 12390 --
NM_004762chr1731984 1970 1894 --1296 --
NM_004768chr131164 1067 872 ------
NM_004774chr1763066 2897 949 620 366 310 11977 --12043
NM_004776chr2093245 3178 2328 2245 2130 2124 2050 492 239 --33004 2102 1046 --
NM_004779chr541314 459 162 141 --11036 --
NM_004781chr12611 152 ------
NM_004781chr12611 152 ------
NM_004785chr161359 ------
NM_004788chr1152358 2338 2220 1718 80 --12159 --
NM_004789chr91325 ------
NM_004791chr131117 ------
NM_004792chr2182 ------
NM_004796chr1472447 2327 2165 1651 1526 435 245 1559 ----
NM_004798chr2053203 2661 988 498 358 --43384 2654 1382 898 12745
NM_004800chr132229 65 ------
NM_004801chr21238 ------
NM_004805chr21339 ------
NM_004818chr124650 480 239 56 ----1684
NM_004822chr1713056 --13758 11440
NM_004824chr651059 380 347 337 299 11263 ----
NM_004834chr263147 3090 1245 1180 1010 975 ------
NM_004836chr27876 846 670 385 219 188 97 ------
NM_004840chrX22416 987 --21899 100 --
NM_004841chr14794 766 318 226 ------
NM_004842chr621801 1398 --11441 --
NM_004849chr621280 636 --1613 11694
NM_004850chr231424 1418 1367 ------
NM_004856chr15----1213 1544
NM_004857chr1454160 3938 3171 3052 2913 ------
NM_004859chr1772043 861 852 801 419 228 97 --22483 642 --
NM_004860chr171462 ------
NM_004862chr1621146 84 21409 1168 1411 --
NM_004863chr14105268 5185 5120 4393 3937 3731 3447 1958 1277 767 --13851 --
NM_004865chr62343 298 ------
NM_004866chr544005 3734 1748 1724 --1633 11336
NM_004867chrX3513 463 198 ------
NM_004869chr1811610 ------
NM_004871chr1774359 4278 3399 2918 1385 210 190 --11488 --
NM_004873chr1473120 3005 2469 2265 987 617 540 --2435 33 --
NM_004874chr82378 182 --2492 487 --
NM_004879chr112905 300 1635 ----
NM_004884chr1551733 1517 1283 1246 415 --1440 --
NM_004893chr54415 176 157 112 ------
NM_004896chr1051420 1389 1301 1063 521 ------
NM_004898chr482840 2740 2607 2270 690 357 234 123 31872 947 225 1720 --
NM_004902chr203700 320 210 --2583 219 --
NM_004904chr7126283 6165 6091 6011 4979 4128 2556 2309 1957 1750 860 669 12128 22547 1180 12414
NM_004921chr132495 2462 271 21759 434 ----
NM_004932chr561512 1300 517 314 277 96 ----11593
NM_004938chr911232 --1272 --
NM_004946chr53510 417 331 ------
NM_004947chr362331 2079 1904 1600 522 291 ------
NM_004949chr182639 217 12179 11989 --
NM_004956chr763399 2951 954 577 525 80 1302 11501 --
NM_004958chr12734 725 1306 ----
NM_004968chr73696 547 90 ------
NM_004969chr101577 ------
NM_004972chr94961 771 455 419 ------
NM_004973chr671555 1392 1379 1139 544 232 145 1303 11519 --
NM_004976chr1144760 3609 3535 2071 ----1221
NM_004985chr12124357 4174 4139 3997 3814 3311 2860 2832 545 367 202 83 --12773 --
NM_004992chrX137945 7429 6635 6309 5805 5760 5413 5315 3272 2405 1126 931 186 --48288 7454 5400 1846 11409
NM_004992chrX137945 7429 6635 6309 5805 5760 5413 5315 3272 2405 1126 931 186 --48288 7454 5400 1846 11409
NM_004993chr1451330 1014 549 536 360 11232 ----
NM_004995chr1411504 --11513 --
NM_004996chr1661703 1511 1194 654 509 321 ------
NM_004999chr6124386 4147 3808 1746 1713 1625 1188 1060 1033 966 764 311 1753 2907 450 --
NM_005006chr22692 25 --1940 --
NM_005011chr761617 1606 1584 1505 1338 111 ------
NM_005022chr171206 ------
NM_005023chr521513 1090 --11108 --
NM_005025chr3181 ------
NM_005027chr1921196 1084 11075 ----
NM_005036chr2298336 6006 1922 1513 1273 1265 1167 945 165 139 22603 927 --
NM_005044chrX84185 4114 3779 3255 2919 1470 586 500 1221 14157 --
NM_005045chr73860 844 831 --2757 639 --
NM_005048chr21840 ------
NM_005053chr19--1570 ----
NM_005054chr231409 1212 1184 ----11637
NM_005056chr12154862 4538 4362 3824 3745 3687 3629 3571 2189 2159 1811 1804 1424 1387 1349 --35594 4523 1909 12255
NM_005057chr131870 651 607 --21877 315 --
NM_005066chr11777 --135 --
NM_005067chr33966 813 74 --3752 216 121 --
NM_005068chr631405 589 24 --11332 --
NM_005077chr92432 414 ------
NM_005078chr1541863 1441 324 216 ----11403
NM_005079chr873026 2923 1279 1058 602 422 303 --1528 13130
NM_005087chr33827 588 275 ------
NM_005088chrX1794 --1738 --
NM_005093chr2045351 1350 797 704 11670 1905 --
NM_005096chrX11123 ----11172
NM_005102chr23793 317 235 1655 1670 --
NM_005104chr62756 479 1599 ----
NM_005109chr382561 1898 1827 731 590 559 477 138 12396 1566 --
NM_005112chr42917 849 ------
NM_005116chr2084471 4417 4371 4363 4286 4010 3273 948 --42805 1830 1221 1107 --
NM_005119chr13836 341 251 ------
NM_005120chrX1171 ------
NM_005121chr1743379 3297 2532 391 ----1140
NM_005131chr18180 ------
NM_005134chr182908 724 ------
NM_005135chr1553827 3743 1342 718 32 --33842 653 108 --
NM_005151chr1832166 1590 386 ------
NM_005156chr9114931 4646 3697 3576 3402 1273 1141 866 769 582 317 --11157 --
NM_005168chr21393 ------
NM_005180chr1011574 --1392 --
NM_005184chr1921604 1538 --11532 --
NM_005188chr11178247 7082 6992 6307 5981 5773 5451 3279 2780 2705 2439 2080 1787 1424 712 611 187 --27186 650 32552 982 867
NM_005194chr20----3465 460 455 --
NM_005197chr14135752 5336 4988 4192 1526 1520 1513 1507 1501 754 245 152 110 --75986 5757 5286 4900 4020 1548 177 124
NM_005201chr3--1341 ----
NM_005204chr103917 830 57 ----1661
NM_005207chr22113707 3577 3477 3353 2685 2599 1499 1123 884 515 465 --81177 1043 579 574 565 560 504 37 --
NM_005214chr211071 ------
NM_005215chr181506 ------
NM_005221chr7153 --146 --
NM_005222chr72952 695 ------
NM_005224chr193609 545 253 ------
NM_005229chrX21223 206 --1483 --
NM_005230chr125613 536 231 225 168 ------
NM_005233chr352162 1655 667 658 554 --12377 --
NM_005235chr267125 6603 2968 2961 1109 629 1105 37818 1992 661 --
NM_005238chr1173429 2834 2652 2171 964 665 416 1517 1464 --
NM_005239chr2151759 756 732 483 292 11479 ----
NM_005241chr311262 --2974 199 --
NM_005242chr511317 --11248 1982
NM_005243chr222321 63 ------
NM_005244chr202628 570 1177 ----
NM_005250chr1611922 1477 ----
NM_005252chr141641 ----1603
NM_005254chr1541398 1248 926 288 ------
NM_005256chr111916 --194 183
NM_005257chr1821299 139 --11150 --
NM_005259chr221539 354 1309 21437 975 --
NM_005269chr12--1150 ----
NM_005276chr1211785 ------
NM_005276chr1211785 ------
NM_005277chr441268 648 551 260 1399 11864 1365
NM_005278chrX1464 --1431 --
NM_005284chr6----1489 --
NM_005296chrX----1158 --
NM_005308chr102336 188 ------
NM_005310chr171354 ------
NM_005311chr762881 2513 2113 1761 949 415 1487 42843 2562 2352 756 --
NM_005313chr152360 210 ----1484
NM_005316chr1131049 786 26 ------
NM_005328chr83777 587 510 --1276 --
NM_005329chr1651972 1881 1495 229 101 11506 ----
NM_005334chrX51752 1640 713 440 152 ------
NM_005336chr231956 1815 1418 ------
NM_005339chr474348 3203 3151 1674 1240 1063 411 --13652 --
NM_005342chrX72782 2616 1846 822 785 683 264 ------
NM_005348chr142896 73 ----2918 346
NM_005358chr1331854 1493 352 ----1332
NM_005359chr18106550 6212 5433 5336 5125 4998 4934 2272 1439 850 14257 55360 4804 4799 904 96 --
NM_005369chrX2439 109 ------
NM_005370chr1911058 ----21064 55
NM_005375chr63979 962 930 --1938 1944
NM_005381chr23385 334 300 1174 1324 --
NM_005385chr382602 2519 2290 2184 1899 691 350 81 ------
NM_005392chr961904 1811 1724 1658 1516 1358 11168 11428 --
NM_005398chr1031211 1153 457 --11196 11188
NM_005399chr164343 3363 1314 816 747 657 1917 11673 --
NM_005400chr262759 2749 2243 2008 1970 1211 1682 ----
NM_005406chr1841537 1197 443 132 ------
NM_005415chr21302 ------
NM_005417chr20----11876 --
NM_005418chr113712 505 196 ------
NM_005426chr13787 356 278 ------
NM_005433chr1842113 2090 1893 106 --22640 2441 1816
NM_005436chr1064007 3454 3442 1216 886 215 13555 21405 1234 --
NM_005440chr1732209 568 351 ------
NM_005442chr32259 59 --1125 --
NM_005443chr42161 142 ----2400 167
NM_005445chr10----1225 1246
NM_005455chr151517 1430 1410 1321 1195 --1313 --
NM_005458chr932469 2280 1701 ------
NM_005460chr51507 ------
NM_005461chr2031966 1866 1569 ------
NM_005467chr11190 ----1115
NM_005487chr2242055 2045 1906 660 --1318 --
NM_005493chr61592 ------
NM_005494chr71498 1537 ----
NM_005496chr321045 124 ------
NM_005497chr17156042 5844 5817 5761 5464 4996 4709 4220 3771 2470 1782 1564 1342 1106 201 16172 16077 14729
NM_005499chr191467 --1611 --
NM_005502chr943299 3044 2797 2015 --1657 --
NM_005509chr52674 109 --21203 276 --
NM_005513chr321592 1136 11368 ----
NM_005517chr151144 1082 340 156 96 1239 ----
NM_005519chr10------1166
NM_005521chr103805 253 163 ------
NM_005524chr31125 ------
NM_005530chr153239 208 180 ------
NM_005534chr213549 513 68 ------
NM_005537chr132953 167 ------
NM_005539chr1031295 1176 917 11391 ----
NM_005542chr771924 1519 1503 1414 1299 1228 363 ----11455
NM_005544chr22846 633 ------
NM_005562chr141478 1270 655 551 ------
NM_005563chr12189 157 --1709 --
NM_005572chr1----194 --
NM_005573chr53687 285 163 ------
NM_005575chr52598 309 1541 1297 --
NM_005576chr15----1212 --
NM_005578chr374589 4449 2023 1880 1071 428 101 13792 --11718
NM_005587chr151383 ------
NM_005591chr11122793 2483 2196 2011 981 799 764 632 499 435 365 164 ------
NM_005595chr12954 865 1645 --1747
NM_005596chr994948 4880 4577 3996 1959 1860 1791 1768 809 15458 32153 1568 388 --
NM_005599chr131360 1085 152 --11563 --
NM_005604chr682398 2387 1909 904 690 611 490 100 --22482 626 1218
NM_005610chr15776 707 637 601 153 177 ----
NM_005611chr161820 --21260 381 --
NM_005613chr142050 1535 740 655 ----1645
NM_005618chr6----1611 --
NM_005625chr81750 ------
NM_005627chr64785 739 299 52 ------
NM_005632chr1611112 --11117 --
NM_005634chrX3450 161 142 ------
NM_005637chr1882017 1623 1616 1609 1603 1497 746 704 1669 2601 531 --
NM_005638chrX51694 1620 1402 685 293 ------
NM_005639chr123374 360 139 11198 ----
NM_005644chr11341 ------
NM_005647chrX73301 3244 3147 3130 1091 430 154 12143 12167 --
NM_005650chr221415 --21179 1174 --
NM_005656chr2131238 591 57 --21133 1128 --
NM_005657chr15152 ------
NM_005662chr81392 --165 --
NM_005664chr153117 61 40 --1199 --
NM_005665chr1104247 3716 3336 1714 1447 1184 952 501 483 425 --11037 1937
NM_005667chr2173 ------
NM_005668chr5104602 4564 3878 3752 2844 1607 1481 1284 521 509 --11823 --
NM_005676chrX----1191 --
NM_005684chr1144 ------
NM_005686chr121576 486 ------
NM_005688chr331016 446 219 ------
NM_005708chr131154 ------
NM_005713chr52104 28 ------
NM_005715chr662691 2244 2014 691 189 155 11077 ----
NM_005717chr161254 1197 1017 1004 941 501 --51290 1285 336 331 326 --
NM_005721chr22702 194 186 167 --
NM_005722chr282378 2188 1989 1650 1639 776 627 571 12403 2899 560 --
NM_005731chr22352 115 ------
NM_005733chr51182 ------
NM_005734chr114703 671 510 253 --1164 --
NM_005737chr282856 2788 2761 2450 1980 1811 749 508 --12824 --
NM_005738chr741940 1772 1447 1435 --41422 674 335 123 11378
NM_005744chr15----1135 --
NM_005746chr772521 2501 1804 1774 1706 810 75 12016 22609 2081 --
NM_005748chr1283476 3264 2625 2543 2294 2254 885 558 --13344 --
NM_005751chr7--1455 1376 --
NM_005752chr1631224 1125 299 --11161 --
NM_005754chr51861 ------
NM_005759chr254026 3608 1897 1752 387 21562 828 14060 24326 893
NM_005765chrX3562 153 126 --150 --
NM_005766chr1341440 1120 346 224 ------
NM_005776chr143756 705 176 ------
NM_005779chr56793 757 439 429 411 252 --42930 2886 2881 2873 --
NM_005782chr17----1195 --
NM_005786chr1831264 1211 229 ------
NM_005789chr1772105 605 401 338 294 156 121 ------
NM_005795chr222340 1997 --21943 30 11220
NM_005797chr1131298 562 116 11418 1608 --
NM_005801chr171812 ------
NM_005807chr11121 ------
NM_005808chr372559 2534 2376 2333 1276 1046 857 --22889 146 --
NM_005813chr281700 1683 1034 662 578 355 249 69 ----1817
NM_005819chr133483 3140 720 23396 836 1334 --
NM_005822chr651959 875 816 369 273 ------
NM_005826chr12597 511 --1482 --
NM_005828chr1764768 4453 3412 1644 1595 935 23350 1335 --21812 1084
NM_005832chr331043 149 48 --1199 1346
NM_005839chr15891 800 677 366 340 1351 1691 2916 899
NM_005840chrX97057 5606 4888 2996 2662 1075 704 371 175 12090 1518 --
NM_005841chr46924 81 75 69 63 56 --1282 1355
NM_005842chr131481 ------
NM_005843chr241486 1321 699 245 --11750 --
NM_005857chr141474 471 206 75 ------
NM_005862chr34885 338 268 110 --1803 --
NM_005863chr105997 556 133 123 61 ------
NM_005868chr721589 255 ------
NM_005869chr5--1128 1148 --
NM_005871chr1041099 1068 683 676 --1713 --
NM_005875chr3140 ----1247
NM_005880chr1661571 1071 558 550 305 57 ------
NM_005885chr561542 1367 1260 165 126 98 --11534 --
NM_005895chr12114070 4022 3516 3473 3273 2763 2627 543 476 107 82 --21040 112 13903
NM_005896chr22749 289 ------
NM_005898chr1173018 2894 2210 1052 949 125 90 22137 1103 1207 --
NM_005899chr1731602 1084 407 1381 11045 --
NM_005900chr43845 488 407 ----1397
NM_005901chr18228542 8364 8295 7622 7430 7339 6937 6763 6634 6292 6124 5309 3447 2806 2766 2311 1593 1379 1361 1222 674 664 26547 2622 18051 --
NM_005902chr1574499 4009 1502 1110 816 584 144 14135 14378 --
NM_005903chr565207 2037 1753 1015 621 44 --1473 14408
NM_005904chr1831470 1436 1092 --3417 167 162 --
NM_005907chr641666 1614 659 230 --2392 127 --
NM_005909chr563426 2843 1515 1504 1419 442 ----14101
NM_005910chr1734097 3791 931 1943 ----
NM_005911chr21965 --1202 --
NM_005920chr173845 3755 3489 2834 1455 1339 536 1520 ----
NM_005924chr721140 137 ------
NM_005933chr1112301 ------
NM_005935chr4135215 4857 4694 4190 3935 3645 3334 1779 1440 1236 947 482 454 --64726 3960 3668 3663 3658 3653 --
NM_005937chr1734159 3315 1636 --24179 285 --
NM_005941chr841346 800 729 211 --13704 --
NM_005944chr321144 1018 ------
NM_005955chr184988 4916 4574 4460 3929 1872 1628 600 --25042 832 --
NM_005964chr1721091 408 11204 ----
NM_005966chr221903 1670 --11690 --
NM_005969chr1111192 ------
NM_005977chr132249 29 --161 --
NM_005981chr122859 87 ------
NM_005986chr134843 630 583 240 --22565 2210 --
NM_005990chr552749 2139 1925 541 358 --1317 --
NM_005996chr1251158 1045 1039 1033 601 ----11403
NM_005999chr141487 1111 981 128 21497 1255 ----
NM_006007chr9124464 3802 3795 3625 2839 1788 1350 1251 1206 1062 98 34 11378 43637 3632 3189 886 --
NM_006009chr12151 1189 ----
NM_006011chr1574258 4221 3964 3178 1551 855 768 --1689 --
NM_006015chr11396 11158 21106 1101 --
NM_006016chr672181 2169 1648 1616 773 705 514 ------
NM_006017chr43875 764 257 11134 ----
NM_006036chr232506 2158 1867 --1477 --
NM_006037chr2144756 4436 4353 4005 3588 3499 3359 3089 1914 1708 1577 1351 994 23 1959 54787 4085 4080 4075 892 --
NM_006038chr2042150 1821 1610 287 --4310 302 297 292 --
NM_006039chr1711084 ------
NM_006047chr2063396 2685 2321 1256 305 66 --32900 2446 619 --
NM_006054chr1131331 387 136 ------
NM_006063chr2171 ------
NM_006064chrX1370 ------
NM_006067chr162830 164 ------
NM_006076chr732819 1023 629 --1522 --
NM_006079chr62278 190 --1561 --
NM_006080chr752875 971 821 745 691 --1521 --
NM_006089chrX41890 652 530 160 21232 1190 2520 90 --
NM_006090chr12764 33 ------
NM_006094chr841736 841 417 80 --3856 851 846 --
NM_006095chr494471 4395 4239 4047 3689 3642 3180 1265 552 --13132 --
NM_006106chr11113366 3289 3249 2674 2449 1368 1127 779 738 729 536 --3855 713 708 --
NM_006109chr143334 318 47 ----1326
NM_006113chr142055 1582 464 266 11399 31993 1753 1665 11320
NM_006122chr1521780 161 ------
NM_006135chr121305 179 --11476 --
NM_006136chr721233 184 ------
NM_006139chr232890 2568 555 ------
NM_006141chr1642553 2204 885 395 ------
NM_006143chr121108 ------
NM_006145chr192919 129 ------
NM_006148chr1762593 2364 2189 1851 312 90 --12861 --
NM_006153chr33241 226 218 ------
NM_006154chr1531802 1139 27 --12756 --
NM_006157chr11----197 --
NM_006158chr821450 722 ----11409
NM_006159chr122570 42 ------
NM_006160chr1721071 542 ------
NM_006166chr1232645 2586 1804 1715 1233 --
NM_006178chr172591 569 --21568 1384 --
NM_006180chr972138 1934 1926 1697 1580 568 559 ------
NM_006183chr122405 166 ------
NM_006190chr23783 430 296 ------
NM_006194chr14----11053 --
NM_006195chr921143 145 --1892 --
NM_006197chr852037 1965 495 360 204 --11798 --
NM_006202chr1931769 1314 145 ------
NM_006203chr5115421 4812 4418 4358 3959 1237 1135 1106 969 940 801 15155 13498 --
NM_006206chr442917 2911 2402 2161 --11816 --
NM_006209chr82153 58 ------
NM_006211chr8177 ------
NM_006212chr1115393 5128 5046 4608 4590 3432 1972 1596 1467 456 187 --23564 3559 14854
NM_006216chr23549 525 82 --1158 --
NM_006223chrX1432 ------
NM_006224chr1752444 1747 538 397 104 ------
NM_006226chr251220 380 193 80 63 --1519 --
NM_006228chr82413 396 1357 ----
NM_006237chr1352127 1907 1434 654 319 --1676 --
NM_006238chr612039 --1359 --
NM_006241chr392407 2286 1954 712 702 696 674 667 73 ------
NM_006243chr12942 40 --11027 --
NM_006246chr1441104 1058 828 237 ------
NM_006251chr572457 2120 1280 963 505 416 114 13233 11269 13121
NM_006252chr1127380 7040 7020 6135 6067 2909 2245 2142 2117 2038 1861 1321 --31503 1240 1086 16960
NM_006256chr162693 2297 894 582 385 115 ------
NM_006258chr102262 191 ------
NM_006265chr831504 1295 1267 ----1209
NM_006268chr1141213 864 819 744 --1362 --
NM_006275chr2041914 1646 351 278 --11855 2928 385
NM_006277chr22675 137 ------
NM_006281chr831141 827 21 --1231 --
NM_006281chr831141 827 21 --1231 --
NM_006282chr20134751 4712 4692 4481 4403 4364 3358 3036 2961 1057 993 337 309 ------
NM_006304chr71126 ----1152
NM_006306chrX115906 5878 4598 2143 1813 1804 1679 1660 1574 836 405 --13631 --
NM_006309chr31103 ------
NM_006310chr1731302 397 29 --1329 --
NM_006312chr122715 608 ------
NM_006313chr1211371 ----1280
NM_006315chr473253 3189 2779 1494 1305 1202 850 1287 13964 23930 865
NM_006320chr42963 431 ------
NM_006321chr372181 1952 1639 425 409 269 158 ------
NM_006324chr16173 ------
NM_006325chr121759 --1214 --
NM_006327chr101261 ------
NM_006330chr811648 --2113 95 --
NM_006333chr21475 ------
NM_006335chr12341 80 --1350 1791
NM_006345chr41231 ------
NM_006352chr192040 1998 1954 1553 1494 365 358 212 126 --11675 --
NM_006357chr21429 ------
NM_006359chrX52512 2323 2169 1696 221 --1256 --
NM_006363chr201410 --1207 --
NM_006364chr144901 826 815 808 ----11083
NM_006366chr621252 1238 ------
NM_006367chr11959 ------
NM_006371chr395315 5289 4920 3866 1906 664 656 550 403 ------
NM_006374chr22207 43 --1530 151
NM_006375chrX31430 1419 290 ----1355
NM_006378chr931402 1383 61 ------
NM_006380chr1743828 3687 3277 274 21674 1244 179 --
NM_006386chr2262459 2321 2118 1829 1507 698 11556 2424 374 1558
NM_006390chr1241747 1463 1187 285 --1632 --
NM_006393chr1063347 2917 2898 1480 1330 425 34467 2806 947 24487 3867 11359
NM_006401chr91392 ------
NM_006413chr102318 94 --11123 --
NM_006415chr92993 287 --11283 --
NM_006416chr62762 215 ------
NM_006420chr20133238 3176 3164 3097 3045 2991 2828 1231 695 656 551 483 328 --1560 --
NM_006434chr1052108 2082 1155 871 715 --12048 --
NM_006439chr41384 ------
NM_006451chr52991 973 --1237 --
NM_006457chr442587 2529 1625 1513 198 14048 --
NM_006459chr1051765 1637 574 318 21 ------
NM_006460chr1741240 284 218 179 --11750 --
NM_006464chr2104669 4627 4527 4490 4315 3652 1634 921 915 249 ------
NM_006467chr582287 2272 2217 1803 1734 790 543 471 --1110 --
NM_006469chr141600 1577 1527 474 11191 2305 201 --
NM_006474chr122020 216 ------
NM_006482chr1293803 3631 2633 1493 1277 345 223 163 86 --1704 12828
NM_006489chr144729 605 163 28 11979 1205 --
NM_006496chr12670 511 ------
NM_006504chr1062960 2638 2616 2139 2091 833 ------
NM_006519chr6----1100 --
NM_006520chrX31629 1523 1299 ------
NM_006526chr2062144 1962 1649 1639 1414 528 --22214 182 --
NM_006529chr431322 1245 241 ------
NM_006532chr1941805 1770 1753 1533 1510 11812 --
NM_006536chr13853 757 288 ------
NM_006537chr152177 124 ----1204
NM_006538chr264037 3932 3728 2762 1282 308 --24095 1600 --
NM_006539chr161534 ------
NM_006540chr881599 1277 1211 1182 1170 488 401 114 --21385 361 --
NM_006544chr14166037 5973 5475 5084 4054 3799 3708 2361 2353 2279 2025 1911 1597 386 334 282 25911 5214 14470 --
NM_006546chr1766586 5771 5565 1721 407 364 16310 16039 14881
NM_006547chr762049 1680 1668 1624 1504 468 ------
NM_006548chr321319 681 --11727 11479
NM_006549chr1242947 1046 152 137 ------
NM_006555chr721969 775 11353 21910 1238 --
NM_006559chr121145 114 3776 407 374 ----
NM_006561chr10106172 5878 4234 4036 1886 1573 1298 1050 967 832 25579 1426 65916 5857 4837 1502 1175 646 --
NM_006565chr1641061 873 500 421 ----1211
NM_006572chr17102746 2735 2598 1190 1019 611 602 49 40 22 --3707 567 61 12283
NM_006575chr1431453 1144 447 ------
NM_006577chr231151 979 63 1223 ----
NM_006582chr1------133
NM_006591chr1151954 1891 520 499 122 --1621 --
NM_006595chr114498 392 285 178 21535 415 11308 --
NM_006599chr16228180 8150 7963 7929 7172 6793 6641 6431 6313 3130 2968 2114 1918 1752 1709 1654 1589 1366 1358 811 403 376 --21689 1511 21062 765
NM_006601chr121145 ------
NM_006602chr201299 ------
NM_006603chrX81915 1844 1788 1768 1642 524 473 159 ------
NM_006609chr262629 2511 2493 2244 1064 890 --22953 895 --
NM_006614chr3103067 2802 1392 1154 1087 1013 941 751 693 212 --23470 199 --
NM_006618chr121480 255 --11410 --
NM_006620chr663759 1532 933 723 385 105 --1664 --
NM_006622chr51233 ------
NM_006624chr1051966 1931 1693 588 453 ------
NM_006625chr11444 --31181 1109 742 --
NM_006625chr11444 --31181 1109 742 --
NM_006625chr11444 --31181 1109 742 --
NM_006626chr951929 853 780 772 482 --12365 --
NM_006628chr1563276 3138 1184 1108 736 633 12843 54586 4581 4576 4563 310 --
NM_006629chr1862551 2415 1823 1766 1090 1067 ------
NM_006633chr53788 276 72 ----1137
NM_006646chr13103092 2921 2796 2725 2562 2495 2057 2038 1119 450 ------
NM_006651chr431504 1329 576 ------
NM_006654chr12114302 4157 3796 3731 3522 3441 3116 3086 2958 1892 807 2991 933 13234 --
NM_006667chrX41141 439 283 240 1103 1381 --
NM_006670chr61207 --2540 170 --
NM_006675chr1253413 3402 2413 1175 1056 ------
NM_006681chr42128 67 ------
NM_006690chr2032356 1746 1658 ------
NM_006699chr162720 2414 2246 2128 856 289 --137 21850 202
NM_006700chr122748 563 ------
NM_006703chr61188 ------
NM_006713chr5485 74 44 35 --1723 --
NM_006717chr9103303 3152 2928 2873 2736 2717 2267 984 360 139 11038 --1145
NM_006718chr621067 42 --1220 --
NM_006721chr101323 ------
NM_006722chr363053 2759 1141 950 907 813 ------
NM_006726chr42880 205 --1807 --
NM_006727chr51510 --1395 --
NM_006729chrX44264 2237 1773 1030 --24739 4248 --
NM_006732chr1922134 1351 --1185 --
NM_006734chr631604 57 51 ------
NM_006735chr7159 ------
NM_006736chr2--11906 ----
NM_006738chr1594555 3952 3659 3008 2822 1640 1608 1305 298 23861 3263 3823 617 404 --
NM_006746chrX31544 969 547 --199 --
NM_006751chr24978 799 746 716 --1380 --
NM_006756chr841433 1103 232 128 ----11160
NM_006763chr132090 1857 843 ------
NM_006766chr842064 897 704 194 --22512 187 --
NM_006769chr11561 ------
NM_006772chr631779 1636 1626 ------
NM_006774chr721536 153 ------
NM_006775chr612798 22198 645 22904 2135 --
NM_006777chrX42398 754 302 27 1174 3468 423 32 11890
NM_006791chr156630 425 254 215 118 52 ------
NM_006802chr151186 978 227 182 173 ------
NM_006805chr531176 319 307 --1111 --
NM_006810chr3----152 --
NM_006813chr61227 --1272 --
NM_006814chr2052574 2055 1953 711 81 --11719 --
NM_006815chr1251064 1025 944 541 307 --2996 550 --
NM_006822chr171201 ------
NM_006823chr841292 1124 976 447 --1495 --
NM_006826chr221217 311 --1328 --
NM_006827chr1472910 2286 1147 989 731 335 220 --1820 --
NM_006838chr124362 278 214 91 ----1284
NM_006842chr11----1122 --
NM_006852chr1742854 2395 548 419 --11975 --
NM_006854chr731892 1341 747 --11575 --
NM_006861chr121121 ------
NM_006873chr283105 1374 1325 1195 940 925 635 188 --2326 238 11303
NM_006874chr431184 961 888 11015 11133 --
NM_006884chr371818 1738 1732 1722 1609 598 255 1696 ----
NM_006885chr16164031 4022 3055 2904 2898 2892 2773 2688 2682 2571 1504 1494 557 542 527 153 --22967 604 --
NM_006888chr1473292 3195 2707 2235 1221 726 637 12412 ----
NM_006896chr711154 ------
NM_006897chr121203 ------
NM_006898chr2--1617 ----
NM_006908chr741450 1325 196 188 --31490 1354 937 --
NM_006912chr172453 2116 1755 1617 935 248 229 --1241 --
NM_006914chr92412 200 --31509 1108 274 --
NM_006915chrX42495 2065 320 243 --12502 --
NM_006916chr22386 229 ----11336
NM_006918chr1165775 4770 4586 1967 1312 1220 ----1490
NM_006920chr251841 1806 1780 217 109 --1691 --
NM_006922chr282049 2043 1858 1795 1694 375 211 107 --1506 --
NM_006924chr1794337 4188 3994 3968 3596 2846 1392 816 712 --43408 1671 1273 92 --
NM_006925chr141446 ------
NM_006930chr551913 1256 556 539 232 --1127 --
NM_006937chr172432 37 ----1234
NM_006939chr141757 --11079 --
NM_006940chr1261333 1297 627 438 345 335 --3443 407 399 --
NM_006947chr42501 28 ------
NM_006948chr2152497 2464 2346 1734 948 1988 22334 151 --
NM_006951chr103635 100 38 1583 ----
NM_006981chr962630 2431 1898 883 338 210 --1873 --
NM_006982chr121226 ------
NM_006996chr161831 1549 1179 621 440 331 1737 31569 553 540 --
NM_006999chr541399 467 428 221 ------
NM_007005chr92545 539 ------
NM_007006chr1683534 3483 3209 2892 2799 2693 2466 214 23431 796 13340 --
NM_007007chr12194394 4105 4039 3768 3357 3179 3139 3108 2990 1777 1543 1389 1318 1270 953 698 344 328 206 ----24094 1597
NM_007008chr21700 ------
NM_007010chr1721485 1233 ----11684
NM_007011chr1586809 6037 5187 5176 4665 4653 1759 1193 --26583 6578 36647 2185 1185
NM_007013chr83796 408 126 ------
NM_007017chr51789 ------
NM_007019chr20----1115 --
NM_007023chr211028 --1888 --
NM_007026chr171115 ------
NM_007027chr32404 38 1148 ----
NM_007031chr21124 ------
NM_007033chr142276 2174 1989 1598 21763 44 1675 --
NM_007034chr151062 1037 789 748 266 ------
NM_007035chr125847 758 739 704 624 ------
NM_007040chr1941073 1006 434 263 --11058 --
NM_007042chr372616 2048 1694 864 857 636 491 1379 22549 553 --
NM_007050chr2068118 7898 6694 5890 1515 693 --22428 412 1314
NM_007054chr5113741 3719 3592 3561 3530 3455 2410 972 702 690 605 --43569 1507 560 383 --
NM_007064chr311396 --11377 1604
NM_007068chr2211063 ------
NM_007069chr11----156 --
NM_007076chr121123 ------
NM_007078chr1023030 794 12340 22959 1230 --
NM_007084chr133600 389 365 1314 11226 --
NM_007106chr1332149 1712 223 --22584 1770 --
NM_007107chr362334 2181 2166 753 161 97 ------
NM_007111chr133917 667 246 --1629 1194
NM_007112chr12249 241 ------
NM_007114chr363147 3111 3101 2227 1112 140 ------
NM_007118chr51562 ------
NM_007124chr651773 1570 210 185 134 --1475 11390
NM_007125chrY31044 469 67 --1221 1481
NM_007129chr131755 ----11040
NM_007137chrX105461 5445 5384 5308 4433 4407 4384 1309 1159 714 --13995 --
NM_007145chr1931007 536 275 ------
NM_007146chr1762484 2318 2111 1960 1932 466 --1757 --
NM_007147chr1921228 918 ------
NM_007158chr11890 21135 68 1407 --
NM_007159chr331667 1200 1123 --11326 11621
NM_007166chr1121500 1368 ------
NM_007172chr2263236 3103 2896 2721 2659 345 --22479 460 11301
NM_007173chr1171795 1787 930 446 408 69 43 ------
NM_007175chr8103415 3238 2993 2826 2582 2541 1055 724 590 385 --13483 --
NM_007178chr121467 ------
NM_007192chr1441191 1107 223 105 ------
NM_007195chr1873639 3515 2828 2683 2539 1487 808 1457 23010 1178 --
NM_007197chr1231038 190 68 --2200 195 --
NM_007200chr1594555 3952 3659 3008 2822 1640 1608 1305 298 23861 3263 3823 617 404 --
NM_007203chr953820 3442 2878 2506 1534 11525 12614 12620
NM_007204chr11563 ----1163
NM_007207chr11689 ------
NM_007212chr181833 1685 1524 1443 826 790 605 246 11418 11966 --
NM_007214chr61401 --157 --
NM_007218chr83754 639 240 ------
NM_007222chr861627 1604 1283 1199 193 98 ------
NM_007235chr12----2215 127 1105
NM_007238chr2073096 1897 1445 1247 1111 433 346 ------
NM_007246chr41351 --1802 --
NM_007249chr13119233 9054 8513 8479 7956 7175 6207 3676 3417 664 251 --58173 827 766 687 671 --
NM_007250chrX2401 377 ------
NM_007256chr1141667 1615 1032 1020 --11186 --
NM_007260chr11758 ------
NM_007271chr61266 21465 1358 11746 --
NM_007276chr75971 733 441 373 334 ----1126
NM_007282chr321015 684 --1322 --
NM_007285chr161147 ------
NM_007292chr1794749 4607 4295 1236 1051 953 426 366 177 14161 22048 1191 34839 4143 915
NM_007308chr41511 ------
NM_007325chrX71820 1689 874 704 691 544 367 --31701 1696 573 --
NM_007331chr462720 851 824 743 470 120 1346 32487 573 292 --
NM_007345chr1852253 1872 1755 199 48 22304 2187 ----
NM_007347chr1552919 2638 1990 647 131 --23103 484 --
NM_007349chr72407 97 --1372 --
NM_007350chr12103885 3733 3603 3496 3490 1479 1096 1016 580 346 133 21177 1137 --
NM_007353chr732885 2478 2137 ------
NM_007358chr121941 1263 --21250 396 1800
NM_007359chr1751702 1689 1395 1107 316 --1376 --
NM_007361chr141670 ------
NM_007372chr172909 171 --1188 --
NM_007373chr1061524 1491 1297 533 395 220 11621 11586 1520
NM_007375chr182754 2386 1737 1126 1028 972 383 193 --1472 --
NM_012064chr1241070 999 285 136 --11083 --
NM_012074chr1411057 168 2795 177 --
NM_012081chr573735 3053 1273 1018 889 881 873 ----11416
NM_012089chr151520 1407 1348 239 162 ----1148
NM_012090chr131064 1050 817 --1516 1897
NM_012092chr21341 --21679 128 --
NM_012095chr1072919 2390 1402 1249 1017 884 35 ------
NM_012096chr363775 3132 2927 1508 1486 1311 23241 2357 --11016
NM_012097chr272138 1909 1768 1669 1662 1472 612 ------
NM_012098chr931003 179 132 --11503 --
NM_012102chr152614 1758 921 796 512 --31829 1022 938 --
NM_012110chr41113 ------
NM_012111chr141151 ------
NM_012115chr63622 209 69 --1411 --
NM_012120chr611915 --22637 176 --
NM_012124chr111343 --188 --
NM_012129chr742212 873 833 97 ------
NM_012137chr152887 2323 2124 1873 76 --12110 --
NM_012141chr1344137 3126 1039 1020 --32766 1008 420 --
NM_012155chr191215 ------
NM_012158chr1341667 1142 501 165 174 ----
NM_012161chr411075 --1115 --
NM_012164chr9147246 7100 5979 5963 5846 5502 5457 5002 4857 2676 2085 651 181 53 --77072 6974 6828 4910 4697 1369 143 16727
NM_012175chr114863 278 184 83 --1792 1329
NM_012180chr41220 ------
NM_012188chr521080 1050 ------
NM_012193chr1145456 1887 725 329 --24264 1945 --
NM_012197chr951330 1275 590 566 522 --11356 --
NM_012199chr184662 3875 3785 3670 3456 1373 590 544 --12915 --
NM_012207chr1041097 929 163 116 ------
NM_012214chr296001 5187 4604 4423 4133 2300 1956 1049 985 --14994 15688
NM_012215chr1031344 1225 712 11237 ----
NM_012219chr32891 551 ------
NM_012223chr261307 1189 845 433 244 60 --1188 --
NM_012229chr1021315 169 --1163 --
NM_012234chr3103560 3526 3278 2895 2458 1417 1205 898 331 213 1465 33597 2444 338 --
NM_012238chr1061754 1736 1622 1594 1403 142 --21677 323 --
NM_012243chr12368 124 ------
NM_012245chr141418 --1306 --
NM_012247chr104900 725 679 28 --1841 --
NM_012248chr161252 ------
NM_012249chr273405 2973 2896 2556 1241 550 405 ------
NM_012250chr1131242 529 299 ------
NM_012252chr7135141 4986 4881 4824 4705 4409 3380 1218 818 810 295 249 207 21669 1088 ----
NM_012257chr71329 --1764 --
NM_012259chr611179 ----11372
NM_012261chr201672 ------
NM_012262chr1125257 4504 3789 1707 1542 1064 1022 923 464 332 178 61 1320 ----
NM_012266chr911102 ------
NM_012272chr121449 --1438 --
NM_012278chrX1144 ------
NM_012281chr752352 2226 2093 959 904 ------
NM_012286chrX5470 137 129 84 55 ------
NM_012287chr374003 3635 925 806 549 490 430 13257 13514 --
NM_012288chr675713 5527 4875 3867 1990 1129 576 --24507 4502 11677
NM_012289chr19154 ------
NM_012290chr231519 523 82 ------
NM_012291chr122108 46 ------
NM_012297chr452410 2076 2062 1794 869 22023 1738 12180 --
NM_012300chr592269 2049 1842 1005 987 943 681 562 315 12172 ----
NM_012304chr532521 2459 2360 ------
NM_012307chr182894 823 ------
NM_012308chr1142193 2176 2043 605 21697 383 ----
NM_012309chr1154858 4570 3231 1592 1084 13450 13750 14746
NM_012316chr165478 4491 4048 1159 511 210 --14024 --
NM_012319chr181109 --2826 265 --
NM_012322chr7----3453 322 35 --
NM_012327chr1841567 1366 458 188 ------
NM_012328chr751465 1065 940 914 406 ------
NM_012329chr1731580 1268 1071 --1157 --
NM_012330chr1061811 1781 1574 1157 347 180 ----11392
NM_012331chr81550 ------
NM_012333chr141497 1325 662 39 11700 21222 393 --
NM_012338chr741094 1029 910 37 ----1276
NM_012339chr101677 ------
NM_012347chr631966 1129 449 --22138 484 1246
NM_012382chr563039 1635 1389 1233 359 115 34531 4128 57 --21617 609
NM_012384chr2052420 2236 1658 1547 702 --12437 --
NM_012388chr1542931 2047 2017 21 12525 12031 22981 2959
NM_012395chr783412 2892 2606 879 684 523 455 172 12214 22463 2175 --
NM_012399chr2221896 1717 ------
NM_012416chr92176 93 1498 ----
NM_012417chr17153 ------
NM_012420chr1061990 1898 1588 1573 712 63 1921 --2932 457
NM_012426chr161361 --143 --
NM_012428chr1511023 --1973 --
NM_012434chr641307 1300 1197 266 11216 21552 1161 --
NM_012446chr51515 ------
NM_012448chr1741017 991 562 65 --21552 820 --
NM_012464chr472298 2188 2181 2097 1833 339 91 ----11913
NM_012471chrX31493 170 164 11708 124 --
NM_012479chr762573 2463 702 441 402 353 --22424 241 --
NM_012482chr12282 48 ------
NM_013229chr1252116 1959 585 433 195 --22860 2632 12752
NM_013230chrY1563 11659 --11199
NM_013231chr1484286 3995 3936 3784 3679 1194 1062 210 ------
NM_013242chr162351 115 ------
NM_013253chr1151206 902 367 298 175 --1500 --
NM_013254chr121663 ------
NM_013257chr842234 916 340 295 ----1187
NM_013261chr452726 2495 1469 1136 638 --12543 12380
NM_013264chr11--163 ----
NM_013269chr1253994 1202 446 196 172 ----13281
NM_013282chr1961340 1083 1077 402 75 29 ------
NM_013283chr52855 83 ------
NM_013286chr352787 2541 2342 1426 254 ------
NM_013293chr71158 ------
NM_013302chr16144730 4508 4452 4062 3838 3747 3643 3511 3301 1261 1242 1049 933 266 --24549 739 1304
NM_013316chr73822 719 50 ----1101
NM_013322chr721603 283 11616 ----
NM_013330chr1195 ------
NM_013336chr33535 285 106 --11328 --
NM_013341chr232502 373 140 11851 1851 22817 760
NM_013352chr63878 306 219 ------
NM_013354chr851484 1449 479 462 426 1536 ----
NM_013368chr19182 ------
NM_013372chr15113373 2796 2636 2360 2150 1217 1185 580 413 332 184 1321 ----
NM_013373chr2221003 996 ------
NM_013374chr362626 2578 1233 788 623 583 --22737 501 --
NM_013377chr121162 ------
NM_013381chr1232283 2277 155 --22009 192 --
NM_013382chr1422192 434 ----12419
NM_013390chr971753 1684 1656 1569 1557 1284 293 ------
NM_013396chr2121276 968 --11208 --
NM_013423chrX51079 1045 923 475 94 1330 ----
NM_013427chrX51079 1045 923 475 94 1330 ----
NM_013433chr1911842 --21382 575 --
NM_013436chr23755 270 97 ------
NM_013437chr841382 1231 346 255 ------
NM_013438chr921279 467 ----11596
NM_013446chr781137 1070 982 536 481 284 182 82 --21282 528 --
NM_013448chr143631 612 185 --1570 --
NM_013449chr1242608 2481 1115 276 ------
NM_013450chr211104 ------
NM_013958chr81470 ------
NM_013959chr81470 ------
NM_013961chr81470 ------
NM_013962chr81470 ------
NM_013986chr222321 63 ------
NM_013989chr1465126 4768 4758 1968 1139 30 ------
NM_013995chrX132539 2492 2483 2475 2406 2311 2100 1945 1722 1712 564 387 285 ------
NM_013996chr73461 371 175 --1441 --
NM_013996chr73461 371 175 --1441 --
NM_013997chr73461 371 175 --1441 --
NM_013997chr73461 371 175 --1441 --
NM_013998chr73461 371 175 --1441 --
NM_013998chr73461 371 175 --1441 --
NM_014000chr1011700 --11959 1464
NM_014007chr9----1426 --
NM_014010chr9--2436 409 ----
NM_014011chr242366 2292 2265 2224 ------
NM_014021chr163460 3302 3205 2390 463 222 --1491 11170
NM_014023chr1042452 1172 534 127 --12875 --
NM_014028chr633270 2748 2032 ------
NM_014034chr611367 ----1221
NM_014035chr521411 1204 ------
NM_014038chr72151 93 --1162 --
NM_014043chr341670 1619 1457 304 11232 --11549
NM_014048chr1655081 4789 4181 3209 1231 --34816 1871 1553 --
NM_014055chr122171 103 ----1403
NM_014057chr951341 1316 1184 498 271 ------
NM_014071chr20----1426 --
NM_014089chr1352123 1846 1688 305 202 1111 12140 22028 239
NM_014096chr112742 39 ------
NM_014106chr1522125 171 --22897 2114 --
NM_014112chr885437 5400 5355 4745 4588 2066 1603 628 --33581 3566 2055 --
NM_014117chr1642562 2491 1824 530 12624 12002 --
NM_014141chr784282 3819 3473 2061 1989 1143 826 315 --24153 3827 23833 1588
NM_014154chr351497 1073 545 351 114 --11464 2380 222
NM_014155chr11217546 7239 7042 7031 6857 6519 6060 5782 5507 5080 3024 2744 2663 2249 2218 2167 1186 1094 731 296 277 27502 70 --17255
NM_014170chr3191 ------
NM_014171chr24552 254 151 93 ------
NM_014181chr252441 478 472 466 459 11986 21875 485 12028
NM_014183chr202305 224 ------
NM_014189chr421513 1317 ------
NM_014190chr431865 1669 1215 ------
NM_014203chr19165 ------
NM_014211chr541723 1424 393 163 ----11701
NM_014216chr1431292 486 116 21616 1576 ----
NM_014217chr121379 265 ------
NM_014232chr1711591 ------
NM_014232chr1711591 ------
NM_014236chr11224 ------
NM_014243chr44674 561 523 328 --21417 179 --
NM_014245chr331097 1025 682 ------
NM_014248chr221110 --134 --
NM_014250chr2242055 2045 1906 660 --1318 --
NM_014253chrX42129 888 617 43 --2835 596 1732
NM_014255chr12183 ------
NM_014264chr41448 ------
NM_014271chrX3223 185 148 ------
NM_014278chr43143 118 95 1133 ----
NM_014280chr11126 --1290 1945
NM_014283chr141348 1247 239 45 --1607 --
NM_014289chrX21394 333 ------
NM_014290chr91159 ------
NM_014292chr2241949 1907 1858 1343 ------
NM_014294chr861205 461 452 371 254 82 ------
NM_014296chr321152 216 ------
NM_014299chr1922116 379 ------
NM_014305chr131690 ------
NM_014309chr22105437 4730 4532 3777 3719 3688 1734 1709 1138 160 --24654 1699 --
NM_014319chr1231385 616 241 11931 ----
NM_014325chr1261952 1805 1738 914 442 242 11962 32245 2151 1546 --
NM_014331chr487637 7551 6493 6455 2723 689 418 369 --34968 2805 1320 13058
NM_014333chr11112676 2633 2577 2568 2357 2163 962 452 304 167 94 --1695 12268
NM_014335chr153333 122 84 --11061 --
NM_014342chr1131446 943 151 ------
NM_014344chr111185 ----1789
NM_014350chr51161 ------
NM_014353chr163714 687 116 ------
NM_014363chr132346 120 ------
NM_014368chr941436 1325 515 265 --12093 --
NM_014372chr141837 1701 1321 774 151 ----
NM_014382chr331284 638 580 --21701 1140 11246
NM_014388chr1106043 5278 5082 4611 4387 4185 2108 593 586 467 46112 5375 4537 1621 ----
NM_014393chr832115 1633 583 ----1600
NM_014397chr911176 ------
NM_014399chr73743 651 163 1703 ----
NM_014405chr1722346 1933 --12360 1237
NM_014411chr732049 1346 1324 --2482 35 1388
NM_014415chr331477 401 111 ------
NM_014423chr585208 5097 3917 2228 2003 1899 468 140 24978 4615 25185 1883 --
NM_014426chr201721 ------
NM_014429chr33659 635 604 ------
NM_014432chr631245 1193 231 11491 11451 --
NM_014445chr331738 1620 525 ----11757
NM_014447chr421250 1226 ----11501
NM_014455chr11138 ------
NM_014456chr1061823 1743 339 294 187 169 --1104 --
NM_014458chr11233 1241 ----
NM_014469chr112191 106 --1608 1682
NM_014488chr112593 272 ------
NM_014491chr73942 271 187 ------
NM_014494chr166905 897 771 474 410 130 --1722 --
NM_014502chr111396 ------
NM_014504chr722071 297 ------
NM_014515chr121211 ------
NM_014517chr371979 1937 1712 1702 1656 1507 1222 --21991 689 --
NM_014554chr1292163 1969 1721 1656 1510 1476 615 282 270 ------
NM_014570chr223912 829 93 2986 170 1105 --
NM_014572chr1341183 1124 1112 504 --196 --
NM_014573chr1721181 375 11809 31828 1449 344 --
NM_014574chr1441417 1402 1267 262 11393 --11250
NM_014583chr31513 ------
NM_014585chr251073 982 953 895 103 --194 --
NM_014592chr51792 --1244 180
NM_014606chr461570 1429 359 243 237 231 ------
NM_014607chr261664 850 784 551 539 322 ------
NM_014612chr961435 1269 1208 1101 1088 593 ------
NM_014613chr543109 2529 2238 1102 --22534 534 --
NM_014615chr1683540 2585 1013 914 896 825 817 366 --1926 --
NM_014616chr363247 3153 3071 1369 1363 1165 ------
NM_014620chr122719 262 ------
NM_014630chr1523765 3353 --2744 736 23594 3363
NM_014634chr2233355 745 693 13666 21026 560 --
NM_014635chr231377 1175 1147 ----11615
NM_014636chr944389 3703 2839 715 --12753 --
NM_014637chr861506 1482 1352 444 359 168 1263 21290 943 1218
NM_014640chr21291 ------
NM_014647chr1672204 1839 1724 593 347 144 134 --22258 2176 --
NM_014660chr721150 809 ------
NM_014665chr853680 2775 2439 2227 560 ------
NM_014666chr541192 1119 1113 142 1987 31325 980 975 --
NM_014667chr342396 821 621 615 --1154 --
NM_014669chr16----2105 100 --
NM_014670chr21190 --5581 576 571 566 561 --
NM_014671chr751606 1577 1440 1426 602 ------
NM_014674chr393953 3716 3007 2439 1500 1298 1128 1009 994 --22515 999 12523
NM_014675chr12511 491 ------
NM_014676chr151285 1164 426 236 81 ----11312
NM_014677chr831393 246 144 11098 1864 --
NM_014682chr852158 1761 820 773 236 --22136 2088 --
NM_014683chr1762115 2019 1837 1755 818 72 ------
NM_014685chr162451 365 ------
NM_014686chr1932260 2164 2076 11929 11965 --
NM_014690chr742909 2624 2019 446 ------
NM_014701chr1562822 2152 1261 1124 869 708 ------
NM_014705chr711736 --21329 545 --
NM_014706chr122303 256 ----1823
NM_014707chr711513 --32230 1810 511 --
NM_014709chr24566 224 80 68 ------
NM_014711chr1682094 1925 1898 1848 1800 1498 821 807 ------
NM_014712chr162409 212 --1243 --
NM_014713chr21177 ------
NM_014720chr1061640 1385 264 135 122 55 --3719 150 145 21771 1580
NM_014721chr677416 6837 6087 5375 1882 1426 650 ------
NM_014729chr83459 206 48 ------
NM_014730chr12115293 5269 3404 3230 1816 1755 1680 1216 1190 766 64 13372 ----
NM_014730chr12115293 5269 3404 3230 1816 1755 1680 1216 1190 766 64 13372 ----
NM_014733chr551972 1696 1593 735 707 1461 --12075
NM_014735chrX31466 1301 821 --21531 522 --
NM_014738chr171945 ------
NM_014739chr6163915 3666 2727 2721 2715 2709 2703 2697 2691 2673 1056 1031 718 352 136 69 2629 322 12682 --
NM_014741chr111856 ------
NM_014742chr2051269 1174 374 328 202 ------
NM_014743chr4153077 2952 2790 2715 2511 2415 2365 2301 2171 2104 1264 1077 1016 588 419 --11005 12323
NM_014746chr284195 3556 2852 1108 1049 777 632 452 --14275 --
NM_014747chr195352 4394 1799 973 788 608 502 451 413 --14822 --
NM_014751chr842110 1988 1978 1563 --1511 --
NM_014752chr1131914 604 259 1715 1120 --
NM_014755chr294001 3890 3295 1523 1486 1082 1071 709 588 ------
NM_014757chr522369 21 --12218 --
NM_014761chr1641151 899 744 45 ------
NM_014764chr1211106 --11168 11096
NM_014767chr1022423 311 ----11414
NM_014770chr121818 ------
NM_014772chr1853281 2836 2438 952 702 ------
NM_014774chr1103192 3151 3118 2971 2956 2596 2508 2502 2140 2121 1503 ----
NM_014776chr1283130 2908 2226 1196 646 585 153 29 --1603 11227
NM_014779chr361082 1003 940 437 295 66 ------
NM_014781chr821012 214 ------
NM_014782chrX1326 ----1340
NM_014783chr1521812 190 ------
NM_014786chr1121187 1181 --21171 1166 --
NM_014787chr131792 946 104 --12183 --
NM_014791chr91230 ------
NM_014795chr231287 1188 919 --11135 --
NM_014800chr721022 989 ------
NM_014803chr1072965 2668 2637 2041 2007 1184 254 1200 ----
NM_014804chr1741237 964 942 189 --2448 64 1331
NM_014810chr122897 657 --1984 --
NM_014812chr131413 745 729 ------
NM_014819chr532449 1863 1534 ------
NM_014820chr331815 1771 1469 --1341 11489
NM_014822chr41522 191 1578 --
NM_014824chr1151561 1315 789 287 67 1164 ----
NM_014826chr144102 2981 2770 812 1145 11166 --
NM_014827chr141701 1221 336 240 ------
NM_014828chr1472391 2348 2056 917 910 901 63 ------
NM_014829chr552378 2346 2263 2118 206 ------
NM_014830chr1283818 3008 2852 2686 1513 262 239 217 11055 2838 119 12771
NM_014835chr202886 364 21600 393 ----
NM_014836chr1022004 1462 --1563 --
NM_014838chr2262720 2301 2116 304 287 194 --11157 12350
NM_014839chr152455 2283 922 789 259 --165 --
NM_014840chr1253423 2969 2315 2194 191 --13041 --
NM_014841chr63997 964 352 --1950 --
NM_014847chr11479 ------
NM_014848chr1532711 2529 1942 --1655 --
NM_014853chr1711453 ------
NM_014860chr252321 1906 1896 547 101 --123 --
NM_014862chr1564137 3429 1402 1243 1237 480 13593 ----
NM_014864chr154370 3338 3323 3086 106 11590 21676 1669 2609 347
NM_014871chr123635 597 43 ------
NM_014873chr194000 3899 3890 3855 3735 3588 1791 612 216 ------
NM_014874chr121804 1191 ------
NM_014876chr2252186 582 326 242 207 --1179 --
NM_014877chr17207733 7634 7221 6581 6272 6205 5903 5181 5070 2706 2367 2205 1948 1134 757 730 662 120 103 33 ------
NM_014878chr92157 43 --151 --
NM_014883chr452199 2000 1888 952 353 --22065 874 --
NM_014885chr4141 ------
NM_014887chr133710 274 194 ------
NM_014892chr62634 175 ------
NM_014893chrY72211 1921 932 865 681 552 98 ------
NM_014897chr1742630 2167 837 23 1873 32494 2447 931 22772 1017
NM_014899chr573138 2645 2431 2201 1179 813 245 12635 1235 --
NM_014900chr211113 --21039 455 --
NM_014901chr522228 1555 --21921 764 --
NM_014903chr1232309 1565 668 ------
NM_014904chr1053713 3140 2961 1215 539 --22944 902 13812
NM_014905chr21763 11335 1297 --
NM_014906chr1763918 3822 3501 3424 797 165 --12658 --
NM_014912chr1022329 2147 --32737 632 86 32826 380 371
NM_014913chr1841494 596 285 225 ------
NM_014916chr73723 646 596 --1772 --
NM_014917chr12962 841 --1846 --
NM_014918chr1581614 1455 1348 1329 1248 1060 432 269 --61376 1123 582 577 409 366 --
NM_014920chr652331 627 591 279 70 --23261 991 12633
NM_014923chr1341876 1742 359 206 --1795 --
NM_014926chr311028 1405 ----
NM_014932chr3--1146 11806 1216
NM_014946chr262993 2698 2154 1141 613 396 ------
NM_014947chr173003 2985 2782 2641 2277 2243 1956 1663 --12268
NM_014949chr11660 2343 23 ----
NM_014950chr1421757 1148 ------
NM_014951chr1052548 2135 1971 1669 427 ------
NM_014959chr1963209 2595 2333 1337 1280 858 22619 1391 ----
NM_014961chr432201 473 185 --1407 --
NM_014962chr2052473 1779 1004 456 302 ------
NM_014964chr17--22400 711 ----
NM_014969chr1----1950 --
NM_014970chr11117 ------
NM_014974chr1061800 1214 1182 423 414 50 --11636 --
NM_014978chr1021773 1458 11829 ----
NM_014982chr1484715 4349 3944 3494 2041 2033 1654 258 --21978 386 --
NM_014988chr482718 2556 2324 1892 1782 520 167 143 --2351 184 11844
NM_014989chr621950 1353 --5820 480 431 414 113 --
NM_014990chr142944 892 --1854 11171
NM_014991chr462904 2194 1243 1192 1009 563 --22859 2405 --
NM_014994chr1532362 1577 779 ----12274
NM_014996chr341044 1011 664 144 ------
NM_014997chr732828 2312 512 1813 12431 --
NM_014999chr1261696 1690 241 231 220 210 --11451 --
NM_015000chr1272952 2880 2825 2535 2187 1213 415 --23130 1932 12115
NM_015001chr14980 964 763 325 --1985 --
NM_015002chr1222000 615 --12103 --
NM_015008chr373478 3200 2683 2617 2343 920 138 13254 23618 2747 23091 1029
NM_015011chr1341165 724 456 358 11066 ----
NM_015015chr194533 519 473 424 ------
NM_015017chr1----11256 --
NM_015020chr1633777 3236 2710 12424 22495 573 1121
NM_015023chr111858 1483 2123 79 --
NM_015024chr8------11178
NM_015025chr262271 966 602 353 81 51 12094 1230 --
NM_015026chr12104491 3322 3125 2967 1900 1699 1038 891 522 385 11547 ----
NM_015027chr1652018 1861 1755 1346 1314 ------
NM_015032chr1362255 1989 1124 1089 1046 456 22352 1923 11064 11801
NM_015035chr2086310 5877 2427 1839 1748 1611 1365 445 14364 --16322
NM_015039chr153548 2674 1545 877 102 1819 14084 --
NM_015040chr2153183 3098 3092 3086 2202 2172 2092 923 620 601 536 430 327 125 78 11042 1424 --
NM_015042chr1574378 3792 3658 3477 3185 1487 563 ------
NM_015045chr1041994 1500 1403 295 --21884 1879 1430
NM_015046chr932506 2063 87 --12446 --
NM_015049chr262877 2443 2436 865 805 617 1433 23292 2574 --
NM_015050chr631102 503 341 ----1528
NM_015051chr922523 487 --12151 --
NM_015052chr73932 487 206 --2947 942 --
NM_015055chr1122926 2726 ------
NM_015059chr1553308 2804 1085 308 138 ------
NM_015061chr9188 1838 ----
NM_015062chr101106 ------
NM_015068chr753385 1512 1043 1010 609 12630 ----
NM_015071chr586277 6254 5673 4697 4275 4158 1943 1016 --24864 4769 --
NM_015073chr1921962 1899 ------
NM_015074chr194813 4522 4274 1891 1472 933 887 425 244 ------
NM_015075chrX11686 ------
NM_015076chr6104281 3958 3658 3632 1806 1499 1490 1457 1075 380 13494 1491 --
NM_015079chr1543224 2913 1239 1007 1496 ----
NM_015090chr156030 6008 5887 5109 409 --12483 --
NM_015091chr141749 ----1714
NM_015092chr1674680 4267 3877 3728 3363 3356 1163 --23582 1127 24244 3383
NM_015093chr651818 1776 1721 1561 376 --1126 --
NM_015094chr2283351 3113 1225 1021 905 633 614 449 --24456 4423 --
NM_015097chr361545 1489 731 626 441 140 ------
NM_015100chr152031 1961 1597 1461 408 ------
NM_015107chrX62381 2066 2060 764 710 303 --11989 --
NM_015111chr543789 3741 1214 397 ------
NM_015115chr472742 1293 888 780 563 177 45 --11009 --
NM_015120chr21272 ------
NM_015129chrX41794 1750 1742 1736 ------
NM_015130chr451315 1037 442 131 58 ------
NM_015132chr731522 1352 577 --1697 --
NM_015134chr172646 86 ------
NM_015137chr882544 2059 2037 1038 411 314 289 158 --1254 --
NM_015138chr1542798 2650 1055 280 --11026 --
NM_015143chr441319 502 431 235 --1100 1106
NM_015144chr16103987 3940 3923 3864 3271 3031 2679 2496 1214 537 13466 2450 445 --
NM_015153chr61261 --1669 --
NM_015155chr1022068 1129 1640 13250 1795
NM_015156chr1463875 3015 2741 1580 895 463 13035 11560 --
NM_015163chr1451882 1628 805 491 33 ------
NM_015170chr852278 2055 1988 1803 1439 21836 1709 ----
NM_015172chr141270 1181 1156 433 ------
NM_015173chr451345 646 284 195 183 --11709 --
NM_015176chr141715 1511 626 229 11326 --1241
NM_015180chr141739 ------
NM_015184chr31677 ------
NM_015185chrX3717 435 206 --22156 217 --
NM_015186chr92441 120 --149 --
NM_015191chr1122476 177 ----11958
NM_015192chr2062655 2607 2489 2464 337 240 --12223 --
NM_015196chr4------148
NM_015197chr1442388 914 697 568 ----12594
NM_015198chr7193 --31226 491 222 --
NM_015199chr332409 584 261 11034 12749 1804
NM_015200chr452468 1885 954 512 232 --11004 --
NM_015203chr1286 76 ------
NM_015206chr1533334 806 449 23247 1103 13729 23226 3016
NM_015208chr1882913 2665 2567 1539 1320 1102 733 635 --1624 --
NM_015209chr14526 362 356 350 --1914 --
NM_015213chr113710 682 642 --1791 --
NM_015215chr1143159 2470 2255 2113 1950 1938 1134 979 959 585 541 149 64 52 --1186 13131
NM_015216chr531355 94 50 ----1566
NM_015225chr953088 2840 1178 531 46 12623 22388 1922 --
NM_015229chr1721151 178 ------
NM_015233chr1352590 2261 825 769 255 1394 ----
NM_015236chr421028 319 ----157
NM_015238chr51556 ------
NM_015239chr92457 184 ------
NM_015245chr642731 2584 1969 272 ------
NM_015247chr1645225 4863 605 75 1624 31174 1065 617 --
NM_015251chr1631998 1822 214 ----11570
NM_015256chr5------1632
NM_015260chr19----11537 11567
NM_015264chr22104774 4254 4052 3688 3679 1910 1249 1156 523 426 13298 24901 1817 --
NM_015265chr252590 2541 98 92 85 --1141 --
NM_015267chr1222195 1435 --1689 1383
NM_015268chr32638 466 ------
NM_015269chr13449 419 195 ------
NM_015270chr1212007 ------
NM_015271chr474346 4124 4059 4009 844 830 650 --23899 3670 --
NM_015275chr1252011 1587 1578 1369 520 --11661 --
NM_015277chr1831299 43 29 --21241 673 --
NM_015278chr673348 3310 3264 2543 1230 1082 534 ------
NM_015282chr232894 944 405 11014 --1501
NM_015285chr1842594 2328 1800 520 1417 11944 --
NM_015288chr523905 3365 1152 ----
NM_015289chr1521876 481 ------
NM_015291chr193462 3456 3140 2735 1183 1112 872 631 156 11343 33445 3199 538 --
NM_015305chr1411818 ----11914
NM_015308chr112826 177 --2760 42 --
NM_015310chr898302 8275 7915 6439 6344 5872 5248 2020 313 ------
NM_015313chr1184242 4169 3897 3794 3366 3118 1757 786 34519 3493 3210 1398 --
NM_015314chr782305 1669 1034 861 650 560 450 108 --22478 1039 --
NM_015315chr593052 2900 2466 2460 2454 2448 2237 959 722 --22907 885 --
NM_015317chr232864 2555 2278 --1836 --
NM_015320chr22751 728 ------
NM_015323chr661563 1397 1307 660 482 297 --11642 --
NM_015326chr171920 1116 1025 737 513 115 22 --32145 630 401 --
NM_015330chr2262589 2175 1878 1802 1697 362 --32015 849 813 --
NM_015331chr11610 ------
NM_015335chr1241892 840 810 349 12423 1619 --
NM_015336chr1262543 1964 1762 708 440 273 11894 1585 --
NM_015339chr202776 175 ----1721
NM_015344chr841970 1600 872 276 --21940 628 --
NM_015346chr1441877 1494 589 399 ------
NM_015347chr1242762 2508 712 505 --12220 --
NM_015349chr64962 921 464 162 --42943 742 509 299 --
NM_015350chr12525 511 ------
NM_015354chr92369 345 ------
NM_015355chr1771972 745 704 525 348 81 75 --1777 --
NM_015358chr2151217 1103 888 300 78 --1973 2236 179
NM_015359chr872940 2851 2831 2577 2167 1910 1883 1335 ----
NM_015361chr23826 627 278 ------
NM_015365chrX124054 3921 3746 3737 3098 2820 610 481 350 339 309 198 14282 ----
NM_015367chr2221648 1617 ----1288
NM_015375chr174731 4720 3828 1502 1311 1115 444 --24585 270 --
NM_015379chr71258 --199 --
NM_015381chr2232021 1342 789 11429 ----
NM_015385chr1052108 2082 1155 871 715 --12048 --
NM_015387chr282094 2078 1741 1391 623 481 440 383 ------
NM_015393chr463183 2934 672 135 129 37 --2333 113 --
NM_015396chr3----3214 209 120 --
NM_015397chr961906 1641 1493 594 191 101 --21843 180 --
NM_015409chr1242656 2516 1837 1108 ----2598 307
NM_015416chr122950 915 ------
NM_015423chr1131620 1389 1379 --2659 421 --
NM_015435chr811235 --1245 --
NM_015439chr62509 438 ------
NM_015442chr31184 ------
NM_015443chr1731432 189 158 --1171 --
NM_015446chr131619 1554 482 ------
NM_015454chr4299 51 ----1253
NM_015455chr5103348 3221 2754 2747 2618 2545 1277 957 715 634 --13646 --
NM_015458chr8155234 4867 3824 3709 3684 3503 3232 1815 1719 1680 1112 942 930 534 434 1764 13628 --
NM_015460chr321703 1431 1661 11617 --
NM_015461chr183756 484 58 ------
NM_015464chr72265 89 ----1728
NM_015472chr3--1161 ----
NM_015472chr3--1161 ----
NM_015475chr23974 803 338 1354 1434 --
NM_015477chr152783 230 --1690 --
NM_015483chr71911 --11122 1401
NM_015496chr8----1263 --
NM_015497chr1521129 1088 --31006 820 775 --
NM_015503chr161693 ------
NM_015508chr3--163 ----
NM_015509chr1251553 1198 1136 1085 254 ------
NM_015511chr2031146 1086 853 ------
NM_015517chr111528 ------
NM_015520chr332535 2419 1013 --12100 --
NM_015535chr243963 2833 436 36 13872 ----
NM_015541chr341256 1057 887 368 1941 ----
NM_015542chr102958 935 --1942 --
NM_015548chr61368 --1900 --
NM_015550chr773537 3009 2431 1179 1086 993 977 --21105 959 --
NM_015554chr1552429 2423 2372 1078 830 11940 --1704
NM_015555chr651669 1236 552 121 70 --1156 --
NM_015564chr533446 2847 788 ------
NM_015569chr154429 3957 3073 1907 1270 --34573 952 637 --
NM_015570chr781813 1716 1623 1488 1278 742 729 214 --1164 --
NM_015571chr652520 1751 1638 908 427 ------
NM_015575chr293568 3442 3313 3307 2579 1026 670 634 380 12399 22412 846 --
NM_015576chr342665 1808 196 30 --1876 136
NM_015577chr531195 545 84 ----11131
NM_015578chr1961799 1358 1292 807 141 130 --11497 1390
NM_015589chr14--1136 ----
NM_015601chr1021016 55 ------
NM_015602chr151690 1461 1423 675 528 138 --1264
NM_015609chr132995 2799 2005 ------
NM_015630chr231145 1042 341 ------
NM_015635chr911493 --196 --
NM_015640chr1135387 5349 5291 4807 4379 1874 1637 1447 1031 366 235 202 149 14957 31694 1668 928 --
NM_015642chr32125 119 --196 --
NM_015646chr1231309 1048 940 --11298 --
NM_015678chr1321667 171 --1243 --
NM_015686chrX----12478 --
NM_015687chr6------1170
NM_015691chrX62888 2709 1921 417 279 41 12136 22014 2009 --
NM_015693chr41298 ------
NM_015695chr662170 1635 1557 1399 1376 809 1159 ----
NM_015713chr893505 3481 3332 3319 3012 2639 2450 1028 275 ------
NM_015718chr6132 ------
NM_015850chr872028 1852 1676 1629 850 830 792 --1371 --
NM_015866chr171406 951 944 540 438 375 314 --11144 --
NM_015872chr11399 ------
NM_015878chr852216 2201 1915 681 571 22060 620 --1647
NM_015879chr18128644 8623 7241 6934 5810 2981 2546 2267 1705 1422 937 615 --38225 2212 395 --
NM_015881chr1151206 902 367 298 175 --1500 --
NM_015885chr112210 23 1839 ----
NM_015886chr865750 5429 4546 4173 1601 113 24566 3945 --14993
NM_015888chr142439 2250 406 312 ------
NM_015891chr642008 1644 1445 178 ------
NM_015902chr81820 ----1310
NM_015904chr24829 813 268 146 ------
NM_015906chr184675 3107 1752 1452 1030 537 460 262 --14827 14330
NM_015907chr41275 ------
NM_015912chr842512 2506 538 248 --1158 --
NM_015920chr152585 112 1168 ----
NM_015939chr203642 83 31 1552 ----
NM_015955chr21367 ------
NM_015960chr102268 117 ------
NM_015975chrX71702 1610 1493 1236 256 171 87 148 21309 711 --
NM_015976chr12349 256 --1105 --
NM_015981chr563187 3173 3049 2914 941 739 ------
NM_015984chr1------1439
NM_015995chr1545538 5311 4752 2233 --23801 1833 11648
NM_016009chr194559 3872 3785 1783 1286 1070 813 288 207 --14785 21642 562
NM_016013chr15123 ------
NM_016019chr741069 735 691 157 1216 ----
NM_016021chr642858 2593 340 254 ----12662
NM_016022chr11135 ------
NM_016023chr882169 2070 1890 842 320 141 76 28 --21555 295 --
NM_016025chr1672000 1690 1593 1476 473 358 178 1802 11861 --
NM_016032chrX21330 111 ------
NM_016037chr14736 728 407 182 1431 ----
NM_016040chr132517 698 340 ------
NM_016045chr2031189 739 629 ----21609 520
NM_016048chr52972 702 1964 2828 273 --
NM_016057chr123518 369 198 ------
NM_016059chr61339 ------
NM_016061chr221021 331 --11337 --
NM_016072chr1272316 1909 1689 935 670 280 106 ------
NM_016073chr1521067 816 ------
NM_016075chr1382474 2259 2145 2103 1141 782 572 320 ------
NM_016076chr152927 1132 687 250 210 --1490 --
NM_016079chr262330 2270 786 163 142 110 ------
NM_016087chr721514 1414 ------
NM_016090chr114994 898 754 24 ------
NM_016101chr1621104 329 ----1260
NM_016103chr51114 ------
NM_016107chr541084 509 395 57 ------
NM_016115chr22519 132 ------
NM_016120chrX11163 ------
NM_016121chr12897 802 1877 ----
NM_016125chr171173 ------
NM_016129chr41382 ------
NM_016131chr252294 2095 1522 697 143 --1554 --
NM_016132chr15123375 3367 3361 3332 2337 2247 1326 929 366 297 267 237 1989 32750 2693 38 --
NM_016133chr211440 ----2652 577
NM_016138chr164326 282 179 134 11424 ----
NM_016141chr3131 ------
NM_016144chr54622 270 202 81 ------
NM_016147chr1131144 790 178 ------
NM_016151chr162334 310 ------
NM_016162chr121636 ------
NM_016166chr15179 ------
NM_016169chr1041280 1092 832 574 --12140 --
NM_016185chr174728 253 204 29 ------
NM_016192chr21198 ------
NM_016195chr102748 122 ----1553
NM_016201chr352260 2200 2085 1424 454 --11750 --
NM_016203chr741015 895 204 61 --11027 --
NM_016206chr3148681 8411 8068 7744 6712 6238 5932 5560 3032 2352 1040 986 657 488 1709 88103 7398 7393 7388 7383 7370 7365 599 28309 7404
NM_016213chr15139 ------
NM_016216chr32724 22 --135 --
NM_016217chr663394 3381 3272 3070 2898 2726 1191 33314 1050 482 12235
NM_016221chr51658 --32355 867 840 --
NM_016224chr631608 1468 780 ----12158
NM_016227chr141348 1247 239 45 --1607 --
NM_016231chr1731532 666 233 --1316 --
NM_016239chr17--1757 ----
NM_016248chr13123960 3897 3622 3278 2754 2644 2455 1606 1065 1040 774 492 12619 --11501
NM_016255chr653045 2927 2874 925 799 11343 1390 --
NM_016258chr12310 289 --1603 --
NM_016260chr2137340 6990 6702 5674 5475 5464 2668 2494 2146 1560 697 592 475 1710 37364 6820 1090 --
NM_016269chr421023 868 --11007 --
NM_016270chr191487 ------
NM_016271chr1851993 1984 1752 1541 1457 --11642 --
NM_016272chr2232667 2525 1077 ------
NM_016275chr342216 824 413 276 ------
NM_016277chr661634 1546 1534 1514 644 279 ------
NM_016287chr131734 701 292 179 --1734
NM_016289chr222069 141 1255 ----
NM_016299chr101112 ------
NM_016300chr31520 ------
NM_016306chr33361 86 80 ------
NM_016308chr151929 1894 1389 562 156 11736 --11971
NM_016315chr231419 668 102 --1426 --
NM_016322chr973118 2826 2354 2301 1998 1254 976 --43238 1280 488 483 13124
NM_016329chr33486 387 349 ------
NM_016338chr541213 1113 1039 356 ------
NM_016351chr71431 --1573 --
NM_016352chr751401 574 551 221 190 --11391 --
NM_016374chr171337 1293 1261 1248 1240 1075 446 --11119 --
NM_016374chr171337 1293 1261 1248 1240 1075 446 --11119 --
NM_016376chr1752943 2791 1511 1114 478 ------
NM_016377chr621801 1398 --11441 --
NM_016396chr1552931 2829 2816 2280 452 --12510 --
NM_016401chr11----1244 148
NM_016410chr91464 ------
NM_016417chr142534 441 ------
NM_016418chr2253833 2447 2343 1530 295 --11505 --
NM_016422chr1163108 2816 2378 749 623 203 --3717 588 323 --
NM_016424chr173798 472 366 --2554 204 --
NM_016426chr2221733 379 --1576 --
NM_016436chr2032479 1964 1674 --1972 --
NM_016441chr252361 2355 2138 1940 209 --31785 1780 872 --
NM_016463chr51139 ------
NM_016467chr22543 500 --11317 1149
NM_016472chr1451173 1134 609 106 100 --1959 --
NM_016475chr143479 403 272 --2898 144 --
NM_016476chr17----1129 --
NM_016480chr51785 ------
NM_016485chr642210 1474 874 105 ----12129
NM_016488chr1231868 1830 782 --2744 739 --
NM_016506chr113532 217 90 --1151 --
NM_016507chr1772657 2266 2129 2087 967 389 293 33019 2783 2460 2996 443 11016
NM_016513chr652331 627 591 279 70 --23261 991 12633
NM_016530chr1554074 1125 1100 622 251 13190 33002 1520 1258 13008
NM_016531chr443337 2667 694 171 ------
NM_016542chrX21748 253 31759 1220 1171 ----
NM_016545chr11807 ------
NM_016559chr341502 1264 1089 308 --11302 --
NM_016562chrX21044 64 21342 1175 11111 194
NM_016569chr1251158 1045 1039 1033 601 ----11403
NM_016586chr141465 1175 ----
NM_016587chr75971 733 441 373 334 ----1126
NM_016588chr62744 178 ------
NM_016592chr20131 ------
NM_016598chr311314 ------
NM_016603chr551893 1843 488 481 91 --1258 --
NM_016604chr521305 1039 ------
NM_016605chr542710 2660 2254 672 ----12366
NM_016607chrX21672 1341 21382 100 21650 1565 1194
NM_016613chr452607 2404 2308 906 53 3381 298 186 12224 1390
NM_016614chr63695 139 24 ------
NM_016620chr14549 326 220 201 --21063 423 --
NM_016621chr1174539 4519 1205 1086 1000 994 344 13470 12903 14562
NM_016622chr221619 1532 --12100 11729
NM_016626chr181465 1448 ----
NM_016628chr101561 128 1234 --
NM_016630chr15142 ----1539
NM_016631chr215926 708 372 199 103 ------
NM_016641chr1611449 11709 ----
NM_016648chr4299 51 ----1253
NM_016651chr1481134 1079 937 761 262 246 77 34 1305 21007 196 --
NM_016652chr2051449 1279 629 531 208 --126 --
NM_016654chr1541398 1248 926 288 ------
NM_016655chr15------149
NM_016656chrX1370 ------
NM_016823chr172948 369 ------
NM_016824chr1031652 1591 601 --11495 --
NM_016834chr1734097 3791 931 1943 ----
NM_016835chr1734097 3791 931 1943 ----
NM_016841chr1734097 3791 931 1943 ----
NM_016929chr634542 4189 3399 ------
NM_016931chr111360 ------
NM_016937chrX3978 953 626 ------
NM_016950chr421297 563 1252 ----
NM_016952chr11143921 3693 3374 3195 3166 3147 3092 3079 3024 1330 1323 450 283 191 1644 21349 237 13645
NM_016953chr2146136 6100 5957 5851 5664 5558 1929 1912 1557 1535 1274 875 370 80 --1281 --
NM_017410chr1221260 1139 ------
NM_017412chr81489 ------
NM_017420chr14113806 3797 2625 2456 2418 2409 966 931 736 396 105 11320 --13323
NM_017423chr442214 1537 283 245 ------
NM_017426chr42636 520 --1510 --
NM_017437chr14142303 2015 1999 1977 1939 1772 1667 867 794 728 625 536 515 273 --31988 86 81 --
NM_017447chr21154058 3839 3590 3158 3135 3029 3023 1560 1289 1155 1093 706 624 562 480 11687 43168 3163 2785 922 --
NM_017455chr1511023 --1973 --
NM_017456chr1731984 1970 1894 --1296 --
NM_017489chr8--11192 ----
NM_017491chr42917 849 ------
NM_017495chr2021474 1222 ----11452
NM_017519chr65489 306 284 70 63 ------
NM_017545chr201560 ------
NM_017548chr331453 1367 232 1487 2811 800 --
NM_017551chr1062263 2085 1724 755 730 252 --1552 --
NM_017554chr342091 1955 1929 1718 ------
NM_017563chr3146368 5673 5489 5410 5091 4813 4757 2319 2244 2158 2018 1527 488 143 22039 992 36405 5461 4308 --
NM_017569chr131116 --1393 --
NM_017572chr19183 --1238 --
NM_017580chr1072354 1793 655 649 600 485 131 ----22346 638
NM_017593chr41325 --1418 --
NM_017596chr144671 4284 1638 537 --24582 4309 --
NM_017599chr1241854 1687 820 233 1477 ----
NM_017610chr1522075 350 1530 --1704
NM_017611chr112742 39 ------
NM_017617chr951504 1264 637 209 109 1263 11047 --
NM_017628chr4115072 4841 4631 3551 3348 1651 1638 1627 1621 1356 191 --14850 --
NM_017629chr111792 ------
NM_017632chr42353 114 ------
NM_017633chr663358 3301 3027 1278 1155 1147 --33763 552 110 --
NM_017634chr821925 44 11343 --1144
NM_017635chr1121272 489 ------
NM_017637chr9179274 9077 8821 8399 8351 8164 7881 7485 3658 3608 2513 2503 2429 2312 2028 715 222 2488 348 89263 9258 9253 3052 1818 1676 1671 1565 23784 3318
NM_017640chr61758 ------
NM_017643chr1762616 2462 2206 1165 659 620 --32474 2469 902 --
NM_017644chr395081 4686 4443 4326 4075 3976 1668 1499 624 --35122 3366 841 --
NM_017645chr963181 3166 2731 2657 2542 106 --22553 817 11998
NM_017649chr1021090 365 --1399 --
NM_017650chr7105985 5870 5564 5166 2214 1836 1808 1701 1683 1345 21314 711 2300 253 --
NM_017655chr151533 1407 1297 317 79 11543 ----
NM_017658chr1494491 3758 3263 1750 1642 1443 479 166 136 24389 3330 14644 11005
NM_017666chrX51665 882 517 411 252 22195 70 21779 329 --
NM_017667chr74496 489 160 117 ------
NM_017672chr1541336 526 373 28 ----1291
NM_017684chr1581814 1799 1560 1541 1258 506 394 368 --21808 1296 --
NM_017694chr231458 1295 708 11783 11812 1785
NM_017700chr4198 ------
NM_017709chr1124151 4045 4017 3910 2817 1623 1056 1050 1021 973 898 371 --23213 1470 11461
NM_017714chr203859 96 82 ------
NM_017719chr331846 1618 648 --22112 311 --
NM_017724chr33327 230 103 ----197
NM_017737chr172195 1962 1941 637 508 362 173 --1526 11475
NM_017739chr11115 ------
NM_017742chr18--21758 377 ----
NM_017745chrX2255 163 ------
NM_017752chrX1507 --1866 --
NM_017753chr93992 755 27 --2289 128 --
NM_017754chr655035 3720 1109 984 164 ------
NM_017757chr1851173 1156 1101 357 340 --11163 --
NM_017758chr1781198 488 397 147 116 109 102 74 --1351 166
NM_017762chr15----21766 492 1551
NM_017768chr13725 263 75 --1273 --
NM_017769chr1493272 2518 2495 2429 2289 2158 2121 540 324 13118 ----
NM_017770chr672887 2518 2101 419 360 85 52 ------
NM_017772chr641423 1237 1196 224 ------
NM_017778chr83301 287 93 --21111 601 --
NM_017779chr151821 566 531 328 225 22092 364 ----
NM_017780chr81846 --1103 --
NM_017784chr33372 77 40 ------
NM_017786chr84710 638 563 103 ------
NM_017787chr1061992 719 678 314 230 126 12435 --12876
NM_017791chr1441648 1251 493 97 ------
NM_017799chr1431504 686 555 ------
NM_017801chr372216 1848 1805 979 959 401 263 --32506 730 454 22083 436
NM_017811chr972646 2554 1009 999 946 699 332 --13025 --
NM_017812chr71525 1161 ----
NM_017813chr8155717 5706 5512 5161 5064 4803 4406 4075 3986 1888 1819 1656 1569 967 836 14362 25654 664 --
NM_017822chr123774 682 107 --1650 --
NM_017824chr1092697 2503 1714 1068 557 375 334 263 192 --121 160
NM_017826chr133770 750 684 ------
NM_017831chr1854798 4249 2947 451 185 12971 1375 14203
NM_017845chr4--1588 1249 --
NM_017848chrX84377 4268 4258 4248 3910 576 459 203 --24636 4611 --
NM_017851chr152892 853 --159 1437
NM_017866chr83865 248 202 ------
NM_017896chr2083526 3324 3306 3281 690 601 543 448 12990 ----
NM_017907chr11----1494 --
NM_017913chr9----3183 178 140 1189
NM_017915chr121989 --1883 --
NM_017919chr975692 5592 5178 4374 4352 4266 3748 1985 ----
NM_017921chr1731876 1619 407 11932 ----
NM_017925chr931960 1564 1383 ------
NM_017933chr211341 ------
NM_017938chrX31547 717 488 11622 ----
NM_017944chr1142095 2088 565 36 22453 979 --21095 173
NM_017952chr264570 3523 3432 2896 1655 1077 --13870 --
NM_017983chr17150 ------
NM_017987chr1041999 740 303 179 1382 ----
NM_017990chr1643330 1701 1319 429 11162 2860 506 --
NM_017994chr752225 590 583 575 322 12773 21003 565 --
NM_017998chr951147 1000 509 385 248 --11007 1138
NM_018003chr1541923 1870 122 30 --12389 11961
NM_018004chr33298 62 54 ------
NM_018011chr135588 127 92 86 80 ------
NM_018015chrX4999 435 144 89 11153 ----
NM_018017chr1072822 2564 2351 1900 1847 615 205 --32604 2290 115 --
NM_018018chr1241261 748 235 170 ------
NM_018030chr183943 397 58 ------
NM_018032chr162342 316 --3880 361 305 --
NM_018040chr14401 79 54 23 ----1622
NM_018043chr1131389 180 166 ------
NM_018046chr551560 1506 1463 572 341 1705 ----
NM_018047chr52931 924 ------
NM_018053chr11850 ------
NM_018060chr11332 ------
NM_018061chr161621 1100 281 242 221 179 --1357 --
NM_018067chr11134 ------
NM_018078chr43975 963 209 ----1846
NM_018084chr253248 2835 739 373 314 --1517 --
NM_018086chr261650 1501 1415 609 328 234 --1528 --
NM_018092chr1661637 1551 1147 518 433 146 ------
NM_018094chrX----1141 --
NM_018095chr113532 217 90 --1151 --
NM_018098chr321127 1100 ------
NM_018105chr821092 379 ----11140
NM_018110chr1631092 1082 354 ------
NM_018115chr44637 631 622 150 ----1645
NM_018117chr105713 704 557 500 128 ------
NM_018120chr831413 1178 230 ------
NM_018121chr1053057 1219 1191 1075 593 --1725 1695
NM_018122chr13290 83 40 ------
NM_018125chr11148 --1174 --
NM_018131chr102937 638 1354 2582 344 --
NM_018133chr382127 1860 1815 1643 1520 698 121 68 --21650 1469 11371
NM_018142chr8----1235 --
NM_018144chr101307 ------
NM_018147chr33257 211 102 ------
NM_018149chr174219 90 68 47 ------
NM_018151chr22792 721 169 ----
NM_018155chr362493 1075 972 515 289 132 --1575 --
NM_018157chr1243152 2263 2220 165 ------
NM_018159chrX31501 1465 639 --1603 --
NM_018164chr122255 240 ------
NM_018169chr121446 --1364 --
NM_018177chr42141 95 ------
NM_018178chr161707 1276 411 391 86 70 ------
NM_018179chr12156 1244 ----
NM_018181chr1841254 1243 747 429 --41724 1297 1248 280 --
NM_018182chr1721607 1408 --1557 --
NM_018184chr321649 754 --1719 --
NM_018191chr1361963 1675 1429 778 113 22 ------
NM_018192chr32821 187 --21043 178 --
NM_018195chr1161898 1891 1854 1803 1362 65 ----1130
NM_018200chr1592583 2552 2374 1979 1900 1641 1598 743 40 1525 ----
NM_018202chr11336 --2880 358 --
NM_018206chr161134 ------
NM_018214chr621197 274 ------
NM_018221chr21351 ------
NM_018227chr4103215 3162 2919 2661 2492 1087 1061 956 947 256 ------
NM_018237chr101237 ------
NM_018241chr41157 ------
NM_018243chr453837 3262 1360 146 74 ----1260
NM_018246chr852382 2172 1085 285 237 1478 --181
NM_018247chr693077 2957 2687 2009 1974 1117 924 862 724 --11080 1947
NM_018254chr132284 185 121 --1298 11509
NM_018257chr2052475 2106 1899 1803 232 ------
NM_018265chr122093 222 11516 --11930
NM_018266chr321121 972 ----1119
NM_018270chr202681 262 --1739 --
NM_018287chr1011254 ------
NM_018290chr441281 845 339 115 ------
NM_018293chr352409 2142 1189 1074 436 ----12365
NM_018299chr853380 2885 1249 1143 338 --11254 23096 634
NM_018302chr432243 1836 785 --11644 1141
NM_018307chr173853 734 69 ------
NM_018312chr1181795 1351 821 811 585 552 510 237 --32000 778 698 --
NM_018313chr362547 2444 2310 2131 359 349 --12433 --
NM_018315chr461614 1451 1216 517 372 105 --11090 --
NM_018318chr122907 89 ------
NM_018319chr1431276 1246 566 1482 21589 217 --
NM_018323chr441675 1552 1242 47 ------
NM_018325chr971515 1423 1142 1101 1030 667 306 --1651 --
NM_018327chr2041751 1357 292 150 11624 ----
NM_018330chr1071612 1550 1374 1339 1099 1073 413 --1639 --
NM_018332chr1611347 ------
NM_018334chr7----1526 --
NM_018339chr941841 1485 653 34 --11630 --
NM_018347chr20--1978 ----
NM_018351chr1243254 691 333 174 1853 23161 139 14456
NM_018360chrX176 ----1339
NM_018362chr1183476 3171 3165 3158 2678 2671 2651 234 ------
NM_018364chr173956 3798 3570 3430 2932 371 237 --23501 778 --
NM_018369chr51590 ----148
NM_018370chr1232066 325 212 2638 79 ----
NM_018371chr81348 1275 1309 --
NM_018374chr7145106 4548 4522 1781 1606 1379 1238 1200 1014 680 649 552 444 377 --1974 --
NM_018376chr93777 714 268 ------
NM_018388chrX21427 381 --1516 --
NM_018394chr31348 --11604 --
NM_018403chr3134065 3848 3833 3720 3677 3564 3490 3156 1490 849 605 273 142 2786 448 --1209
NM_018412chr71154 ------
NM_018416chr1252619 771 436 207 122 ----1762
NM_018426chr63602 592 572 ------
NM_018429chr522879 2259 ------
NM_018433chr2----1369 --
NM_018438chr13495 169 153 ------
NM_018439chr1812188 --12611 --
NM_018440chr8208700 8524 8432 8360 8125 7895 7342 7018 6764 6472 5389 3175 3143 3055 2478 1903 1825 1081 525 143 ----28438 2741
NM_018442chr11395 ----134
NM_018444chr841652 1638 1632 551 ----11742
NM_018448chr124790 442 226 162 ------
NM_018461chr101577 ------
NM_018462chr31120 ------
NM_018466chrX1680 ------
NM_018477chr1421062 772 --184 --
NM_018482chr862129 1927 1615 1035 428 266 --12361 --
NM_018486chrX1492 ------
NM_018489chr172129 2034 1994 1741 767 694 184 ----12279
NM_018490chr1141273 655 603 527 --1708 11882
NM_018534chr21588 ------
NM_018553chr1741643 1276 330 208 --11229 --
NM_018557chr231469 1336 131 --184 --
NM_018566chr1114965 4957 4442 3970 3466 3146 1934 1928 1580 1479 823 --14977 13661
NM_018584chr11477 --11063 1406
NM_018590chr1071655 1614 1485 1140 1107 600 116 --1191 2287 258
NM_018602chr151199 --21045 584 --
NM_018638chr12125372 4304 3911 3620 1830 1718 1224 1040 1022 853 747 325 11327 35447 5304 4518 --
NM_018640chr1252828 2183 1820 1749 616 --1806 --
NM_018641chr71142 ------
NM_018644chr1152195 2064 1935 202 39 ------
NM_018649chr105541 454 232 218 58 1510 ----
NM_018650chr171983 1833 1788 1578 749 486 353 --11535 --
NM_018657chr33758 713 164 1806 ----
NM_018682chr72465 228 --134 --
NM_018683chr201548 1573 11699 11086
NM_018695chr562019 884 717 624 425 269 ------
NM_018697chr782404 2385 2278 2093 867 608 531 268 ------
NM_018700chr551355 1323 1196 463 208 --4606 601 176 95 --
NM_018704chr13844 525 380 ----1546
NM_018710chr821163 227 11134 1182 --
NM_018712chr1121192 129 ----11146
NM_018718chr772193 2180 1896 1883 1493 420 33 --2359 311 1574
NM_018834chr54388 206 116 51 ------
NM_018840chr202471 152 ------
NM_018841chr143666 2953 860 114 --13953 --
NM_018846chr73933 694 84 --197 --
NM_018847chr941936 1714 682 192 ------
NM_018890chr741450 1325 196 188 --31490 1354 937 --
NM_018898chr541581 714 225 168 1374 11739 --
NM_018899chr541581 714 225 168 1374 11739 --
NM_018900chr541581 714 225 168 1374 11739 --
NM_018901chr541581 714 225 168 1374 11739 --
NM_018902chr541581 714 225 168 1374 11739 --
NM_018903chr541581 714 225 168 1374 11739 --
NM_018904chr541581 714 225 168 1374 11739 --
NM_018905chr541581 714 225 168 1374 11739 --
NM_018906chr541581 714 225 168 1374 11739 --
NM_018907chr541581 714 225 168 1374 11739 --
NM_018908chr541581 714 225 168 1374 11739 --
NM_018909chr541581 714 225 168 1374 11739 --
NM_018910chr541581 714 225 168 1374 11739 --
NM_018911chr541581 714 225 168 1374 11739 --
NM_018912chr51569 1447 21618 675 --
NM_018913chr51569 1447 21618 675 --
NM_018914chr51569 1447 21618 675 --
NM_018915chr51569 1447 21618 675 --
NM_018916chr51569 1447 21618 675 --
NM_018917chr51569 1447 21618 675 --
NM_018918chr51569 1447 21618 675 --
NM_018919chr51569 1447 21618 675 --
NM_018920chr51569 1447 21618 675 --
NM_018921chr51569 1447 21618 675 --
NM_018922chr51569 1447 21618 675 --
NM_018923chr51569 1447 21618 675 --
NM_018924chr51569 1447 21618 675 --
NM_018925chr51569 1447 21618 675 --
NM_018926chr51569 1447 21618 675 --
NM_018927chr51569 1447 21618 675 --
NM_018928chr51569 1447 21618 675 --
NM_018929chr51569 1447 21618 675 --
NM_018945chr653657 3564 3117 1235 1058 12485 23475 616 --
NM_018947chr773816 1947 1772 1482 1382 1139 487 --1418 --
NM_018951chr761269 1146 945 903 800 211 ----1164
NM_018957chr221319 ------
NM_018959chr191562 ------
NM_018964chr2141055 1003 992 880 ------
NM_018968chr2188 ------
NM_018970chr752815 2415 1959 1035 551 --1449 12145
NM_018976chr1222889 84 --31132 165 160 --
NM_018977chrX2967 874 ------
NM_018979chr1222456 137 1669 ----
NM_018982chr1122 ------
NM_018993chr201472 ------
NM_018994chr11491 ------
NM_018999chr10104836 4705 4524 4445 1914 1900 1893 1558 1405 1194 --11206 --
NM_019000chr561615 1421 1300 1142 272 124 ------
NM_019001chr3124713 4368 4233 3740 3563 3451 3356 1837 1648 1348 599 521 ------
NM_019004chr722123 915 21632 1552 11506 --
NM_019005chr71266 1144 ----
NM_019006chr152460 137 --1131 1143
NM_019018chr51641 ------
NM_019022chr1853216 2836 2594 2193 1106 --12877 --
NM_019024chr2190 --1439 --
NM_019027chr442495 916 909 299 --11760 --
NM_019028chr11137 --1423 --
NM_019035chr432012 357 271 ------
NM_019042chr72931 314 ------
NM_019044chr264570 1007 657 498 250 133 33967 1622 81 34070 3457 1266 13268
NM_019045chrX1239 --3817 812 224 --
NM_019049chr11629 --1508 --
NM_019050chr431975 1664 572 ------
NM_019063chr252203 680 527 349 128 --11804 --
NM_019074chr152903 314 ------
NM_019080chr1331566 1305 610 11332 21571 205 --
NM_019084chr1062350 1800 901 830 477 65 --12355 --
NM_019087chr541726 620 458 270 ------
NM_019091chr261124 1086 1074 1045 733 721 ------
NM_019094chr1263323 3141 1245 469 371 138 ------
NM_019114chr942149 2028 961 809 ------
NM_019116chr16103652 3581 3155 2786 2383 1239 581 448 354 90 --13641 --
NM_019555chr321792 319 ----11777
NM_019556chrX1487 ------
NM_019557chr11597 ------
NM_019590chr1061238 1070 569 263 169 70 --1347 --
NM_019591chr123767 412 354 ------
NM_019592chr92887 286 1627 ----
NM_019593chr2053179 3029 3008 2280 632 --2956 46 --
NM_019594chr921533 663 --11033 --
NM_019595chr22675 137 ------
NM_019597chrX1203 ------
NM_019604chr1131112 1078 1050 ------
NM_019605chr1186 ------
NM_019610chr172114 1700 1613 1532 475 453 155 --12185 --
NM_019857chrX21403 117 --1295 1652
NM_019860chr1041642 1106 1098 258 ------
NM_019862chr1661703 1511 1194 654 509 321 ------
NM_019885chr252855 2778 2070 846 310 --32821 2548 598 22827 323
NM_019895chr33901 465 81 ------
NM_019898chr1661703 1511 1194 654 509 321 ------
NM_019899chr1661703 1511 1194 654 509 321 ------
NM_019900chr1661703 1511 1194 654 509 321 ------
NM_019903chr1031652 1591 601 --11495 --
NM_020066chr13750 639 132 --1850 --
NM_020069chr11------125
NM_020116chr421409 144 --11274 11384
NM_020122chr296035 4303 4174 1951 1646 1635 1504 898 827 14412 11176 --
NM_020123chr1021582 1136 --11286 --
NM_020127chr131537 1235 480 ------
NM_020132chr2154474 1603 1390 933 688 11473 11785 --
NM_020135chr61318 --1409 --
NM_020141chr121920 623 --1319 --
NM_020144chr742065 1962 821 176 1854 --12105
NM_020152chr214902 837 254 218 --3819 814 726 --
NM_020156chr71238 ----1191
NM_020159chr441602 1191 637 420 1218 11239 --
NM_020177chr541155 714 612 271 12410 12232 12736
NM_020178chr1721143 839 --1916 --
NM_020182chr2053297 3101 3083 956 490 ------
NM_020184chr222256 244 ------
NM_020193chr1131015 433 294 11132 11064 --
NM_020194chr23606 268 210 --1249 --
NM_020198chr1731459 577 478 126 --11244
NM_020204chr12859 690 ------
NM_020205chr153327 2977 2696 2648 1376 12583 12952 --
NM_020226chr4--1268 ----
NM_020228chr1172368 2277 1871 931 464 126 46 --1880 22356 682
NM_020234chr15168 ------
NM_020239chr182193 1826 1717 1709 1603 808 349 22 ------
NM_020240chr532760 2705 1921 --177 --
NM_020245chr6184842 4610 3972 3550 3401 2051 1672 1492 1486 1480 1473 1460 1447 1031 841 592 266 205 --12008 --
NM_020307chr33438 334 39 ------
NM_020309chr1921026 245 1325 ----
NM_020310chr1732342 2117 427 ------
NM_020311chr23568 200 39 --2702 602 1505
NM_020317chr11332 --1308 --
NM_020336chr2083400 3254 2899 2417 1339 1121 1083 550 --23066 1408 --
NM_020337chr4113113 3046 2720 2713 2653 2273 2179 2160 2097 1200 508 --32825 2804 2291 --
NM_020341chr2022014 1700 1467 ----
NM_020342chr242566 730 409 165 1934 22511 740 1764
NM_020354chr102947 855 ------
NM_020357chr321319 177 --21174 515 --
NM_020361chr82257 74 ------
NM_020369chr71142 ------
NM_020374chr1251910 1863 676 592 516 --11368 --
NM_020379chr13374 338 70 ------
NM_020381chr63557 496 142 1597 11691 --
NM_020382chr122236 119 ------
NM_020383chr10124 ------
NM_020387chr11210 ------
NM_020390chr3124725 4163 4074 4033 3580 3277 3214 855 784 310 144 121 ------
NM_020394chr141364 1348 1270 387 ------
NM_020401chr121220 ------
NM_020403chr1331590 610 152 ----11813
NM_020416chr442489 2202 1640 556 --21650 1645 --
NM_020420chrY31179 284 253 1131 ----
NM_020425chr6101991 1629 1585 1579 1381 689 409 323 262 93 142 1381 --
NM_020429chr762991 2950 2389 1037 691 510 12645 --12912
NM_020432chr761983 1874 1773 1758 1724 1557 ------
NM_020436chr20----164 --
NM_020438chr921407 384 11113 11207 --
NM_020440chr163357 3316 1166 662 539 233 1159 11252 --
NM_020443chr1156714 6559 6479 6138 5927 5727 5443 5156 5016 4382 2353 2170 1515 1140 843 --15747 --
NM_020445chr72734 80 ----1559
NM_020449chrX1647 ------
NM_020452chr11505 ------
NM_020453chr431471 638 87 ------
NM_020455chr652843 2669 2456 1130 1056 ------
NM_020457chr16----1594 --
NM_020463chr221456 429 --11325 --
NM_020465chr1651928 1650 1551 170 114 ----11341
NM_020466chr645003 3737 3276 3061 --44037 3281 3185 45 --
NM_020474chr1821936 648 ------
NM_020475chr82319 313 12339 --1344
NM_020476chr82319 313 12339 --1344
NM_020477chr82319 313 12339 --1344
NM_020478chr82382 376 12402 --1407
NM_020480chr82319 313 12339 --1344
NM_020532chr21700 ------
NM_020546chr5102817 2787 2587 2436 1206 734 586 339 182 84 --11013 1610
NM_020548chr2160 ------
NM_020630chr102574 155 ------
NM_020640chr321995 652 --31868 876 510 21940 868
NM_020644chr112367 68 --1383 --
NM_020651chr261756 1565 1377 659 447 283 1224 1317 11475
NM_020654chr361642 1544 1530 1199 1173 31 11053 21473 305 21627 1577
NM_020655chr161182 ------
NM_020662chr631767 1389 243 --1696 --
NM_020673chr20137693 7622 7601 7365 7057 2916 2345 2327 2231 1771 750 301 145 --37751 7075 7070 --
NM_020682chr1031151 886 54 ------
NM_020686chr1632846 292 78 --12038 --
NM_020689chr2031754 1718 495 --1138 --
NM_020693chr11170 1405 ----
NM_020699chr165024 4028 1604 1494 338 212 1572 11428 --
NM_020711chr242463 2078 1814 1724 ------
NM_020713chr203727 597 410 ------
NM_020715chr142897 663 --1115 --
NM_020718chr1696476 5907 5729 5702 4434 1322 1223 1182 23 1341 55714 5709 4552 4408 91 --
NM_020726chr53611 126 86 ------
NM_020727chr2193630 3404 2903 2873 2723 2643 1278 412 205 ------
NM_020728chr753047 2053 1128 902 663 ------
NM_020732chr65489 306 284 70 63 ------
NM_020734chr1293355 3316 2809 1325 1226 753 556 355 333 --21129 949 --
NM_020739chr1553794 3034 2570 1271 1058 --23677 2713 --
NM_020742chrX62669 1988 696 566 190 116 11696 1583 1998
NM_020747chr53872 771 183 ------
NM_020748chr1742113 1922 1809 783 11396 ----
NM_020752chr1032543 1846 744 --1852 --
NM_020760chr23798 764 125 --11761 11883
NM_020761chr171703 --1288 11738
NM_020766chrX104578 3614 3354 2844 1750 1620 1447 650 416 66 11826 11571 --
NM_020771chr651359 1176 401 353 172 11212 --11368
NM_020772chr17198566 7841 7682 7304 6801 6663 5663 5571 3246 2921 2231 2213 2134 2126 1122 1076 963 954 291 11586 38394 1619 426 27197 3391
NM_020773chr422610 418 12263 ----
NM_020774chr18125249 4947 3983 2209 2003 1744 1611 815 622 197 191 184 24686 82 15327 --
NM_020779chr2123012 2961 2168 2089 1976 1055 1018 887 804 263 230 95 --13187 --
NM_020783chr1832377 2151 2021 --12342 12316
NM_020791chr1741308 938 205 149 --1154 --
NM_020794chr161538 1126 260 254 248 238 ------
NM_020796chr593052 2468 2364 2330 2176 2106 1993 1966 1105 22220 1118 ----
NM_020800chr311359 148 172 --
NM_020801chr532586 1673 896 --42671 2656 884 658 --
NM_020803chr431967 1720 346 --1559 --
NM_020804chr612479 --22598 2444 --
NM_020805chr1821508 161 --11779 --
NM_020806chr141318 ----1205
NM_020808chr11104 ------
NM_020809chr1151499 1485 675 650 424 ------
NM_020810chr1463005 2955 675 668 488 460 13088 ----
NM_020818chr141383 ------
NM_020819chr641117 1074 993 442 ------
NM_020821chr1581814 1799 1560 1541 1258 506 394 368 --21808 1296 --
NM_020824chr102548 311 --1793 --
NM_020825chr1673829 3634 3040 2883 731 720 621 --23763 2782 --
NM_020830chr283265 3243 3177 3116 2712 2560 1015 443 --1152 --
NM_020841chr1293846 3669 2672 1592 1348 1303 1234 885 804 11092 23954 3800 1340
NM_020844chr876848 6044 5032 2169 1710 1661 313 --35544 5405 146 15866
NM_020854chr1851585 1573 1264 243 103 --1523 --
NM_020856chr1941397 465 98 85 --21298 139 --
NM_020858chr1532318 1940 1883 --1610 --
NM_020859chr451562 1257 993 964 916 --33104 2963 542 --
NM_020860chr441150 1017 465 278 --11078 --
NM_020861chr631122 876 112 ------
NM_020866chr133854 689 292 --1250 --
NM_020868chr241829 524 278 251 --21604 304 --
NM_020870chr41188 1450 1516 --
NM_020871chrX12192 ------
NM_020872chr32249 86 ------
NM_020873chr32812 296 ----1818
NM_020898chr122252 147 ------
NM_020899chr1742418 2321 2211 922 --1705 1406
NM_020918chr1083659 3361 2776 2470 2294 2269 818 612 --1359 --
NM_020919chr23906 841 824 --21244 1009 11078
NM_020921chr14103657 3550 3357 3351 2841 2792 1401 460 421 309 1290 --13204
NM_020922chrX41730 560 217 89 ------
NM_020924chr9------1201
NM_020925chr131351 1215 976 1211 153 --
NM_020927chr1642213 1690 489 158 ------
NM_020935chr2104612 4568 3907 3573 2987 1832 1450 1016 761 579 --24540 628 --
NM_020940chr1072702 2395 2079 1837 994 647 185 --12929 --
NM_020948chr112326 --33123 3104 1010 --
NM_020951chr1932399 2102 111 --3470 465 257 --
NM_020962chr1562026 2002 1955 1772 801 751 1612 1671 --
NM_020967chr205954 871 215 89 63 1796 2838 223 11214
NM_020971chr191667 ------
NM_020975chr1031757 1587 145 ------
NM_020977chr421371 440 ------
NM_020981chr22309 106 --1718 --
NM_020983chr1212007 ------
NM_020987chr1031297 1272 485 ------
NM_020993chr1222024 1851 ----11119
NM_021003chr142551 274 ------
NM_021005chr1521044 419 1821 ----
NM_021007chr252220 749 636 366 110 ------
NM_021025chr51348 ------
NM_021030chr193266 259 102 --1248 --
NM_021032chr33815 639 441 ------
NM_021033chr1353314 3158 3143 3124 554 --23424 3110 11260
NM_021035chr20182 ------
NM_021038chr353324 3041 3017 2535 717 --31280 1275 1270 --
NM_021063chr6163 ------
NM_021064chr611548 ------
NM_021069chr432065 844 386 ------
NM_021072chr51906 ------
NM_021076chr221426 ------
NM_021079chr171218 --43330 2179 2060 1216 --
NM_021083chrX73068 2728 2609 1113 450 343 242 ------
NM_021088chr22738 434 11921 --1383
NM_021090chr2275031 4945 4653 4492 4386 4071 1553 --11361 --
NM_021096chr2232378 544 440 ----13303
NM_021097chr263075 3038 2819 1155 434 298 --3362 357 286 13085
NM_021104chr121290 ------
NM_021111chr9----31006 416 173 --
NM_021115chr221144 ------
NM_021120chrX83105 2952 2611 1267 925 297 156 104 12621 ----
NM_021131chr9--1325 21473 342 --
NM_021132chr1051071 1036 998 839 344 --21311 1026 --
NM_021136chr143528 299 145 ------
NM_021140chrX3744 330 60 --1235 --
NM_021144chr91482 ----1380
NM_021145chr7----21088 792 --
NM_021148chr772526 2127 1738 1710 844 815 809 12022 12307 11762
NM_021149chr1661241 1232 1157 1137 1064 253 --11069 --
NM_021151chr71963 --11124 --
NM_021163chr753082 2978 1212 914 751 --21267 1013 13495
NM_021165chr12834 779 ------
NM_021174chr81763 ------
NM_021177chr62120 97 ------
NM_021180chr11706 ------
NM_021183chrX22055 1776 --1622 1659
NM_021189chr11161 ------
NM_021190chr13211 107 101 ------
NM_021191chr1232537 2278 2185 1419 ----
NM_021192chr2----1357 --
NM_021194chr1----1219 --
NM_021202chr2032685 2450 564 --12929 12440
NM_021204chr4--1347 ----
NM_021205chr162842 2726 2489 872 752 326 12286 ----
NM_021215chr2062348 2334 2250 2242 1949 1645 --11802 12100
NM_021222chr121305 120 --21423 1185 162
NM_021229chr1231243 1027 220 ------
NM_021238chr1241379 1289 654 103 1361 12048 1607
NM_021239chr1441442 1153 1118 235 --1283 --
NM_021249chr1441479 518 424 59 ------
NM_021252chr1051968 1916 1611 1286 110 --21902 1883 --
NM_021255chr1454027 3845 3454 3418 1363 21056 536 ----
NM_021572chr62938 855 ------
NM_021574chr2222138 954 1551 ----
NM_021619chr911097 ------
NM_021620chr65809 757 717 524 118 ------
NM_021622chr103902 764 251 --32120 2068 1589 21595 927
NM_021629chr395026 4825 4752 4099 3400 1526 1156 387 22 --31431 1095 1090 --
NM_021637chrX61364 1340 1322 1226 978 75 ------
NM_021639chr11172 --1156 --
NM_021643chr231894 1502 1380 --21485 686 --
NM_021644chr1041097 929 163 116 ------
NM_021648chr652772 2313 2240 654 356 11935 12476 --
NM_021705chr611308 ------
NM_021722chr71390 --1532 --
NM_021723chr71431 --1573 --
NM_021728