TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-592
miRNA Sequence: UUGUGUCAAUAUGCGAUGAUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX65629 5586 2671 2497 1283 1257 --11620 --
NM_000109chrX42312 2147 1847 1812 --11055 --
NM_000125chr674002 3942 3758 3344 1103 1090 607 --2655 168 --
NM_000163chr51286 ----1529
NM_000217chr1255034 2056 2019 1894 1745 14378 --1882
NM_000248chr331149 623 499 ----22116 2072
NM_000333chr321001 990 ----1735
NM_000337chr554595 4232 4223 1777 617 12509 14719 --
NM_000362chr2273186 1340 1156 1143 1057 433 211 22863 1035 ----
NM_000368chr963147 1753 1263 974 670 467 14541 23910 43 --
NM_000408chr263003 2394 1207 1085 700 377 --23125 285 13343
NM_000430chr1763556 3550 3178 2488 769 56 --1564 23653 3297
NM_000555chrX136371 6355 6312 5944 4877 3067 2086 1771 1565 1405 1316 911 597 15978 --25396 4966
NM_000618chr1242628 2581 1483 31 35730 1085 639 14968 1999
NM_000813chr555492 4926 4527 2122 104 34106 2244 1585 ----
NM_000814chr1574157 3491 3421 3367 833 106 94 24189 1442 21213 818 --
NM_000833chr1651537 1409 1240 1033 498 --1447 --
NM_000875chr15126238 6090 5088 4577 2704 1123 992 748 699 688 456 232 1798 35228 4353 1751 11633
NM_000933chr2061744 1500 1411 1331 664 640 ------
NM_001001323chr1252609 1985 1033 406 117 --2727 63 12005
NM_001001323chr1252609 1985 1033 406 117 --2727 63 12005
NM_001001323chr1252609 1985 1033 406 117 --2727 63 12005
NM_001001349chr1761675 1607 1496 406 390 186 11724 ----
NM_001001395chr1231012 573 552 --2498 83 --
NM_001001396chr133047 1679 1636 13191 13625 14177
NM_001001419chr555139 1824 1303 1245 829 --13323 1592
NM_001001433chr2042728 2222 1104 228 ----12994
NM_001001971chr1031389 1333 964 ----189
NM_001003760chr62135 23 12411 11323 12327
NM_001004065chr943373 2433 1545 1360 --23514 413 23457 1183
NM_001004317chr664126 3088 1613 1316 1154 295 ------
NM_001004356chr4141205 962 608 594 563 524 475 446 417 386 273 230 170 156 --21276 497 --
NM_001005473chr5116520 6442 6048 5980 5731 5318 4846 4552 4424 4244 2097 14075 35917 2496 1456 --
NM_001007094chr1043656 3637 2966 370 ----23225 1250
NM_001007559chr18----1662 1251
NM_001008541chr1031693 940 361 12341 ----
NM_001008925chr421316 506 --32611 2228 458 --
NM_001009554chr464363 4168 3392 3155 1308 218 --23240 1017 --
NM_001010846chr153893 3325 3034 471 34 --24245 4218 22936 2894
NM_001012393chr1124782 4597 24981 393 33561 3326 1697 --
NM_001013659chr1965108 1441 1304 990 660 464 11748 13671 1773
NM_001014797chr1097485 6495 6308 5706 3168 2306 1744 889 700 26989 2314 37762 7575 6028 17850
NM_001017930chrX31404 1292 941 --21154 399 --
NM_001018111chr733821 2442 884 --12946 13510
NM_001024649chr562941 2864 873 822 735 92 --22078 78 11081
NM_001024916chr91402 ----1293
NM_001025076chr1065759 5592 4937 4063 2396 433 --26192 4003 15412
NM_001025108chr263669 3391 1315 741 348 205 11579 ----
NM_001025580chrX64285 4180 3818 3691 858 488 --11638 13981
NM_001032280chr611366 --11673 11614
NM_001033602chr1351899 1718 1004 709 553 11984 1427 --
NM_001033925chr1051837 647 431 156 56 --1784 --
NM_001034850chr521356 170 ----11530
NM_001037132chr751793 828 368 336 292 ------
NM_001037332chr542213 1876 1025 177 --22441 887 --
NM_001037339chr131146 605 257 1280 --11729
NM_001039538chr252975 2955 2650 1435 812 11024 23194 762 --
NM_001039570chr2264263 4016 3892 3513 3105 661 14368 24574 329 --
NM_001039590chrX33993 1592 1379 --22831 2538 12979
NM_001039618chr1154617 3916 1361 572 93 --1161 11182
NM_001040152chr764394 1820 1264 630 522 105 --11313 21937 1542
NM_001040152chr764394 1820 1264 630 522 105 --11313 21937 1542
NM_001040284chr1634281 3728 1491 ----15733
NM_001040429chr1373548 3379 3332 3111 1418 949 687 --31017 826 572 --
NM_001040712chr933279 965 419 --11062 13580
NM_001042404chr13775 662 586 21668 485 --1493
NM_001042413chr953599 2520 1397 1326 1024 1458 --13461
NM_001042555chr1244676 3993 3285 267 13986 13056 --
NM_001042749chrX31276 117 75 ----11538
NM_001106chr3137405 6598 6342 5888 3732 3601 3207 2770 2616 2219 1156 692 238 28044 964 16133 1371
NM_001167chrX45415 4927 4816 621 --14368 15568
NM_001204chr297616 7212 5935 4970 2939 2625 2035 568 453 1433 17701 --
NM_001356chrX21895 523 --32214 2087 429 1443
NM_001412chrX33611 1313 674 23742 2989 13189 2707 432
NM_001420chr19112340 2066 1279 1089 973 954 899 868 849 839 827 12058 12476 --
NM_001423chr1221928 1836 --1283 12037
NM_001455chr644973 3169 3122 107 --14950 2652 52
NM_001482chr153939 809 37 ----1166
NM_001616chr263377 2586 1402 1324 971 320 --1483 13226
NM_001626chr1973274 2860 2608 1127 1121 151 25 --23164 2280 --
NM_001668chr172252 2047 2032 1884 804 332 119 --12136 --
NM_001759chr1255185 3893 1166 698 663 14572 11229 --
NM_001969chr1463898 3077 1291 1005 927 252 ------
NM_002006chr445224 4702 4107 3590 14751 25537 4520 14603
NM_002025chrX57921 6279 2767 691 166 28139 398 27233 3685 13160
NM_002126chr1794075 3490 3021 2898 2762 1500 1050 961 88 13975 11644 --
NM_002264chr364926 3637 1478 736 695 377 14043 24722 1832 --
NM_002267chr132342 323 11678 --1534
NM_002270chr523820 759 13772 22021 1326 15661
NM_002397chr541470 1424 538 491 --21990 165 --
NM_002487chr15--1661 --1570
NM_002522chr1763935 3114 2644 2637 1299 523 --12675 --
NM_002581chr965520 5179 5151 3888 3760 3694 25269 3668 12022 14400
NM_002655chr865146 4232 3980 675 530 365 --14326 --
NM_002709chr282453 1403 1377 1206 1016 703 94 45 13374 ----
NM_002710chr12--1365 1692 1430
NM_002737chr1776641 6413 4505 4377 1861 1610 691 11346 15141 --
NM_002753chr46870 573 227 203 82 43 1656 --1708
NM_003028chr973120 2380 1263 1035 1015 946 351 1854 13865 --
NM_003030chr321454 1306 --21850 1486 --
NM_003108chr277079 6763 6621 6357 4489 2556 1401 15923 25419 924 1181
NM_003128chr272867 2831 2755 2639 966 646 392 --21734 893 12488
NM_003257chr1521197 98 --21315 1123 11263
NM_003319chr22261 199 ----1649
NM_003342chr1732637 2615 61 --1553 13147
NM_003458chr3103598 3150 2993 2955 1465 1331 1253 594 434 304 --1560 --
NM_003473chr102923 771 ----1255
NM_003590chr223507 3367 --23771 1393 13263
NM_003672chr131895 1819 1631 143 ----
NM_003873chr1052460 2408 2109 725 362 ----1267
NM_004124chr1423244 2787 163 --23489 2533
NM_004215chr82576 95 --1492 1535
NM_004227chr763069 2459 1150 958 798 372 1631 ----
NM_004274chr141659 ----12522
NM_004464chr433415 716 90 21311 230 1349 1491
NM_004501chr133984 3028 2751 --31393 1221 26 --
NM_004586chrX34542 4236 1426 ----12007
NM_004614chr1662313 2025 1824 1641 463 319 32212 1770 996 12203 --
NM_004687chr1762029 1574 1336 1300 1284 193 --21748 1399 --
NM_004745chr885848 5386 4915 2703 2628 2227 2012 137 --24935 4588 11336
NM_004834chr253438 2945 2314 579 495 21100 406 --11231
NM_004852chr181314099 12001 11627 8623 5622 5416 4571 3797 3638 3262 2657 1818 926 411504 5122 454 25 313185 4716 3721 211220 9467
NM_004866chr534531 1624 255 --25038 3669 --
NM_004898chr442362 663 387 24 1740 --1843
NM_004956chr754194 3069 1410 803 57 2751 672 24279 1400 --
NM_004992chrX108228 8210 7772 7626 6646 5856 5459 2669 1053 631 ------
NM_004999chr653541 3412 3106 1763 1723 --33400 1422 364 11173
NM_005180chr1031592 162 126 1312 ----
NM_005201chr32344 157 --1874 1177
NM_005339chr432768 1532 896 --43775 3676 2938 1042 --
NM_005359chr1845719 5690 5609 4895 21257 787 --12071
NM_005399chr143253 3205 663 531 --24400 4375 1510
NM_005400chr252614 2119 1952 1225 391 1909 1837 --
NM_005436chr1074029 2978 2782 1470 598 563 531 13774 14109 --
NM_005502chr931224 288 130 --1464 1959
NM_005504chr1236567 4879 2396 15001 1708 14056
NM_005596chr986110 5958 5739 5413 4713 1649 1552 1396 --15357 1298
NM_005746chr732389 575 117 --183 --
NM_005748chr1232843 1050 92 --22126 565 --
NM_005795chr242443 1035 253 239 --22107 632 --
NM_005839chr11187 ----1210
NM_005898chr1172811 2045 838 684 639 352 241 --1572 --
NM_005909chr534003 3035 1585 13309 --1718
NM_005941chr854031 3921 3841 3537 990 ------
NM_006011chr1534165 3895 297 21427 671 13787 179
NM_006037chr2113778 3205 2988 1810 1051 827 809 360 255 247 181 13790 23963 3603 23453 354
NM_006252chr186801 6731 2986 2473 1773 1460 166 127 --17225 14639
NM_006298chr683352 3304 3046 3038 2764 2629 881 734 --12491 --
NM_006393chr102850 133 --24170 2789 11820
NM_006544chr1425934 4336 --24005 105 11127
NM_006572chr1742286 1315 1121 432 --13353 --
NM_006595chr1141871 1392 597 22 ----21553 666
NM_006599chr1698129 6892 6666 6512 6271 5762 5598 1415 479 --1605 --
NM_006624chr102423 48 --21845 538 11487
NM_006646chr1352138 989 920 875 766 --22860 1153 --
NM_006729chrX45354 5267 3769 1757 25395 2025 25411 3455 --
NM_006823chr811010 ----11224
NM_006902chr143244 3119 3111 2056 23087 686 ----
NM_006912chr142447 2019 859 509 11675 --12562
NM_007035chr123325 219 49 184 ----
NM_007039chr1441423 733 111 90 --12125 1911
NM_007214chr61472 1981 --1487
NM_007249chr1399252 8194 7867 5851 2320 910 903 330 146 12974 1755 1226
NM_012069chrX52261 1964 159 143 94 --12593 --
NM_012164chr957368 6151 2360 2264 1101 --27425 190 --
NM_012193chr1183984 3539 3315 2099 1989 1913 1860 1670 13758 11066 --
NM_012234chr362999 2684 2328 1245 1079 192 11394 22836 547 --
NM_012262chr154832 4667 4530 2100 323 15117 24821 1136 --
NM_012290chr241538 1412 453 420 11145 ----
NM_012296chr1183750 1296 1265 1126 1048 1031 621 137 --13895 --
NM_012297chr442444 2184 1902 508 --21720 92 --
NM_012382chr521246 477 --22947 61 12983
NM_012395chr753145 2867 2629 2574 1214 --23310 261 --
NM_012463chr1251640 1566 1424 1276 551 --31728 1579 118 --
NM_012464chr432625 450 54 1371 --184
NM_012479chr742443 2179 1011 155 ----12226
NM_013231chr1453950 1322 1185 327 76 ------
NM_013357chr84342 283 275 131 ----1325
NM_013447chr1943767 1520 1145 528 --1859 13565
NM_013943chr132798 759 663 12408 13075 12985
NM_014011chr2----11792 12094
NM_014157chr1673834 3683 3328 3154 2897 400 230 11118 1958 1512
NM_014423chr565245 4894 4605 3650 883 504 --11052 --
NM_014504chr721394 676 --21621 204 --
NM_014572chr1311276 1392 11719 11808
NM_014585chr2--1282 --11224
NM_014636chr953612 559 207 131 81 11160 12793 1547
NM_014637chr821275 221 1381 11087 --
NM_014872chr951842 1767 1457 580 464 --52022 1905 918 869 279 --
NM_014877chr17107494 7077 6769 5853 2498 2358 1994 1780 1558 1006 --27255 4836 1542
NM_014920chr622956 688 --23356 2822 --
NM_015025chr242645 2600 1778 378 --1222 11872
NM_015144chr1653756 3447 3121 2615 412 32745 634 45 11038 --
NM_015185chrX42233 449 337 151 ----13013
NM_015192chr2052577 2389 2322 908 578 --12643 --
NM_015265chr25982 974 966 764 184 1802 --22006 778
NM_015271chr464100 4094 3887 2915 1610 484 ----12670
NM_015310chr867391 6302 6284 3360 2225 730 --28391 7313 11475
NM_015339chr204838 734 203 28 --1970 --
NM_015344chr83798 495 471 --12072 12140
NM_015352chr2042984 2935 2591 785 13277 13610 1366
NM_015435chr83966 455 125 ----11137
NM_015635chr91104 --1598 1835
NM_015723chr71568 ----1552
NM_015888chr143277 2880 2526 727 22311 559 12122 --
NM_015912chr842142 684 635 139 --1866 --
NM_016083chr653053 2773 2614 763 637 ------
NM_016089chr3101807 1333 806 722 638 470 386 302 134 50 ------
NM_016257chr143383 2873 2654 562 22959 1269 12275 --
NM_016530chr1544060 3845 3448 220 --13248 12781
NM_017420chr1421178 1138 168 33690 3454 1343 --
NM_017599chr1221699 558 ----31822 499 246
NM_017610chr1542152 1633 1617 213 11999 ----
NM_017628chr484712 4693 4009 3588 1917 1379 1167 421 --44286 4199 3733 539 --
NM_017633chr633867 2727 2403 ----2633 289
NM_017637chr957933 7496 7382 7190 3088 36069 1245 955 18666 --
NM_017704chr111111 --2363 262 1299
NM_017813chr834308 922 613 --11205 25782 1562
NM_017824chr1041743 1730 956 658 ----1425
NM_017848chrX64008 3362 3330 1628 1523 382 --1749 --
NM_017944chr1122055 110 12139 22827 1238 --
NM_018011chr131489 --1514 1546
NM_018254chr122461 929 --22102 504 --
NM_018351chr1234191 3245 239 --1319 13007
NM_018364chr143943 1123 761 127 --1419 12497
NM_018374chr731821 1342 267 14559 25076 1774 15235
NM_018403chr353730 3084 2896 694 153 --23392 1242 --
NM_018427chr1651661 601 585 130 30 --1247 1307
NM_018717chr432757 2631 2364 21968 415 12522 --
NM_018981chr221111 50 ----11176
NM_019022chr1843049 1028 951 348 --1968 13198
NM_019117chrX22892 2547 ----1764
NM_020116chr42667 165 --11595 1324
NM_020122chr275922 5642 4957 2258 697 607 242 ------
NM_020336chr2063693 3233 3137 2736 760 574 1199 1544 1797
NM_020342chr232304 963 506 ----1480
NM_020466chr654264 3543 2006 1177 815 33508 3355 259 24887 4709 --
NM_020699chr154889 4691 3923 496 481 11068 ----
NM_020718chr1655763 5095 727 446 232 15933 --16200
NM_020752chr102382 338 ----21119 598
NM_020771chr621084 569 --21105 591 1189
NM_020772chr1758046 7346 5767 3308 2174 164 32383 1411 442 --
NM_020795chr1751683 1591 743 666 354 ----1609
NM_020801chr552258 960 498 415 84 --21002 231 12386
NM_020859chr442772 553 440 208 ----11598
NM_020871chrX32369 732 282 ----22355 1679
NM_020925chr1--1420 21026 409 11374
NM_021033chr1343453 2183 1282 599 --11334 --
NM_021097chr242132 1073 679 82 11192 23015 2968 --
NM_021252chr10146 ----1312
NM_021638chr464666 4402 3169 1839 1530 285 --24296 4169 --
NM_021643chr241838 625 510 107 177 31517 1412 1259 --
NM_021813chr685859 5224 5161 4980 4027 732 238 68 --34801 1526 1516 15150
NM_021961chr1145450 1328 1137 851 24843 442 27412 2348 --
NM_022832chr44783 617 562 306 --1196 1447
NM_022912chr212573 12539 23069 2849 12481
NM_024090chr421674 484 ----21560 71
NM_024665chr354635 4308 902 840 720 1871 13308 --
NM_024761chr924885 3326 34848 3734 1107 31874 300 92 --
NM_024949chr434558 3538 707 21649 751 24330 1992 --
NM_024989chr257640 5430 2679 1873 1260 --26629 1914 --
NM_025179chr134085 4018 1089 24936 4326 24730 3562 --
NM_025195chr81660 --21783 366 11448
NM_030648chr454873 3591 1667 1552 1060 --24997 969 1239
NM_030762chr1221487 452 31886 1840 1311 ----
NM_030816chr13449 139 123 --22576 238 --
NM_030817chr1233724 1090 178 11003 --1457
NM_030918chr165146 3759 3639 2184 2174 1183 15352 13537 --
NM_030938chr171865 11040 1157 1301
NM_030940chr911020 --1106 21341 1235
NM_031216chr1851723 809 383 200 114 ------
NM_031445chr263219 1133 992 941 691 54 --11213 --
NM_032172chr71727 1779 2830 704 --
NM_032440chr1041832 1040 267 99 --11876 1567
NM_032457chr453128 1459 1370 469 158 --12526 --
NM_032499chr1511586 21405 215 --11212
NM_032505chr322308 170 12378 22058 2004 163
NM_032859chr1322508 104 --23982 2691 11208
NM_032968chrX43985 1586 1226 713 161 12770 --
NM_032973chrY53977 1585 1226 819 713 161 12765 --
NM_033505chr242136 1973 1605 208 --1134 --
NM_033656chr2124089 455 --22377 1629 --
NM_052879chr1253611 2954 2769 2705 725 --34022 3344 1607 --
NM_052904chr64993 540 523 484 1347 --11053
NM_052906chr2265030 3429 2000 244 217 117 14036 14524 --
NM_080836chr2064071 3939 3394 3256 1332 446 34537 522 279 34678 4157 1141 --
NM_080927chr353139 3066 1270 604 227 12532 22358 185 --
NM_133493chr663351 3248 1547 1049 950 564 1863 --11699
NM_133646chr255016 3673 1270 634 290 14965 35225 432 414 --
NM_138286chr1944259 4046 636 322 ------
NM_138423chr1542209 2187 1454 110 --1217 1469
NM_138468chr266366 6332 6079 1505 1094 1026 14144 15478 26016 993
NM_138473chr1264695 4470 3884 3161 1570 27 34676 3512 143 2897 561 --
NM_144571chr456775 6362 5865 4984 1622 --11334 15043
NM_144599chr15125395 5089 5042 4957 4762 3999 3884 3750 3624 1165 416 215 11433 14704 --
NM_144664chr1112556 ----22292 1719
NM_144963chr842355 1748 930 633 --12698 12374
NM_145305chrX2321 296 --11135 1534
NM_145753chr321683 387 ----11416
NM_152409chr533288 2400 489 11329 12185 13334
NM_152682chr41521 ----11766
NM_152774chr732729 2509 2191 --21100 338 --
NM_153183chrX5914 831 387 212 110 ------
NM_153184chr322008 660 1428 21688 628 --
NM_153262chr1----12264 22649 165
NM_153367chr1073226 1356 1263 902 660 581 182 1851 12534 --
NM_153456chr13106247 5982 5898 5034 4998 4393 636 347 193 46 15443 25828 2411 13991
NM_153607chr542606 2434 2048 979 --22819 455 --
NM_153619chr1542808 2363 2223 1123 --23091 727 --
NM_153810chr1044049 1760 971 42 15023 ----
NM_172070chr241725 1378 353 326 ------
NM_173468chr421202 693 ----25194 1659
NM_173491chr52485 226 --21164 513 --
NM_173495chrX32071 1654 229 ----12372
NM_173531chr1923072 778 1132 --12837
NM_173602chr1221347 1014 --42752 1246 369 222 --
NM_173829chr545541 5124 1498 819 --36147 1339 431 46050 2088 1850 973
NM_178011chr1033187 2996 2316 --1903 --
NM_178313chr251709 1697 761 568 352 --21904 329 --
NM_178505chr1062955 2722 1411 1207 418 295 13300 12804 12940
NM_181504chr564118 4006 2798 2543 692 481 ------
NM_194247chr253699 3144 2840 2777 609 --23283 3063 11096
NM_194298chr1011873 ----11772
NM_197941chr553043 2750 997 358 206 --13059 11931
NM_198503chr13363 255 68 --22185 1826 --
NM_198965chr12130 ----1333
NM_199131chr1032399 731 527 12847 23128 2633 --
NM_206853chr633273 2741 2631 1529 33415 2915 593 --
NM_207406chr474701 4640 1879 513 495 482 176 --22620 2590 1782
NM_212558chr943144 3065 806 173 1512 ----