TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-589-5p
miRNA Sequence: UGAGAACCACGUCUGCUCUGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51505 ------
NM_000038chr522081 129 ------
NM_000052chrX33392 2800 651 1222 ----
NM_000084chrX66010 5092 4680 2709 2357 1892 26158 2172 ----
NM_000089chr71681 --1826 --
NM_000096chr32953 273 1364 ----
NM_000108chr71559 ----1420
NM_000109chrX62416 2117 1951 1879 262 119 32512 2497 668 ----
NM_000110chr11797 ------
NM_000115chr1342015 1808 1682 926 ------
NM_000125chr634171 4021 3730 23269 160 ----
NM_000134chr431178 493 325 21551 1414 ----
NM_000158chr3148 ------
NM_000163chr5----12107 --
NM_000165chr631698 1068 325 --11297 --
NM_000167chrX51865 1602 1524 617 204 1558 ----
NM_000168chr733035 2763 2103 12080 --1689
NM_000173chr172417 381 ------
NM_000176chr533317 521 86 1111 --13438
NM_000189chr231753 815 135 12203 1246 --
NM_000210chr222309 2298 ------
NM_000212chr1731939 1698 332 --1636 1469
NM_000214chr2041471 710 393 52 11693 ----
NM_000216chrX53127 3092 1559 1368 313 1265 --13536
NM_000217chr1233402 1293 1101 15301 ----
NM_000232chr432100 1275 216 1907 ----
NM_000245chr731471 691 48 ------
NM_000248chr383081 3054 2465 2232 2210 1006 951 709 --21035 81 --
NM_000252chrX41236 1030 603 216 11243 ----
NM_000259chr1534978 4911 1707 66080 5996 4847 1690 1596 1469 24376 1008 26249 2278
NM_000264chr933286 2507 2329 12757 13129 --
NM_000276chrX32142 1724 234 ------
NM_000280chr1111012 1818 ----
NM_000310chr111232 ------
NM_000314chr1052304 2154 894 470 169 23041 1004 12488 --
NM_000332chr676406 6162 2696 2466 2243 1998 1794 12535 37073 6368 2732 16379
NM_000333chr31102 1916 ----
NM_000337chr5116452 6269 6002 5826 5253 4651 2124 1699 1148 1090 627 1876 15263 15089
NM_000340chr341496 1368 275 254 --1290 --
NM_000346chr1721944 1480 11262 ----
NM_000358chr5--185 ----
NM_000362chr2273652 3542 2875 2749 2375 206 101 --13045 --
NM_000368chr951894 1071 803 447 162 ------
NM_000378chr111344 ------
NM_000393chr221564 303 22129 1895 ----
NM_000396chr11443 ------
NM_000399chr104733 391 355 315 --1167 --
NM_000401chr1131055 449 205 1307 1234 --
NM_000408chr211386 12993 1768 --
NM_000411chr2152860 2109 1300 161 115 ------
NM_000421chr172285 58 1316 ----
NM_000430chr1773755 3349 2528 2521 1507 1190 936 11080 13124 --
NM_000439chr542382 1828 749 250 --1437 --
NM_000445chr8--171 ----
NM_000448chr1142864 2522 2312 28 23205 1184 --1379
NM_000452chr1321882 1367 143 1813 --
NM_000461chr374327 3651 3297 3096 895 226 194 14373 24277 1672 --
NM_000462chr1531714 586 301 ------
NM_000484chr211240 11092 ----
NM_000489chrX31112 495 486 32567 413 246 12737 --
NM_000493chr6--11091 1237 --
NM_000495chrX2875 419 ------
NM_000503chr8--11205 ----
NM_000523chr24356 235 223 217 ----1430
NM_000527chr1922454 883 --11948 --
NM_000530chr11970 ------
NM_000533chrX41606 1580 1549 1298 22016 1681 ----
NM_000546chr173272 233 72 ------
NM_000555chrX37831 6685 2985 47249 5549 1390 901 12039 --
NM_000575chr221048 730 ------
NM_000598chr721114 153 ------
NM_000599chr244311 4273 4194 828 14329 33935 725 235 --
NM_000600chr72394 88 ------
NM_000610chr1142952 1927 995 158 22863 2224 22097 921 --
NM_000615chr1162416 2295 2289 2192 964 717 11073 --22850 2818
NM_000618chr1265485 4859 2589 2573 1624 1493 14878 14471 --
NM_000618chr1265485 4859 2589 2573 1624 1493 14878 14471 --
NM_000633chr1834894 1895 1510 34920 4085 1184 ----
NM_000663chr1632508 2382 2316 180 12299 --
NM_000668chr4--21030 428 ----
NM_000686chrX2335 75 11552 ----
NM_000700chr91194 ------
NM_000701chr11228 ------
NM_000719chr1241798 764 758 81 1853 34335 1673 884 --
NM_000726chr21248 ------
NM_000729chr31214 ------
NM_000767chr192968 226 ------
NM_000786chr731424 1231 162 11379 ----
NM_000795chr111374 --1850 --
NM_000800chr511651 ------
NM_000801chr203901 741 34 1264 ----
NM_000806chr511829 159 ----
NM_000813chr534877 1837 920 14500 1201 --
NM_000814chr1543869 3476 1311 596 1580 ----
NM_000816chr5------131
NM_000826chr412322 12633 1207 --
NM_000827chr542581 1751 408 196 1473 22555 144 --
NM_000828chrX3703 692 368 21822 1707 ----
NM_000829chr113929 348 228 ------
NM_000833chr1611109 ------
NM_000838chr622733 2317 12260 ----
NM_000840chr7123 --1519 --
NM_000844chr34905 802 443 367 ------
NM_000855chr112308 227 ------
NM_000859chr541113 581 137 42 --1166 --
NM_000865chr61190 ------
NM_000868chrX42606 870 503 179 21633 774 ----
NM_000875chr15136756 6531 6490 6397 5300 5284 4880 2599 2584 2448 1507 1289 323 36538 5577 4727 --16184
NM_000876chr61245 11210 --1929
NM_000891chr1763421 3129 2656 2611 436 239 ------
NM_000899chr1274003 3556 3274 2845 2780 1389 131 22936 1498 ----
NM_000901chr421574 1552 ------
NM_000905chr71122 ------
NM_000912chr833463 3143 31 13178 ----
NM_000919chr5--1643 ----
NM_000934chr171690 ------
NM_000941chr71370 ------
NM_000944chr442140 785 317 95 ------
NM_000945chr231937 1416 734 ------
NM_000950chrX63512 3049 2537 1206 716 469 12272 ----
NM_000956chr141310 123 1708 --
NM_000958chr511298 ------
NM_000962chr932820 2090 598 11130 --3360 259 231
NM_000964chr172941 511 ------
NM_000965chr31357 21142 137 ----
NM_000966chr1221076 996 ------
NM_000975chr1--139 ----
NM_000983chr12606 35 --11572 --
NM_000990chr1131129 416 110 23775 404 21044 66 --
NM_001001323chr1232448 2291 1078 12442 ----
NM_001001330chr1021247 461 1253 ----
NM_001001331chr342303 407 388 367 --1250 12416
NM_001001389chr1142952 1927 995 158 22863 2224 22097 921 --
NM_001001390chr1142952 1927 995 158 22863 2224 22097 921 --
NM_001001391chr1142952 1927 995 158 22863 2224 22097 921 --
NM_001001392chr1142998 1973 1041 204 22909 2270 22143 967 --
NM_001001395chr1232182 1819 617 --12072 12292
NM_001001396chr184311 4051 3979 3391 3273 3247 2762 845 --13521 24333 1111
NM_001001419chr5125161 4748 4217 3995 3960 2093 2086 2038 1009 622 580 384 14567 14546 --
NM_001001420chr5125161 4748 4217 3995 3960 2093 2086 2038 1009 622 580 384 14567 14546 --
NM_001001433chr2052944 2808 2020 425 187 ------
NM_001001436chr161685 ------
NM_001001481chr831370 1248 337 32887 1333 384 12928 --
NM_001001484chr101418 11554 ----
NM_001001520chr192185 127 ------
NM_001001549chr722882 2514 22705 417 ----
NM_001001550chr722882 2514 22705 417 ----
NM_001001555chr722882 2514 22705 417 ----
NM_001001556chr1521236 199 ------
NM_001001557chr82493 273 11545 ----
NM_001001664chr233975 1325 429 33585 1655 1389 12500 --
NM_001001701chr421742 398 31793 1507 205 22183 37 12228
NM_001001713chr212398 335 ------
NM_001001740chr11116 ------
NM_001001740chr11116 ------
NM_001001852chr221738 --2871 178 --
NM_001001890chr2163264 2940 2876 2754 868 542 ------
NM_001001924chr821648 362 21794 391 ----
NM_001001925chr821648 362 21794 391 ----
NM_001001928chr2278349 8211 6005 5829 3172 1927 946 11169 17684 26096 2586
NM_001001931chr821648 362 21794 391 ----
NM_001001933chr11485 ------
NM_001002026chr322346 289 --1543 --
NM_001002032chr172209 105 ------
NM_001002243chr21825 ------
NM_001002255chr62119 38 ------
NM_001002257chr243450 3362 2581 2318 23530 2749 1761 --
NM_001002838chrX41544 1492 88 33 ----11278
NM_001002843chr1521087 1031 ----1275
NM_001002860chr1464450 3906 3799 1311 1179 173 23201 1404 11833 14631
NM_001002926chr72667 261 167 1460 --
NM_001003407chr10124800 4723 4713 3575 3481 3420 3239 1698 1017 947 616 288 23587 3379 14856 --
NM_001003408chr10124800 4723 4713 3575 3481 3420 3239 1698 1017 947 616 288 23587 3379 14856 --
NM_001003652chr18148691 8365 8296 7877 7623 6293 6247 6200 6125 2807 2147 1594 1378 657 57341 7297 5311 3068 1363 11658 28461 2840
NM_001003674chr1835861 2155 1979 57045 6951 5734 4375 2440 ----
NM_001003675chr1835861 2155 1979 57045 6951 5734 4375 2440 ----
NM_001003681chr2231907 1427 101 ------
NM_001003688chr421111 487 --11190 1452
NM_001003698chr621913 377 ------
NM_001003699chr621913 377 ------
NM_001003792chr321226 472 ------
NM_001003793chr321226 472 ------
NM_001003799chr72655 569 ----1482
NM_001003800chr953556 2680 2531 2375 1325 --11105 1753
NM_001003810chr41332 1178 ----
NM_001003940chr1533818 357 336 --12457 1559
NM_001003942chr1533818 357 336 --12457 1559
NM_001003943chr1533822 361 340 --12461 1563
NM_001004051chrX--2322 243 1302 --
NM_001004065chr943937 2507 1533 633 12880 23892 2805 --
NM_001004127chr131687 ------
NM_001004196chr311145 ------
NM_001004304chr1253046 2148 1046 503 379 1214 1927 --
NM_001004317chr674446 3700 1019 568 551 435 22 1827 11361 --
NM_001004342chr186013 4746 4263 4198 3777 1606 1372 668 3912 905 329 ----
NM_001004360chr231965 1508 279 ------
NM_001004419chr1274313 4091 4068 1636 1564 520 270 1247 11326 14170
NM_001005158chr31388 1351 ----
NM_001005159chr31388 1351 ----
NM_001005266chr152607 196 ------
NM_001005267chr152607 196 ------
NM_001005268chr152607 196 ------
NM_001005269chr152607 196 ------
NM_001005366chr123665 274 201 1794 ----
NM_001005375chrY51180 283 254 151 129 ------
NM_001005386chr242377 2303 626 570 11765 1683 --
NM_001005404chr1764355 4348 3601 3187 3009 1086 44531 4409 3295 1124 1642 --
NM_001005463chr10------11936
NM_001005473chr544332 4189 2648 2419 26602 4796 24998 316 --
NM_001005732chr211124 1670 ----
NM_001005733chr211124 1627 ----
NM_001005743chr1431151 1094 898 ------
NM_001005744chr1431151 1094 898 ------
NM_001005745chr1431151 1094 898 ------
NM_001005746chr21248 ------
NM_001005747chr21248 ------
NM_001005753chr252314 2061 787 141 109 1165 ----
NM_001005781chr2----1382 --
NM_001005782chr22715 60 1165 1831 --
NM_001005849chr173559 116 38 ------
NM_001005910chr31244 1642 ----
NM_001005911chr31244 1642 ----
NM_001006117chrY--1185 ----
NM_001006600chr532388 718 225 12139 ----
NM_001006610chr163918 903 374 ------
NM_001006612chrX1115 ------
NM_001006613chrX1115 ------
NM_001006614chrX1115 ------
NM_001006618chr9166 ------
NM_001006624chr1--12022 ----
NM_001006636chr21640 ------
NM_001006656chr192600 522 1494 11694 --
NM_001006684chrX2417 403 ------
NM_001006946chr231488 1222 534 ------
NM_001007024chr1774279 3458 3398 3039 1384 291 191 24361 2806 --1239
NM_001007025chr1774279 3458 3398 3039 1384 291 191 24361 2806 --1239
NM_001007067chr81204 ------
NM_001007068chr81204 ------
NM_001007069chr81204 ------
NM_001007070chr81204 ------
NM_001007097chr934730 1827 1531 11820 33551 3499 123 11084
NM_001007098chr14849 737 712 298 ------
NM_001007156chr1541589 1487 166 84 --21640 1517 --
NM_001007226chr1711260 11187 ----
NM_001007227chr1711260 11187 ----
NM_001007228chr1711260 11187 ----
NM_001007229chr1711260 11187 ----
NM_001007230chr1711260 11187 ----
NM_001007246chr2121667 250 1267 2626 458 --
NM_001007257chr11541 1953 ----
NM_001007277chr1131028 755 359 ------
NM_001007278chr1384055 3676 3529 3327 2077 1633 333 25 1948 14292 12004
NM_001007466chr694960 4594 4571 1873 994 934 361 300 277 34068 688 40 1552 --
NM_001007546chr211237 1328 11450 --
NM_001007553chr141198 1133 1106 66 ------
NM_001007559chr1862016 1925 1723 1617 1595 1429 21499 607 ----
NM_001007794chr12765 34 ------
NM_001008220chr512516 11419 153 --
NM_001008222chrX21331 1056 --2451 257 --
NM_001008226chr1531779 1121 196 ------
NM_001008239chr1863232 3153 2716 2675 1326 659 23648 1451 13687 --
NM_001008272chr32215 122 ------
NM_001008273chr32215 122 ------
NM_001008405chr7--1129 ----
NM_001008408chr7106201 5116 4881 4522 4231 2566 2282 1333 299 128 2379 267 ----
NM_001008495chr882264 2177 2012 1727 1536 1510 460 420 11904 11760 --
NM_001008540chr21436 2446 367 ----
NM_001008564chr1321687 203 1876 ----
NM_001008701chr19--11885 ----
NM_001008726chr1431579 1541 32 11562 ----
NM_001008738chr512180 1806 ----
NM_001008777chr171239 ------
NM_001008801chr1952002 1982 464 278 109 3801 550 196 ----
NM_001008895chr134970 341 309 209 ------
NM_001009554chr484037 3949 3410 3119 1570 1467 492 418 --13870 --
NM_001009554chr484037 3949 3410 3119 1570 1467 492 418 --13870 --
NM_001009567chr104580 449 158 83 ------
NM_001009571chr751555 1353 1171 350 178 --11113 1540
NM_001009899chr341768 1636 1321 627 32391 198 121 ----
NM_001009909chr1143464 1490 1184 729 ----1369
NM_001009955chr11375 ------
NM_001009955chr11375 ------
NM_001009959chr222464 1725 ------
NM_001009993chr234325 3055 817 24567 554 --11522
NM_001010000chr1853274 3194 2678 1327 344 23319 1255 12345 --
NM_001010852chr6------152
NM_001010853chr642308 2149 1234 455 12737 11251 --
NM_001010854chr141504 1279 ----
NM_001010867chr162172 1962 1593 1242 729 198 46594 6041 5024 2300 16230 15343
NM_001010888chrX74582 4411 3886 3013 821 720 378 34179 3519 1247 --13369
NM_001010891chr5106184 5091 4926 4863 4259 2128 1198 917 698 390 25962 4487 ----
NM_001010895chr941557 1446 543 414 --2321 104 --
NM_001010924chr1041025 949 455 330 --1798 --
NM_001010971chr11743 --2704 213 --
NM_001010989chr161364 --1559 --
NM_001010990chr161364 --1559 --
NM_001011537chr332185 1454 138 42173 1894 1880 209 ----
NM_001011551chrX1173 ------
NM_001011657chrX3949 938 131 ------
NM_001011663chr102817 315 ------
NM_001011666chr796092 5862 2518 2126 1891 1021 606 241 108 --16297 --
NM_001011713chr143450 413 211 11415 21222 1060 --
NM_001012393chr1165013 4053 1244 795 205 124 24114 3587 23129 1305 --
NM_001012398chr163713 143 125 ------
NM_001012420chr1512818 --12546 --
NM_001012423chr1512818 --12546 --
NM_001012751chr1041932 1606 1290 700 ------
NM_001012755chrX74902 4666 3894 1562 1133 982 56 13834 14371 --
NM_001012761chr53817 192 23 1169 22407 1027 12512
NM_001012968chrX32712 1750 60 42494 2024 1072 965 11888 --
NM_001012979chrX--1244 ----
NM_001013031chr1063450 3178 3097 2913 2620 137 42500 2478 1212 853 ----
NM_001013398chr721114 153 ------
NM_001013399chr63802 415 215 ------
NM_001013439chr3129 1277 ----
NM_001013690chr1221538 213 1586 22044 403 --
NM_001013843chr153884 860 24 ----1719
NM_001014380chr1384961 4783 3983 1958 1875 1547 1486 1098 2929 761 1107 --
NM_001014431chr145719 666 231 206 80 ------
NM_001014432chr145719 666 231 206 80 ------
NM_001014442chr13167 ------
NM_001014445chr173907 387 347 --1165 1691
NM_001015045chr432200 1686 354 1954 1569 --
NM_001015508chr81215 1248 ----
NM_001015877chrX32578 2168 73 2973 571 ----
NM_001015880chr1021458 1186 11711 ----
NM_001015881chrX21173 54 ------
NM_001017368chr1722517 234 ------
NM_001017371chr231244 1000 199 173 ----
NM_001017395chr353199 2684 862 724 87 12619 12692 12430
NM_001017405chr4--1344 1959 --
NM_001017415chr12813 126 ----1241
NM_001017416chr12813 126 ----1241
NM_001017424chr12577 266 1353 ----
NM_001017425chr12577 266 1353 ----
NM_001017440chr7118185 7447 7382 6822 5881 2468 2341 1678 964 231 225 36216 1314 610 ----
NM_001017523chr1231476 1330 44 1574 ----
NM_001017923chr14128 ------
NM_001017930chrX51426 968 590 385 317 ------
NM_001017967chr161925 1880 --189
NM_001017969chr92243 183 ------
NM_001017977chr11104 ------
NM_001018004chr151669 ------
NM_001018006chr151669 ------
NM_001018007chr151669 ------
NM_001018020chr151669 ------
NM_001018037chr921088 505 --21076 228 --
NM_001018038chr91150 1167 ----
NM_001018057chr1141372 448 366 176 31252 1208 904 ----
NM_001018064chr942139 1933 1696 1365 1561 ----
NM_001018065chr995819 5442 5409 4788 4550 3999 3720 1161 930 24721 4590 1543 --
NM_001018066chr995819 5442 5409 4788 4550 3999 3720 1161 930 24721 4590 1543 --
NM_001018067chr175290 4531 3847 1347 860 431 409 1237 15306 11528
NM_001018068chr175290 4531 3847 1347 860 431 409 1237 15306 11528
NM_001018069chr175290 4531 3847 1347 860 431 409 1237 15306 11528
NM_001018072chr1231476 1330 44 1574 ----
NM_001018074chr533317 521 86 1111 --13438
NM_001018075chr533317 521 86 1111 --13438
NM_001018076chr533317 521 86 1111 --13438
NM_001018077chr533317 521 86 1111 --13438
NM_001018108chr1531986 813 719 ----11862
NM_001018159chr161105 ------
NM_001018160chr161105 ------
NM_001018676chr81475 ------
NM_001018677chr81475 ------
NM_001020658chr131211 1165 397 11275 ----
NM_001020658chr131211 1165 397 11275 ----
NM_001020818chr1961904 1611 170 101 61 46 21602 245 ----
NM_001020819chr1961904 1611 170 101 61 46 21602 245 ----
NM_001020820chr1961904 1611 170 101 61 46 21602 245 ----
NM_001020821chr1961904 1611 170 101 61 46 21602 245 ----
NM_001023567chr1532210 1736 327 --12242 --
NM_001023587chr33979 448 300 ------
NM_001024094chr533317 521 86 1111 --13438
NM_001024218chr14184 ------
NM_001024226chr11387 21141 1134 ----
NM_001024227chr11387 21141 1134 ----
NM_001024228chr11387 21141 1134 ----
NM_001024401chr1612860 ------
NM_001024593chr101833 --2268 70 --
NM_001024649chr522957 880 --12030 --
NM_001024660chr351428 1216 1108 509 107 --11350 --
NM_001024688chr851795 1673 1490 788 754 2666 187 11991 --
NM_001024809chr172941 511 ------
NM_001024948chr183487 3233 3174 2400 1260 1234 1165 1128 --12755 --
NM_001025076chr1086173 5921 4421 2066 2026 1885 1574 833 14306 1166 --
NM_001025077chr1067531 7279 5779 2932 2191 948 15664 11524 --
NM_001025079chr343839 2817 1391 696 23461 842 ----
NM_001025201chr22524 197 1570 --1653
NM_001025233chr1242431 2041 1846 279 ------
NM_001025248chr1561283 1115 990 972 829 500 ------
NM_001025249chr1561283 1115 990 972 829 500 ------
NM_001025366chr621381 1293 ------
NM_001025366chr621381 1293 ------
NM_001025367chr621381 1293 ------
NM_001025367chr621381 1293 ------
NM_001025368chr621381 1293 ------
NM_001025368chr621381 1293 ------
NM_001025369chr621397 1309 ------
NM_001025369chr621397 1309 ------
NM_001025370chr621381 1293 ------
NM_001025370chr621381 1293 ------
NM_001025580chrX73971 3738 2996 461 370 351 250 13100 13091 --
NM_001025595chr451286 1250 1105 322 178 ------
NM_001025780chr931105 154 82 --130 --
NM_001029858chr612202 23392 2286 --12941
NM_001029875chr582961 2868 2399 2133 1167 314 106 93 ------
NM_001029882chr12620 35 --1593 --
NM_001029882chr12620 35 --1593 --
NM_001029884chr632393 1821 540 22598 1092 ----
NM_001030006chr1711083 22632 2051 1537 11057
NM_001030007chr1643676 3610 3314 2466 ------
NM_001030059chr10--1311 179 --
NM_001031623chr64553 429 341 71 ------
NM_001031685chr13930 781 279 1358 ----
NM_001031690chr742910 2018 447 355 --1660 --
NM_001031695chr2264554 4210 3591 1745 627 171 ------
NM_001031700chr442378 2309 184 52 ------
NM_001031702chr3----185 --
NM_001031711chr531820 1339 642 ------
NM_001031712chr62386 99 ------
NM_001031732chr432941 2436 1177 1286 22988 1056 --
NM_001031743chr61157 ------
NM_001031801chr222440 163 ------
NM_001031803chr171268 ------
NM_001031804chr1663621 3345 1291 725 646 384 13356 ----
NM_001031812chr531988 369 308 ------
NM_001032279chr111320 --1371 --
NM_001032288chr2021409 1215 ------
NM_001032289chrX185 ------
NM_001032293chr171245 ------
NM_001032296chr1362777 2695 2109 2014 617 24 12923 12197 --
NM_001032380chr10--21803 1245 ----
NM_001032999chr2085235 5180 4713 1668 1373 1349 1213 798 ------
NM_001033044chr131806 700 40 --21393 1361 1616
NM_001033047chr422603 145 11741 12629 12049
NM_001033056chr131806 700 40 --21393 1361 1616
NM_001033057chr332122 1838 42 ------
NM_001033087chr2022979 915 22286 1292 ----
NM_001033117chr311092 11157 24289 4038 --
NM_001033503chr5--1465 ----
NM_001033506chr11153 ----1109
NM_001033557chr221156 1137 1294 ----
NM_001033561chr173784 718 88 ------
NM_001033576chr1732501 329 143 1431 167 --
NM_001033602chr1342589 451 392 256 1312 ----
NM_001033659chr1721475 373 ------
NM_001033723chr842768 2176 1785 1114 ------
NM_001033756chr621315 1227 ------
NM_001033756chr621315 1227 ------
NM_001033925chr1011664 ------
NM_001034841chr16105523 5461 5335 5154 4016 3411 1545 1431 1050 360 --11163 --
NM_001034850chr531614 1301 1104 ------
NM_001034852chr143567 371 284 --12040 --
NM_001034954chr1053003 2996 1156 853 716 ------
NM_001034955chr1053003 2996 1156 853 716 ------
NM_001034956chr1053003 2996 1156 853 716 ------
NM_001034957chr1053003 2996 1156 853 716 ------
NM_001035chr121028 119 ------
NM_001035254chr932604 2392 2321 --1927 --
NM_001035260chr1021506 1285 ------
NM_001037132chr712127 1418 ----
NM_001037133chr712127 1418 ----
NM_001037164chr721434 656 --138 --
NM_001037165chr7108880 8337 7665 7525 6620 3131 2578 2473 1215 1159 28719 1025 11502 13025
NM_001037174chr242139 1769 1725 613 ----1846
NM_001037281chr16----1117 --
NM_001037331chr182720 184 ------
NM_001037332chr512331 ------
NM_001037333chr512331 ------
NM_001037535chrX11076 11554 ----
NM_001037536chrX11076 11554 ----
NM_001037540chrX11076 11554 ----
NM_001037954chr1142988 2517 716 664 13417 21319 1183 --
NM_001038628chr351607 1554 1245 382 226 --11277 --
NM_001038702chr532761 1077 158 ------
NM_001038707chr152194 1710 1680 292 21 --21925 681 --
NM_001038707chr152194 1710 1680 292 21 --21925 681 --
NM_001039199chr2021774 679 --14005 2711 309
NM_001039348chr21952 ------
NM_001039349chr21952 ------
NM_001039350chr71619 ------
NM_001039457chr1----151 --
NM_001039465chr142447 332 ------
NM_001039538chr233212 2462 1295 --1921 --
NM_001039547chr387775 6326 5942 5210 5018 2805 2010 826 26708 1227 ----
NM_001039569chr243285 659 426 74 --22731 705 --
NM_001039570chr2224608 3528 --176 --
NM_001039571chr2224608 3528 --176 --
NM_001039577chr154199 2881 2872 1040 986 1499 21642 147 --
NM_001039590chrX63733 3451 3274 3181 2877 1498 ------
NM_001039591chrX63733 3451 3274 3181 2877 1498 ------
NM_001039618chr1163923 3883 2166 1801 1591 1163 24919 803 ----
NM_001039619chr143333 319 46 ------
NM_001039690chr1611883 --32365 1621 168 --
NM_001039709chr2085235 5180 4713 1668 1373 1349 1213 798 ------
NM_001039762chr1052376 2011 1947 773 206 ------
NM_001039840chrX85543 4759 4292 3773 2372 2087 493 437 ------
NM_001039937chr1321567 296 24139 1022 13873 --
NM_001039960chr121319 --1247 --
NM_001040001chr661919 1576 1520 1375 1323 1271 ------
NM_001040020chr711600 21137 986 ----
NM_001040057chr711062 11503 ----
NM_001040110chr741618 1607 1339 28 ------
NM_001040134chr1921474 140 ------
NM_001040142chr211533 ------
NM_001040143chr211533 ------
NM_001040144chr1611883 --32365 1621 168 --
NM_001040146chr1611883 --32365 1621 168 --
NM_001040152chr744524 1756 1463 770 --11792 --
NM_001040159chr411296 ------
NM_001040214chr6--12066 ----
NM_001040272chr931745 548 175 ------
NM_001040284chr1675174 5156 4590 4361 4354 3692 877 15969 12285 --
NM_001040402chr473186 2872 2034 1014 887 781 178 11295 12542 --
NM_001040409chr22688 673 --11006 --
NM_001040429chr1343472 3016 2316 156 ------
NM_001040446chr531852 918 257 ------
NM_001040455chr1121339 482 ------
NM_001040633chr721033 756 2271 206 ----
NM_001040665chr794932 4669 3196 1894 1476 1126 941 910 148 --13989 --
NM_001040666chr71634 ------
NM_001040708chr81968 ------
NM_001040709chr152532 2280 2153 2125 1768 11989 ----
NM_001040712chr963569 3384 3247 3195 986 646 ------
NM_001040876chr42700 154 2490 269 ----
NM_001042355chr1695033 4534 1460 1343 742 622 606 441 222 --14668 --
NM_001042388chr183909 845 360 ------
NM_001042404chr121643 247 ------
NM_001042412chr1695033 4534 1460 1343 742 622 606 441 222 --14668 --
NM_001042413chr963496 1208 744 588 133 62 --1208 --
NM_001042414chr13187 ------
NM_001042453chrX21757 1261 ------
NM_001042465chr10144 ------
NM_001042466chr10144 ------
NM_001042472chr20150 --1408 --
NM_001042473chr1022059 740 --11622 --
NM_001042481chr1452245 2233 2212 1075 68 11625 --12281
NM_001042486chr2021181 75 ------
NM_001042493chr641586 1380 410 40 11993 11622 --
NM_001042494chr1543872 3785 3589 33 23745 1344 2897 821 --
NM_001042495chr1543872 3785 3589 33 23745 1344 2897 821 --
NM_001042496chr1543872 3785 3589 33 23745 1344 2897 821 --
NM_001042497chr1543872 3785 3589 33 23745 1344 2897 821 --
NM_001042498chrX1222 ------
NM_001042517chr133905 250 178 ------
NM_001042537chrX52324 2170 483 344 190 12514 ----
NM_001042550chr92392 121 11854 ----
NM_001042555chr12104756 4450 4341 4158 3576 3523 3168 1893 989 808 23118 229 ----
NM_001042599chr266604 5039 2371 1110 963 646 27699 631 --16396
NM_001042601chr382939 2429 900 882 851 803 341 244 ----11306
NM_001042603chr12124295 3579 3500 3442 3384 3326 2138 1946 1916 1734 1568 1561 --14711 --
NM_001042604chr354369 4312 3617 3197 3074 ------
NM_001042646chr32813 44 31703 622 351 ----
NM_001042681chr172615 2097 1757 922 797 297 42 ------
NM_001042682chr172615 2097 1757 922 797 297 42 ------
NM_001042682chr172615 2097 1757 922 797 297 42 ------
NM_001042683chr611718 11140 ----
NM_001042728chr1221076 996 ------
NM_001042749chrX31916 1845 1378 21770 1756 ----
NM_001042750chrX31916 1845 1378 21770 1756 ----
NM_001042751chrX31916 1845 1378 21770 1756 ----
NM_001043318chr1454170 4136 1166 1137 269 13607 ----
NM_001043351chr122324 1941 1598 ----
NM_001044305chr631530 460 280 ------
NM_001044387chr1943849 2580 805 198 1471 ----
NM_001044388chr1943849 2580 805 198 1471 ----
NM_001044722chr531988 369 308 ------
NM_001044723chr531988 369 308 ------
NM_001046chr532165 251 181 ----11969
NM_001049chr141496 1876 --12136
NM_001068chr31117 ------
NM_001071775chr1321441 769 ------
NM_001076chr4170 ------
NM_001076chr4170 ------
NM_001077628chr11454 --1635 --
NM_001078chr13727 505 487 ------
NM_001079874chr132056 634 267 ------
NM_001083620chr422320 206 12631 ----
NM_001094chr172808 660 ------
NM_001099678chr356096 2391 2309 1737 1565 1248 15495 --
NM_001100108chr1107319 5083 2909 2746 2388 1838 1667 1500 74 64 58191 1979 1749 143 81 57626 6987 5382 2490 804 1904
NM_001104548chr11160 ------
NM_001106chr3129650 8099 6732 6301 3673 3116 3009 2939 2743 2673 2654 2092 --28162 3640 --
NM_001109977chr43774 235 45 --130 --
NM_001113490chrX43053 2476 2422 1453 23303 296 171 --
NM_001117chr1822187 57 ------
NM_001121chr101141 ------
NM_001126chr1--1351 --1839
NM_001128chr1643676 3610 3314 2466 ------
NM_001148chr431370 441 318 1187 ----
NM_001149chr1011296 ------
NM_001156chr103609 488 187 ------
NM_001167chrX116658 6511 4994 4724 2366 2324 2234 1786 1500 1457 812 24879 35 --12628
NM_001186chr2122375 558 23229 2551 12757 --
NM_001189chr4----1331 --
NM_001191chr201160 1368 ----
NM_001197chr222150 92 ------
NM_001198chr632293 2169 1898 ------
NM_001200chr2041059 1041 995 794 1421 ----
NM_001204chr287736 7636 6794 6614 6244 5194 2112 833 ----16218
NM_001206chr982970 2110 2056 1930 1114 485 285 277 ------
NM_001233chr71581 ------
NM_001237chr45947 214 153 76 24 ----1725
NM_001237chr45947 214 153 76 24 ----1725
NM_001241chr22844 479 ------
NM_001241chr22844 479 ------
NM_001256chr1732377 2204 398 --21170 441 12519
NM_001257chr1621340 130 ------
NM_001259chr785218 4761 4470 2076 2034 1617 1297 1023 25248 2355 ----
NM_001270chr531026 413 231 ------
NM_001271chr1533091 563 347 ------
NM_001273chr121374 ------
NM_001280chr192688 127 1276 1588 1226
NM_001282chr1711083 22632 2051 1537 11057
NM_001289chrX21521 70 ------
NM_001290chr43823 785 291 --1904 --
NM_001293chr111126 --1560 --
NM_001304chr171439 --23074 1113 1904
NM_001310chr1222650 1229 21988 463 ----
NM_001315chr6--11636 1879 1567
NM_001319chr191434 ------
NM_001326chr111384 --2140 94 --
NM_001329chr1011229 11163 ----
NM_001331chr112297 284 ------
NM_001332chr531585 1109 583 ------
NM_001338chr212495 254 --1954 --
NM_001343chr531486 1321 418 --11357 --
NM_001351chr33188 159 41 ------
NM_001356chrX22081 851 1723 ----
NM_001364chr1124762 1642 ------
NM_001365chr171513 ------
NM_001380chr102716 678 2853 150 --1777
NM_001386chr862254 2064 1828 1821 869 430 --11681 --
NM_001387chr562783 2717 1084 601 595 187 --12621 --
NM_001389chr21----1538 1465
NM_001390chr1843201 2646 2297 753 1233 13009 --
NM_001391chr18----135 --
NM_001396chr2132019 484 278 ------
NM_001400chr12492 379 ----11255
NM_001406chr1721238 434 --1383 --
NM_001407chr31484 --11299 --
NM_001408chr111538 ------
NM_001412chrX62768 1127 616 536 206 146 1603 13219 --
NM_001417chr1231958 1950 1658 ------
NM_001418chr112621 155 2263 102 ----
NM_001418chr112621 155 2263 102 ----
NM_001419chr1994817 4448 4392 4315 2988 1087 841 431 137 24257 2962 ----
NM_001420chr1942501 2470 2224 284 --11192 --
NM_001427chr731947 242 128 ------
NM_001429chr221328 ------
NM_001430chr231544 531 359 1229 ----
NM_001431chr64288 282 276 246 1496 ----
NM_001432chr433688 3164 1444 ------
NM_001438chr1--33112 2864 2760 ----
NM_001448chrX3441 329 156 ------
NM_001452chr61587 ----1549
NM_001463chr22259 228 ------
NM_001483chr72757 101 ------
NM_001491chr632759 2732 2708 ------
NM_001497chr9----31887 981 370 --
NM_001498chr62371 111 --11313 --
NM_001511chr4--1671 ----
NM_001518chr72843 414 11021 ----
NM_001527chr664801 3778 3610 1661 632 64 13736 --14246
NM_001543chr554872 4463 3494 3286 678 14434 14579 14033
NM_001546chr621192 948 1134 ----
NM_001560chrX22078 335 --12099 --
NM_001565chr4--3602 262 110 --1723
NM_001584chr1141102 443 227 104 ------
NM_001587chrX32142 1724 234 ------
NM_001604chr1111012 1818 ----
NM_001608chr22658 193 --1246 --
NM_001609chr1054109 3669 1161 813 458 21386 989 23657 163 --
NM_001614chr171591 --1644 --
NM_001614chr171591 --1644 --
NM_001616chr213077 12206 ----
NM_001619chr11283 62 ------
NM_001629chr132286 254 131 ----
NM_001635chr7141 21063 748 ----
NM_001642chr1131169 1078 263 ------
NM_001650chr1831357 1320 476 33167 823 228 13846 --
NM_001655chr1131943 770 725 ------
NM_001658chr11387 21141 1134 ----
NM_001659chr1221968 688 --22261 1005 --
NM_001660chr32622 187 ------
NM_001663chr1442731 1688 700 320 11960 1161 --
NM_001664chr321060 667 1965 ----
NM_001668chr152184 2087 1820 1799 1774 --12208 --
NM_001677chr11396 ------
NM_001682chr1242162 2005 1122 792 12156 ----
NM_001683chr342303 407 388 367 --1250 12416
NM_001684chr174028 3768 3696 3108 2990 2964 562 --13238 24050 828
NM_001693chr881179 1111 1026 949 514 246 51 45 ------
NM_001699chr1941602 385 335 303 --11440 --
NM_001701chr921506 1494 1565 ----
NM_001704chr61528 1139 ----
NM_001706chr3--2854 797 ----
NM_001709chr1142703 2565 430 145 --11958 --
NM_001717chr1531510 938 134 1578 ----
NM_001718chr611327 ------
NM_001723chr62653 227 ------
NM_001726chr1--1141 ----
NM_001731chr121690 ------
NM_001735chr9172 ------
NM_001742chr71663 ------
NM_001743chr22586 146 ------
NM_001746chr522957 880 --12030 --
NM_001753chr7--1148 ----
NM_001754chr2163264 2940 2876 2754 868 542 ------
NM_001755chr1631888 1768 206 --1416 --
NM_001759chr12135294 5260 5141 4644 3758 3413 1939 1931 1884 1851 1679 1108 75 24831 2046 ----
NM_001760chr61726 1347 ----
NM_001777chr343839 2817 1391 696 23461 842 ----
NM_001789chr321440 538 ------
NM_001792chr183794 277 22 1949 ----
NM_001795chr1621466 1416 ------
NM_001798chr1211022 ------
NM_001799chr51185 ------
NM_001801chr5125 2438 237 ----
NM_001806chr1972890 2495 1095 548 370 208 192 1281 1364 --
NM_001822chr22524 197 1570 --1653
NM_001829chr44868 856 840 137 ------
NM_001830chrX43968 3493 3218 3143 1589 1438 --
NM_001839chr12701 282 ------
NM_001845chr132940 474 ------
NM_001854chr111030 1934 ----
NM_001858chr675175 5007 4988 1848 1778 829 286 34087 2019 588 --11602
NM_001859chr943448 1154 388 299 ------
NM_001881chr102344 24 1359 ----
NM_001895chr2021258 848 ------
NM_001896chr161456 --133 --
NM_001902chr12284 170 1381 ----
NM_001935chr22356 226 153 ----
NM_001936chr71619 ------
NM_001948chr1561283 1115 990 972 829 500 ------
NM_001949chr653197 2801 2052 890 790 22821 638 ----
NM_001954chr62855 214 ------
NM_001962chr54598 423 126 102 ------
NM_001964chr521094 245 --1921 1117
NM_001969chr1453310 3246 1351 664 306 ------
NM_001975chr122789 750 ------
NM_001981chr111495 1892 12319 1392
NM_001982chr12----1226 --
NM_001987chr1253865 3400 2965 627 393 13275 ----
NM_001992chr512089 1599 11409 --
NM_001993chr11165 --21043 782 --
NM_001995chr431425 577 305 11073 1138 1936
NM_001999chr531480 1473 1391 --1549 --
NM_002006chr455830 5518 4873 3642 523 33619 1264 957 --11310
NM_002009chr1542782 1882 867 61 22692 1998 ----
NM_002010chr13------170
NM_002015chr1383180 2978 2087 812 728 482 378 104 12936 ----
NM_002017chr1151034 310 288 132 100 1508 ----
NM_002024chrX11615 32112 862 392 ----
NM_002025chrX89201 9192 9047 6985 2989 1119 1046 98 39153 8942 6435 21112 776 17676
NM_002027chr81475 ------
NM_002035chr1853636 2570 1191 809 101 13732 22463 440 --
NM_002039chr43884 578 350 --1314 1907
NM_002040chr2163115 2824 2744 2556 2115 1056 12196 ----
NM_002044chr1521236 199 ------
NM_002056chr22872 804 1786 ----
NM_002061chr131578 701 219 ------
NM_002065chr131806 700 40 --21393 1361 1616
NM_002069chr73583 326 307 21704 615 ----
NM_002074chr161528 1460 1236 1098 589 252 ------
NM_002076chr1222704 294 32986 2332 261 23117 1114 --
NM_002077chr92761 83 1815 ----
NM_002104chr52181 140 ------
NM_002106chr42319 241 ------
NM_002126chr1793556 3463 2621 1657 1607 1446 1171 1079 977 ------
NM_002128chr1311686 1651 1266 --
NM_002129chr41321 ------
NM_002130chr52427 295 --11619 --
NM_002137chr742167 2044 1992 1476 --22074 1849 --
NM_002138chr41332 1178 ----
NM_002146chr1721387 572 ------
NM_002148chr21141 ------
NM_002151chr191280 ------
NM_002166chr22508 186 --1258 --
NM_002182chr342695 2486 408 232 ------
NM_002202chr51812 ------
NM_002211chr102110 93 ------
NM_002214chr7104666 4540 4197 3639 1845 1354 1267 1069 981 669 13788 ----
NM_002222chr311058 ------
NM_002229chr191455 --1494 --
NM_002232chr121262 537 ------
NM_002241chr11604 21908 667 12321 --
NM_002247chr1042297 428 404 88 1676 12326 --
NM_002264chr374623 4240 4133 3494 3419 483 102 14101 23401 562 --
NM_002265chr172773 749 ------
NM_002267chr1332442 2390 1762 22323 1571 ----
NM_002268chr331499 1243 747 11231 ----
NM_002270chr575537 5121 4137 2165 2108 1995 490 --1592 --
NM_002271chr1332262 1885 883 1963 1531 --
NM_002293chr152063 1817 1090 1048 196 22214 850 12469 --
NM_002310chr552393 1806 705 688 335 --45814 1618 1315 357 15392
NM_002313chr10124800 4723 4713 3575 3481 3420 3239 1698 1017 947 616 288 23587 3379 14856 --
NM_002334chr1142010 1331 1320 683 ------
NM_002355chr1221084 926 ------
NM_002356chr662669 2515 2377 2166 1056 78 ------
NM_002358chr42505 237 --149 --
NM_002374chr233212 2462 1295 --1921 --
NM_002376chr142481 44 ------
NM_002382chr1441142 1109 506 176 ------
NM_002397chr5------11408
NM_002401chr1732205 1635 1558 ------
NM_002408chr142657 205 1631 ----
NM_002430chr2232598 821 721 2984 365 11790 --
NM_002438chr104580 449 158 83 ------
NM_002442chr1241756 1639 1515 1464 ------
NM_002449chr52252 193 ------
NM_002455chr1129 ------
NM_002473chr2221354 349 --1985 --
NM_002480chr12--21048 537 ----
NM_002481chr1117873 7347 7102 5555 5088 3092 2853 1781 994 897 184 12511 27557 6744 --
NM_002482chr14285 192 172 127 --1460 --
NM_002485chr851795 1673 1490 788 754 2666 187 11991 --
NM_002486chr942261 502 429 29 ------
NM_002499chr1552168 1580 1535 975 455 --11543 --
NM_002501chr1933998 2626 2597 23455 231 --14008
NM_002505chr611309 11302 21581 1337 --
NM_002509chr201680 ------
NM_002515chr1431840 606 210 2689 331 ----
NM_002518chr221193 851 --1219 --
NM_002520chr51207 ------
NM_002524chr11297 1179 2822 261 --
NM_002537chr153756 167 141 21009 871 ----
NM_002538chr51605 --1227 --
NM_002542chr31203 ------
NM_002545chr1165013 4053 1244 795 205 124 24114 3587 23129 1305 --
NM_002547chrX54055 4047 3576 2897 49 2964 331 ----
NM_002556chr1131741 745 671 ------
NM_002569chr1531546 1513 1444 1962 ----
NM_002572chr111291 ------
NM_002577chr354053 3792 3460 1598 964 ------
NM_002579chr1921474 140 ------
NM_002581chr985580 5567 4368 4109 3867 3475 1423 1412 35554 5208 1339 ----
NM_002583chr124470 449 251 172 1145 ----
NM_002585chr11396 --1250 --
NM_002590chr13----1529 --
NM_002595chr1271854 1812 1715 1698 1580 1544 205 11771 ----
NM_002601chr22371 37 ------
NM_002605chr1521196 1099 ------
NM_002610chr252786 2495 2468 2182 984 1104 ----
NM_002612chr71279 ------
NM_002645chr1132304 361 333 1696 ----
NM_002648chr631247 967 531 ------
NM_002655chr843860 3807 3442 1650 ------
NM_002657chr2073907 3805 3229 1527 1439 1395 922 1552 ----
NM_002660chr201844 --169 --
NM_002670chr341613 1506 1485 341 ------
NM_002687chr142947 819 1883 ----
NM_002699chr141225 559 549 415 --11239 --
NM_002701chr6296 81 ------
NM_002706chr2141 ------
NM_002707chr23274 268 36 ------
NM_002709chr253517 3106 2390 2289 353 1408 1906 1842
NM_002710chr122759 403 ------
NM_002713chr1--1776 ----
NM_002714chr641097 1035 1007 980 --1156 --
NM_002715chr531243 1010 468 31186 1035 119 1912 --
NM_002716chr1163696 3398 2278 2234 854 585 2222 66 11430 --
NM_002718chr321902 68 1811 21863 305 --
NM_002719chr145468 373 353 315 40 32060 927 521 12005 --
NM_002729chr102560 347 ----1283
NM_002731chr162572 2206 1275 823 647 481 22750 2094 1298 --
NM_002736chr762086 2069 1972 634 485 108 ------
NM_002737chr1766491 4315 4268 4073 2086 1110 --26302 1371 --
NM_002738chr162801 765 ------
NM_002740chr342399 965 465 230 22546 2070 ----
NM_002745chr2253290 3130 3099 67 54 --34120 4108 3024 14279
NM_002748chr151127 1175 ----
NM_002763chr12196 172 ------
NM_002764chrX1834 --1353 --
NM_002778chr10144 ------
NM_002787chr7------1638
NM_002806chr142372 330 ------
NM_002814chrX2181 105 --1633 --
NM_002815chr17--1168 ----
NM_002816chr17181 1295 ----
NM_002819chr1921246 1013 ------
NM_002821chr61234 1600 ----
NM_002822chr1211318 1239 ----
NM_002825chr72607 464 ------
NM_002835chr7--1625 ----
NM_002839chr963569 3384 3247 3195 986 646 ------
NM_002840chr121586 665 11238 ----
NM_002841chr31500 ------
NM_002843chr112990 756 1661 23130 505 13220
NM_002851chr74774 635 570 42 ------
NM_002855chr1143640 639 622 302 --33504 2449 1057 --
NM_002858chr111234 ------
NM_002868chr1242365 2298 2087 398 --11906 --
NM_002869chr1142200 2166 866 804 ------
NM_002880chr31822 199 2805 604 --
NM_002892chr1411416 1692 ----
NM_002897chr2--128 1117 --
NM_002902chr151536 ------
NM_002906chr1141608 1536 829 27 --1189 --
NM_002911chr1961678 1593 547 505 330 93 ------
NM_002912chr61356 ------
NM_002920chr12--1352 ----
NM_002928chr131306 445 88 1312 11362 --
NM_002940chr42700 154 2490 269 ----
NM_002941chr32315 166 21668 1562 --11166
NM_002942chr31175 1348 --1573
NM_002955chr621913 377 ------
NM_002956chr122882 225 1208 ----
NM_002971chr31176 1316 ----
NM_002984chr17--1277 ----
NM_002994chr431861 1299 56 ------
NM_002997chr231488 1222 534 ------
NM_002998chr812252 2864 94 ----
NM_003010chr1721529 697 ----11520
NM_003011chr91122 ----1153
NM_003012chr862712 2305 2243 995 233 137 2821 450 ----
NM_003014chr721406 938 ------
NM_003015chr10--196 1722 --
NM_003016chr1711684 ------
NM_003017chr61491 1968 --11176
NM_003022chrX1464 ----1126
NM_003028chr962756 2679 1202 1176 405 363 ------
NM_003029chr12542 480 11417 ----
NM_003030chr351819 1721 694 254 227 ------
NM_003031chr163918 903 374 ------
NM_003034chr1287965 6820 6316 5965 5803 5282 2522 449 16667 150 --
NM_003036chr121025 493 ------
NM_003042chr342270 1775 1418 362 --1533 --
NM_003043chr354221 3849 3811 1456 1012 --12801 --
NM_003045chr1344785 3134 1868 782 --21628 182 1963
NM_003048chr22885 667 ------
NM_003069chrX1261 ------
NM_003070chr91328 ------
NM_003071chr321394 540 --11623 --
NM_003074chr332181 2126 1860 --1756 --
NM_003076chr1221148 654 --1546 --
NM_003077chr171683 ----1551
NM_003079chr17161 --1730 --
NM_003082chr1431050 292 37 ------
NM_003093chr63174 86 32 ------
NM_003099chr1552312 1497 1305 416 332 --1794 --
NM_003100chr51123 ------
NM_003101chr13606 585 522 ------
NM_003106chr3----1936 --
NM_003107chr642440 472 424 150 ------
NM_003108chr265569 2857 2130 1999 1800 806 26754 4478 15050 --
NM_003111chr231244 1000 199 173 ----
NM_003112chr711042 1107 ----
NM_003113chr22805 738 --1258 --
NM_003115chr11113 ------
NM_003118chr531975 709 482 11345 ----
NM_003131chr6171 ------
NM_003133chr11890 1177 ----
NM_003136chr141306 1251 ----
NM_003137chr632229 1434 505 ----11811
NM_003140chrY1100 ------
NM_003142chr2139 ------
NM_003144chr631618 810 198 12177 ----
NM_003145chr1----1468 --
NM_003150chr1722338 232 1357 --11457
NM_003155chr812611 12393 ----
NM_003161chr1712874 1917 12601 --
NM_003162chr23407 270 164 ------
NM_003174chr101334 1118 ----
NM_003178chr32209 109 ------
NM_003188chr61856 ------
NM_003199chr1844914 3752 3678 1847 35664 5656 4378 ----
NM_003211chr121188 ------
NM_003214chr611280 --11017 --
NM_003216chr2213083 12648 22713 2109 12945
NM_003221chr664220 4130 3515 3210 994 746 13048 21353 260 1203
NM_003224chr202855 130 --2763 113 --
NM_003234chr331665 715 529 ----12059
NM_003236chr263157 3027 2782 2643 633 426 --12925 --
NM_003246chr1511894 1176 ----
NM_003247chr6----32033 1764 132 --
NM_003253chr212135 117 11848 11618 --
NM_003257chr153977 903 347 --1896 --
NM_003269chr61470 --1964 --
NM_003274chr2152737 2714 2220 1898 1198 1171 ----
NM_003275chr92136 120 ------
NM_003286chr201388 ------
NM_003291chr132299 203 197 ----
NM_003298chr356065 5947 4332 2275 293 12050 1795 --
NM_003305chr41148 ------
NM_003317chr141203 --1323 --
NM_003318chr61201 ------
NM_003320chr1143880 3022 1554 1242 14331 23542 1060 --
NM_003336chrX1141 1269 ----
NM_003337chr5192 1269 ----
NM_003338chr1031872 235 50 ------
NM_003339chr511630 --11567 --
NM_003342chr1753315 2807 2409 1276 1098 1594 1390 1802
NM_003344chr751505 1338 1175 702 110 --21216 1089 --
NM_003347chr2231839 610 145 ------
NM_003348chr1211414 ----11121
NM_003349chr2021409 1215 ------
NM_003350chr811011 1170 ----
NM_003352chr22715 60 1165 1831 --
NM_003359chr421123 989 --1935 --
NM_003368chr12813 126 ----1241
NM_003370chr191663 ------
NM_003371chr972161 2136 2119 1896 1839 1634 1626 ----11959
NM_003372chrX2710 31 1701 ----
NM_003376chr621381 1293 ------
NM_003376chr621381 1293 ------
NM_003387chr21369 ------
NM_003390chr1131059 883 776 ------
NM_003392chr353338 3285 1212 79 72 ----1932
NM_003394chr122717 505 --1637 --
NM_003400chr22666 614 ------
NM_003403chr141559 ------
NM_003405chr221540 ------
NM_003406chr841909 1397 1332 149 1206 ----
NM_003409chr1821307 1197 ------
NM_003410chrX32621 2060 1237 11163 12251 --
NM_003411chrY31628 671 419 ------
NM_003412chr31356 ------
NM_003413chrX51988 1923 1712 691 147 ------
NM_003432chr52515 42 ------
NM_003439chr752997 2853 2640 2182 661 ------
NM_003442chr112670 95 ------
NM_003452chr93896 879 710 --1382 --
NM_003453chr134517 502 483 186 ------
NM_003457chr171245 ------
NM_003467chr21436 2446 367 ----
NM_003468chr243570 1391 630 146 --13013 1869
NM_003470chr16----21436 539 --
NM_003472chr61304 11506 ----
NM_003474chr1031789 1562 265 12035 --11479
NM_003478chr1123034 2154 13044 2638 324 --
NM_003482chr1252471 2358 1776 987 579 12465 ----
NM_003483chr1232816 2658 287 1761 ----
NM_003489chr2142754 2325 2294 574 1860 ----
NM_003506chr821201 1111 ------
NM_003507chr241858 1507 1327 142 ------
NM_003557chr131636 484 436 --11215 --
NM_003558chr91725 1145 ----
NM_003559chr1721256 348 13049 --1777
NM_003563chr1711260 11187 ----
NM_003566chr1243118 2248 1187 615 1852 ----
NM_003574chr1874434 4185 3940 1863 967 292 279 34787 941 820 --14769
NM_003576chr1362777 2695 2109 2014 617 24 12923 12197 --
NM_003580chr82434 130 2517 449 ----
NM_003583chr1233653 3492 1492 12635 11042 --
NM_003589chr134970 341 309 209 ------
NM_003590chr243686 683 260 62 21272 1175 ----
NM_003591chr101117 ------
NM_003592chr71469 ------
NM_003597chr261931 1505 1492 375 221 136 1627 --11623
NM_003603chr41387 1644 ----
NM_003607chr174211 4079 3882 2972 2889 1643 811 12983 23362 2782 --
NM_003613chr153667 212 102 ------
NM_003615chr363683 2977 871 816 529 116 ----1205
NM_003617chr164745 4500 4203 4021 3617 3525 11832 ----
NM_003618chr231287 1205 1164 ------
NM_003620chr172802 24 1876 ----
NM_003629chr163372 3022 2985 1124 464 263 --2182 28 --
NM_003633chr532543 2078 606 --12301 --
NM_003648chr222473 1867 1441 --12039
NM_003654chr113787 560 45 ------
NM_003659chr2--2135 50 ----
NM_003663chr372522 2140 1109 1054 1010 845 268 22377 482 ----
NM_003671chr973576 3293 3089 2803 2269 847 375 12981 ----
NM_003672chr12477 30 ------
NM_003685chr192928 837 ------
NM_003687chr5--11067 ----
NM_003692chr91244 11031 ----
NM_003701chr132709 212 ------
NM_003711chr5138 ------
NM_003714chr522454 2366 ------
NM_003716chr31714 ------
NM_003722chr322371 567 22613 2459 ----
NM_003743chr212052 ------
NM_003744chr1431151 1094 898 ------
NM_003749chr1332216 1682 99 1295 ----
NM_003759chr433051 3014 2784 33691 1398 356 ----
NM_003762chr121439 189 ------
NM_003763chr2052944 2808 2020 425 187 ------
NM_003766chr17------1509
NM_003772chr1121332 827 1153 ----
NM_003774chr1243210 1185 939 545 --12438 --
NM_003781chr351607 1554 1245 382 226 --11277 --
NM_003787chr1821187 682 ------
NM_003794chr32428 204 ------
NM_003795chr6--1605 ----
NM_003796chr192471 128 ------
NM_003816chr821499 72 --11043 --
NM_003819chr13265 239 195 ------
NM_003822chr153131 3091 2943 2619 2348 --22019 328 11983
NM_003825chr154612 531 161 83 1258 1286 1236
NM_003831chr1821757 1548 ------
NM_003861chr1462728 1921 1875 599 377 318 11087 ----
NM_003872chr272365 2001 1022 888 859 569 241 ------
NM_003873chr1041784 1013 591 517 12311 ----
NM_003884chr351780 1714 1568 1317 648 ------
NM_003885chr1752484 2303 2015 590 136 ------
NM_003887chr22748 111 11589 --1189
NM_003895chr2122065 1648 1660 1788 --
NM_003899chr1331854 791 380 12339 ----
NM_003901chr1031975 180 155 --150 --
NM_003902chr1--2790 731 ----
NM_003905chr161105 ------
NM_003908chr201321 21062 534 ----
NM_003909chr8--33021 2440 2334 12093 11874
NM_003913chr654124 3523 3466 3026 394 53717 1250 1007 859 325 ----
NM_003916chrX1386 ------
NM_003932chr2251799 1778 1640 697 208 ------
NM_003934chr971259 1239 1160 498 325 309 71 ------
NM_003948chr452509 2397 1690 423 100 12706 22325 288 --
NM_003957chr1131012 821 772 ------
NM_003966chr567364 6405 5852 3109 2689 1327 21556 546 11935 12885
NM_003971chr172593 416 1574 ----
NM_003980chr63935 110 100 11378 11368 1526
NM_003994chr1274003 3556 3274 2845 2780 1389 131 22936 1498 ----
NM_004006chrX62416 2117 1951 1879 262 119 32512 2497 668 ----
NM_004007chrX62416 2117 1951 1879 262 119 32512 2497 668 ----
NM_004009chrX62416 2117 1951 1879 262 119 32512 2497 668 ----
NM_004010chrX62416 2117 1951 1879 262 119 32512 2497 668 ----
NM_004011chrX62416 2117 1951 1879 262 119 32512 2497 668 ----
NM_004012chrX62416 2117 1951 1879 262 119 32512 2497 668 ----
NM_004013chrX62416 2117 1951 1879 262 119 32512 2497 668 ----
NM_004014chrX62416 2117 1951 1879 262 119 32512 2497 668 ----
NM_004015chrX62416 2117 1951 1879 262 119 32512 2497 668 ----
NM_004016chrX62330 2031 1865 1793 176 33 32426 2411 582 ----
NM_004017chrX62416 2117 1951 1879 262 119 32512 2497 668 ----
NM_004018chrX62330 2031 1865 1793 176 33 32426 2411 582 ----
NM_004020chrX62416 2117 1951 1879 262 119 32512 2497 668 ----
NM_004021chrX62330 2031 1865 1793 176 33 32426 2411 582 ----
NM_004022chrX62330 2031 1865 1793 176 33 32426 2411 582 ----
NM_004023chrX62330 2031 1865 1793 176 33 32426 2411 582 ----
NM_004028chr1831357 1320 476 33167 823 228 13846 --
NM_004034chr103609 488 187 ------
NM_004047chr1----151 --
NM_004050chr1422169 584 ----21758 419
NM_004067chr731506 1048 92 ------
NM_004075chr122571 144 ------
NM_004080chr7--11430 1601 --
NM_004081chrY51180 283 254 151 129 ------
NM_004086chr14--1568 ----
NM_004087chr362059 1396 1346 1301 1269 373 --1610 11251
NM_004089chrX21173 54 ------
NM_004093chr1343171 2895 2524 837 13263 --12123
NM_004094chr1443068 889 658 78 12387 ----
NM_004096chr1011976 11403 ----
NM_004098chr10--11121 ----
NM_004100chr61226 --12707 1879
NM_004105chr21952 ------
NM_004107chr191180 ------
NM_004112chr1711454 ------
NM_004113chr32762 440 ------
NM_004114chrX41182 470 454 367 --21088 984 --
NM_004124chr1433455 1382 1367 ------
NM_004130chr32645 573 ----1108
NM_004133chr8--22479 2042 ----
NM_004136chr1532563 2504 1219 --12189 --
NM_004145chr192378 353 ------
NM_004157chr32792 746 ------
NM_004161chr241496 1290 1280 457 ------
NM_004169chr172547 152 ------
NM_004170chr951740 749 353 238 172 11404 ----
NM_004171chr11109517 8883 8768 8637 6712 6078 5826 3472 417 280 ----18394
NM_004175chr222174 151 ------
NM_004180chr23404 181 51 ------
NM_004187chrX31299 1285 927 ------
NM_004200chr1123062 626 ------
NM_004205chr112539 533 ------
NM_004215chr81212 ------
NM_004229chrX31853 355 320 32209 1652 1470 ----
NM_004232chr1853508 3380 2771 1264 213 1669 21511 188 --
NM_004237chr52719 580 1920 ----
NM_004242chr61359 ------
NM_004252chr171151 1453 ----
NM_004263chr271622 1347 1136 515 418 147 106 ------
NM_004272chr52647 585 11665 11396 --
NM_004274chr1473187 2902 2295 1062 1038 258 174 11162 1215 13076
NM_004279chr751987 797 569 335 178 2879 770 11458 --
NM_004281chr10193 ------
NM_004293chr953265 1111 101 45 26 --12700 --
NM_004305chr23166 146 82 --165 --
NM_004311chr1021978 435 12969 13038 --
NM_004316chr1231060 885 412 1459 ----
NM_004319chr142989 2560 638 177 12841 1554 --
NM_004323chr92547 192 ----1143
NM_004326chr141034 1027 757 324 ------
NM_004329chr1041443 1346 256 231 ----1100
NM_004337chr831864 1501 61 ------
NM_004338chr1835861 2155 1979 57045 6951 5734 4375 2440 ----
NM_004342chr7--1880 ----
NM_004343chr191138 ------
NM_004346chr42522 23 ------
NM_004354chr4--1653 ----
NM_004364chr1931133 1056 1039 --11180 --
NM_004379chr211242 11366 --1625
NM_004380chr1661948 958 662 275 206 37 1981 2235 75 12193
NM_004384chr531988 369 308 ------
NM_004385chr51250 128 ----
NM_004386chr1952227 1711 1613 868 731 ------
NM_004392chr1362483 1830 934 686 167 128 2732 241 21816 553 --
NM_004393chr312362 --11459 --
NM_004396chr171189 1221 ----
NM_004397chr1154303 3513 261 247 86 23200 2800 ----
NM_004414chr2131359 313 299 21433 501 ----
NM_004415chr62824 610 ------
NM_004423chr322643 2016 ------
NM_004428chr11758 1611 --1168
NM_004430chr832405 2231 1841 12256 ----
NM_004432chr932388 1554 225 12001 ----
NM_004437chr1102587 2438 1405 1230 1191 1111 1026 903 589 268 --1918 --
NM_004438chr221136 1062 12769 ----
NM_004439chr41155 1175 ----
NM_004440chr621806 1723 ------
NM_004442chr121446 289 ----11138
NM_004449chr2121106 1022 11323 ----
NM_004454chr322128 72 --22148 1925 1587
NM_004458chrX22642 1652 ----151
NM_004459chr171227 11349 ----
NM_004463chrX1147 ------
NM_004464chr424125 428 14079 23091 2745 --
NM_004480chr141259 ------
NM_004481chr122097 582 --12014 --
NM_004491chr1944266 4183 2997 921 11685 ----
NM_004497chr19----1588 --
NM_004500chr1471717 1289 687 570 334 284 118 ------
NM_004501chr174085 2650 1189 960 556 250 64 13325 ----
NM_004502chr171204 ------
NM_004504chr232480 648 477 ------
NM_004506chr6----1681 --
NM_004514chr171805 1566 22430 1926 --
NM_004516chr1931007 977 401 --11027 --
NM_004523chr101544 1529 ----
NM_004524chr171240 ------
NM_004529chr941302 965 83 53 ------
NM_004535chr2031435 476 251 1484 11471 1311
NM_004538chrX2804 734 ------
NM_004543chr22156 106 190 ----
NM_004569chr142206 193 --170 1722
NM_004571chr2143399 3273 2841 1285 --1764 --
NM_004575chr411460 11206 --1566
NM_004576chr51285 ------
NM_004583chr171747 ------
NM_004586chrX35435 4874 3811 35340 4296 1267 ----
NM_004593chr32771 299 2210 162 ----
NM_004596chr191216 ------
NM_004598chr533083 1299 1104 12733 ----
NM_004599chr221453 ------
NM_004600chr121331 366 1379 ----
NM_004612chr9114458 4048 3437 3182 1602 1558 1464 1306 785 592 54 ------
NM_004630chr1131102 890 736 --11208 --
NM_004642chr122459 219 190 ----
NM_004660chrY22187 2006 ------
NM_004663chr1511163 --11453 --
NM_004664chr12----1265 --
NM_004670chr1021458 1186 11711 ----
NM_004673chr131472 991 251 ------
NM_004687chr1711382 11852 11586 --
NM_004696chr1------2857 814
NM_004697chr9296 53 ------
NM_004701chr152158 121 ------
NM_004703chr172525 39 12155 --12038
NM_004709chrX41643 333 178 143 11762 ----
NM_004710chr173777 383 238 ------
NM_004717chr721183 367 ----11192
NM_004723chr12690 682 --1403 --
NM_004725chr1021328 144 1577 ----
NM_004726chrX104294 4256 4202 4121 3711 3540 1085 675 621 345 ------
NM_004730chr542002 1813 1467 1366 ----21610 1425
NM_004731chr122616 89 ------
NM_004734chr1312767 31214 385 242 1649 --
NM_004736chr151929 1910 620 415 388 --135 --
NM_004738chr2022657 743 22300 1016 ----
NM_004739chr111657 1577 --1632
NM_004742chr321650 1374 --21759 1412 --
NM_004744chr453802 1576 1044 849 622 --13609 --
NM_004745chr826666 639 55252 4363 2616 1416 290 26513 4396 --
NM_004748chr1544178 3795 2571 1057 11273 ----
NM_004755chr141387 1440 1312 --
NM_004758chr173967 954 315 --11062 --
NM_004760chr731974 1609 741 12399 ----
NM_004768chr111068 ------
NM_004772chr511357 ------
NM_004774chr1733084 2028 1026 1951 23047 2519 --
NM_004781chr111121 ------
NM_004781chr111121 ------
NM_004792chr2183 ------
NM_004796chr1452448 2166 611 557 244 132 ----
NM_004798chr2032660 499 359 ----12716
NM_004801chr2--1240 ----
NM_004805chr21299 ------
NM_004822chr171962 ------
NM_004824chr641060 381 346 300 ------
NM_004831chr193860 694 443 11020 ----
NM_004834chr243146 1246 738 389 1977 23215 139 --
NM_004841chr12795 319 ------
NM_004845chrX53934 2947 1201 1117 158 --13068 --
NM_004850chr21510 ------
NM_004855chr151212 ------
NM_004856chr151421 ------
NM_004857chr1434642 4135 1009 ------
NM_004859chr1762620 2042 1938 1185 853 98 ------
NM_004860chr171461 ------
NM_004862chr1621166 83 11271 ----
NM_004863chr1455267 5121 3446 3363 1135 31279 769 524 24012 713 --
NM_004869chr181142 --11595 --
NM_004871chr1774279 3458 3398 3039 1384 291 191 24361 2806 --1239
NM_004874chr8--2191 184 ----
NM_004879chr113906 633 237 ------
NM_004884chr1551732 1518 1284 1247 416 ------
NM_004895chr12501 35 ------
NM_004896chr1021421 1200 ------
NM_004898chr462841 2741 2608 2271 1870 356 11940 --11000
NM_004902chr202699 211 ------
NM_004904chr796092 5862 2518 2126 1891 1021 606 241 108 --16297 --
NM_004926chr1431686 1664 641 ------
NM_004930chr14638 248 218 68 ------
NM_004947chr322080 1687 --1244 --
NM_004949chr1851781 1347 780 640 311 ------
NM_004958chr12724 304 1736 ----
NM_004960chr163237 100 22 ------
NM_004969chr101548 ------
NM_004972chr92821 456 ------
NM_004973chr651556 1393 1254 301 126 11381 ----
NM_004976chr1124761 3536 --33881 3632 844 1490
NM_004985chr1284358 3961 2961 1528 1338 544 425 207 14176 ----
NM_004992chrX157944 7428 7039 7015 6636 6310 6253 5804 5759 5316 2752 1952 1827 932 398 11969 38374 7074 3057 --
NM_004992chrX157944 7428 7039 7015 6636 6310 6253 5804 5759 5316 2752 1952 1827 932 398 11969 38374 7074 3057 --
NM_004993chr1471015 550 537 503 484 361 232 ----1583
NM_004999chr674387 2875 1685 1061 965 791 312 --13170 12846
NM_005010chr712127 1418 ----
NM_005011chr741618 1607 1339 28 ------
NM_005016chr122233 94 ------
NM_005020chr71553 1586 ----
NM_005022chr171216 ------
NM_005023chr521089 615 ----1221
NM_005027chr1921195 1073 --21141 137 --
NM_005036chr2278349 8211 6005 5829 3172 1927 946 11169 17684 26096 2586
NM_005045chr71845 ------
NM_005053chr191568 ------
NM_005054chr221410 1279 11214 ----
NM_005056chr12114539 3823 3744 3686 3628 3570 2190 2160 1978 1812 1805 --14955 --
NM_005063chr1033430 950 51 --33630 989 812 --
NM_005065chr14--1352 11400 --
NM_005067chr32965 62 1799 ----
NM_005076chr132684 307 111 14214 12668 --
NM_005077chr91413 ------
NM_005080chr221652 --1725 --
NM_005087chr3129 1277 ----
NM_005088chrX2721 576 ------
NM_005093chr2085235 5180 4713 1668 1373 1349 1213 798 ------
NM_005095chr132181 1575 199 1219 22210 872 --
NM_005105chr13794 157 27 ------
NM_005109chr352562 2382 786 560 139 ------
NM_005116chr2064362 4009 3387 3272 949 898 24288 3246 11648 --
NM_005119chr131243 977 837 ------
NM_005120chrX1170 ------
NM_005121chr171392 13519 --11456
NM_005126chr321948 1533 ------
NM_005131chr18179 ------
NM_005133chr111320 --1371 --
NM_005134chr183909 845 360 ------
NM_005135chr1543872 3785 3589 33 23745 1344 2897 821 --
NM_005156chr9115085 5055 4697 4033 3577 3401 2003 1413 1272 986 583 1868 --24140 1202
NM_005157chr911932 ----11606
NM_005163chr145719 666 231 206 80 ------
NM_005168chr24715 610 472 335 ------
NM_005171chr12--11151 ----
NM_005184chr1951605 1537 1275 95 33 ------
NM_005188chr11147877 7083 6306 3280 3075 2781 2438 1831 1749 1554 1425 1221 713 612 25775 2535 11321 12944
NM_005190chr63802 415 215 ------
NM_005197chr1485079 4989 4010 3856 1861 1553 1333 755 --21453 123 --
NM_005203chr10--168 ----
NM_005204chr10156 ----2361 205
NM_005206chr1731077 1028 498 1505 ----
NM_005207chr22103482 3476 3276 2883 2507 1221 912 549 514 220 ------
NM_005215chr181507 ------
NM_005224chr194608 588 457 252 ------
NM_005231chr1161320 1054 266 250 86 79 --169 --
NM_005233chr322163 668 11657 ----
NM_005235chr266604 5039 2371 1110 963 646 27699 631 --16396
NM_005238chr1142989 2833 2172 963 --11037 --
NM_005241chr321263 979 ------
NM_005245chr42741 70 ----1190
NM_005252chr141617 ------
NM_005256chr11--1623 ----
NM_005259chr2--11541 146 --
NM_005264chr102291 67 ------
NM_005273chr71310 ------
NM_005277chr411509 31270 650 553 ----
NM_005308chr101189 ------
NM_005311chr722882 2514 22705 417 ----
NM_005312chr942101 1802 276 270 --1258 --
NM_005313chr152361 209 11046 ----
NM_005316chr1141050 743 403 25 ------
NM_005318chr222812 415 ------
NM_005328chr81588 1615 ----
NM_005329chr1622237 2127 21497 231 21745 383 1778
NM_005333chrX21271 206 ------
NM_005338chr74642 634 431 206 14061 ----
NM_005339chr424349 753 --11592 --
NM_005342chrX22783 265 32618 2494 383 ----
NM_005349chr42574 482 ------
NM_005354chr192490 477 1662 2654 561 --
NM_005358chr1321855 1842 11495 --1369
NM_005359chr1875434 5126 4437 4255 2271 1502 849 34936 2409 397 ----
NM_005373chr11515 11499 ----
NM_005374chr1752398 2261 1872 1533 386 --22414 902 --
NM_005375chr62860 344 ----130
NM_005381chr24396 299 172 54 ------
NM_005387chr112677 235 ------
NM_005392chr941903 1725 1359 1166 ------
NM_005398chr1031154 910 469 ------
NM_005399chr164421 4344 4046 3469 1315 865 13365 1485 1281
NM_005400chr282760 2750 2244 1961 1063 680 601 325 22508 2010 1202 --
NM_005406chr1841538 1198 327 168 ------
NM_005407chr1411475 1109 --11355
NM_005414chr3143 ------
NM_005426chr13930 781 279 1358 ----
NM_005433chr1832353 2089 552 12666 ----
NM_005436chr1043691 3464 3421 887 ------
NM_005437chr1041233 1103 1031 114 1977 1434 --
NM_005443chr41192 ------
NM_005445chr101324 1102 ----
NM_005450chr17------1103
NM_005461chr2031816 1505 1450 ------
NM_005475chr1231066 338 229 13312 1431 --
NM_005476chr921185 58 1134 ----
NM_005477chr1522068 742 ----1334
NM_005477chr1522068 742 ----1334
NM_005487chr2231907 1427 101 ------
NM_005493chr61114 ------
NM_005494chr71499 ------
NM_005497chr1765121 4708 4219 2246 1516 770 23773 203 ----
NM_005499chr19--1528 ----
NM_005502chr912798 ------
NM_005506chr442732 1085 1054 220 --12910 --
NM_005509chr52663 281 ----1546
NM_005521chr102806 164 ----1729
NM_005530chr151393 1182 ----
NM_005537chr13--2955 169 ----
NM_005539chr1031296 534 225 1315 ----
NM_005542chr731925 1441 1413 11912 ----
NM_005544chr2--1848 --1689
NM_005565chr52467 125 ------
NM_005576chr152295 226 ------
NM_005585chr151388 ------
NM_005596chr966261 6232 5456 4578 1173 810 ----12238
NM_005597chr19182 ------
NM_005599chr161455 1361 1086 335 310 153 --11097 --
NM_005602chr3----1958 --
NM_005604chr662386 1849 1738 691 491 101 1906 ----
NM_005607chr8147 --1917 --
NM_005610chr13656 154 75 1603 ----
NM_005611chr1611027 11129 ----
NM_005625chr81204 ------
NM_005627chr62695 21 ----1199
NM_005631chr721086 414 ------
NM_005634chrX3462 451 160 ----1687
NM_005637chr1862016 1925 1723 1617 1595 1429 21499 607 ----
NM_005638chrX21403 686 ------
NM_005639chr12--21594 1377 ----
NM_005644chr11340 ------
NM_005647chrX63302 3131 2141 563 431 155 22710 2680 ----
NM_005656chr2121237 56 1593 --1488
NM_005657chr15263 23 ------
NM_005662chr81391 ------
NM_005665chr184947 3717 3337 3101 1842 1780 821 248 1427 ----
NM_005668chr574565 4160 3847 2845 1687 1608 1380 44326 3754 1483 634 ----
NM_005686chr111577 1488 ----
NM_005688chr321017 445 1221 1514 --
NM_005708chr133328 155 110 ------
NM_005715chr662635 2245 190 163 154 50 12016 ----
NM_005717chr131018 942 318 11084 ----
NM_005721chr25879 252 245 92 84 ------
NM_005722chr242377 2303 626 570 11765 1683 --
NM_005725chr122021 531 1772 11870 --
NM_005730chr1252708 2421 1355 1206 768 --1727 11309
NM_005731chr21353 ----198
NM_005736chr101498 ------
NM_005737chr232857 2762 507 11813 ----
NM_005738chr721434 656 --138 --
NM_005739chr1572407 2055 1803 1649 896 375 172 ------
NM_005740chr224916 857 834 86 --1825 --
NM_005746chr712522 --11817 1654
NM_005748chr12103477 3349 3074 2893 2626 2295 886 623 604 455 --12588 --
NM_005752chr1611126 21226 301 ----
NM_005756chrX31076 238 185 --11377 --
NM_005759chr284422 3888 1898 1741 1560 1456 826 388 24028 3929 ----
NM_005776chr14--1178 ----
NM_005779chr562706 1252 440 430 424 410 12719 ----
NM_005780chr132920 367 ------
NM_005786chr1831297 1265 230 --1126 --
NM_005789chr171339 2622 296 --12112
NM_005798chr1384055 3676 3529 3327 2077 1633 333 25 1948 14292 12004
NM_005801chr172745 738 1814 ----
NM_005813chr262223 2101 1691 542 248 70 ------
NM_005822chr681909 1718 1711 1469 817 370 274 216 ------
NM_005826chr12598 448 ------
NM_005828chr1784767 3413 3348 1911 1645 1594 1531 1333 14455 14028 11611
NM_005832chr3149 ----1218
NM_005839chr14801 676 349 328 ------
NM_005840chrX106981 6573 5607 4889 2661 2405 2088 1076 372 176 12998 --1411
NM_005841chr43925 387 82 ------
NM_005843chr241537 1322 700 162 ------
NM_005857chr121057 947 1976 ----
NM_005859chr5----11485 --
NM_005863chr103523 134 66 --1280 --
NM_005868chr722291 2277 11591 ----
NM_005869chr51126 ------
NM_005880chr1621245 557 159 ----
NM_005882chr4--1344 1959 --
NM_005895chr1244071 3274 3195 1045 22765 2629 12640 13508
NM_005897chr11108 ----1869
NM_005898chr1152753 2385 2135 2072 91 1127 ----
NM_005900chr421111 487 --11190 1452
NM_005901chr18148691 8365 8296 7877 7623 6293 6247 6200 6125 2807 2147 1594 1378 657 57341 7297 5311 3068 1363 11658 28461 2840
NM_005903chr5125161 4748 4217 3995 3960 2093 2086 2038 1009 622 580 384 14567 14546 --
NM_005904chr181214 11094 1136 --
NM_005907chr61660 1117 11281 --
NM_005909chr51564 22845 1421 --11267
NM_005911chr231501 1088 954 ----11458
NM_005923chr61516 ------
NM_005924chr71327 ------
NM_005933chr1112504 12303 1502 --
NM_005934chr1932463 1021 544 12118 ----
NM_005935chr475216 4191 3936 3673 3637 1780 453 24200 1238 14068 --
NM_005937chr1744160 3647 1539 1525 ----13560
NM_005938chrX1218 ------
NM_005941chr831127 415 212 21487 731 ----
NM_005943chr611066 --11136 --
NM_005944chr311145 ------
NM_005955chr123930 1629 24990 397 23488 766 --
NM_005969chr11--21194 190 --11079
NM_005986chr136717 629 582 295 241 220 --22298 2257 --
NM_005990chr562750 2651 2633 1924 542 426 ----12083
NM_005994chr17------1893
NM_005996chr1251516 1159 1046 1040 1032 1603 11524 1499
NM_005999chr121517 1486 ------
NM_006007chr984465 4428 3982 3811 1517 1181 1063 99 33971 1253 932 --1792
NM_006009chr121187 ------
NM_006011chr15--14223 1108 11260
NM_006015chr131111 1094 820 ------
NM_006016chr642182 2170 2113 706 11650 ----
NM_006037chr294755 3358 3090 1730 1692 1352 957 503 24 24355 996 34768 4727 716 --
NM_006038chr2051887 1879 1822 1611 286 --31641 854 273 --
NM_006047chr2053514 995 627 304 67 ------
NM_006048chr12849 237 ------
NM_006054chr1131463 458 137 1352 --11123
NM_006055chr243055 2185 908 751 13214 11215 --
NM_006064chrX1371 ------
NM_006079chr61156 ------
NM_006080chr71692 22325 973 ----
NM_006089chrX1271 21900 654 ----
NM_006090chr12765 34 ------
NM_006091chr15121 21822 1442 ----
NM_006092chr7128 ------
NM_006094chr852218 1735 840 418 79 --11488 --
NM_006095chr474356 4101 4048 3643 3318 3181 1375 11427 ----
NM_006100chr31244 1591 ----
NM_006106chr1153250 1353 879 778 722 188 ----
NM_006107chr17--1339 ----
NM_006108chr1132076 1628 571 1103 11564 --
NM_006109chr143333 319 46 ------
NM_006113chr132056 634 267 ------
NM_006135chr11180 --1124 --
NM_006139chr252569 2438 1781 755 556 12674 11864 --
NM_006141chr163980 939 396 --12171 12221
NM_006145chr192182 130 ------
NM_006147chr12482 459 ------
NM_006148chr1762594 2573 2365 2291 762 313 12191 2709 219 --
NM_006153chr31242 ------
NM_006159chr122620 43 ------
NM_006177chr1411103 --175 1366
NM_006180chr942139 1933 1696 1365 1561 ----
NM_006183chr121432 1168 ----
NM_006186chr21477 ------
NM_006190chr221092 429 1785 ----
NM_006191chr123967 759 81 ------
NM_006202chr1931313 146 135 ------
NM_006203chr554813 1596 1539 1267 1107 1697 --15527
NM_006224chr1732384 1748 537 1399 ----
NM_006228chr82397 355 ------
NM_006235chr1111324 ------
NM_006237chr133853 318 300 11436 ----
NM_006241chr362406 2066 2003 1955 685 74 22288 1855 11838 --
NM_006246chr1421194 75 1239 ----
NM_006251chr542765 1281 964 417 ------
NM_006252chr157041 6252 4737 2282 2143 14664 42996 2230 1868 1256 --
NM_006256chr122367 893 ----11933
NM_006258chr102263 192 ------
NM_006265chr841505 1476 1386 334 ------
NM_006267chr231192 726 670 ------
NM_006268chr1141036 865 743 388 ------
NM_006275chr2031907 1621 343 32193 1916 849 ----
NM_006277chr21138 ------
NM_006282chr2074713 4404 2962 1058 994 588 338 ------
NM_006284chr11--157 ----
NM_006291chr1422047 1716 --187 --
NM_006306chrX75907 5879 3828 1937 1812 1661 835 12145 ----
NM_006313chr1231599 1372 658 ------
NM_006320chr4--1965 ----
NM_006321chr351951 1638 1365 270 159 --11999 --
NM_006327chr101262 ------
NM_006329chr142721 510 ------
NM_006333chr2--1477 ----
NM_006352chr121495 1448 --1551 --
NM_006359chrX52324 2170 483 344 190 12514 ----
NM_006364chr143816 807 229 1795 --1940
NM_006366chr621237 846 ------
NM_006367chr11900 --3439 68 21 --
NM_006371chr3105283 4921 4749 4411 3865 2057 1932 1905 1790 402 34247 552 276 ----
NM_006372chr6------1473
NM_006379chr732109 813 568 ------
NM_006380chr1753705 3369 3278 1514 1242 14137 14256 --
NM_006386chr2282460 2322 2117 1851 1830 1554 1508 605 ------
NM_006387chr191251 199 ----
NM_006393chr1043199 2918 2804 1331 23349 3319 13680 --
NM_006416chr61763 ------
NM_006420chr2033413 2829 294 --1447 --
NM_006421chr811164 ------
NM_006434chr1053003 2996 1156 853 716 ------
NM_006439chr41212 1484 ----
NM_006449chr21512 2534 491 21618 107 --
NM_006451chr5--1801 ----
NM_006459chr1051646 1638 575 319 22 ------
NM_006460chr172219 180 --21229 639 --
NM_006464chr284668 4491 3857 3653 1635 920 914 250 --12984 --
NM_006469chr131526 1284 392 ------
NM_006472chr12827 353 1795 --1488
NM_006474chr1--12022 ----
NM_006482chr1233653 3492 1492 12635 11042 --
NM_006489chr1431840 606 210 2689 331 ----
NM_006496chr131356 689 368 ------
NM_006526chr2022002 1415 11641 ----
NM_006529chr431496 1284 610 ------
NM_006534chr2033199 3006 790 13159 --1576
NM_006537chr15155 ------
NM_006538chr264038 3727 588 332 309 260 --23470 108 1898
NM_006539chr161533 ------
NM_006544chr1485974 5686 5502 4225 1596 387 335 167 25086 2281 2487 342 --
NM_006546chr1736615 6587 341 1884 14378 --
NM_006547chr741681 1669 1309 758 1470 ----
NM_006561chr1086173 5921 4421 2066 2026 1885 1574 833 14306 1166 --
NM_006572chr1762747 2734 2520 2183 603 50 22600 613 ----
NM_006575chr1421454 996 ----1419
NM_006591chr113500 156 123 1284 ----
NM_006593chr2----1238 --
NM_006599chr16118151 6432 5621 1753 1710 1653 1590 1367 812 670 377 47965 6315 1903 1819 --26198 6184
NM_006602chr202683 300 1624 ----
NM_006603chrX31916 1845 1378 21770 1756 ----
NM_006609chr222630 2512 11066 ----
NM_006614chr373118 3068 2803 1176 1092 1086 357 21156 214 ----
NM_006618chr111481 ------
NM_006620chr674287 3031 1531 722 669 411 354 13101 11886 --
NM_006622chr52216 176 ------
NM_006624chr1041930 452 280 56 ------
NM_006625chr11445 ------
NM_006625chr11445 ------
NM_006625chr11445 ------
NM_006628chr1554332 3539 1275 1185 272 24107 3140 --12885
NM_006629chr1852550 2338 1824 1767 1125 --11096 --
NM_006633chr51762 ------
NM_006636chr22688 673 --11006 --
NM_006646chr1353091 2797 684 483 438 22059 951 ----
NM_006650chr512516 11419 153 --
NM_006651chr421505 575 11331 ----
NM_006654chr12104756 4450 4341 4158 3576 3523 3168 1893 989 808 23118 229 ----
NM_006662chr161338 ------
NM_006667chrX21204 910 ------
NM_006681chr4168 1130 ----
NM_006682chr722738 1101 ----1126
NM_006699chr142721 2127 1951 855 ------
NM_006705chr91422 ------
NM_006706chr52294 64 ------
NM_006713chr5286 75 ------
NM_006717chr993304 3064 2874 2779 2718 2709 2120 361 138 12738 1859 --
NM_006720chr10124800 4723 4713 3575 3481 3420 3239 1698 1017 947 616 288 23587 3379 14856 --
NM_006722chr383081 3054 2465 2232 2210 1006 951 709 --21035 81 --
NM_006729chrX34265 1799 1246 --15422 --
NM_006731chr955735 4199 2288 2100 329 24230 664 ----
NM_006732chr1922133 1350 11825 12059 --
NM_006734chr621605 1118 ------
NM_006735chr7158 ------
NM_006738chr1554556 3859 3123 3009 297 11307 1799 --
NM_006746chrX11076 11554 ----
NM_006751chr23979 836 747 ------
NM_006761chr171143 3844 179 169 1231 --
NM_006766chr852155 2063 1731 705 193 --21054 200 --
NM_006772chr641780 1645 1637 1118 ------
NM_006775chr622988 224 --13031 12525
NM_006777chrX21076 303 22926 224 ----
NM_006778chr61386 --1320 --
NM_006790chr52377 103 ------
NM_006791chr153600 538 119 2217 54 ----
NM_006805chr52660 434 ------
NM_006811chr202889 275 --1295 --
NM_006814chr2031954 1008 82 22576 2510 1990 --
NM_006815chr1251063 1026 949 943 542 1309 --11205
NM_006819chr111286 --1335 --
NM_006822chr171202 ------
NM_006825chr125978 718 652 187 66 --1782 --
NM_006827chr1463113 2911 1196 384 336 219 11149 ----
NM_006851chr1232770 2197 1912 --1379 --
NM_006852chr172774 420 --12727 1833
NM_006874chr41953 2437 336 11099 --
NM_006884chr351819 1721 694 254 227 ------
NM_006885chr1684023 3407 2886 2843 2572 1493 1486 154 23057 529 33438 2696 1600 --
NM_006888chr1443353 3293 2712 404 11223 ----
NM_006892chr2011179 11304 ----
NM_006892chr2011179 11304 ----
NM_006908chr761324 1110 1041 606 187 21 1449 ----
NM_006910chr16--1404 ----
NM_006912chr11247 --1732 --
NM_006915chrX42111 1902 321 93 ------
NM_006920chr211781 21808 219 ----
NM_006922chr222036 1796 ------
NM_006924chr1743595 2847 1391 47 24190 331 13942 --
NM_006925chr142447 332 ------
NM_006930chr541914 1332 1257 557 1189 ----
NM_006937chr173559 116 38 ------
NM_006940chr121465 21835 1335 ----
NM_006948chr2121735 947 22348 363 ----
NM_006950chrX1310 --1110 1190
NM_006963chr1021164 775 ------
NM_006981chr922901 2631 --1265 --
NM_006982chr12----1241 --
NM_007005chr92546 530 --11070 --
NM_007006chr16103535 3429 2800 2694 1168 862 794 674 213 98 --1945 --
NM_007007chr1294106 3822 3769 3198 1778 1544 1271 809 345 23659 3359 --13050
NM_007008chr2--1702 ----
NM_007011chr1586036 5188 4654 2733 1932 1760 553 246 16811 26594 204 --
NM_007013chr84913 409 134 127 ------
NM_007017chr51891 1367 ----
NM_007023chr2--11030 ----
NM_007031chr21123 ------
NM_007033chr142277 1990 494 155 12176 --1573
NM_007036chr52664 353 ----1913
NM_007040chr1921078 264 ------
NM_007046chr21377 ------
NM_007064chr351428 1216 1108 509 107 --11350 --
NM_007068chr22194 11065 ----
NM_007078chr102784 144 1388 ----
NM_007084chr1331447 601 388 ------
NM_007106chr1332125 1713 239 12151 ----
NM_007107chr352255 2182 1799 754 557 --1368 --
NM_007112chr11250 1181 ----
NM_007118chr52833 825 1320 ----
NM_007124chr621944 211 11775 11440 --
NM_007129chr1331008 387 314 ------
NM_007136chr3----21083 31 --
NM_007158chr141198 1133 1106 66 ------
NM_007159chr311199 ------
NM_007170chr11695 --1337 --
NM_007172chr2233237 2660 344 23105 2857 ----
NM_007173chr1131786 438 409 145 ----
NM_007174chr121390 21652 665 ----
NM_007175chr843024 1273 589 189 1387 22750 1193 --
NM_007191chr122720 168 ------
NM_007192chr1421175 224 193 21014 393 --
NM_007195chr1843327 2682 2540 2302 13641 13175 --
NM_007197chr1221039 189 --1206 --
NM_007200chr1554556 3859 3123 3009 297 11307 1799 --
NM_007203chr943937 2507 1533 633 12880 23892 2805 --
NM_007207chr1172 ------
NM_007212chr141684 1535 571 444 ------
NM_007218chr8--1242 1133 --
NM_007229chr222418 281 ------
NM_007235chr121492 ------
NM_007238chr2053748 1562 1446 1248 1110 23098 348 ----
NM_007246chr42863 352 1294 ----
NM_007249chr13149055 8514 8480 7963 6208 5930 3188 2806 2467 2419 2156 1637 1288 252 48891 7148 3589 3419 28909 1395 --
NM_007250chrX2575 378 ------
NM_007256chr1121668 1614 --11054 --
NM_007260chr11748 ------
NM_007271chr641463 1230 285 38 ------
NM_007274chr11127 ------
NM_007282chr321016 683 ------
NM_007285chr161146 ------
NM_007313chr911932 ----11606
NM_007325chrX3703 692 368 21822 1707 ----
NM_007341chr212398 335 ------
NM_007345chr1852302 2185 1873 1754 200 ------
NM_007347chr1551991 648 450 369 132 --1943 --
NM_007349chr72408 98 1277 ----
NM_007350chr1274376 3916 3886 3734 1480 168 31 24106 1098 14234 14072
NM_007353chr732884 2674 2138 ------
NM_007358chr111264 ------
NM_007373chr1021329 196 ------
NM_012074chr143809 238 66 ------
NM_012081chr513153 23497 3055 ----
NM_012089chr141408 1349 1215 238 2630 164 ----
NM_012090chr121107 1065 ------
NM_012096chr323239 3133 21313 704 ----
NM_012097chr242139 1769 1725 613 ----1846
NM_012098chr931525 180 133 1450 ----
NM_012102chr172615 2097 1757 922 797 297 42 ------
NM_012111chr141152 ------
NM_012120chr621055 938 11917 ----
NM_012124chr11------1136
NM_012137chr122375 77 22325 1875 ----
NM_012141chr1321567 296 24139 1022 13873 --
NM_012153chr112908 225 11718 1772 --
NM_012154chr81139 ------
NM_012156chr2043413 3159 459 419 --12449 --
NM_012164chr997006 6272 6207 5980 5741 2857 970 302 52 25965 97 ----
NM_012175chr114864 249 135 84 ------
NM_012177chr63510 125 58 ------
NM_012188chr511081 ------
NM_012189chr181468 ------
NM_012197chr951612 1329 1274 589 565 11171 ----
NM_012199chr143457 1750 1374 589 --24045 3295 14423
NM_012200chr11----184 --
NM_012207chr103928 826 164 1118 --1749
NM_012210chr931147 963 59 ------
NM_012214chr256002 4605 4072 986 545 12302 ----
NM_012215chr1061772 1672 1662 1538 1409 1235 ------
NM_012219chr32915 565 1978 --1828
NM_012223chr251308 1284 245 115 59 1847 ----
NM_012224chr441025 778 389 294 1439 ----
NM_012234chr353559 3283 2449 432 324 1900 ----
NM_012238chr1021538 1404 31624 1182 355 ----
NM_012247chr102901 27 --1421 --
NM_012248chr161253 ----162
NM_012249chr242972 2557 1242 406 23407 2833 12495 --
NM_012250chr112530 402 ------
NM_012252chr7104987 4882 4706 3657 1105 999 819 811 250 208 1940 ----
NM_012259chr631178 564 423 ------
NM_012262chr165256 5015 1065 1021 565 318 35236 1709 63 ----
NM_012266chr91849 --11076 1134
NM_012281chr72960 862 12095 ----
NM_012286chrX3526 130 85 2472 57 1593 --
NM_012290chr241315 1175 629 83 11247 ----
NM_012301chr751823 803 728 492 47 ------
NM_012307chr181824 1282 ----
NM_012308chr1152330 2181 2175 604 381 --22297 431 --
NM_012309chr1154859 3448 1591 1539 1532 ------
NM_012316chr175417 4492 4049 628 512 237 209 15480 11674 13464
NM_012317chrX2668 564 ------
NM_012325chr2031630 1083 1009 ------
NM_012328chr741320 915 581 145 ------
NM_012329chr171663 --1468 --
NM_012330chr1041812 1158 650 569 ------
NM_012333chr121698 38 ------
NM_012334chr564055 1643 1571 1474 928 743 14686 ----
NM_012341chr10--1472 ----
NM_012347chr621128 180 --12992 --
NM_012382chr564199 3869 3541 1374 1232 693 ------
NM_012388chr1542932 2018 178 22 1359 ----
NM_012395chr7113413 3191 2891 2212 1108 602 524 456 340 173 112 ----11066
NM_012399chr2231716 1527 753 ----1172
NM_012406chr1221254 79 11083 ----
NM_012419chr6----1162 --
NM_012420chr101713 --2181 52 --
NM_012426chr16----1344 --
NM_012428chr15----184 1933
NM_012446chr51514 ------
NM_012448chr1752290 1018 990 563 302 ------
NM_012471chrX31706 629 165 1590 ----
NM_012479chr762574 2345 2138 701 543 442 ----1305
NM_013230chrY1564 1376 ----
NM_013231chr1454287 3996 3785 3773 1061 ------
NM_013233chr211080 ------
NM_013236chr2221260 179 --1402 --
NM_013253chr1141372 448 366 176 31252 1208 904 ----
NM_013259chr32215 122 ------
NM_013261chr453707 2919 2727 2494 1137 --1974 --
NM_013262chr631116 1102 1080 --21162 1087 --
NM_013264chr11161 ------
NM_013269chr1274240 4018 3995 1563 1491 447 197 1174 11253 14097
NM_013272chr15------1277
NM_013281chr2031078 1006 38 ------
NM_013283chr52856 800 ------
NM_013286chr342788 2341 620 253 22543 164 ----
NM_013293chr71159 ------
NM_013302chr1674731 3832 3748 3510 1243 597 277 24454 1263 ----
NM_013316chr7151 ------
NM_013322chr71302 ------
NM_013334chr3----135 --
NM_013346chrX153 ------
NM_013352chr61343 ------
NM_013354chr831485 534 58 ------
NM_013363chr33428 182 60 ------
NM_013371chr11329 ------
NM_013372chr1532797 2361 319 ------
NM_013374chr322627 380 ------
NM_013390chr921745 1558 --11700 --
NM_013396chr2131277 969 624 148 11500 --
NM_013400chr721090 1027 ------
NM_013423chrX41285 1046 328 95 ------
NM_013427chrX41285 1046 328 95 ------
NM_013433chr1921781 1649 --11772 --
NM_013436chr2149 ------
NM_013437chr8--2473 257 ----
NM_013446chr741058 535 183 83 1286 ----
NM_013448chr142698 244 ------
NM_013449chr12--21117 579 ----
NM_013450chr22917 466 --1348 --
NM_013993chr62855 214 ------
NM_013994chr62855 214 ------
NM_013995chrX42474 2407 1946 181 2566 287 ----
NM_014005chr542168 977 706 310 --1939 --
NM_014011chr21253 ------
NM_014021chr153303 2796 2300 697 221 ------
NM_014023chr1041173 762 623 128 ------
NM_014028chr622749 1197 ------
NM_014038chr72150 94 ------
NM_014043chr341671 1594 1456 1259 11621 ----
NM_014048chr1654879 3951 3208 1956 558 14791 ----
NM_014057chr921317 499 ------
NM_014089chr1321687 203 1876 ----
NM_014096chr113645 618 38 1744 ----
NM_014110chr1--1776 ----
NM_014112chr855438 4589 4387 2065 1742 25402 5361 24736 40 --
NM_014117chr1612350 1539 21960 899 --
NM_014141chr755109 3474 1882 344 207 ------
NM_014154chr32546 352 11118 ----
NM_014155chr11127553 7547 7129 7030 6059 5783 5508 2564 1998 1095 1071 68 45728 2746 2220 1188 ----
NM_014217chr12577 266 1353 ----
NM_014225chr191356 ------
NM_014232chr17----11511 --
NM_014232chr17----11511 --
NM_014250chr2231907 1427 101 ------
NM_014253chrX82474 2130 1990 1757 887 616 454 205 1262 2330 76 --
NM_014263chr1021153 32 ------
NM_014271chrX1329 ------
NM_014279chr92726 629 1316 1244 --
NM_014282chr91433 ------
NM_014283chr12450 46 ------
NM_014289chrX11395 1335 ----
NM_014292chr2231859 1344 694 11909 ----
NM_014294chr831206 462 83 1454 ----
NM_014296chr341262 1153 215 50 ------
NM_014300chr15141 ------
NM_014309chr2264544 4200 3581 1735 617 161 ------
NM_014315chr141115 ------
NM_014319chr1211437 ------
NM_014323chr222693 86 1658 ----
NM_014325chr1251960 1804 913 485 443 11740 ----
NM_014331chr466782 6693 6456 2337 382 368 27639 420 16195 12118
NM_014333chr1152634 2358 2164 2149 168 ------
NM_014335chr1531362 949 332 ------
NM_014353chr161715 2689 118 ----
NM_014361chr111186 ------
NM_014372chr161838 1700 1503 500 431 49 ------
NM_014374chr721090 1027 ------
NM_014376chr512331 ------
NM_014388chr1116110 6044 5279 5081 4947 4701 4612 4388 4186 2107 466 --24028 1712 --
NM_014405chr1712345 ------
NM_014423chr565096 4986 2221 2016 1576 112 ------
NM_014445chr341524 700 409 173 ------
NM_014447chr451285 1249 1104 322 178 ------
NM_014452chr62173 54 ------
NM_014456chr1021306 613 ------
NM_014458chr13234 223 207 --11047 --
NM_014491chr73943 272 188 ------
NM_014494chr1642230 898 411 131 1476 --31736 941 732
NM_014502chr111395 ------
NM_014503chr121399 ------
NM_014504chr73802 654 296 --11493 --
NM_014515chr121108 ------
NM_014517chr351980 1809 1657 1613 1223 ----1762
NM_014521chr221856 358 ------
NM_014552chr2--11130 11430 --
NM_014554chr1221970 1730 1284 21932 1844 --
NM_014572chr1341184 1125 670 498 21512 1114 21739 1165 --
NM_014573chr1731807 1798 374 11183 11480 --
NM_014574chr1411411 ------
NM_014575chr3--1458 ----
NM_014577chr222150 136 ------
NM_014583chr31327 ------
NM_014603chr17----21401 1043 --
NM_014606chr421146 360 ------
NM_014612chr921209 1089 11325 1528 --
NM_014613chr512939 2513 351 ----
NM_014614chr221136 1037 ------
NM_014615chr164931 913 371 365 12587 1254 1734
NM_014634chr2221070 1004 --21106 735 --
NM_014635chr221378 1242 11177 ----
NM_014636chr944390 1414 1136 716 14041 24244 4002 1316
NM_014637chr831221 1072 167 1446 ----
NM_014640chr21290 ------
NM_014649chr192170 22 ------
NM_014660chr711149 ------
NM_014663chr11964 ------
NM_014665chr822776 2440 --23686 182 --
NM_014666chr51985 ------
NM_014667chr322311 1557 ------
NM_014670chr221315 1076 11617 1330 2633 76
NM_014671chr721535 1038 1604 ----
NM_014674chr343954 1501 1127 1010 ----11486
NM_014676chr131211 1165 397 11275 ----
NM_014682chr822159 452 11763 1742 --
NM_014683chr1732114 2020 1838 --11356 --
NM_014685chr161364 --1559 --
NM_014686chr1942094 1927 487 337 ------
NM_014689chr21390 198 ----
NM_014690chr742910 2018 447 355 --1660 --
NM_014701chr1542556 870 707 327 ------
NM_014705chr71550 --11427 --
NM_014707chr731689 1432 581 ------
NM_014709chr2------1406
NM_014711chr1621499 808 ------
NM_014715chr11--1793 2936 865 --
NM_014718chr12------1837
NM_014720chr102265 123 21387 57 ----
NM_014721chr675376 5332 2738 2513 1881 1427 1280 26839 652 12791 --
NM_014729chr82255 84 150 --1340
NM_014730chr1284866 3370 3231 1817 1754 1191 973 63 15022 44821 3590 1352 876 --
NM_014730chr1284866 3370 3231 1817 1754 1191 973 63 15022 44821 3590 1352 876 --
NM_014731chr2021795 708 --1119 --
NM_014733chr542095 1594 914 633 11698 11871 --
NM_014735chrX52089 1707 1467 1446 810 1823 ----
NM_014738chr17--1947 ----
NM_014743chr482976 2953 2716 2366 1076 1054 589 420 12106 1783 --
NM_014746chr243774 3041 2851 778 13558 1887 --
NM_014747chr1105353 4395 3998 2077 1798 972 789 503 452 414 ------
NM_014749chr14291 42 ------
NM_014751chr811781 ------
NM_014752chr1131649 763 605 ------
NM_014755chr244083 2758 1524 66 13892 23923 991 --
NM_014761chr162745 183 21153 901 ----
NM_014764chr1211107 1917 ----
NM_014767chr102333 312 ------
NM_014774chr193191 3119 2970 2597 2513 2507 2501 2141 501 --1713 --
NM_014776chr1272951 2591 2482 2227 647 154 30 12767 ----
NM_014779chr331004 927 67 1423 ----
NM_014781chr831013 222 208 ------
NM_014786chr1121186 1180 --1346 --
NM_014787chr122653 947 1106 171 --
NM_014791chr91229 ------
NM_014793chr15148 ------
NM_014804chr1731238 943 188 1966 ----
NM_014812chr121643 247 ------
NM_014824chr1151718 1652 1545 1490 790 --11777 --
NM_014826chr174211 4079 3882 2972 2889 1643 811 12983 23362 2782 --
NM_014827chr111055 ------
NM_014829chr532379 2119 566 1208 ----
NM_014830chr1283915 3379 3009 2685 2399 337 261 218 --11272 21464 397
NM_014836chr10--21803 1245 ----
NM_014839chr182456 1898 923 790 641 382 258 227 --1290 --
NM_014840chr1243411 2436 2316 1291 12841 --23299 1045
NM_014841chr63996 965 911 ------
NM_014847chr11468 ------
NM_014850chr311092 11157 24289 4038 --
NM_014853chr1711452 ------
NM_014862chr1564138 3591 3430 1242 1158 835 11404 --12761
NM_014868chr124807 608 242 36 1699 ----
NM_014873chr1104872 4325 4298 3900 3891 3440 1792 1649 613 400 13590 1807 24622 1063
NM_014874chr111851 ------
NM_014877chr17107726 7590 6759 6626 5649 2974 2707 2206 1465 949 57735 7675 7291 5072 122 --15222
NM_014883chr432200 1686 354 1954 1569 --
NM_014888chr711600 21137 986 ----
NM_014893chrY32210 1480 551 1683 11592 --
NM_014897chr1742166 2043 836 24 189 ----
NM_014900chr21883 11115 ----
NM_014902chr2021181 75 ------
NM_014903chr1221746 655 21907 612 ----
NM_014905chr231931 764 130 11962 ----
NM_014906chr1733919 798 774 1167 ----
NM_014913chr182286 233 21496 227 ----
NM_014917chr11963 ------
NM_014918chr1551349 1059 587 565 270 11457 1114 11104
NM_014921chr19--11885 ----
NM_014923chr1321743 592 ------
NM_014924chr1443187 2867 2634 45 1958 22436 2172 12056
NM_014926chr311029 ------
NM_014932chr321913 144 ------
NM_014939chr18156 11153 ----
NM_014946chr253106 2992 2568 1142 614 12156 ----
NM_014947chr132783 2244 661 ------
NM_014951chr1032549 1670 635 1591 --12515
NM_014959chr1952617 2334 1389 1376 859 145 ----
NM_014962chr2031980 233 130 1215 ----
NM_014964chr1722398 790 ----1692
NM_014974chr1031183 415 51 --1378 --
NM_014978chr1041827 1780 1774 1335 ------
NM_014982chr1445369 4320 2050 2040 --15192 --
NM_014988chr44978 268 189 144 ------
NM_014989chr641789 1618 1354 419 1486 1459 --
NM_014990chr141945 1894 ----
NM_014996chr321045 145 160 --131
NM_014997chr752829 1945 840 796 153 1514 ----
NM_014999chr1221691 1154 ------
NM_015000chr1242826 2542 1214 538 --32258 978 569 --
NM_015001chr1--1765 1629 --
NM_015008chr353199 2684 862 724 87 12619 12692 12430
NM_015009chr31619 ------
NM_015015chr1921994 425 ------
NM_015020chr1633776 3237 2711 --23721 1414 --
NM_015024chr811318 ----11083
NM_015025chr231963 967 641 ------
NM_015026chr1244668 2966 1901 1037 13566 --1801
NM_015027chr1632019 1600 1345 --31501 1402 387 --
NM_015032chr1362256 1921 1125 1047 977 652 1458 11946 --
NM_015039chr173549 3512 2673 1379 878 817 103 --2854 547 --
NM_015040chr243334 2173 770 185 ------
NM_015042chr1574379 4023 3793 3659 1488 1044 564 ------
NM_015045chr1032244 1501 296 ------
NM_015049chr252878 2763 2435 1115 261 1619 11229 12682
NM_015051chr932604 2124 129 22525 469 ----
NM_015052chr72968 488 1208 ----
NM_015053chr122335 487 ------
NM_015059chr1523307 1526 31087 310 140 12590 --
NM_015068chr733376 608 315 11012 1644 --
NM_015071chr546255 4276 2402 265 32268 2236 2209 1822 11184
NM_015073chr1931992 1904 1898 ----11573
NM_015074chr144873 4523 3784 1821 11474 ----
NM_015075chrX11685 11659 ----
NM_015076chr6104282 3966 3659 3633 3492 1500 1458 1357 1138 1076 1473 ----
NM_015087chr1332305 2230 920 11864 ----
NM_015092chr1613317 23879 3074 13612 11460
NM_015093chr611817 ------
NM_015094chr2221226 448 11023 11310 --
NM_015097chr321546 761 178 ----
NM_015100chr142030 1960 396 250 ------
NM_015101chr152408 2096 224 83 48 32104 648 101 ----
NM_015107chrX52085 1907 1590 709 304 ----11967
NM_015110chr92725 223 21530 254 ----
NM_015111chr533891 1213 398 1649 ----
NM_015115chr473186 2872 2034 1014 887 781 178 11295 12542 --
NM_015125chr19----1446 --
NM_015130chr4159 2444 133 ----
NM_015132chr711236 11524 1150 --
NM_015138chr1522153 1882 ------
NM_015143chr41236 21321 504 ----
NM_015144chr1693932 3464 3030 2792 1213 690 644 536 379 ------
NM_015155chr1052928 2308 1247 971 638 --1135 --
NM_015156chr1443876 3005 1062 464 ------
NM_015163chr1421883 1773 2493 35 ----
NM_015170chr822056 1914 --32011 1660 216 --
NM_015172chr141269 1182 434 415 ------
NM_015176chr131510 1399 634 21717 628 1427 --
NM_015180chr141797 ------
NM_015185chrX3509 292 207 ------
NM_015186chr92311 121 ------
NM_015191chr1152567 2475 2023 195 176 1528 ----
NM_015192chr2072662 2606 2523 2490 616 584 241 --12910 --
NM_015197chr1462387 2224 913 698 528 307 --12537 --
NM_015199chr352493 583 559 459 260 125 ----
NM_015200chr452265 1909 857 790 233 ------
NM_015203chr1187 ------
NM_015208chr1843261 1540 478 359 1735 13716 --
NM_015213chr111652 ------
NM_015215chr133160 1949 631 2543 54 --12606
NM_015225chr953036 2621 1064 536 45 ------
NM_015233chr1342589 451 392 256 1312 ----
NM_015236chr41471 --11191 --
NM_015239chr92458 53 ------
NM_015247chr1695033 4534 1460 1343 742 622 606 441 222 --14668 --
NM_015250chr951858 833 677 322 165 ------
NM_015260chr1931578 1520 79 --11363 --
NM_015263chr151354 1368 ----
NM_015265chr232591 2345 106 1504 ----
NM_015267chr1211757 ------
NM_015270chr1222296 2008 ------
NM_015271chr464347 4125 4010 3991 3557 651 33947 3676 846 ----
NM_015272chr1631904 1306 224 ------
NM_015278chr673311 2356 1083 903 793 786 535 13266 33412 2135 208 --
NM_015282chr232903 2886 406 ------
NM_015288chr543906 3366 1451 127 ------
NM_015289chr1521877 1342 1537 ----
NM_015291chr132699 1341 873 33007 1185 645 12750 --
NM_015294chr173430 243 212 --1884 --
NM_015296chr1321177 448 1342 ----
NM_015305chr1451931 1819 1628 324 174 --11549 --
NM_015308chr11--1149 ----
NM_015310chr878336 7787 6440 5161 2021 1288 49 --45823 2415 1088 285 --
NM_015313chr1194517 4371 4241 3898 3491 3208 3119 787 167 14565 11467 --
NM_015314chr742365 1670 860 109 1652 1754 12537
NM_015315chr51960 ------
NM_015317chr232556 1969 638 12280 1160 --
NM_015321chr1964947 3579 3529 1699 1689 911 --23089 3057 --
NM_015326chr141921 738 116 105 1244 --1267
NM_015328chr763061 2942 2840 2636 2254 375 --12815 --
NM_015335chr122809 631 22013 351 ----
NM_015336chr1232056 661 272 22378 279 --1235
NM_015339chr202777 176 ------
NM_015344chr831684 746 608 1454 ----
NM_015346chr142590 237 --1405 1661
NM_015347chr122713 506 --12529 --
NM_015349chr642476 2314 470 163 1748 1543 --
NM_015354chr91346 ------
NM_015355chr171154 21448 706 ----
NM_015358chr21----11270 --
NM_015359chr852691 2576 2168 1170 333 12833 11895 --
NM_015361chr21226 2828 629 ----
NM_015365chrX73971 3738 2996 461 370 351 250 13100 13091 --
NM_015375chr134979 3829 1116 ----13112
NM_015379chr7--1260 ----
NM_015385chr1053003 2996 1156 853 716 ------
NM_015387chr251742 394 384 203 116 12096 ----
NM_015393chr442935 673 136 38 11327 1473 --
NM_015396chr31219 ------
NM_015397chr941640 1494 1308 192 11778 ----
NM_015423chr1121390 489 ------
NM_015428chr192600 522 1494 11694 --
NM_015439chr61439 1136 ----
NM_015443chr1731158 485 190 ------
NM_015455chr543349 3220 2748 633 32620 959 717 1681 13138
NM_015458chr8104868 4280 3825 3502 3257 1902 1816 1681 762 55 25236 899 1861 1756
NM_015460chr321763 1704 11433 21322 722 --
NM_015461chr181757 1486 1647 --
NM_015464chr7190 1267 ----
NM_015472chr31159 ------
NM_015472chr31159 ------
NM_015475chr211025 2340 332 ----
NM_015477chr151229 ----21040 637
NM_015483chr71802 1422 ----
NM_015497chr1521097 989 ------
NM_015508chr331532 1453 61 ------
NM_015509chr1231554 1137 1084 ------
NM_015514chr141379 --2532 444 --
NM_015520chr332820 2536 740 ------
NM_015525chr62921 882 ------
NM_015534chr121069 137 1403 ----
NM_015541chr331257 1056 21 1228 ----
NM_015542chr101959 ------
NM_015554chr1532300 1978 104 --1587 12088
NM_015555chr64553 429 341 71 ------
NM_015564chr543520 3447 2860 447 ------
NM_015565chr2121775 1602 ------
NM_015567chr1321030 493 ------
NM_015569chr144801 3188 3074 313 ------
NM_015571chr622478 949 1910 22425 2227 --
NM_015576chr311872 1168 12398 11975
NM_015578chr1961917 1766 1359 780 318 124 ------
NM_015602chr1----11385 --
NM_015607chr11211 ------
NM_015609chr132800 2006 540 ------
NM_015630chr221146 966 --11066 --
NM_015640chr175290 4531 3847 1347 860 431 409 1237 15306 11528
NM_015642chr31214 ------
NM_015652chr102254 231 ------
NM_015670chr171116 ------
NM_015680chr21643 --1588 --
NM_015686chrX11774 ------
NM_015691chrX72696 2453 2254 2000 465 418 189 21923 59 12746 --
NM_015695chr611556 --1176 --
NM_015711chr192693 109 ------
NM_015723chr71574 122 ----
NM_015850chr831859 1795 1628 12030 ----
NM_015866chr11541 1953 ----
NM_015872chr11398 ------
NM_015874chr42574 482 ------
NM_015878chr841704 1622 1498 655 ------
NM_015879chr1868296 6933 1423 1139 938 614 25812 2983 ----
NM_015881chr1141372 448 366 176 31252 1208 904 ----
NM_015885chr111837 ------
NM_015886chr834547 1433 114 1659 13597 12221
NM_015888chr1--22252 314 ----
NM_015898chr1932242 1606 296 ------
NM_015904chr21147 ------
NM_015906chr151127 897 833 601 461 14865 ----
NM_015907chr4162 ------
NM_015912chr82539 249 --11805 --
NM_015975chrX41703 1643 1237 46 11612 ----
NM_015976chr11245 1258 ----
NM_015986chr171918 ----128
NM_015995chr1544753 4234 2234 334 ------
NM_016009chr171705 1160 685 639 590 289 208 34446 3787 815 1526 --
NM_016018chr832693 2222 764 2550 284 ----
NM_016019chr71158 ------
NM_016021chr612951 12577 1761 --
NM_016022chr12846 134 --11027 --
NM_016025chr1651830 1691 1577 800 406 ------
NM_016026chr14--11474 --185
NM_016032chrX21331 1056 --2451 257 --
NM_016037chr13429 406 52 --193 --
NM_016040chr152518 1731 699 553 351 1408 ----
NM_016048chr52962 330 ------
NM_016057chr1231193 519 370 ------
NM_016059chr62818 338 ------
NM_016061chr21370 ------
NM_016072chr1231910 1690 107 12030 1557 --
NM_016073chr153962 817 324 ------
NM_016075chr1352738 2146 1140 1005 783 12261 12670 --
NM_016076chr162833 2711 2525 2109 1133 983 1689 22257 737 --
NM_016079chr252314 2061 787 141 109 1165 ----
NM_016081chr421604 792 2849 818 ----
NM_016090chr114938 217 198 166 1996 ----
NM_016101chr1631105 410 330 ------
NM_016103chr5--1465 ----
NM_016107chr51394 ------
NM_016115chr22520 131 ------
NM_016120chrX11038 ------
NM_016121chr121144 896 ------
NM_016124chr111255 --21472 1312 --
NM_016125chr171114 ------
NM_016131chr22144 43 22296 283 1541 --
NM_016132chr1563376 3333 2338 1320 432 186 1269 ----
NM_016133chr22660 107 11442 ----
NM_016141chr3132 ------
NM_016144chr53612 181 82 ------
NM_016152chr31357 21142 137 ----
NM_016203chr721033 756 2271 206 ----
NM_016205chr441246 518 326 312 ------
NM_016206chr378680 8069 7743 7358 2353 1581 73 22090 1722 1142 27690 5868
NM_016217chr693640 3382 3273 3069 2899 2371 1472 1425 189 --1836 --
NM_016224chr621485 1469 1381 --12140
NM_016227chr12450 46 ------
NM_016230chr62544 63 ------
NM_016231chr1731052 667 308 --1439 --
NM_016235chr1621266 1133 --1945 --
NM_016248chr1394015 3961 3659 3553 2755 2745 2441 1137 775 23613 1475 11402 22712 283
NM_016252chr21818 ------
NM_016255chr633046 1263 707 4927 801 762 575 ----
NM_016260chr285802 5675 5453 5169 4957 551 476 384 26704 786 1875 --
NM_016264chr19134 ------
NM_016269chr42869 254 ------
NM_016270chr191466 ------
NM_016271chr1831753 1456 495 --12369 --
NM_016272chr2242666 2560 281 240 ------
NM_016277chr631635 1429 278 ----187
NM_016287chr121599 686 ------
NM_016289chr242177 2068 1625 121 ------
NM_016300chr31441 ------
NM_016303chrX1115 ------
NM_016304chr15----1747 --
NM_016306chr3166 ------
NM_016308chr12451 157 11563 ----
NM_016315chr2----11890 --
NM_016322chr952355 2142 1990 977 465 12303 ----
NM_016329chr31388 1351 ----
NM_016333chr163486 381 192 ------
NM_016337chr141183 --1321 --
NM_016338chr5--11215 ----
NM_016351chr71432 ------
NM_016356chr632749 2623 2247 1873 ----
NM_016374chr111294 11077 ----
NM_016374chr111294 11077 ----
NM_016376chr1734100 2868 1512 1480 24136 3545 --
NM_016396chr1531156 603 552 12282 21195 955 --
NM_016410chr91463 ------
NM_016424chr171799 11844 ----
NM_016436chr20--31996 1966 961 12736 --
NM_016441chr232362 1711 210 11508 --11470
NM_016472chr14199 11136 ----
NM_016483chr3--1266 1318 --
NM_016485chr622211 104 1179 ----
NM_016486chr11352 1446 ----
NM_016505chr11740 ------
NM_016507chr1753017 2781 968 449 59 --12651 --
NM_016521chrX--1255 181 --
NM_016530chr1543188 1109 865 623 23307 1214 ----
NM_016531chr453544 3146 577 326 172 1696 23969 1010 --
NM_016542chrX21757 1261 ------
NM_016544chr253796 3466 2949 2479 81 13086 ----
NM_016545chr12864 806 ------
NM_016559chr351503 1290 1090 317 309 ------
NM_016569chr1251516 1159 1046 1040 1032 1603 11524 1499
NM_016574chr111374 --1850 --
NM_016592chr20--133 ----
NM_016603chr52489 482 --11379 --
NM_016604chr511032 11307 ----
NM_016614chr6123 2244 141 ----
NM_016618chr22394 59 --1104 --
NM_016620chr11574 1958 ----
NM_016621chr1144554 3468 1001 345 --43977 652 241 113 --
NM_016625chr3157 ------
NM_016626chr1821304 1136 ------
NM_016628chr10126 ------
NM_016630chr15143 --1200 1113
NM_016631chr212707 200 ------
NM_016653chr2166 --1848 --
NM_016656chrX1371 ------
NM_016819chr31510 ------
NM_016820chr3125 ------
NM_016823chr173947 898 368 1375 ----
NM_016824chr101141 ------
NM_016831chr142191 1807 1516 571 12163 1517 --
NM_016836chr2--128 1117 --
NM_016839chr2--128 1117 --
NM_016936chr162713 104 2672 125 ----
NM_016948chr16----1117 --
NM_016950chr411296 ------
NM_016952chr1163445 1355 1305 642 284 192 13168 --1397
NM_017413chrX32241 422 200 12552 12340 1558
NM_017420chr14103807 3599 3303 2626 2457 2419 2366 1318 932 737 13533 11053 --
NM_017424chr22168 --21955 205 1525
NM_017440chr121100 ------
NM_017447chr2183840 3157 3030 3022 2988 1156 707 479 2725 564 ----
NM_017449chr121446 289 ----11138
NM_017450chr17296 69 --1983 --
NM_017455chr15----184 1933
NM_017481chr11130 ------
NM_017489chr811190 ------
NM_017495chr2011475 ------
NM_017519chr65307 285 222 71 64 ------
NM_017526chr11103 ------
NM_017545chr201124 ----1402
NM_017548chr34850 755 485 233 11620 ----
NM_017551chr1042538 2262 2086 1723 1732 ----
NM_017575chr1721616 389 --11287 --
NM_017580chr1062355 1492 677 654 648 132 --12310 22110 745
NM_017582chr1------11703
NM_017590chr2211780 12212 ----
NM_017594chr953100 2492 2247 778 701 1545 32644 2194 898 --
NM_017599chr1241855 1688 821 475 ----11971
NM_017611chr113645 618 38 1744 ----
NM_017612chr12--1595 183 --
NM_017613chr211134 --1364 --
NM_017626chr1061556 1374 1326 1257 1094 721 ------
NM_017629chr11660 --11290 --
NM_017632chr43434 354 138 ------
NM_017633chr632453 602 136 23360 1157 1280 --
NM_017634chr841924 1341 275 45 1631 ----
NM_017635chr1121174 1095 --11353 --
NM_017637chr9129241 8822 8815 8329 3609 3556 3290 2607 2504 2430 1534 486 19079 ----
NM_017638chr1172 ------
NM_017640chr62741 92 ------
NM_017643chr1732862 838 660 ----12601
NM_017644chr344494 1669 519 51 25083 1381 11041 --
NM_017646chr13269 164 148 1518 ----
NM_017650chr785986 5871 5565 5167 1702 1338 1117 709 --25402 1368 15946
NM_017655chr161541 1298 1259 497 247 40 ------
NM_017657chr21825 ------
NM_017658chr1484541 4387 3572 3328 1751 1744 578 72 ------
NM_017661chr1521087 1031 ----1275
NM_017666chrX31655 883 518 21785 1667 ----
NM_017667chr71490 1162 --1384
NM_017672chr15127 ------
NM_017692chr93797 626 578 ------
NM_017693chr1351659 1328 1278 508 138 2560 459 ----
NM_017703chr19--137 ----
NM_017709chr162818 1624 1536 1057 1022 372 ------
NM_017714chr20162 ------
NM_017719chr341938 1847 942 80 ------
NM_017736chr1632808 2394 1080 32868 337 122 12116 13107
NM_017737chr142196 1942 1883 509 --11464 --
NM_017742chr181375 ------
NM_017744chr131851 1598 785 12476 ----
NM_017745chrX--1586 ----
NM_017748chr171210 --127 --
NM_017752chrX21508 871 1509 ----
NM_017753chr91993 ------
NM_017754chr655034 4701 3773 1108 944 23722 166 ----
NM_017757chr1821174 358 11103 ----
NM_017758chr1751197 489 146 96 73 ----1195
NM_017769chr1452494 2430 2290 2159 174 13110 ----
NM_017770chr652888 2812 2519 2102 359 ------
NM_017772chr611716 11247 ----
NM_017778chr82294 94 1384 ----
NM_017779chr122090 565 32435 637 330 --1929
NM_017784chr321079 76 ------
NM_017787chr1051932 1165 677 229 127 ------
NM_017791chr1431649 1497 1250 ------
NM_017799chr1421503 574 ------
NM_017801chr351847 1623 1004 960 511 ----22444 1654
NM_017811chr9------11074
NM_017813chr885487 5162 5055 4563 4411 4405 3976 28 25150 1571 ----
NM_017822chr123773 681 48 ------
NM_017824chr1072209 1930 1863 558 376 262 29 21716 194 ----
NM_017848chrX2449 361 23724 578 ----
NM_017866chr82976 718 1867 ----
NM_017893chr1011297 ------
NM_017913chr92170 108 ------
NM_017915chr122907 824 ------
NM_017919chr965693 5593 5259 4202 3749 764 14268 14182 14390
NM_017933chr22243 121 41505 1343 1180 306 11218 --
NM_017938chrX21342 746 11549 1842 --
NM_017944chr1143019 2451 2089 41 ------
NM_017954chr751555 1353 1171 350 178 --11113 1540
NM_017983chr17149 ------
NM_017988chr121228 ------
NM_017990chr1653255 1700 1320 590 498 13332 12684 13717
NM_017994chr742828 1969 771 591 1324 1379 12866
NM_018010chr331603 308 38 1659 ----
NM_018011chr13173 ------
NM_018014chr22437 90 ------
NM_018015chrX1436 191 ----
NM_018026chr1131433 1018 257 11157 1510 --
NM_018027chr1022598 650 12942 11104 --
NM_018043chr1121388 167 --1110 --
NM_018045chr122985 106 ------
NM_018046chr551559 1505 1464 573 342 ------
NM_018049chr192103 96 ------
NM_018053chr1--1852 ----
NM_018061chr13709 624 222 21102 181 ----
NM_018070chr11375 ------
NM_018078chr44710 307 210 73 1977 ----
NM_018084chr24893 769 293 241 --13054 --
NM_018086chr251808 1651 1502 610 329 ------
NM_018092chr1631638 1552 519 ------
NM_018096chr173907 387 347 --1165 1691
NM_018098chr311128 ------
NM_018105chr831097 275 186 ------
NM_018110chr1621091 1072 ------
NM_018117chr103705 590 501 ------
NM_018120chr83383 231 50 11415 ----
NM_018121chr1032184 1220 1192 ----12139
NM_018122chr1139 1292 1260 --
NM_018126chr441562 1283 1023 498 ------
NM_018131chr102639 352 --1878 --
NM_018133chr342222 2016 1861 67 3546 208 123 ----
NM_018149chr17291 41 ------
NM_018151chr24791 761 229 26 ------
NM_018155chr332864 2623 288 12495 ----
NM_018157chr1222638 837 1655 ----
NM_018164chr122241 110 ------
NM_018172chr1121483 991 --11089 1222
NM_018176chr4--1134 11451 --
NM_018181chr1851867 1255 1242 1217 748 21618 327 ----
NM_018182chr1742253 1608 1407 195 --1907 11396
NM_018184chr321648 1455 --1611 1358
NM_018195chr1181983 1899 1855 1804 1698 1363 64 21 150 21951 681 --
NM_018200chr1562538 1762 1599 744 523 403 12376 ----
NM_018206chr162665 51 ------
NM_018208chr11132 --11176 --
NM_018221chr21445 ------
NM_018223chr12--21098 89 ----
NM_018227chr432662 2021 1062 ------
NM_018243chr443838 3500 3263 75 --13299 --
NM_018246chr852383 2197 1084 476 286 --12247 --
NM_018247chr642962 2956 2589 2010 22689 864 11090 --
NM_018254chr132420 1707 836 --1329 --
NM_018257chr2042476 703 537 233 12108 1140 --
NM_018263chr232543 530 62 --22266 636 --
NM_018264chr72933 292 2918 882 158 --
NM_018266chr311122 ------
NM_018279chr1252806 2315 976 768 577 32429 385 296 --12838
NM_018283chr1321314 108 11141 ----
NM_018286chr171905 1836 ----
NM_018287chr1011253 ------
NM_018290chr421282 846 ------
NM_018293chr331190 437 218 ------
NM_018299chr831370 1248 337 32887 1333 384 12928 --
NM_018312chr1132046 586 553 ----1409
NM_018313chr36591 365 358 350 343 324 22549 2312 ----
NM_018318chr12190 ------
NM_018325chr941143 1102 668 610 1143 ----
NM_018327chr2031622 1562 1356 11753 ----
NM_018330chr1041551 443 418 412 --1334 --
NM_018339chr921679 35 11843 ----
NM_018360chrX175 ------
NM_018362chr1193924 3798 3124 2640 2514 448 388 354 51 11484 ----
NM_018364chr153967 3799 3448 2933 2721 ------
NM_018368chr6123 ------
NM_018374chr7104827 3734 1780 1596 1589 1557 1384 1185 1172 154 33719 1202 651 --13626
NM_018388chrX1497 ------
NM_018403chr363858 3515 3157 850 784 143 33566 1648 275 ----
NM_018416chr1281997 848 793 772 532 368 219 123 ------
NM_018423chr122267 43 --1432 --
NM_018426chr63593 584 561 ------
NM_018438chr1--2497 171 ----
NM_018440chr878701 8525 8124 6763 1258 390 144 47650 6474 5391 2465 12218 --
NM_018442chr11104 ------
NM_018444chr82672 508 ----1496
NM_018448chr1211079 2792 444 ----
NM_018452chr6_random1193 --11447 --
NM_018469chr1711181 --157 --
NM_018482chr892332 2154 2134 2128 1975 1928 1040 433 427 --1166 --
NM_018489chr152128 785 677 327 183 ------
NM_018490chr1111757 2657 529 ----
NM_018553chr1731841 1642 589 ----11730
NM_018557chr231183 149 132 --11620 --
NM_018566chr1104958 4641 3971 3467 3349 1933 1927 1798 1384 1040 --161 --
NM_018569chr431248 1149 1030 11204 ----
NM_018638chr1265373 3919 3841 2264 2099 1325 23913 749 ----
NM_018640chr1232182 1819 617 --12072 12292
NM_018644chr1142065 1667 203 40 11937 ----
NM_018649chr103508 219 57 ------
NM_018650chr151984 1789 750 382 354 11737 --11872
NM_018685chr731046 856 32 ------
NM_018689chr1512221 22356 2233 ----
NM_018695chr532388 718 225 12139 ----
NM_018697chr732384 2279 2092 --12377 --
NM_018700chr521227 209 1465 ----
NM_018703chr16--1404 ----
NM_018708chr1941571 1124 121 87 --11365 --
NM_018710chr82228 47 ----1196
NM_018712chr1131193 1097 262 1131 ----
NM_018724chr11648 ------
NM_018840chr201153 1473 ----
NM_018841chr133226 2863 861 1116 ----
NM_018844chr7--1371 ----
NM_018847chr9--1312 ----
NM_018890chr761324 1110 1041 606 187 21 1449 ----
NM_018898chr51167 1227 ----
NM_018899chr51167 1227 ----
NM_018900chr51167 1227 ----
NM_018901chr51167 1227 ----
NM_018902chr51167 1227 ----
NM_018903chr51167 1227 ----
NM_018904chr51167 1227 ----
NM_018905chr51167 1227 ----
NM_018906chr51167 1227 ----
NM_018907chr51167 1227 ----
NM_018908chr51167 1227 ----
NM_018909chr51167 1227 ----
NM_018910chr51167 1227 ----
NM_018911chr51167 1227 ----
NM_018945chr643565 3118 2654 1059 ------
NM_018948chr121255 935 ----150
NM_018951chr72212 24 11271 ----
NM_018958chr1533836 2971 1421 33692 3130 1148 ----
NM_018959chr191168 ------
NM_018963chr2111205 --21280 395 --
NM_018975chr163647 585 85 1790 ----
NM_018976chr12--186 1127 --
NM_018977chrX2984 873 11010 ----
NM_018979chr1222457 2041 ------
NM_018983chr4--1259 ----
NM_018992chr1631550 335 41 ------
NM_018993chr203529 332 276 ------
NM_018994chr11446 ------
NM_018999chr1034158 2992 371 13380 ----
NM_019000chr531614 1301 1104 ------
NM_019001chr354369 4312 3617 3197 3074 ------
NM_019004chr752124 1630 743 689 405 1917 ----
NM_019006chr152136 60 ------
NM_019008chr2253242 2647 1523 1468 1024 --12962 1877
NM_019027chr43989 882 287 22501 157 ----
NM_019042chr72899 313 ----1195
NM_019044chr253965 1620 251 134 79 34764 4572 3887 ----
NM_019045chrX1240 ------
NM_019049chr11630 1745 ----
NM_019063chr251936 1750 569 350 129 ------
NM_019084chr1042349 1801 900 447 42623 1862 1047 832 ----
NM_019087chr52621 457 ------
NM_019091chr231159 1085 722 ------
NM_019094chr1233324 3142 372 12362 12390 1121
NM_019106chr2232417 1231 1133 12133 22839 581 --
NM_019114chr932150 2041 438 12030 ----
NM_019116chr1693532 3156 2785 2537 2384 1363 1240 1225 605 23654 1015 ----
NM_019117chrX53027 2369 1241 821 85 1877 ----
NM_019558chr21260 --1136 --
NM_019590chr102957 262 172 1179 --
NM_019593chr2033007 1242 148 13031 ----
NM_019594chr921534 343 ------
NM_019595chr21138 ------
NM_019605chr11251 ------
NM_019606chr7------1517
NM_019610chr142115 454 306 156 21615 477 ----
NM_019896chr21298 ------
NM_019903chr101141 ------
NM_020066chr12835 133 ------
NM_020122chr296036 3904 2061 1950 1636 1505 1381 1069 380 25322 1768 15561 --
NM_020123chr1011137 --2518 176 --
NM_020127chr111139 1461 11220 --
NM_020141chr131921 1743 324 ----12076
NM_020148chr1863071 2327 2282 1096 293 89 ----1903
NM_020150chr1031902 1584 416 21599 842 ----
NM_020159chr441603 638 443 252 --11706 --
NM_020163chr331624 1563 826 1268 2334 171 --
NM_020168chr1531016 450 324 21311 403 ----
NM_020177chr542408 1156 613 270 ------
NM_020178chr1731144 840 369 ------
NM_020182chr2033042 955 491 13085 --12872
NM_020189chr8130 ------
NM_020193chr1111201 ------
NM_020194chr2----1618 --
NM_020198chr1751320 1018 479 275 160 --11186 --
NM_020205chr153495 2976 2306 1377 407 --33322 2555 1094 1386
NM_020210chr151951 ------
NM_020216chr11379 1415 ----
NM_020226chr4----1295 --
NM_020228chr1142369 1769 690 200 3933 472 48 ----
NM_020231chr31562 --1125 --
NM_020239chr152194 1710 1680 292 21 --21925 681 --
NM_020240chr532761 1077 158 ------
NM_020245chr694866 4500 4477 1779 900 840 267 206 183 23974 594 1458 --
NM_020307chr3238 32 ------
NM_020315chr22--1912 ----
NM_020317chr1--1334 ----
NM_020319chr71874 --1668 1138
NM_020336chr2073401 3157 2975 2898 1340 1120 1084 --13189 --
NM_020337chr432714 2652 1201 22722 2181 148 --
NM_020338chr1033238 3181 1086 --1376 --
NM_020341chr2022013 1630 ------
NM_020342chr231896 731 166 --1696 --
NM_020346chr112663 588 ------
NM_020348chr1032102 1086 336 ----21965 1831
NM_020353chr341476 1328 647 505 21434 311 ----
NM_020361chr8--2259 76 ----
NM_020374chr1241686 1391 677 517 1799 ----
NM_020378chr191578 --179 --
NM_020381chr631851 1767 348 1201 ----
NM_020382chr122524 308 ----11218
NM_020390chr374726 4164 3114 856 606 334 62 33835 3279 123 --1236
NM_020403chr1311413 11592 ----
NM_020420chrY51180 283 254 151 129 ------
NM_020423chr11593 1564 1506 --
NM_020425chr641586 1380 410 40 11993 11622 --
NM_020438chr91383 ------
NM_020440chr143138 663 374 234 1541 ----
NM_020443chr176137 5728 5444 5087 2169 1516 832 1845 2983 154 --
NM_020449chrX1783 ------
NM_020452chr11504 --12034 --
NM_020456chr131754 --11612 21938 918
NM_020457chr162694 422 1650 ----
NM_020463chr21596 ------
NM_020466chr663820 3060 3047 1900 1453 1245 34403 4281 211 ----
NM_020474chr1821935 1865 1650 ----
NM_020528chr21----1115 --
NM_020532chr2--1702 ----
NM_020546chr541207 735 340 131 12047 22381 1954 --
NM_020630chr10--1576 1707 --
NM_020640chr321996 921 ----1321
NM_020644chr112352 67 ------
NM_020647chr831908 315 56 12308 ----
NM_020651chr241696 1491 1378 448 --159 --
NM_020653chr17128 ------
NM_020673chr2077062 7056 5905 5141 3056 1392 150 37624 1012 86 12748 1358
NM_020686chr1632508 2382 2316 180 12299 --
NM_020689chr2031755 1719 496 --11505 --
NM_020693chr111403 ------
NM_020699chr145023 2006 243 213 11606 --15286
NM_020708chr2022404 2063 --12437 --
NM_020711chr222464 1725 ------
NM_020713chr2062917 2213 726 598 409 92 12933 ----
NM_020718chr1696098 4779 4611 4112 2214 1901 1512 1222 339 46338 5909 5587 1184 12379 11927
NM_020726chr51127 ------
NM_020727chr21103846 3803 3470 3405 2904 2874 1277 326 319 204 23772 414 12911 13449
NM_020728chr721941 903 21130 487 --12538
NM_020732chr65307 285 222 71 64 ------
NM_020739chr1544178 3795 2571 1057 11273 ----
NM_020742chrX2565 191 1698 ----
NM_020746chr2011105 --1873 --
NM_020748chr1721923 1394 1543 ----
NM_020749chr821648 362 21794 391 ----
NM_020752chr1022691 826 11848 12833 --
NM_020754chr33488 474 370 ------
NM_020760chr23799 238 126 11750 ----
NM_020766chrX74579 3756 3615 2845 1824 1619 651 11626 24554 91 --
NM_020768chr532366 431 336 2966 957 ----
NM_020770chr131306 1280 81 11217 --1829
NM_020772chr17127840 5664 5510 2922 2593 2341 2222 1204 955 509 342 267 46665 5573 3248 1124 11611 16516
NM_020773chr422693 419 ------
NM_020774chr18116264 5951 4922 3984 3790 2004 1853 1610 920 623 379 12211 32148 851 405 --
NM_020782chr1233166 1494 508 54870 4630 3213 1154 907 21525 407 --
NM_020783chr1822378 33 ----12064
NM_020791chr1711309 ------
NM_020792chr382401 2021 1085 707 509 348 332 237 12110 1540 --
NM_020795chr1741251 334 313 224 --1768 --
NM_020796chr532469 1116 1104 ----22010 73
NM_020800chr331480 1360 1292 ------
NM_020801chr512098 ------
NM_020805chr183658 239 162 ------
NM_020806chr14184 ------
NM_020808chr1172 ------
NM_020809chr1131964 1486 253 ----12253
NM_020810chr1433516 497 88 2490 462 11433 --
NM_020818chr141363 ------
NM_020830chr293279 3264 3244 3178 2832 2713 2561 2394 444 11017 1398 --
NM_020831chr221234 ------
NM_020834chr1431231 657 123 ----11405
NM_020839chr31607 1487 ----
NM_020844chr867074 5033 4964 2466 1711 651 2526 152 32656 2643 1719 2632 406
NM_020845chr123922 813 465 11605 1274 --
NM_020856chr1931398 1303 86 1100 ----
NM_020858chr1522394 1941 ------
NM_020860chr421018 466 1280 ----
NM_020861chr641112 258 113 82 21351 478 ----
NM_020866chr13--2856 691 ----
NM_020868chr231965 1508 279 ------
NM_020870chr462112 1561 715 544 358 187 --22102 557 --
NM_020873chr32859 218 ------
NM_020898chr122601 251 1149 --1508
NM_020899chr1742417 2210 1649 169 ------
NM_020918chr1063231 2994 2295 1318 954 908 ------
NM_020919chr241197 907 842 232 ------
NM_020921chr1443658 3356 314 308 33438 1403 423 2846 466 168
NM_020922chrX41544 1492 88 33 ----11278
NM_020925chr121043 209 --11395 11067
NM_020927chr1612018 1491 1261 --
NM_020940chr103726 648 209 32704 1839 187 ----
NM_020948chr123559 830 12328 33478 3254 2930 --
NM_020951chr1922362 22 ------
NM_020962chr1572309 2025 2003 1771 802 752 610 ------
NM_020971chr191668 ------
NM_020975chr1021611 163 11759 --21650 639
NM_020977chr431370 441 318 1187 ----
NM_020981chr23308 136 105 ------
NM_020983chr1222296 2008 ------
NM_020987chr1011296 ------
NM_020988chr161191 11046 ----
NM_021005chr1551062 868 819 463 420 ------
NM_021007chr211533 ------
NM_021012chr1721051 374 13146 ----
NM_021032chr32762 440 ------
NM_021033chr1313313 23160 192 33054 2777 1196 11294
NM_021038chr333245 3085 3042 1719 ----
NM_021063chr6--165 ----
NM_021069chr41387 1644 ----
NM_021072chr522197 347 ------
NM_021076chr221427 ------
NM_021079chr1722352 219 ------
NM_021097chr273039 1202 1156 914 648 433 297 23077 304 ----
NM_021106chr92783 494 ------
NM_021110chr82754 615 ------
NM_021115chr221145 ------
NM_021120chrX63104 2953 1085 157 144 105 1299 ----
NM_021132chr1011070 2841 540 ----
NM_021136chr142300 230 ------
NM_021140chrX2847 73 1332 ----
NM_021148chr792527 1674 1005 821 814 808 793 749 97 22129 1712 ----
NM_021155chr1972305 2296 2263 2208 2140 1864 77 11009 11164 --
NM_021159chr421261 222 1683 ----
NM_021163chr753557 2740 713 685 588 1762 ----
NM_021165chr12835 780 ------
NM_021174chr81739 ------
NM_021177chr63128 119 96 ------
NM_021183chrX22056 1033 31778 983 273 --1736
NM_021188chr14--2432 350 ----
NM_021189chr11160 ------
NM_021190chr121186 1013 ------
NM_021202chr2022451 563 ------
NM_021205chr112727 22844 449 ----
NM_021215chr2032236 1677 89 --1273 --
NM_021220chr201452 ----165
NM_021222chr111304 2489 122 1178 --
NM_021238chr1221378 655 11688 ----
NM_021239chr14--21444 1120 1199 --
NM_021240chr9--1542 ----
NM_021249chr1431637 1326 60 ------
NM_021252chr1051967 1915 1752 1457 1287 --21370 736 --
NM_021253chr61145 --31412 391 265 --
NM_021255chr1483455 3417 3360 1466 1364 941 534 288 ------
NM_021572chr62939 856 ------
NM_021619chr9--11147 ----
NM_021620chr61756 1526 ----
NM_021627chr32992 965 1105 139 --
NM_021629chr374753 4332 4100 3399 3184 1155 23 25028 1225 1728 --
NM_021637chrX41341 1323 1254 979 ------
NM_021643chr221734 64 ------
NM_021644chr103928 826 164 1118 --1749
NM_021647chr484037 3949 3410 3119 1570 1467 492 418 --13870 --
NM_021648chr642241 1933 355 129 12774 1674 --
NM_021705chr611309 11302 21581 1337 --
NM_021722chr71391 ------
NM_021723chr71432 ------
NM_021738chr101334 1118 ----
NM_021783chrX21833 48 ----2629 316
NM_021784chr201665 ------
NM_021785chrX156 ------
NM_021813chr6125644 5632 4287 2338 2228 1576 1564 818 790 727 694 51 45790 5595 5443 1273 15024 --
NM_021814chr6----21493 1473 --
NM_021908chr71701 ----1904
NM_021911chr534877 1837 920 14500 1201 --
NM_021912chr1543869 3476 1311 596 1580 ----
NM_021913chr1941602 385 335 303 --11440 --
NM_021914chr1451894 872 657 84 78 ------
NM_021935chr31757 ----1229
NM_021940chr631530 460 280 ------
NM_021945chr622986 532 ------
NM_021947chr171386 11272 11131 --
NM_021954chr1353281 2732 2636 2512 2357 1181 ----
NM_021959chr61877 1265 --2915 348
NM_021960chr142680 2330 2179 968 11037 ----
NM_021961chr11107047 6145 6097 5537 4853 2863 2542 2454 406 253 27392 4622 16812 --
NM_021963chrX1761 1176 ----
NM_021964chr386246 5747 5604 4247 4120 2184 1882 794 46334 2321 1917 1733 ----
NM_021971chr3----135 --
NM_021980chr10--185 ----
NM_021988chr2021409 1215 ------
NM_022037chr21989 1833 ----
NM_022041chr1631802 1727 130 ------
NM_022048chr1556047 4810 4577 824 354 21656 666 14465 14605
NM_022049chr121176 601 ------
NM_022051chr11246 ------
NM_022062chr1111383 11974 ----
NM_022066chr171992 ------
NM_022075chr14848 770 764 118 ------
NM_022080chr2072532 1949 1927 1852 1054 406 236 2753 359 ----
NM_022085chr61149 ------
NM_022093chr11826 --1922 --
NM_022114chr123906 486 --11211 14292
NM_022118chr131537 1402 ----
NM_022123chr141460 ----1592
NM_022130chr5----174 --
NM_022137chr143567 371 284 --12040 --
NM_022154chr41404 11261 --1194
NM_022160chr91135 ------
NM_022169chr11----1595 --
NM_022170chr72276 164 1562 ----
NM_022173chr21989 1833 ----
NM_022346chr431204 1177 1044 11378 ----
NM_022351chr843747 3518 956 607 33489 1349 51 ----
NM_022442chr2021409 1215 ------
NM_022457chr11116 ------
NM_022459chr13116036 4385 4246 4240 4048 2423 1889 1505 782 631 592 ------
NM_022461chr321092 336 --1172 --
NM_022462chr19143190 3081 2740 2676 2495 2377 2350 1487 1389 1363 1307 789 469 373 11275 --1269
NM_022473chr15113943 3652 3364 2945 1086 971 542 504 276 195 183 21040 380 ----
NM_022474chr1422412 1876 31962 291 129 1216 --
NM_022475chr4--1620 ----
NM_022476chr163713 143 125 ------
NM_022477chr201366 11481 ----
NM_022491chr1253352 3248 2621 68 46 22731 776 11170 --
NM_022496chr121335 ------
NM_022552chr231133 507 336 1975 21038 320 --
NM_022553chr6197 ------
NM_022574chr752210 791 349 335 195 --11518 --
NM_022575chr201137 ------
NM_022658chr1231053 432 159 ------
NM_022716chr152656 2517 2172 576 461 21134 1069 ----
NM_022726chr611116 ------
NM_022730chr231047 766 720 --1274 --
NM_022731chr1193 ------
NM_022735chr151828 1757 1421 1399 752 11177 --11311
NM_022737chr1931126 1094 1007 ------
NM_022753chr142828 2364 2197 69 12471 ----
NM_022756chr151521 487 443 358 351 21501 979 ----
NM_022758chr623221 251 12091 ----
NM_022763chr353059 1263 984 752 265 22851 301 ----
NM_022776chr321047 275 --136 --
NM_022780chr23707 550 258 ------
NM_022781chr952712 1239 812 601 266 --12724 --
NM_022802chr1011229 11163 ----
NM_022818chr1631191 650 425 1233 ----
NM_022824chr52754 88 ------
NM_022826chr21243 ----1830
NM_022828chr521330 596 1316 11479 --
NM_022838chrX196 ------
NM_022841chr1522736 217 22780 169 ----
NM_022843chr1321098 145 ------
NM_022845chr1631842 1722 160 --1370 --
NM_022893chr222326 714 1249 1760 --
NM_022894chr22269 142 1311 ----
NM_022897chr52343 253 1223 ----
NM_022898chr1494560 3519 1293 1163 1033 1021 821 602 242 ------
NM_022912chr252764 1954 1178 565 480 ------
NM_022918chr11--21782 834 ----
NM_022977chrX22642 1652 ----151
NM_023000chr1411416 1692 ----
NM_023001chr1411416 1692 ----
NM_023009chr12719 491 --1187 --
NM_023012chr121679 ------
NM_023037chr133988 368 107 ------
NM_023039chr52119 108 1387 ----
NM_023073chr531090 883 56 ------
NM_023075chr182788 216 1174 ----
NM_023079chr1721889 1284 ------
NM_023105chr831859 1795 1628 12030 ----
NM_023106chr831859 1795 1628 12030 ----
NM_023110chr831859 1795 1628 12030 ----
NM_023111chr831859 1795 1628 12030 ----
NM_023927chr531356 981 538 1844 1178 --
NM_023929chr852278 1895 1036 845 513 ------
NM_024007chr511193 11238 --12347
NM_024052chr1742810 2764 1122 205 22595 872 ----
NM_024055chr52643 452 ------
NM_024065chr2193 ------
NM_024077chr9----1591 --
NM_024092chr1121222 441 --1207 --
NM_024094chr82639 345 ------
NM_024095chr121205 --1350 --
NM_024102chr12891 337 --1405 --
NM_024293chr21199 ------
NM_024294chr623221 251 12091 ----
NM_024295chr83581 462 295 ------
NM_024341chr1943849 2580 805 198 1471 ----
NM_024345chr956023 5866 5674 4086 259 26042 1890 --21335 119
NM_024408chr152715 2576 1410 697 480 21352 135 --1638
NM_024415chr5130 ------
NM_024416chr921317 499 ------
NM_024424chr111344 ------
NM_024425chr111344 ------
NM_024426chr111344 ------
NM_024429chr721033 756 2271 206 ----
NM_024430chr1821491 549 --11911 1269
NM_024501chr21738 ------
NM_024503chr11276 ------
NM_024519chr161270 ------
NM_024524chr372879 2187 2034 879 647 618 325 32061 903 487 ----
NM_024539chrX2862 408 ------
NM_024545chr25780 626 551 74 68 ------
NM_024546chr138993 950 910 882 287 275 188 29 ------
NM_024551chr1241805 1701 1004 784 --1354 --
NM_024551chr1241805 1701 1004 784 --1354 --
NM_024556chr112451 400 --1182 --
NM_024563chr52709 265 11930 ----
NM_024582chr411018 1737 ----
NM_024586chr11231 ------
NM_024590chr431544 1323 536 2119 42 ----
NM_024594chr521479 507 11792 ----
NM_024612chr171744 1318 ----
NM_024617chr91306 ------
NM_024635chr91248 ------
NM_024639chr621907 218 1828 ----
NM_024646chr133997 3937 618 11344 ----
NM_024653chr721357 1224 ------
NM_024659chr21640 ------
NM_024665chr3104467 4150 3824 3811 3293 1832 1143 994 752 466 24502 3041 ----
NM_024670chr102505 96 11151 ----
NM_024674chr151189 1000 734 320 215 1786 ----
NM_024680chr11--1144 ----
NM_024692chr231911 1757 149 11836 1190 --
NM_024700chr141009 860 361 289 1235 --11163
NM_024713chr1531435 1296 32 11585 ----
NM_024721chr832570 2423 256 ------
NM_024740chr1153121 2805 1519 1414 377 12693 13295 --
NM_024744chr222482 443 ------
NM_024749chr121629 432 12226 ----
NM_024751chr442119 1758 1389 213 11633 173 --
NM_024753chr22800 62 ------
NM_024755chr153884 860 24 ----1719
NM_024761chr9104986 4733 4024 3867 3662 1319 1268 899 421 347 13381 14491 --
NM_024771chr1152197 846 823 813 690 1889 1303 --
NM_024789chr10172 ------
NM_024792chr171237 11190 1436 --
NM_024814chr71144 ------
NM_024817chr1555954 5821 5067 1263 525 1500 22256 2070 --
NM_024824chr142594 184 21668 46 ----
NM_024834chr102412 404 ----11438
NM_024835chr172339 162 ------
NM_024847chr1631080 454 86 1936 ----
NM_024852chr1--1262 ----
NM_024896chr932341 1002 690 11936 41990 780 770 677 --
NM_024909chr611621 ------
NM_024917chrX3882 846 760 --1838 --
NM_024941chr531324 993 259 ------
NM_024945chr921043 791 ------
NM_024947chr366673 6414 6006 2338 628 408 42715 2031 1529 916 22799 2428 23828 668
NM_024949chr464881 4360 3864 1067 366 94 34949 4040 1846 14390 --
NM_024956chr151476 1522 ----
NM_024969chr21703 ------
NM_024989chr2117539 6400 6193 5737 3221 2821 1610 1547 1279 599 180 36969 6076 2845 ----
NM_024991chr1053003 2996 1156 853 716 ------
NM_024993chr231514 1180 114 11451 1339 --
NM_025054chr833045 2859 266 ----13351
NM_025073chr174648 4588 3681 3162 1752 963 281 2275 168 12914 --
NM_025074chr41945 --21130 1053 11948
NM_025134chr1622402 651 22133 643 ----
NM_025137chr15124 ------
NM_025146chr382465 1714 1672 927 439 395 199 115 --11925 --
NM_025147chr2--2829 79 ----
NM_025154chr71336 21173 1148 11207 --
NM_025160chr134342 3542 2960 11016 --1990
NM_025164chr1182154 833 323 275 239 177 166 157 ------
NM_025179chr134863 4786 3546 --1258 --
NM_025181chr22158 121 ------
NM_025191chr153110 2883 1132 662 406 ------
NM_025203chr21239 ------
NM_025208chr111763 22360 2044 --12082
NM_025235chr1052069 1797 890 356 182 ------
NM_025248chr1733151 955 183 --11098 11296
NM_030571chr531389 1368 1248 11380 1423 --
NM_030579chr1683739 2886 2467 1431 1281 1199 894 667 ------
NM_030594chr1531266 258 192 1199 ----
NM_030621chr1431369 624 312 --2659 479 --
NM_030625chr102786 530 ------
NM_030627chr543595 2936 632 341 ------
NM_030629chr1611636 --11708 --
NM_030637chr141106 1166 ----
NM_030647chr765863 5834 5726 5073 4421 450 11408 24752 2131 --
NM_030648chr475218 4960 3969 517 356 331 256 --23431 654 --
NM_030650chr252746 1055 1037 365 301 23730 1696 ----
NM_030660chr1471015 550 537 503 484 361 232 ----1583
NM_030664chr101418 11554 ----
NM_030670chr1241803 1728 1633 1433 --11738 --
NM_030671chr1241803 1728 1633 1433 --11738 --
NM_030674chr1295805 5128 5079 4794 4250 2022 1968 1953 162 1674 --13698
NM_030751chr10--1245 11511 --
NM_030751chr10--1245 11511 --
NM_030755chr1462984 2544 2235 1157 565 214 22909 1066 --11902
NM_030756chr10286 39 ------
NM_030758chr2221480 1279 --1194 --
NM_030766chr12--1133 ----
NM_030774chr1131286 1065 1055 ------
NM_030784chr6140 1278 ----
NM_030806chr1138834 7737 5823 3782 3747 2453 2439 2278 1916 1891 395 315 83 12016 37704 3240 1362 --
NM_030809chr1231698 944 602 1667 22474 2444 --
NM_030810chr61149 ------
NM_030816chr153520 2742 2653 2279 177 1479 --13407
NM_030881chr2282460 2322 2117 1851 1830 1554 1508 605 ------
NM_030885chr33913 310 143 1444 --1390
NM_030912chr101155 1884 ----
NM_030915chr222314 744 --1154 --
NM_030920chr152004 1985 593 556 130 11299 ----
NM_030925chr1331974 1833 1428 2460 348 ----
NM_030934chr151475 382 83 72 53 1462 --123
NM_030938chr1751063 1010 391 217 44 ------
NM_030939chr661054 893 829 797 357 62 ------
NM_030949chr65961 356 195 186 175 1538 ----
NM_030962chr1131436 495 356 --1117 --
NM_030963chr62602 232 ------
NM_030964chr583687 3260 3120 2874 2432 2384 1324 86 --43611 2551 800 46 1757
NM_031208chr161983 ------
NM_031216chr1811504 --11519 --
NM_031229chr20----1530 --
NM_031243chr742167 2044 1992 1476 --22074 1849 --
NM_031244chr651141 1132 914 865 193 ------
NM_031283chr21857 ------
NM_031292chr12--11196 ----
NM_031296chr442219 2197 1986 652 1383 --1192
NM_031314chr1471717 1289 687 570 334 284 118 ------
NM_031369chr41332 1178 ----
NM_031370chr41332 1178 ----
NM_031371chr111294 11077 ----
NM_031371chr111294 11077 ----
NM_031407chrX129 ------
NM_031411chr51167 1227 ----
NM_031417chr1941014 844 426 197 --11036 --
NM_031427chr1465552 4972 4598 2082 1857 785 12250 24437 2206 --
NM_031438chr51495 --1123 11740
NM_031439chr841600 661 365 242 --1380 --
NM_031442chrX23165 1017 22548 2242 ----
NM_031445chr243288 3203 2770 2366 33307 2832 891 1978 --
NM_031453chr1031741 785 335 --22357 651 12505
NM_031461chr81208 11913 11761 --
NM_031468chr7118185 7447 7382 6822 5881 2468 2341 1678 964 231 225 36216 1314 610 ----
NM_031476chr164754 519 325 51 ------
NM_031483chr2043553 3454 1397 480 23131 135 ----
NM_031492chr112459 144 ------
NM_031844chr174085 2650 1189 960 556 250 64 13325 ----
NM_031845chr233212 2462 1295 --1921 --
NM_031847chr233212 2462 1295 --1921 --
NM_031849chr51167 1227 ----
NM_031857chr51167 1227 ----
NM_031860chr51167 1227 ----
NM_031890chr2262955 2425 2194 1996 498 136 ------
NM_031904chr1132042 2021 1527 12122 ----
NM_031922chr62199 45 ----1470
NM_031989chr122233 94 ------
NM_031990chr1921246 1013 ------
NM_031991chr1921246 1013 ------
NM_031992chr72276 164 1562 ----
NM_032012chr944834 4577 4031 1235 55201 4664 1740 1329 869 21410 765 15137
NM_032013chr201366 11481 ----
NM_032042chr562776 2538 1098 606 470 102 32732 1971 618 ----
NM_032047chr331738 1715 819 4810 509 265 26 ----
NM_032050chr222693 86 1658 ----
NM_032052chr2221078 471 11043 ----
NM_032102chr1141235 1001 665 537 ------
NM_032116chr1384961 4783 3983 1958 1875 1547 1486 1098 2929 761 1107 --
NM_032124chr1841204 505 383 315 ------
NM_032131chr62550 122 ------
NM_032138chr133487 421 249 --1531 --
NM_032144chr231169 718 656 1280 ----
NM_032145chr651906 1863 1816 407 341 --11353 1289
NM_032151chr531190 282 89 1398 ----
NM_032153chr332368 2241 546 ------
NM_032154chr102817 315 ------
NM_032160chr1812766 24209 3523 11369 --
NM_032182chr1051389 1276 1081 297 61 ------
NM_032186chr11574 1958 ----
NM_032189chr1334276 1968 1216 ------
NM_032199chr1033783 1419 971 11309 ----
NM_032208chr232894 912 561 22698 2478 ----
NM_032217chr42297 282 ------
NM_032221chr2031836 626 354 --12058 --
NM_032228chr1182973 2962 2616 2484 2352 887 769 476 1558 ----
NM_032233chr141140 ----1862
NM_032236chr141082 923 884 758 ------
NM_032246chr151363 ------
NM_032256chr122686 162 1828 ----
NM_032271chr1611238 --11437 --
NM_032281chr1942501 2470 2224 284 --11192 --
NM_032288chr332185 1454 138 42173 1894 1880 209 ----
NM_032291chr11216 ------
NM_032293chr92246 34 ------
NM_032320chr111165 --1249 --
NM_032321chr232806 993 985 ------
NM_032343chr3--1197 ----
NM_032352chr1421224 281 ------
NM_032354chr173928 908 280 --192 --
NM_032357chr23634 559 41 ------
NM_032368chr1------169
NM_032373chr1085404 5311 5126 3863 3662 1759 498 478 34880 1328 374 ----
NM_032379chr112843 323 ------
NM_032408chr721138 843 ------
NM_032410chr85946 781 508 450 180 1441 ----
NM_032429chr10--1589 ----
NM_032434chr231039 549 340 --1196 --
NM_032439chr103227 171 88 ------
NM_032440chr1011798 ----12076
NM_032441chrX3949 938 131 ------
NM_032445chr151952 2490 185 11919 --
NM_032446chr511255 13837 2714 58 --
NM_032449chr112240 22370 252 ----
NM_032457chr423077 28 ------
NM_032458chrX32908 2498 403 21303 901 ----
NM_032491chr121411 --11104 --
NM_032499chr151171 ------
NM_032505chr322561 640 1502 ----
NM_032508chrX11340 31244 1085 919 ----
NM_032510chr1842494 2486 2211 470 11554 ----
NM_032521chr2033014 2411 2240 2831 22 ----
NM_032536chr91477 ------
NM_032539chrX3312 171 92 ------
NM_032552chr9----1239 --
NM_032557chr42905 740 ------
NM_032558chr931461 1268 1078 1998 ----
NM_032560chr141287 1813 148 --
NM_032562chr10126 ------
NM_032590chr123837 446 373 1966 ----
NM_032595chr1721545 1237 --11013 --
NM_032598chr17142 ------
NM_032603chr2--1151 ----
NM_032626chr161249 ------
NM_032631chr192185 127 ------
NM_032632chr145823 751 665 629 116 11896 ----
NM_032682chr353550 3391 1231 692 87 13364 13072 --
NM_032737chr1982664 2636 2481 2329 1737 651 395 82 ----1565
NM_032747chr10------128
NM_032765chr52300 116 ------
NM_032777chr831564 1546 403 ------
NM_032784chr61894 1338 ----
NM_032786chr121166 ------
NM_032800chr151972 780 754 217 42 1498 ----
NM_032801chr1131994 1835 1745 11853 ----
NM_032826chr755313 3405 1889 1450 286 11724 ----
NM_032829chr121907 --1320 --
NM_032833chr152377 2206 927 788 750 1943 ----
NM_032839chr31123 ------
NM_032857chr15144 --1176 --
NM_032859chr1342836 1078 1072 675 ------
NM_032873chr1144109 3033 2766 198 2512 141 ----
NM_032875chr171338 ------
NM_032880chr1------155
NM_032892chr151285 ------
NM_032900chr101419 23839 1143 13750 --
NM_032905chr101163 ------
NM_032932chr1734174 1727 1244 25375 3940 14342 --
NM_032943chr112843 323 ------
NM_032949chr13----1529 --
NM_032968chrX54253 4238 2857 1359 587 23368 495 ----
NM_032969chrX54253 4238 2857 1359 587 23368 495 ----
NM_032973chrY54245 4230 2852 1359 587 13363 --1495
NM_032975chr1843201 2646 2297 753 1233 13009 --
NM_032978chr18----135 --
NM_032979chr18----135 --
NM_032980chr1843201 2646 2297 753 1233 13009 --
NM_032981chr18----135 --
NM_032983chr742386 639 402 345 22436 2363 12655 --
NM_032991chr42522 23 ------
NM_032993chr4--1259 ----
NM_032999chr72843 414 11021 ----
NM_033000chr72843 414 11021 ----
NM_033001chr72843 414 11021 ----
NM_033012chr132709 212 ------
NM_033014chr921317 499 ------
NM_033020chr151127 897 833 601 461 14865 ----
NM_033027chr31985 ----1136
NM_033030chr251344 1318 1159 1096 228 ----1591
NM_033044chr121107 1065 ------
NM_033055chr11174 21039 50 ----
NM_033067chr13646 570 62 ------
NM_033081chr2031458 1298 1113 ------
NM_033082chr12238 28 ------
NM_033088chr12683 266 ------
NM_033133chr1743676 2792 433 309 ------
NM_033135chr111763 22360 2044 --12082
NM_033136chr511832 ------
NM_033137chr511832 ------
NM_033138chr7--1880 ----
NM_033139chr7--1880 ----
NM_033140chr7--1880 ----
NM_033143chr424456 759 24410 24 23422 3076 --
NM_033157chr7--1880 ----
NM_033167chr351607 1554 1245 382 226 --11277 --
NM_033168chr351607 1554 1245 382 226 --11277 --
NM_033169chr351607 1554 1245 382 226 --11277 --
NM_033211chr51518 1766 ----
NM_033222chr92437 377 21433 1261 --152
NM_033224chr776986 2873 2413 2394 1612 712 662 11625 --21836 1471
NM_033225chr861989 1255 1090 953 414 219 1202 ----
NM_033274chr543374 1427 1294 763 ------
NM_033285chr884425 4275 3999 3920 1791 1463 1336 568 34474 3381 1622 12956 --
NM_033300chr121209 390 ------
NM_033305chr921088 505 --21076 228 --
NM_033315chr1712203 ------
NM_033316chr34609 529 495 28 ------
NM_033326chr1132527 1814 153 ------
NM_033331chr973576 3293 3089 2803 2269 847 375 12981 ----
NM_033360chr1284479 4082 3082 1649 1459 665 546 328 14297 ----
NM_033380chrX2875 419 ------
NM_033381chrX2875 419 ------
NM_033389chr1774866 4010 3552 3249 1825 923 896 ------
NM_033394chr221421 1045 ----1624
NM_033402chr82564 171 ------
NM_033425chr1142988 2517 716 664 13417 21319 1183 --
NM_033426chr1462842 2753 2595 2542 2386 574 --137 --
NM_033427chr7--197 ----
NM_033429chr1533236 2008 72 --11215 --
NM_033430chr463667 3640 1524 354 345 312 --14121 --
NM_033437chr463667 3640 1524 354 345 312 --14121 --
NM_033480chr621128 180 --12992 --
NM_033481chr621128 180 --12992 --
NM_033503chr1533818 357 336 --12457 1559
NM_033505chr286703 4918 4833 2505 1741 1545 1000 259 2542 381 ----
NM_033512chr842915 1049 283 149 13040 ----
NM_033515chr611029 2992 256 ----
NM_033551chr51960 ------
NM_033626chrX21712 270 --11480 --
NM_033631chr163386 3292 3260 2887 1460 521 11518 23470 1509 --
NM_033642chrX41182 470 454 367 --21088 984 --
NM_033656chr2174728 3678 2330 2198 1952 898 611 35838 4795 1946 ----
NM_044472chr1----1479 --
NM_052811chr1384055 3676 3529 3327 2077 1633 333 25 1948 14292 12004
NM_052818chr1321857 1490 ------
NM_052827chr1211022 ------
NM_052862chr1----11015 1458
NM_052867chr13145 ------
NM_052879chr1283827 3333 3282 2995 1491 888 277 182 24077 2785 12650 12900
NM_052885chr1293877 3528 1864 1812 1405 1331 784 614 453 1679 194 --
NM_052886chr812109 --11721 --
NM_052896chr1------22430 1698
NM_052898chr821881 1346 11392 ----
NM_052900chr81506 ------
NM_052905chr241798 1716 1366 671 1287 ----
NM_052910chr132738 343 --1832 --
NM_052913chr631023 456 301 11161 ----
NM_052918chr1063649 3377 3296 3112 2819 336 42699 2677 1411 1052 ----
NM_052925chr192304 145 ------
NM_052927chr541943 1755 1445 859 2808 328 ----
NM_052937chr822590 817 ------
NM_052954chr212538 204 22154 1726 11913 --
NM_052965chr11919 ----1135
NM_053002chr3----1841 1963
NM_053016chr987633 5517 5157 5120 5090 2530 1925 1453 15740 ----
NM_053023chr1143267 2732 427 177 ------
NM_053025chr321708 1562 --1449 --
NM_053026chr321708 1562 --1449 --
NM_053027chr321708 1562 --1449 --
NM_053028chr321708 1562 --1449 --
NM_053031chr321708 1562 --1449 --
NM_053032chr321708 1562 --1449 --
NM_053043chr7106201 5116 4881 4522 4231 2566 2282 1333 299 128 2379 267 ----
NM_053056chr1162259 2101 1081 983 544 486 --1918 --
NM_053064chr1441918 1897 969 657 ------
NM_053280chr111187 ------
NM_054016chr131941 1598 117 ------
NM_054016chr131941 1598 117 ------
NM_054016chr131941 1598 117 ------
NM_054025chr1142065 1667 203 40 11937 ----
NM_057169chr1272951 2591 2482 2227 647 154 30 12767 ----
NM_057170chr1272951 2591 2482 2227 647 154 30 12767 ----
NM_057175chr432538 651 115 11915 ----
NM_057178chr1722517 234 ------
NM_058170chr111426 ------
NM_058172chr42677 139 ------
NM_058191chr213196 170 42 ------
NM_058237chr142877 107 1857 ----
NM_058241chr22744 379 ------
NM_058241chr22744 379 ------
NM_058246chr711232 ------
NM_078469chr101186 1144 ----
NM_078625chr611080 ------
NM_079834chr1911682 ------
NM_080413chr201137 ------
NM_080414chr201137 ------
NM_080544chr321132 407 11336 ----
NM_080546chr942133 1867 1619 514 1264 ----
NM_080552chr201230 --1266 1567
NM_080591chr932820 2090 598 11130 --3360 259 231
NM_080599chr101959 ------
NM_080607chr2011090 ------
NM_080617chr202959 849 ------
NM_080626chr121347 ------
NM_080629chr111030 1934 ----
NM_080630chr111030 1934 ----
NM_080664chr142787 31 1281 ----
NM_080666chr1431579 1541 32 11562 ----
NM_080676chr2022979 915 22286 1292 ----
NM_080682chr13727 505 487 ------
NM_080723chr651295 564 388 67 22 ----11270
NM_080725chr2021953 1266 11682 ----
NM_080738chr111270 --1124 --
NM_080759chr1362483 1830 934 686 167 128 2732 241 21816 553 --
NM_080760chr1362483 1830 934 686 167 128 2732 241 21816 553 --
NM_080764chr2253239 3087 2659 1047 684 --1916 22973 200
NM_080792chr2022029 322 ------
NM_080798chr10--168 ----
NM_080799chr10--168 ----
NM_080800chr10--168 ----
NM_080801chr10--168 ----
NM_080802chr10--168 ----
NM_080803chr10--168 ----
NM_080804chr10--168 ----
NM_080805chr10--168 ----
NM_080806chr10--168 ----
NM_080807chr10--168 ----
NM_080808chr10--168 ----
NM_080809chr10--168 ----
NM_080810chr10--168 ----
NM_080811chr10--168 ----
NM_080812chr10--168 ----
NM_080813chr10--168 ----
NM_080814chr10--168 ----
NM_080815chr10--168 ----
NM_080867chr1434171 873 220 24941 4766 --14548
NM_080872chr853706 3523 3282 414 359 1629 13416 --
NM_080874chr43462 353 283 11619 ----
NM_080927chr392991 2297 2263 2115 2087 2060 1111 1024 385 --12313 --
NM_100264chr10126 ------
NM_100486chr10126 ------
NM_130391chr963569 3384 3247 3195 986 646 ------
NM_130392chr963569 3384 3247 3195 986 646 ------
NM_130393chr963569 3384 3247 3195 986 646 ------
NM_130436chr2132019 484 278 ------
NM_130438chr2132596 1061 855 ------
NM_130440chr121586 665 11238 ----
NM_130459chr941634 522 143 89 1398 ----
NM_130468chr153775 631 518 --1558 --
NM_130795chr92783 494 ------
NM_130797chr71619 ------
NM_130798chr154612 531 161 83 1258 1286 1236
NM_130808chr31393 ------
NM_130809chr582655 2431 2393 2323 2070 2064 1233 341 2999 542 ----
NM_130838chr1531714 586 301 ------
NM_130839chr1531714 586 301 ------
NM_133264chr1733123 3041 708 1574 11465 --
NM_133265chrX43053 2476 2422 1453 23303 296 171 --
NM_133326chr1--1242 ----
NM_133329chr251647 1577 644 248 232 ------
NM_133369chr51970 ------
NM_133370chr432941 2436 1177 1286 22988 1056 --
NM_133372chr512180 1806 ----
NM_133433chr52827 332 1319 --1715
NM_133443chr1622202 868 --21941 249 12217
NM_133445chr953439 2821 1132 599 320 11268 --1396
NM_133465chr9----1314 --
NM_133468chr71356 12533 12543 12025
NM_133493chr663719 3643 3461 1777 272 66 14040 ----
NM_133496chr173766 3211 2884 1444 526 310 257 21211 326 --21604 595
NM_133499chrX1380 --1180 1260
NM_133631chr32315 166 21668 1562 --11166
NM_133638chr52502 290 ------
NM_133647chr1543872 3785 3589 33 23745 1344 2897 821 --
NM_134269chr22------1325
NM_134270chr22------1154
NM_134427chr92783 494 ------
NM_134428chr91274 ------
NM_134442chr211242 11366 --1625
NM_134447chr192471 128 ------
NM_138270chrX31112 495 486 32567 413 246 12737 --
NM_138316chr1031062 208 170 ------
NM_138326chr2--1165 ----
NM_138344chr143390 381 375 ------
NM_138350chr1--11034 --1334
NM_138357chr1031763 1679 714 ------
NM_138373chr1961904 1611 170 101 61 46 21602 245 ----
NM_138389chr42212 77 ------
NM_138391chr13273 234 120 ------
NM_138395chr24999 805 413 328 ------
NM_138415chr2231885 1805 68 --11700 --
NM_138423chr1562329 2252 2006 1629 1545 1493 ------
NM_138426chr711602 12252 ----
NM_138437chrX--2322 243 1302 --
NM_138443chr18164 1186 ----
NM_138444chr1364907 4861 3991 3509 3349 1274 21852 1802 ----
NM_138448chr2--2179 50 ----
NM_138459chr683375 3133 2458 1227 1199 945 733 643 23250 2395 ----
NM_138473chr1244982 1501 1382 1357 13608 33541 1754 1246 11347
NM_138555chr151421 ------
NM_138558chr1--1776 ----
NM_138559chr22427 80 ------
NM_138565chr1161320 1054 266 250 86 79 --169 --
NM_138576chr1494560 3519 1293 1163 1033 1021 821 602 242 ------
NM_138578chr201160 1368 ----
NM_138621chr264038 3727 588 332 309 260 --23470 108 1898
NM_138638chr1451894 872 657 84 78 ------
NM_138689chr111178 ------
NM_138713chr16118151 6432 5621 1753 1710 1653 1590 1367 812 670 377 47965 6315 1903 1819 --26198 6184
NM_138714chr16118151 6432 5621 1753 1710 1653 1590 1367 812 670 377 47965 6315 1903 1819 --26198 6184
NM_138727chr131851 1598 785 12476 ----
NM_138728chr131851 1598 785 12476 ----
NM_138730chr61384 ------
NM_138735chr2--1240 ----
NM_138766chr5--1643 ----
NM_138771chr7--21562 414 ----
NM_138774chr192594 332 ------
NM_138782chr5164 11976 12207 --
NM_138786chr31405 ------
NM_138799chr221804 1741 --21521 567 --
NM_138809chr532739 2125 1952 ------
NM_138811chr72820 89 --11140 --
NM_138821chr5--1643 ----
NM_138822chr5--1643 ----
NM_138927chr212325 163 --180 --
NM_138931chr3--2854 797 ----
NM_138959chr1126429 5624 5272 5118 4345 2272 2041 1151 1088 1000 899 516 34972 2686 1830 1533 --
NM_138966chr18--1425 ----
NM_138970chr1452448 2166 611 557 244 132 ----
NM_139012chr6--11636 1879 1567
NM_139015chr1221742 654 ------
NM_139035chrX1261 ------
NM_139045chr91328 ------
NM_139057chr1522845 317 ------
NM_139071chr1221148 654 --1546 --
NM_139072chr21699 1110 ----
NM_139131chr112677 235 ------
NM_139135chr131111 1094 820 ------
NM_139167chr81535 ------
NM_139168chr541601 1273 652 550 ------
NM_139207chr12--21476 845 1247 --
NM_139211chr42614 82 ------
NM_139212chr42614 82 ------
NM_139242chr151958 --11491 --
NM_139244chr62114 49 1830 ----
NM_139276chr1722338 232 1357 --11457
NM_139280chr1721363 443 ------
NM_139312chr1021153 32 ------
NM_139316chr7141 21063 748 ----
NM_139319chr1211866 ------
NM_139321chr2041525 655 399 327 23420 440 22950 2602 --
NM_139343chr23166 146 82 --165 --
NM_139344chr23166 146 82 --165 --
NM_139345chr23166 146 82 --165 --
NM_139346chr23166 146 82 --165 --
NM_139347chr23166 146 82 --165 --
NM_139348chr23166 146 82 --165 --
NM_139349chr23166 146 82 --165 --
NM_139350chr23166 146 82 --165 --
NM_139351chr23166 146 82 --165 --
NM_144488chr92783 494 ------
NM_144489chr92783 494 ------
NM_144571chr4106614 6561 4965 4928 4746 2536 1799 1407 1292 677 15022 22476 2163 --
NM_144578chr1444751 1071 613 274 --24211 949 23370 236
NM_144586chr23391 127 37 11236 ----
NM_144590chr102982 465 12732 ----
NM_144591chr10--1457 ----
NM_144599chr1585492 4864 4836 4024 3867 3447 3424 2118 1715 14614 --
NM_144611chr17--1516 ----
NM_144628chr2032155 962 949 1825 ----
NM_144632chr221787 224 ------
NM_144633chr321484 353 ------
NM_144636chr31715 --1562 --
NM_144641chr341207 1177 982 223 ----1293
NM_144642chr32890 354 11151 ----
NM_144664chr1142367 1954 449 347 31972 1639 398 ----
NM_144724chr52742 661 ------
NM_144728chr1172 ------
NM_144729chr1172 ------
NM_144732chr1921078 264 ------
NM_144767chr1554556 3859 3123 3009 297 11307 1799 --
NM_144778chr1321930 130 ----12573
NM_144949chr21253 ------
NM_144963chr832635 2533 149 22527 829 ----
NM_144979chr42674 105 ------
NM_145049chr511007 11059 ----
NM_145055chr1863232 3153 2716 2675 1326 659 23648 1451 13687 --
NM_145056chr192568 99 ------
NM_145062chr6150 ------
NM_145112chr1441142 1109 506 176 ------
NM_145113chr1441414 1381 1071 448 ------
NM_145115chr752276 2211 1701 1688 845 --11978 --
NM_145117chr1153227 2723 2293 1028 810 ------
NM_145175chr211091 ----188
NM_145176chr642229 1098 1036 114 12163 --12598
NM_145203chr131649 --1243 --
NM_145206chr1032393 1082 813 --1870 12970
NM_145212chr211342 31325 84 68 ----
NM_145251chr141196 11017 ----
NM_145254chr163487 89 80 1200 ----
NM_145259chr2116664 6339 6252 5026 4748 2543 2246 1447 962 595 587 16035 ----
NM_145307chr1033918 3683 419 13649 ----
NM_145331chr61856 ------
NM_145332chr611004 ------
NM_145333chr611004 ------
NM_145341chr1021306 613 ------
NM_145649chr632759 2732 2708 ------
NM_145655chr632759 2732 2708 ------
NM_145686chr243146 1246 738 389 1977 23215 139 --
NM_145687chr243146 1246 738 389 1977 23215 139 --
NM_145690chr841909 1397 1332 149 1206 ----
NM_145698chr1022059 740 --11622 --
NM_145716chr11375 ------
NM_145735chr1352331 1905 1135 276 65 ------
NM_145753chr321162 172 ------
NM_145793chr102291 67 ------
NM_145800chrX3921 880 693 ------
NM_145802chrX4870 829 642 381 ------
NM_145808chr742816 2629 2420 1201 21934 1231 ----
NM_145861chr111270 --1124 --
NM_145863chr22520 131 ------
NM_145909chr61494 1162 ----
NM_145913chr123747 655 53 --176 --
NM_147128chr741382 580 426 361 21391 469 128 --
NM_147150chr943937 2507 1533 633 12880 23892 2805 --
NM_147156chr101547 ------
NM_147175chrX1680 31560 1464 292 ----
NM_147189chr852374 2242 820 706 625 31757 1592 123 2494 304 --
NM_147223chr212235 ------
NM_147233chr212052 ------
NM_148174chr841704 1622 1498 655 ------
NM_148571chr1731388 512 275 --1255 --
NM_148898chr73943 272 188 ------
NM_148899chr73943 272 188 ------
NM_148904chr11231 ------
NM_148905chr11231 ------
NM_148906chr11231 ------
NM_148907chr11231 ------
NM_148908chr11231 ------
NM_148909chr11231 ------
NM_148918chr172547 152 ------
NM_148921chr1722398 790 ----1692
NM_148955chr1552312 1497 1305 416 332 --1794 --
NM_148977chr1031062 208 170 ------
NM_148978chr1031062 208 170 ------
NM_152233chr1431637 1326 60 ------
NM_152238chr11245 1258 ----
NM_152259chr151924 --1136 --
NM_152261chr123694 536 207 2930 647 22234 1708 --
NM_152263chr165100 4412 4376 2240 1746 702 --15906 1467
NM_152267chr2232421 2261 496 12271 ----
NM_152272chr84551 496 397 283 ------
NM_152275chr231959 1852 787 --1603 --
NM_152277chr51534 11467 153 --
NM_152280chr153031 2526 2390 2341 529 31183 816 173 ----
NM_152288chr163996 907 225 ------
NM_152298chr14285 192 172 127 --1460 --
NM_152305chr332143 1480 562 11419 1125 11427
NM_152330chr1452245 2233 2212 1075 68 11625 --12281
NM_152335chr15--1535 1241 --
NM_152344chr1731019 608 490 ------
NM_152371chr121730 1645 ----1468
NM_152375chr112572 ------
NM_152383chr2297 85 ------
NM_152384chr221932 169 12020 1544 --
NM_152387chr2------1241
NM_152406chr541443 1224 275 112 ------
NM_152408chr5170 ------
NM_152409chr543083 127 115 67 11304 ----
NM_152414chr811573 ------
NM_152417chr831302 1034 900 ------
NM_152423chrX----1631 --
NM_152424chrX54638 3523 1075 963 855 21449 139 21701 150 --
NM_152437chr1242263 1824 992 957 11612 ----
NM_152450chr1532127 2086 695 --11664 --
NM_152470chr1813793 --1691 13861
NM_152478chr192489 225 ------
NM_152487chr1175 1475 ----
NM_152523chr2--1100 1510 --
NM_152542chr442138 509 364 334 ------
NM_152545chr42609 70 ------
NM_152551chr652929 2525 951 393 207 ------
NM_152556chr742480 1731 998 312 --12399 --
NM_152563chr1121483 991 --11089 1222
NM_152588chr1231712 1598 1489 11816 ----
NM_152594chr1542223 1558 932 145 11952 11434 --
NM_152608chr122188 809 1422 1202 --
NM_152622chr542881 2497 818 504 ------
NM_152624chr5147473 6936 6412 6063 5651 5515 5181 5138 2489 1688 1305 876 812 272 ----15775
NM_152629chr963496 1208 744 588 133 62 --1208 --
NM_152636chr1123055 2745 12920 ----
NM_152641chr1252481 776 715 706 177 --31102 993 547 12319
NM_152653chr31162 1287 --192
NM_152665chr131058 916 223 ----1462
NM_152671chr22188 113 ------
NM_152682chr421634 1251 ------
NM_152688chr62801 748 ------
NM_152692chrX1173 ------
NM_152699chr383434 3172 2874 1150 781 705 463 218 1849 11064 --
NM_152705chr132989 508 1307 ----
NM_152707chr103983 349 21 ------
NM_152715chr11----171 --
NM_152737chr651833 820 704 467 88 --1149 --
NM_152744chr753266 2669 2375 1176 172 1557 12334 --
NM_152753chr631936 1329 776 ------
NM_152754chr732758 2707 186 33215 1501 397 13136 --
NM_152756chr5104244 4097 3317 3302 2861 1470 1169 719 705 647 11628 21707 293 --
NM_152758chr852681 2615 2210 1990 923 12827 11896 1155
NM_152772chr122383 301 ------
NM_152780chrX31054 861 826 ----1818
NM_152787chrX--13568 11491 2941 799
NM_152789chr711062 11503 ----
NM_152826chr1552312 1497 1305 416 332 --1794 --
NM_152835chr152694 2205 1085 509 289 ------
NM_152838chr2053514 995 627 304 67 ------
NM_152857chr62734 716 ------
NM_152858chr62734 716 ------
NM_152862chr21353 ----198
NM_152879chr222473 1867 1441 --12039
NM_152896chr92744 646 ------
NM_152905chr12--181 ----
NM_152910chr132122 113 ------
NM_152924chr1586036 5188 4654 2733 1932 1760 553 246 16811 26594 204 --
NM_152989chr121465 21835 1335 ----
NM_152990chr651150 1018 940 750 37 ------
NM_152995chr4--2903 806 ----
NM_152999chr794932 4669 3196 1894 1476 1126 941 910 148 --13989 --
NM_153013chr532089 1546 345 12322 --1953
NM_153020chr6132 1527 ----
NM_153035chr122836 466 11228 ----
NM_153181chr18--1425 ----
NM_153184chr341705 1307 475 309 11560 ----
NM_153188chr575537 5121 4137 2165 2108 1995 490 --1592 --
NM_153207chr1283823 3247 3224 3044 1147 858 767 551 11498 13770 13719
NM_153226chr105866 403 216 210 204 ------
NM_153235chr632410 2341 2222 --1198 --
NM_153262chr182921 2685 2603 1173 1012 462 441 94 21959 1073 ----
NM_153267chr91220 ------
NM_153333chrX2417 403 ------
NM_153341chr11127 ------
NM_153347chr1111010 ------
NM_153354chr52652 360 ------
NM_153365chr422794 2316 32586 501 439 12366 --
NM_153464chr192600 570 --2620 197 --
NM_153607chr523063 2428 -