TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-591
miRNA Sequence: AGACCAUGGGUUCUCAUUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000216chrX53885 3556 3355 2927 273 13914 11220 13706
NM_001018067chr144274 3845 1460 191 13648 --1462
NM_001030055chr1442976 1870 788 715 --23721 3564 --
NM_001033564chr611517 ----2541 303
NM_001042555chr1234590 3360 986 --1329 13941
NM_002006chr454324 2069 2052 1415 680 14860 --11881
NM_002270chr555245 4151 3991 2090 1286 --11993 25032 1237
NM_003471chr312253 ----21597 33
NM_004496chr1411116 21228 376 21185 1019 1879
NM_004866chr554243 4193 3269 3121 653 13640 ----
NM_004956chr743650 1027 380 155 --1812 13115
NM_005156chr931761 1270 917 1526 24939 212 15264
NM_006379chr741739 544 278 204 --1196 --
NM_006544chr1422369 2203 23864 3824 --14733
NM_007054chr533548 1265 1175 ----13977
NM_007195chr1853398 2958 2300 603 338 ----1256
NM_012419chr61134 --1436 1170
NM_012464chr432351 1096 864 ----1953
NM_015176chr131268 140 86 --11756 11579
NM_015906chr154050 3980 3305 669 599 11334 --14717
NM_016132chr1522359 331 31160 738 228 --11153
NM_017637chr958449 7013 2392 936 575 26650 2641 1708 --
NM_017693chr132638 167 11538 --1469
NM_017813chr844262 3853 1267 1034 145 35423 1050 753 195
NM_018440chr898150 6283 5852 2830 2229 1368 1256 287 120 15352 1969 --
NM_019114chr922039 34 --12577 21916 126
NM_020673chr2085683 4909 4847 4830 2891 2143 769 42 17114 --26555 3016
NM_020774chr1875982 5495 4812 4610 1965 459 376 ----11166
NM_022085chr611450 --1283 1218
NM_024989chr258096 7988 6836 1715 242 --37448 832 178 --
NM_030816chr143306 2546 2402 2384 32361 810 793 ----
NM_080867chr1444835 4713 4659 3140 13269 --14798
NM_152622chr533278 2723 942 ----12896