TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-595
miRNA Sequence: GAAGUGUGCCGUGGUGUGUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr581990 1738 1407 1352 827 623 160 61 11608 ----
NM_000084chrX156959 6342 5779 5588 5028 2673 2442 2183 1829 1757 1678 1375 1363 996 110 --183 15262
NM_000089chr72507 308 ------
NM_000093chr932389 1011 253 1910 ----
NM_000125chr6124224 4149 4060 3760 3559 3359 3288 3257 657 385 367 94 --24205 3373 --
NM_000135chr163980 894 771 ----1694
NM_000141chr1041394 1070 578 54 ----1354
NM_000142chr421338 606 ------
NM_000163chr542224 1882 594 587 1518 1331 --
NM_000170chr92408 340 --1463 --
NM_000176chr583355 3079 2934 2593 2518 1166 554 138 22921 703 23872 352 --
NM_000176chr583355 3079 2934 2593 2518 1166 554 138 22921 703 23872 352 --
NM_000196chr16----1518 --
NM_000208chr1974515 4187 3435 2985 1208 845 133 ------
NM_000217chr12105369 4977 4173 4111 3991 3943 2092 451 331 102 13271 191 --
NM_000232chr453173 2170 2070 1175 180 12922 ----
NM_000245chr752162 1740 1576 463 436 11488 22039 34 --
NM_000248chr321936 444 ----11153
NM_000259chr1585457 1512 1193 1077 645 153 86 34 56304 6093 5200 2194 823 15706 11923
NM_000267chr1742458 642 429 102 11016 12475 --
NM_000271chr18----1472 --
NM_000280chr11----1768 --
NM_000286chr17186 1883 ----
NM_000304chr171200 --1883 --
NM_000314chr1072420 2348 1307 1198 419 277 176 31155 989 245 22711 1231 --
NM_000332chr6177017 6899 6281 5551 5542 4839 4723 4635 2785 2743 2450 2370 2264 1390 1263 858 602 22205 1808 45224 4766 2178 1140 --
NM_000337chr596218 6009 5944 5905 5818 5052 4722 4318 457 14274 15059 --
NM_000362chr2272615 2487 2459 1158 918 857 118 1128 11011 --
NM_000390chrX73404 3084 2332 1276 1238 567 191 1180 1365 12164
NM_000393chr251640 1406 1357 1332 778 1802 11545 --
NM_000430chr1752875 1367 792 762 740 13237 2772 567 --
NM_000448chr11103234 3088 3056 2972 2426 2135 1291 1188 944 539 11151 12248 --
NM_000461chr394195 4014 3879 3841 3610 2817 1363 1090 812 11784 --11288
NM_000465chr2122 --184 --
NM_000486chr1243054 2723 1035 37 ------
NM_000489chrX83425 3335 2687 1254 1134 442 216 180 --22967 2260 12748
NM_000522chr761199 1141 929 503 333 42 --11110 --
NM_000555chrX147859 7230 6299 6170 5946 5920 2696 2287 2088 2060 1868 1307 667 140 26345 374 16922 --
NM_000599chr21784 --24529 3924 --
NM_000609chr10--23129 179 1132 --
NM_000610chr1152757 2172 1202 1024 354 33023 2474 70 ----
NM_000615chr1163018 1861 1158 472 419 226 --42786 2404 840 377 --
NM_000618chr1266068 5323 2630 1946 1564 426 26532 113 --16299
NM_000633chr1885211 5183 5126 5067 4175 4007 1869 893 --25033 3887 --
NM_000680chr81360 1442 1434 --
NM_000719chr1286164 5069 4913 2190 1905 1577 1065 723 ------
NM_000726chr241151 973 554 241 2532 223 ----
NM_000767chr1931383 251 157 --1376 --
NM_000793chr1454912 4777 3689 3269 1431 1930 2776 154 --
NM_000800chr521385 351 11622 11311 --
NM_000806chr541926 1543 1470 530 1313 21841 1279 21701 671
NM_000810chr15--1475 136 --
NM_000811chr5--2692 323 1783 --
NM_000813chr5114588 4291 3707 3572 2157 1573 1452 1305 840 443 183 --25398 2125 --
NM_000814chr15104129 3707 3493 3423 3393 1641 1152 1061 835 260 ------
NM_000826chr462484 1755 1667 843 830 792 1542 1485 --
NM_000828chrX32180 1766 655 1638 --1411
NM_000865chr6----190 --
NM_000868chrX2451 424 --12215 --
NM_000875chr15135732 5435 4990 4682 4530 2217 1995 1419 1185 1125 701 690 280 22617 263 24449 168 --
NM_000883chr71696 --1661 --
NM_000891chr1773282 3163 3150 2468 1379 1080 875 1757 11270 --
NM_000899chr1254392 3613 3472 3387 2800 1983 ----
NM_000901chr431918 1020 584 --22115 106 --
NM_000912chr853269 2670 2343 890 849 --12628 11272
NM_000919chr51589 --1127 --
NM_000933chr2011502 --11789 1644
NM_000944chr462421 2193 2053 1477 453 151 1690 11969 --
NM_000945chr262073 1356 597 390 198 29 1633 1125 --
NM_000959chr193938 3677 3560 3111 2783 1104 776 241 181 33782 3756 630 43551 2927 2862 2600 --
NM_000965chr33847 399 73 ------
NM_001001323chr1252917 2215 2155 755 310 32186 2061 1063 1409 --
NM_001001330chr1051110 888 495 314 87 1946 ----
NM_001001331chr361832 1782 1668 896 639 342 --12531 --
NM_001001395chr1262849 2815 2212 1978 1059 692 ------
NM_001001396chr163627 3511 2906 1681 1638 598 23787 2739 12709 --
NM_001001433chr2043115 2605 1106 797 ----1639
NM_001001483chr11------1435
NM_001001557chr812161 --11816 --
NM_001001664chr2114117 3616 3467 3446 2708 1191 1135 844 532 442 248 42751 2522 757 607 11065 13437
NM_001001933chr15616 534 433 228 166 ------
NM_001001974chr1072076 2003 1952 1829 1518 660 410 12335 12205 --
NM_001001994chrX1450 --1205 --
NM_001001995chrX41857 326 230 113 1488 1253 1280
NM_001002032chr172581 217 1141 1749 --
NM_001002233chr852042 1718 1440 850 353 11655 1458 12202
NM_001002838chrX41481 1297 318 248 ----11713
NM_001002860chr14154593 4493 3882 3646 3566 3011 1815 1749 1161 859 749 714 433 300 261 43658 3310 1649 309 1382 1361
NM_001002909chr1752097 2058 1680 404 366 --1615 21811 1513
NM_001003652chr18188191 8082 7950 7695 7128 6338 5329 3319 2726 2163 2067 1850 1648 1639 1496 714 359 118 27705 3336 12987 17809
NM_001003679chr121467 81 --12067 --
NM_001003681chr2211415 --22144 1956 --
NM_001003688chr44827 352 183 107 ------
NM_001003712chr12103969 3893 3718 3487 3347 1007 749 495 225 164 1680 23038 1395 --
NM_001003760chr683456 3340 2597 2333 1268 1047 361 106 199 22797 331 --
NM_001003800chr983753 3436 2466 1145 485 264 158 22 12644 ----
NM_001004065chr922697 1362 32765 1548 565 21576 770 --
NM_001004317chr6114437 4330 4057 3513 3347 3339 2838 2790 1790 511 164 ------
NM_001004354chr9--11077 11028 --
NM_001004360chr23802 421 128 11380 11790 --
NM_001004720chr261009 965 845 805 235 178 ------
NM_001004722chr281178 1134 1014 974 404 347 189 24 ------
NM_001005335chr192275 42 --1303 --
NM_001005366chr123254 177 126 ------
NM_001005404chr1764236 3617 3580 3208 3139 86 11418 ----
NM_001005463chr10122571 2510 2412 2129 1958 1767 1747 1677 940 758 671 404 11040 1242 1421
NM_001005473chr5146522 6444 6288 5637 5409 4976 4581 4554 4215 2596 1992 435 169 60 --36390 5321 5032 --
NM_001005476chr22693 474 ------
NM_001005743chr141468 ----1328
NM_001005861chr31992 --1105 1260
NM_001005909chr3----1206 --
NM_001006600chr572245 2090 2057 1747 1716 1535 742 154 ----
NM_001006612chrX2426 297 ------
NM_001006623chr272350 1667 1625 1587 933 828 503 --32404 1797 992 138
NM_001006636chr24895 699 335 308 --1803 --
NM_001006684chrX----1202 --
NM_001007024chr1744290 4024 3125 2713 --24213 201 --
NM_001007067chr841109 1039 855 693 2916 423 1392 --
NM_001007094chr1064123 3737 1615 1223 239 182 --24404 373 --
NM_001007098chr11373 --1879 --
NM_001007156chr1541966 1420 611 315 --21203 658 --
NM_001007237chr152872 2862 2638 2047 1859 --2810 483 --
NM_001007257chr141178 1151 1056 939 11486 ----
NM_001007271chr103720 436 391 --1752 --
NM_001007277chr111416 1815 ----
NM_001007553chr131180 940 359 1108 ----
NM_001007559chr1871506 1492 683 469 462 396 354 --1208 --
NM_001008220chr553672 1507 938 796 361 ----12976
NM_001008239chr1853562 2697 2652 2386 887 ------
NM_001008392chr3113469 3134 2953 2636 2361 2203 2181 1041 850 836 727 --1794 --
NM_001008408chr7126076 5731 5188 4802 4685 4371 2028 1577 1261 1252 218 40 1411 1676 11299
NM_001008491chr291948 1904 1896 1855 1396 1279 446 216 38 42019 1765 639 304 1118 --
NM_001008493chr131275 1136 357 ------
NM_001008495chr872026 1990 1919 1803 1600 802 243 11942 11909 --
NM_001008541chr1051763 1695 1477 345 129 1170 12230 1365
NM_001008564chr1332082 544 159 --21800 344 --
NM_001008738chr582908 2894 2758 2724 2139 1113 1006 708 ------
NM_001009554chr4124170 4057 3969 3933 3684 3208 2888 1680 1432 749 608 602 44537 3923 3025 1843 174 13186
NM_001009555chr431455 1242 125 1389 21366 1305 --
NM_001009881chr1--1116 1564 --
NM_001009909chr1173841 3822 3149 2949 1415 1220 739 23039 2796 1142 --
NM_001009955chr11564 ------
NM_001009993chr253485 3008 1332 545 41 21255 117 ----
NM_001010854chr142733 98 ------
NM_001010862chrX63273 2691 1097 1061 339 327 --1256 --
NM_001010867chr1126558 6238 6178 6093 5828 5293 4399 2650 2446 1933 1570 996 --26068 1953 --
NM_001010888chrX73999 3794 3164 1749 922 224 57 23319 1234 43189 1218 1118 866 --
NM_001010908chr10--1780 1614 --
NM_001010942chr123455 321 164 --1338 --
NM_001010980chr172525 2250 1313 932 803 297 69 --1554 --
NM_001010986chrX62411 1895 698 446 66 51 2569 211 1389 --
NM_001011553chr73774 278 230 1671 ----
NM_001011666chr796401 5546 4937 4816 4682 4249 1252 776 220 55032 4843 4317 2601 163 --16463
NM_001011708chr282949 2164 1810 996 887 409 396 279 1649 1317 --
NM_001011713chr1451620 1024 436 389 156 --1171 --
NM_001012393chr1194262 4221 3924 3239 1650 1622 1316 1254 63 24461 3565 14344 --
NM_001012398chr1631050 421 30 1797 ----
NM_001012423chr1552723 2626 2152 610 502 22014 533 1210 --
NM_001013399chr631085 952 249 ------
NM_001013438chr33727 690 62 1197 2326 260 --
NM_001013691chr194721 549 287 37 ----1206
NM_001013717chr541398 1353 480 252 21370 463 ----
NM_001013843chr152894 746 --2644 237 --
NM_001014380chr1395066 4658 4619 4038 1776 1254 1200 1034 616 34494 1464 689 35595 5584 3663 14642
NM_001014434chr12699 585 1711 1763 --
NM_001014446chr4187 ------
NM_001014796chr11175 ------
NM_001014797chr10147939 7786 7257 6038 5735 5550 5516 2889 2726 2577 2172 2032 1302 345 26738 1603 25594 1892 --
NM_001015045chr442287 1825 1557 348 1803 11983 --
NM_001015877chrX72612 2005 1110 840 724 446 357 22950 2376 --11162
NM_001015887chr351757 1629 1560 1190 93 --21505 1349 11382
NM_001017395chr343648 3539 3057 456 2685 126 2777 714 --
NM_001017415chr12510 276 ------
NM_001017424chr121224 174 11718 --11517
NM_001017969chr9193 ------
NM_001017977chr11347 253 24 ----
NM_001017979chr41113 --1203 --
NM_001017998chr93891 365 83 ------
NM_001018004chr154737 726 522 25 --1224 --
NM_001018054chr151273 1043 471 227 53 ------
NM_001018067chr1125313 5003 4558 4230 1903 1811 1616 1537 1506 718 425 273 --24321 656 24481 1376
NM_001020658chr131526 1474 255 --11573 --
NM_001023587chr31179 --1166 --
NM_001024218chr141809 1683 ----
NM_001024226chr131127 821 443 ------
NM_001024455chrX62003 1889 1023 776 693 546 --12295 --
NM_001024460chr641088 419 338 221 --1999 11170
NM_001024847chr382356 1010 608 573 567 273 267 224 22430 918 ----
NM_001024956chr11145890 5561 5203 5040 4965 4765 3835 3676 2271 2027 1273 860 639 623 44922 4797 4756 4041 24953 1292 --
NM_001025068chr341797 719 264 183 11484 --1472
NM_001025077chr10127379 7052 6607 6089 6020 5534 5308 3001 1886 752 632 98 36890 613 530 11141 --
NM_001025079chr353982 3601 3202 627 58 23971 1377 44038 1468 1168 861 --
NM_001025108chr273924 3662 3247 1652 1300 328 115 23711 1587 1353 --
NM_001025266chr3124900 4683 4511 3665 3191 3163 3156 3089 1577 1509 899 777 ----1965
NM_001025580chrX43820 2926 1054 823 --11272 24129 1290
NM_001029858chr643253 3009 650 616 12326 1440 --
NM_001029875chr592993 2936 2551 2513 2042 1041 913 810 163 22214 545 12952 --
NM_001030006chr1772035 1807 1642 415 400 188 99 ----12707
NM_001030007chr1693781 3515 3399 2963 2697 2521 1462 1126 472 13958 22529 253 22674 273
NM_001030055chr14104300 1369 1233 1056 882 871 539 120 107 81 2956 365 1556 1851
NM_001030chr1----149 --
NM_001031679chr1283496 2784 2376 2285 2210 709 627 592 --22861 1323 --
NM_001031684chr221459 269 ----1219
NM_001031689chr9----156 --
NM_001031690chr762923 2689 1113 1000 976 177 ------
NM_001031711chr531476 395 199 --11367 --
NM_001031716chr22825 64 156 ----
NM_001031723chr41411 ----1451
NM_001031732chr453628 2257 1423 1016 221 11387 1900 --
NM_001031743chr6----1169 --
NM_001031804chr1613509 --24276 1081 23558 1257
NM_001031812chr571849 1805 1730 1522 848 809 295 21715 1494 2135 127 --
NM_001032280chr641675 1370 1224 525 --1464 1488
NM_001032283chr1231019 71 62 2784 372 --1364
NM_001032393chrX4658 607 546 50 ------
NM_001033057chr321819 132 12025 1223 --
NM_001033059chr642062 694 513 292 ------
NM_001033081chr12552 370 1645 186 --
NM_001033112chr5145 3355 187 104 ----
NM_001033561chr174929 666 293 221 ------
NM_001033566chr172316 39 ------
NM_001033659chr1731301 1152 489 ----1386
NM_001033723chr821103 595 31819 450 399 ----
NM_001033925chr1041870 1673 699 300 1871 2755 463 --
NM_001034837chr54821 630 268 121 ------
NM_001034841chr1695489 4923 3720 3600 3490 2152 2037 1230 678 23895 3695 ----
NM_001034850chr521465 1358 ------
NM_001034954chr1043242 3143 520 424 12512 22605 2340 --
NM_001035003chr441382 1193 480 232 --11426 --
NM_001035chr14823 352 218 83 1425 ----
NM_001037131chr231270 424 401 ------
NM_001037132chr792042 2026 1878 758 583 553 370 76 55 11552 1198 1327
NM_001037164chr741402 785 543 459 11314 ----
NM_001037165chr778250 7827 6121 3473 1657 1246 1010 --38762 5612 2026 --
NM_001037339chr161783 1634 1442 1270 607 419 --1620 --
NM_001038640chr152977 681 ----1192
NM_001038702chr552521 2060 783 499 270 --12664 --
NM_001039141chr2282463 1762 554 342 335 252 226 116 ------
NM_001039465chr141502 1402 170 --
NM_001039585chr1104195 3934 3817 3368 3040 1361 1033 498 438 38 34039 4013 887 43808 3184 3119 2857 --
NM_001039590chrX73962 3832 3594 3364 3174 1295 1263 2879 652 23884 2834 --
NM_001039618chr11115973 5446 4984 4963 2307 2239 1974 1966 1700 842 590 24620 3610 34876 1404 96 --
NM_001039711chr16966 776 742 358 325 59 ------
NM_001039762chr1022362 63 ------
NM_001039802chr12538 47 11108 ----
NM_001039840chrX95144 4796 4102 3949 3684 1662 1361 504 334 34998 4448 1259 22081 920 14879
NM_001039937chr13154146 3385 3149 3049 2839 2578 1660 1597 1391 1378 1131 793 736 494 217 21621 1317 --21028 557
NM_001040001chr63812 478 21 12078 41685 1404 1358 1306 --
NM_001040002chr1721187 226 --11427 --
NM_001040020chr741496 1465 1430 381 31488 1228 1011 2222 34 --
NM_001040057chr741352 460 283 237 ------
NM_001040092chr81428 ----1308
NM_001040110chr7--1281 --1341
NM_001040142chr282483 2327 2181 2064 1680 1664 518 333 1126 21757 902 --
NM_001040152chr784480 3546 3435 1345 1053 902 569 215 24170 1525 23652 67 --
NM_001040153chr133967 806 273 3760 230 170 ----
NM_001040202chr472534 2397 2134 2007 749 678 521 21763 150 11893 --
NM_001040214chr652409 1825 1664 634 397 --1556 --
NM_001040284chr16165757 5501 5425 5115 4882 4612 4392 3993 3730 2119 2090 1493 1375 1286 560 96 42112 2084 1686 1646 34649 4510 1892 11171
NM_001040402chr472600 2443 2209 2007 990 387 211 22494 547 1915 --
NM_001040441chr195245 5041 4488 3318 1667 1552 813 345 102 13454 15370 1454
NM_001040450chr1552336 1067 575 251 179 32426 2239 678 1966 --
NM_001040613chr8266 53 1226 1326 --
NM_001040665chr784761 4085 3408 1746 742 641 444 381 34966 976 294 --11617
NM_001040708chr82268 110 1355 ----
NM_001040712chr963005 2199 773 454 438 79 --1718 --
NM_001042388chr182896 769 ----1631
NM_001042404chr141887 1438 777 354 11956 11218 --
NM_001042406chr61931 1338 ----
NM_001042413chr9153912 3769 3643 3567 3535 3468 3303 3228 2861 2608 2548 1281 1097 1026 727 ------
NM_001042424chr473276 2274 2232 2155 790 715 568 --1260 --
NM_001042459chr33310 233 28 ------
NM_001042537chrX31872 752 624 1326 11971 --
NM_001042548chr23851 738 146 --1104 --
NM_001042555chr1284700 4225 4192 3702 1247 1220 802 743 --24529 3676 --
NM_001042599chr2207783 7569 7533 7010 5831 5282 4991 2072 1568 1553 1338 1285 1185 1038 990 885 875 637 490 110 27671 1088 ----
NM_001042601chr363239 3210 3112 2302 2064 1082 ------
NM_001042604chr394505 4169 4103 3708 1927 875 390 188 148 --33459 1239 578 --
NM_001043318chr1444074 3579 1466 756 --13719 --
NM_001043351chr111849 21792 226 1284 --
NM_001044385chr264000 3746 3593 3579 3018 2512 --11386 --
NM_001045556chr841735 1693 367 279 ------
NM_001046chr521087 78 22288 1074 1749 --
NM_001071775chr1341705 1676 561 396 --11833 11866
NM_001092chr175992 698 692 357 277 ------
NM_001099678chr365535 4769 4642 882 844 138 54473 2379 895 600 30 26230 226 --
NM_001100108chr1128164 7955 7867 7613 7337 6086 5446 1691 1559 1185 954 946 27256 6768 36437 102 34 --
NM_001106chr3169533 7455 7327 7160 7084 7067 6492 6135 6077 5896 3213 1297 1004 890 694 679 --38663 7681 6601 --
NM_001116chr1622795 2547 --42828 2138 611 509 --
NM_001121chr101494 ----163
NM_001135chr152724 257 --1145 --
NM_001146chr842014 1801 1785 768 ----1575
NM_001149chr1031389 1157 124 --1178 --
NM_001151chr4--1199 1236 --
NM_001167chrX96256 5109 4929 2376 1586 1483 1451 1312 254 --12477 --
NM_001172chr143623 274 122 1116 --1304
NM_001186chr2173213 3060 2876 2282 2145 1260 826 11191 --12402
NM_001191chr201459 --21418 177 --
NM_001198chr642381 2142 1956 1660 1237 ----
NM_001200chr202255 97 --11109 --
NM_001204chr2167233 6821 6606 6355 5938 5797 5564 4858 2943 2328 2099 1528 1368 953 592 211 76885 5822 5542 5330 2628 1393 982 37379 6074 614 17089
NM_001206chr952131 1967 795 733 176 22296 1999 22395 100 --
NM_001219chr752042 811 509 228 208 1481 ----
NM_001241chr291962 1852 916 811 769 713 589 497 54 ------
NM_001259chr7156047 6025 5780 5650 5148 5047 4991 4298 4223 3919 2234 1414 1134 1091 1072 11484 --15747
NM_001270chr551126 1079 979 935 728 ------
NM_001271chr15102829 2821 2680 1090 702 688 580 256 202 142 ----12307
NM_001289chrX31624 1213 369 11667 2400 189 --
NM_001292chr151832 --1422 --
NM_001310chr1263109 2276 2232 1103 588 321 31052 245 189 2901 744 --
NM_001316chr201400 --1460 --
NM_001332chr541222 979 370 58 --31274 1233 395 --
NM_001343chr531695 550 367 ----11680
NM_001349chr2------187
NM_001356chrX102216 2115 2089 1897 1807 1770 1584 1543 807 525 ------
NM_001364chr11184797 4790 4662 4598 4571 4153 4058 3947 3752 3652 3433 1715 1008 952 941 514 419 66 ------
NM_001386chr821985 1872 31927 508 277 11794 --
NM_001391chr185957 907 403 239 96 --11092 --
NM_001396chr2132418 1824 106 --1504 --
NM_001401chr931039 1015 291 --11088 --
NM_001406chr1721348 1145 ----1693
NM_001407chr321463 1181 ------
NM_001412chrX63191 2895 2692 2331 1315 939 1886 ----
NM_001427chr741597 1576 1488 322 ------
NM_001429chr222441 401 --1969 --
NM_001431chr621129 898 --1872 --
NM_001438chr163514 3327 3152 2772 2720 638 --1226 --
NM_001452chr62680 475 1671 1635 --
NM_001453chr621773 1437 11704 ----
NM_001455chr654432 4419 4318 4219 1913 1198 23324 1456 --
NM_001494chr101203 ----137
NM_001546chr641232 1122 527 262 ------
NM_001616chr253176 3147 3126 1162 23 23001 1327 --1882
NM_001621chr752413 2009 370 259 253 32751 2488 884 21908 556 --
NM_001649chrX1937 22440 1921 11644 --
NM_001655chr1132123 1744 1495 ----1704
NM_001661chr171160 1727 2493 49 --
NM_001663chr1441862 989 825 247 11067 11764 --
NM_001668chr152138 2096 2049 922 827 1178 --11600
NM_001677chr141166 809 356 127 1109 ----
NM_001701chr931457 1343 284 --21102 103 --
NM_001704chr62384 74 152 ----
NM_001721chrX----1245 --
NM_001731chr122673 378 ------
NM_001748chr12275 75 1109 1293 --
NM_001753chr721526 1175 11480 21641 677 --
NM_001755chr1652274 1936 1798 1431 91 11903 --11413
NM_001759chr1253946 1961 1785 1258 973 --12037 --
NM_001792chr183848 204 174 --1380 --
NM_001797chr161244 1137 --1739
NM_001859chr953494 2443 1271 987 544 --23594 1306 11462
NM_001884chr5----2426 378 --
NM_001895chr2031196 968 94 --1397 --
NM_001918chr1137661 6300 6112 5936 5713 2331 2193 1893 1648 1310 1048 765 329 --38381 6279 209 18417
NM_001931chr1131192 1003 37 ----1195
NM_001945chr521423 1116 1299 ----
NM_001949chr652745 2367 1186 647 148 --12684 --
NM_001955chr62868 270 --1388 --
NM_001968chr42849 357 ------
NM_001969chr14123902 3829 3742 2989 1562 1544 1197 998 929 680 121 114 1854 21142 255 1267
NM_001970chr171251 --1604 --
NM_001995chr411032 11264 21234 219 --
NM_001999chr521518 346 ------
NM_002006chr4135195 5179 4704 4524 4377 3787 3674 2251 2079 1951 1165 1087 871 13862 11315 --
NM_002015chr1353362 1072 955 779 176 2719 24 ----
NM_002025chrX169180 8065 7923 7761 5989 5969 5761 5703 1880 1490 1417 1378 845 331 304 57 56576 6382 1935 933 694 37046 3533 1094 26651 2771
NM_002026chr24897 775 374 212 ------
NM_002031chr61237 1271 1561 --
NM_002035chr1883872 3810 3685 3527 3161 2778 1476 1404 23621 89 ----
NM_002039chr48848 763 708 365 285 259 240 79 1595 ----
NM_002062chr631669 1585 1093 --21240 206 --
NM_002072chr9----1219 --
NM_002077chr952132 1987 1758 678 40 1312 ----
NM_002087chr172301 189 ------
NM_002103chr192920 398 ----1977
NM_002114chr61481 142 182 --
NM_002128chr133886 770 154 1714 ----
NM_002137chr742240 2223 1882 1490 22062 488 11590 --
NM_002140chr931031 904 367 ------
NM_002146chr1741052 965 941 556 1953 2470 340 --
NM_002158chr273452 3116 3014 2992 941 430 125 13740 1857 --
NM_002167chr12510 483 ------
NM_002192chr73580 563 447 1493 1615 --
NM_002198chr54838 644 637 594 --1618 --
NM_002199chr4----1928 --
NM_002205chr12----1138 --
NM_002210chr273470 3373 2388 2269 666 629 453 22620 187 ----
NM_002211chr1031084 1075 235 11171 1759 --
NM_002214chr7165530 5189 5066 4832 4354 4149 4107 4088 2215 2069 1549 455 330 303 236 125 11918 1970 --
NM_002221chr152555 2057 1964 771 125 --1857 --
NM_002232chr12160 83 --1131 --
NM_002242chr221975 164 31877 433 239 11450 --
NM_002253chr41352 --11375 --
NM_002264chr373592 3353 2000 1985 1480 676 460 64929 4317 3069 1812 1400 834 21369 1047 1268
NM_002265chr171144 ------
NM_002267chr1352312 2216 2111 379 31 12183 ----
NM_002270chr5105645 5418 4852 4539 4266 3598 1717 1477 1392 812 45280 4720 4374 3554 ----
NM_002291chr7151 --1114 --
NM_002293chr152734 2494 1985 1070 84 11999 1244 --
NM_002310chr5126404 6223 6154 5926 5118 4919 4767 2618 1076 786 371 138 56234 5786 5674 5171 4391 21098 809 --
NM_002332chr121134 ------
NM_002351chrX1269 ----11738
NM_002354chr21398 --1371 --
NM_002355chr12----31067 905 343 --
NM_002356chr632822 2575 1908 12258 1316 --
NM_002397chr562049 1428 691 356 227 206 ------
NM_002399chr1521388 114 1406 ----
NM_002402chr731082 927 332 --11101 --
NM_002408chr142805 314 --1583 --
NM_002469chr123410 141 85 198 ----
NM_002484chr161174 ------
NM_002499chr1562492 2350 2240 2230 473 98 11937 22401 1804 --
NM_002501chr1912878 12714 12684 --
NM_002509chr201725 ------
NM_002522chr1773792 3445 3117 3058 2646 2639 1362 13640 ----
NM_002526chr651627 1481 1158 1089 373 21312 570 --11609
NM_002547chrX94200 3835 3713 3001 2939 2910 1509 1117 128 12725 44169 3235 3102 800 11306
NM_002581chr9115703 5661 5574 4393 4279 3976 3762 1993 1955 521 159 24990 1864 31654 947 833 --
NM_002582chr1621008 76 --2948 64 --
NM_002594chr2031962 1891 1770 ------
NM_002595chr125668 653 595 525 112 1772 11531 --
NM_002605chr1541146 1035 919 848 1374 ----
NM_002607chr7----1185 --
NM_002613chr1685342 5062 4607 4498 4388 3846 1610 76 13272 11232 --
NM_002655chr8135153 5128 4625 4353 4234 4084 3906 3794 3632 2130 1591 1496 1032 34247 2072 2038 21940 235 --
NM_002657chr2033892 3747 143 --2796 276 --
NM_002658chr101850 ------
NM_002707chr22375 361 ------
NM_002709chr263454 1080 615 452 429 175 13391 23266 48 --
NM_002710chr123826 446 420 ------
NM_002718chr382275 1959 1821 1720 1078 692 257 79 --22284 724 1165
NM_002725chr132778 1722 1391 --42701 2691 1711 37 --
NM_002731chr142312 1057 154 31 1980 ----
NM_002736chr751596 844 587 393 214 2789 126 31947 1910 1575 --
NM_002748chr1531067 413 380 --1423 --
NM_002760chrY125376 5237 4485 3890 2392 2282 2210 1937 903 389 295 99 --34641 3712 588 14756
NM_002763chr1--1472 ----
NM_002767chr171416 ------
NM_002787chr7--2703 136 --194
NM_002822chr1261819 1596 1385 267 232 126 1704 21172 258 --
NM_002827chr2031731 1399 1109 --21472 1241 --
NM_002835chr72239 22 1162 ----
NM_002843chr11123433 3370 3254 2978 2953 2355 2122 1224 1079 784 718 652 ------
NM_002844chr65978 900 214 124 79 --1347 --
NM_002848chr1231278 1125 282 1211 1937 --
NM_002852chr3199 ----146
NM_002867chr14683 113 104 70 ----1631
NM_002869chr1152073 1816 686 273 262 11885 21702 1575 --
NM_002874chr961603 838 708 560 97 45 --126 --
NM_002886chr374655 4498 4483 3889 3847 1966 1848 --54343 4246 3491 2087 867 --
NM_002888chr3------198
NM_002890chr52395 109 --1100 --
NM_002892chr1461651 1175 483 417 393 120 1281 ----
NM_002900chr10----1301 --
NM_002902chr15193 ------
NM_002912chr63755 708 675 1777 ----
NM_002923chr13647 625 34 ------
NM_002924chr1----149 1410
NM_002948chr331290 1010 248 ----130
NM_002956chr12140 2556 271 ----
NM_002959chr174306 4054 3437 223 188 149 56 --11188 --
NM_002968chr1641107 1005 751 438 31060 1053 295 ----
NM_002977chr263449 3435 2569 1237 866 786 23048 2120 11024 --
NM_002994chr451751 1653 1539 1378 448 ------
NM_002998chr872027 1898 1883 1714 586 149 116 ------
NM_003011chr92643 413 ------
NM_003017chr611149 ----1882
NM_003020chr15129 --1447 --
NM_003030chr321981 1537 2643 528 ----
NM_003036chr11976 1282 1346 --
NM_003043chr374326 4119 4030 3403 2953 360 265 21416 343 ----
NM_003069chrX1617 1751 1502 --
NM_003101chr151641 1508 1124 1045 430 2380 189 ----
NM_003107chr632104 1873 1681 12336 ----
NM_003108chr2117299 7256 6365 5595 5036 4841 4482 2069 1032 916 247 21713 738 26462 5422 --
NM_003112chr783242 2933 2865 2374 2046 987 222 37 --12572 --
NM_003128chr262757 2641 855 522 175 77 --22870 1737 --
NM_003133chr1----1814 --
NM_003137chr642196 836 822 35 --1518 --
NM_003144chr661814 1677 1651 891 711 337 ----12076
NM_003152chr1721095 83 --11234 --
NM_003155chr832679 2557 2548 --22091 490 1566
NM_003161chr1782931 2477 1217 1206 1002 862 396 124 ----12375
NM_003205chr1541889 436 179 127 12332 --1761
NM_003206chr61138 ----1371
NM_003221chr663614 3103 1500 1131 531 225 12916 23192 1433 1860
NM_003238chr11224 ------
NM_003239chr143759 388 160 --1792 --
NM_003246chr1531872 1455 763 1617 12003 --
NM_003257chr1531172 360 187 --3562 440 405 --
NM_003262chr395181 4767 4157 1813 754 603 560 383 377 33796 3338 797 35213 4321 1421 --
NM_003264chr4----1509 --
NM_003269chr631228 1156 1100 11133 11184 --
NM_003274chr214991 301 276 46 12779 13011 --
NM_003275chr941342 1083 407 373 ------
NM_003292chr161980 1752 1717 494 312 80 --12126 --
NM_003298chr3125959 5570 5290 5134 4347 3974 1845 1775 1301 1293 723 420 25527 432 15774 --
NM_003319chr26617 362 263 208 188 28 1337 ----
NM_003338chr1081804 1231 1221 659 639 621 604 245 1225 1740 --
NM_003339chr521586 1349 1561 1160 --
NM_003340chr421206 1007 ------
NM_003373chr1061786 1561 785 350 229 181 21908 159 ----
NM_003374chr52764 300 1827 ----
NM_003379chr61804 --3912 378 64 --
NM_003403chr141336 --1605 --
NM_003410chrX72915 2600 2572 1975 617 408 158 22454 770 22693 2581 --
NM_003412chr343091 2964 953 671 23162 2372 ----
NM_003413chrX5551 468 306 235 46 11495 ----
NM_003442chr113157 143 110 --1120 --
NM_003463chr662994 1340 1088 519 371 195 13221 --22733 926
NM_003468chr244006 3990 1710 1027 54192 4087 1509 1052 970 22960 1441 --
NM_003472chr621102 257 1315 21303 340 --
NM_003478chr1163233 3134 2508 1172 197 161 32752 2388 1198 --1868
NM_003483chr1272558 2519 2484 2038 832 772 754 22697 566 21817 406 --
NM_003489chr2173393 3268 1259 973 514 224 159 22363 776 22519 392 --
NM_003502chr163617 563 231 ------
NM_003506chr85959 929 500 484 44 2916 102 21282 1091 --
NM_003567chr11366 ----1162
NM_003569chr63568 259 27 --1118 --
NM_003583chr1253343 3086 1293 896 203 23272 130 11018 --
NM_003593chr171281 --1192 --
NM_003618chr241231 918 904 276 1450 11180 --
NM_003631chr10----1116 --
NM_003633chr532534 1752 1657 --22236 761 --
NM_003654chr11------1301
NM_003659chr22824 104 ----11189
NM_003705chr23843 595 144 1278 1347 --
NM_003711chr52245 139 ------
NM_003714chr553079 2880 2591 2566 990 32040 216 74 12264 --
NM_003722chr332639 915 691 1430 31830 1772 980 --
NM_003758chr1511547 1145 ----
NM_003760chr1------1288
NM_003783chr111209 11031 1954 --
NM_003787chr1861449 652 131 116 80 58 --11137 --
NM_003796chr193519 442 180 --1431 --
NM_003800chr642357 842 486 165 --21667 116 1336
NM_003822chr122754 2142 1168 1965 --
NM_003825chr1551508 1386 1005 274 94 1224 --11483
NM_003861chr1431945 642 613 1684 --12555
NM_003870chr1531621 168 124 12030 1139 --
NM_003872chr252746 2735 2396 449 65 ------
NM_003873chr1052568 2462 2410 1869 1843 --11885 --
NM_003902chr13745 310 241 --1642 --
NM_003909chr832968 964 620 12206 22911 2748 --
NM_003913chr663409 3401 3271 3115 813 527 11717 12663 1709
NM_003916chrX41463 602 594 43 1330 21008 934 11484
NM_003922chr152304 71 ----1134
NM_003932chr2241593 1511 640 237 1350 11609 --
NM_003939chr1053208 2791 2621 773 604 --125 --
NM_003941chr731888 927 679 11600 ----
NM_003947chr341136 992 899 429 ----1398
NM_003948chr472468 2280 2152 2002 1752 715 40 1443 --1567
NM_003971chr172618 445 ------
NM_003972chr1031336 1305 45 1539 11314 --
NM_004035chr1795233 4897 4879 4729 4244 3664 2016 1958 1741 11132 33745 3270 334 14623
NM_004040chr211383 1887 1932 --
NM_004061chr54556 431 275 128 ------
NM_004080chr721217 1079 ------
NM_004093chr1353232 3193 2068 830 200 11138 11146 --
NM_004100chr652065 1787 641 215 46 ------
NM_004113chr351883 1648 1258 733 533 11938 --1234
NM_004124chr14113246 3126 2789 2719 2642 1082 1013 870 837 732 49 170 21216 854 --
NM_004157chr31583 1837 1715 --
NM_004161chr251325 1228 560 514 489 --11430 --
NM_004162chr32331 232 11265 1501 --
NM_004171chr11189569 9337 9246 9143 8971 8201 8063 8030 8023 7829 7705 7592 6879 6385 3296 3051 1021 361 22913 2650 39492 7194 1536 12664
NM_004229chrX2903 149 22076 729 1218 --
NM_004232chr18123717 3690 3483 3451 3360 3297 3251 3245 928 592 483 28 --23847 343 --
NM_004235chr94852 828 65 28 1592 1552 --
NM_004236chr152555 421 ------
NM_004241chr104795 589 548 75 1701 ----
NM_004261chr1----2956 659 --
NM_004267chr3----1141 --
NM_004272chr52636 41 1281 1733 --
NM_004286chr2222819 1946 --1246 --
NM_004294chr132715 115 --1156 --
NM_004302chr1222854 2817 ----1648
NM_004308chr1141926 1875 1442 199 ----11883
NM_004310chr41175 127 ----
NM_004319chr153083 3031 2414 976 800 ------
NM_004330chr153983 970 768 --1260 --
NM_004331chr892688 2634 2462 1983 1778 1032 872 704 211 ------
NM_004342chr772218 2211 1590 821 721 463 415 --1672 --
NM_004349chr821094 495 ----11186
NM_004389chr2------1901
NM_004392chr1352425 1969 1623 631 445 11927 22391 580 --
NM_004414chr2151217 1016 973 250 36 11314 ----
NM_004419chr10171 ------
NM_004426chr1221313 191 --11766 --
NM_004438chr283088 2985 2798 2061 1304 446 75 56 22899 1043 1785 --
NM_004440chr651956 781 770 730 512 --11617 11732
NM_004442chr121746 403 --11114 --
NM_004454chr342235 1698 1540 721 11518 11665 --
NM_004457chr221100 58 --11369 1557
NM_004458chrX62242 2227 983 840 747 278 11964 12136 --
NM_004464chr4124278 3887 3341 992 965 941 842 638 583 565 352 208 31043 858 106 14247 --
NM_004472chr52663 456 ------
NM_004482chr26835 707 633 615 335 67 2649 303 ----
NM_004494chr11209 --1882 --
NM_004501chr163704 3380 1540 479 256 169 11183 ----
NM_004525chr221311 468 21059 476 21361 38 --
NM_004529chr921119 383 ------
NM_004537chr1221129 257 ------
NM_004569chr143624 617 283 ------
NM_004571chr2163234 2333 980 879 103 50 23304 793 ----
NM_004575chr451330 1247 1013 532 397 ------
NM_004576chr5134 ------
NM_004578chr12857 766 ------
NM_004580chr1551824 1772 1493 1419 614 1373 ----
NM_004586chrX155349 5300 4544 4449 4042 3944 1987 1234 874 821 649 485 448 293 99 1395 13332 34362 4137 900
NM_004593chr31762 ------
NM_004598chr573041 2497 2441 2431 630 473 371 12261 13014 --
NM_004612chr974755 4337 3447 1760 1322 954 209 33890 1133 501 24635 1234 --
NM_004622chr272285 2092 2037 1815 1494 762 155 ------
NM_004645chr17----1847 --
NM_004654chrY31219 557 547 --11084 --
NM_004660chrY102040 2015 1828 1737 1702 1526 1489 1423 651 638 ------
NM_004663chr1551589 1223 599 430 406 11265 --1110
NM_004685chr1372984 2534 741 654 641 627 263 --32803 1958 799 --
NM_004687chr1731876 1835 661 11287 ----
NM_004721chr32303 295 ------
NM_004730chr5101877 1614 1446 1394 596 575 399 354 178 108 22069 1911 1715 --
NM_004734chr1342434 1176 1064 424 1573 13111 --
NM_004736chr132116 1740 1724 1723 3885 489 116 --
NM_004738chr2022406 2188 --11044 12647
NM_004742chr31453 --1119 --
NM_004745chr8206915 6260 6174 5529 5388 5051 4917 4719 4425 2705 2203 2152 2014 1572 1547 1092 701 621 336 50 26987 5624 36502 5463 240 --
NM_004748chr1584254 3931 3711 3697 3213 1450 981 150 33024 624 450 22836 1302 --
NM_004760chr752075 1584 750 724 345 12188 ----
NM_004774chr1743075 2877 2238 248 1523 ----
NM_004776chr2053310 3256 3220 2610 1300 ------
NM_004779chr53521 229 102 1997 1536 --
NM_004789chr9----2337 108 --
NM_004798chr2063573 3313 2975 1450 971 834 --13213 --
NM_004801chr241178 575 275 24 ------
NM_004821chr54824 581 555 316 --1165 --
NM_004834chr253154 2281 913 497 287 ----13236
NM_004836chr2--1197 --1933
NM_004849chr641641 1161 1108 109 --11381 --
NM_004850chr271543 1105 1093 583 542 283 125 11275 --21114 369
NM_004852chr182314190 13452 13132 13098 12990 12692 12335 12196 11786 11163 10471 10255 10114 4697 4573 4437 4263 3723 3530 1848 1820 1637 930 25569 1309 311246 4725 885 --
NM_004863chr14135219 4691 4030 3619 3470 1912 1549 1283 1260 667 291 257 155 43713 3459 760 404 184 11820
NM_004869chr181640 --21563 1409 --
NM_004874chr83439 134 52 --1407 --
NM_004891chr2------1202
NM_004906chr62248 191 --175 --
NM_004921chr172260 1716 1669 969 820 364 105 32057 2032 317 22020 261 --
NM_004926chr1431722 1373 1357 ----1540
NM_004929chr82986 35 11362 1351 --
NM_004930chr11692 --1227 1707
NM_004932chr571765 1507 1144 499 359 322 164 21630 1523 ----
NM_004952chr12954 811 ------
NM_004956chr773679 3121 2850 1442 1279 995 175 34545 3180 210 --14283
NM_004985chr1294190 3696 3529 2908 1373 673 529 63 32 22988 1670 24305 3183 --
NM_004993chr1411152 1221 21485 33 --
NM_004998chr15--1742 1401 --
NM_004999chr6134322 3864 3776 3664 3650 3550 3403 3095 2817 565 491 481 349 12739 11129 --
NM_005006chr2--1876 1783 --
NM_005023chr521365 353 1388 ----
NM_005026chr132016 136 62 --11683 --
NM_005037chr3129 ----1160
NM_005063chr1032853 2395 770 --13143 --
NM_005065chr1453400 3265 2064 631 60 24430 707 43278 2135 1898 892 --
NM_005080chr222843 333 1665 ----
NM_005097chr101347 --189 --
NM_005121chr1733795 2561 234 23669 3222 ----
NM_005126chr341431 260 244 44 --11442 1226
NM_005153chr162572 58 ------
NM_005154chr15--1171 1425 --
NM_005156chr995283 5021 4543 4235 1695 1553 1515 543 350 32094 1013 789 11880 --
NM_005168chr241539 1481 1232 307 --11750 --
NM_005187chr16----2758 405 --
NM_005201chr331151 134 32 ------
NM_005224chr192482 236 ------
NM_005233chr342044 1928 1866 840 12587 1569 --
NM_005238chr1123230 2712 --12354 --
NM_005240chr13681 593 349 ------
NM_005249chr14----143 --
NM_005257chr182972 536 ------
NM_005259chr251293 1031 1021 467 440 1251 11546 --
NM_005277chr451943 1787 1639 1356 388 1162 ----
NM_005302chr71454 ------
NM_005334chrX1687 --3540 178 99 --
NM_005339chr4114248 3822 3036 2819 1655 1254 1203 1028 1006 833 211 --24285 1076 12924
NM_005375chr661103 898 818 796 361 38 1471 ----
NM_005378chr23864 596 584 1633 142 --
NM_005385chr362695 2660 2525 1057 553 119 12754 1204 --
NM_005389chr61159 ------
NM_005398chr1031206 247 149 --21407 1039 --
NM_005400chr252963 2626 2616 697 252 ----11030
NM_005406chr1821418 159 --11568 --
NM_005433chr181964 --22578 1918 --
NM_005437chr1051389 1176 983 578 254 ------
NM_005455chr111369 ----2688 507
NM_005479chr1041614 1552 1439 1339 --21585 356 --
NM_005491chrX52147 1728 1347 272 111 --12115 --
NM_005502chr953084 2687 2419 2317 932 1786 1307 --
NM_005509chr551740 1465 1251 389 293 ------
NM_005530chr151113 1295 ----
NM_005537chr132703 302 1247 ----
NM_005539chr1041051 545 76 39 --1137 --
NM_005561chr132794 623 --183 --
NM_005563chr11262 ------
NM_005573chr51187 ------
NM_005578chr3114412 4196 4165 3908 3389 1471 1315 1179 868 816 184 23544 1202 43946 1212 234 178 11341
NM_005585chr151171 ------
NM_005595chr13684 213 156 2664 658 1300 --
NM_005596chr9136387 5741 5323 5162 5116 4928 3985 2477 2432 2091 1561 1480 1281 45962 1081 865 257 11399 11689
NM_005602chr341107 1065 376 221 1910 21132 923 --
NM_005604chr652490 2475 2019 1709 740 12117 ----
NM_005627chr62172 142 ------
NM_005662chr81141 --1426 --
NM_005664chr15------1302
NM_005668chr584073 4051 3361 2817 1139 958 639 30 --23181 1263 --
NM_005686chr131557 411 136 --11543 --
NM_005690chr12------1174
NM_005715chr682625 2546 2494 2199 1947 1750 717 222 --22076 1743 --
NM_005721chr24934 807 397 347 --1388 --
NM_005725chr141861 1526 1503 128 --21598 1581 --
NM_005746chr752239 1099 901 471 119 1864 11951 12636
NM_005748chr1262708 2451 2130 1365 198 183 12952 21069 78 --
NM_005759chr294468 4165 4151 3383 3127 1806 1230 568 120 1483 11268 1496
NM_005776chr142613 271 --1154 --
NM_005778chr31320 --1432 --
NM_005779chr531395 928 194 --12950 12497
NM_005780chr131897 ----1956
NM_005797chr1171749 1132 519 439 395 366 276 --11536 --
NM_005802chr96735 626 605 537 204 91 ------
NM_005813chr232390 2348 568 12150 12472 --
NM_005824chr72668 509 ----165
NM_005862chr32421 88 11027 ----
NM_005880chr162348 223 11322 143 11283
NM_005881chr16195 --1293 --
NM_005898chr1173222 2903 2534 1239 686 282 40 32048 1257 776 ----
NM_005904chr1851516 1371 1080 1068 490 --144 --
NM_005906chr621692 1346 --11245 --
NM_005911chr21929 --11078 --
NM_005920chr173692 3242 2944 1053 447 291 137 1576 1750 --
NM_005927chr52185 80 21312 334 ----
NM_005930chr143871 583 83 1928 ----
NM_005937chr1764154 3422 3292 598 366 211 --13525 --
NM_005941chr853567 3199 1333 264 172 14066 ----
NM_005966chr262397 2332 1897 1500 658 233 ------
NM_005982chr14290 67 ------
NM_006011chr1594205 4142 3781 3382 3354 3168 3075 2929 1227 14168 135 --
NM_006015chr1----1384 --
NM_006016chr642251 1905 885 785 11641 41718 1628 1474 614 --
NM_006037chr2114654 4303 3955 3922 3780 3174 2990 1670 1592 1393 272 --11054 --
NM_006047chr2063139 2195 1345 1287 1206 872 12869 1654 23387 699
NM_006060chr774281 4089 3839 3528 3015 1708 576 --23761 2705 --
NM_006080chr732684 782 586 1994 23018 2620 --
NM_006094chr872269 1773 1703 926 524 312 150 1902 ----
NM_006106chr1153146 2873 2819 660 131 2954 490 23317 3279 --
NM_006107chr17--196 ----
NM_006135chr161434 1416 1194 482 401 305 ----1269
NM_006139chr252520 860 733 371 234 11970 12608 --
NM_006141chr1642498 2345 2298 1980 ----1173
NM_006154chr1552146 2088 918 893 467 1328 12904 --
NM_006158chr81559 --21677 1145 1244
NM_006164chr2----186 --
NM_006194chr143880 267 251 2428 157 ----
NM_006224chr1732456 333 23 ------
NM_006237chr1322026 1956 22215 384 ----
NM_006265chr82984 438 --11461 --
NM_006267chr231446 1383 638 1364 11765 --
NM_006275chr2071753 962 810 747 74 38 24 32532 1003 399 ----
NM_006290chr621668 643 11852 11681 11883
NM_006298chr692631 2592 2296 2199 2185 861 820 736 54 22957 514 ----
NM_006313chr1281692 1670 1204 1195 1158 670 78 32 1206 21447 1304 --
NM_006315chr483842 3021 1799 1211 967 639 195 149 13442 11238 --
NM_006335chr12863 137 21103 131 2940 202 --
NM_006352chr131941 588 133 11509 ----
NM_006364chr1441311 889 476 424 2466 26 1153 --
NM_006379chr742293 2187 1995 1438 1739 ----
NM_006380chr1784335 4085 3630 1619 1569 794 643 54 --1228 --
NM_006403chr651764 1669 1332 1282 127 --11771 --
NM_006416chr6----1668 --
NM_006421chr821049 489 ------
NM_006449chr251779 1501 686 373 336 11380 2809 496 1779
NM_006469chr151169 1107 319 134 64 1442 2299 156 --
NM_006475chr13----1482 --
NM_006494chr19----1133 --
NM_006504chr10102729 2647 2321 1905 1024 948 647 578 529 401 12834 12470 --
NM_006516chr141501 659 408 354 ------
NM_006517chrX3619 276 71 12319 188 --
NM_006519chr63325 304 108 --1318 --
NM_006526chr2021654 1580 12114 31902 1685 323 --
NM_006534chr2053174 1301 781 719 602 1802 ----
NM_006537chr154461 95 66 46 ------
NM_006544chr14155992 5804 5753 5425 5370 4514 3941 2160 1868 1794 660 423 218 115 58 34339 2425 1972 34599 3829 536 1154
NM_006546chr17116103 6066 5748 5682 4592 4055 1463 805 775 480 247 --1693 --
NM_006557chr9--11251 21725 391 11362
NM_006565chr1621096 839 --1392 --
NM_006577chr221012 69 --11224 --
NM_006599chr1678240 8085 8028 6273 5818 2500 1319 36669 1621 609 46346 6047 2081 1037 --
NM_006602chr201557 1609 1154 --
NM_006614chr341448 490 373 184 ------
NM_006618chr141605 1489 452 195 ------
NM_006624chr1052040 425 408 271 120 21675 356 21856 732 --
NM_006626chr942672 2335 600 511 ----22549 632
NM_006628chr15114661 4523 4504 4208 4184 3952 3912 3114 2852 2827 1100 ----24133 777
NM_006633chr53707 543 221 ------
NM_006644chr133648 227 74 ------
NM_006646chr1383072 2760 2717 2140 1155 979 777 237 22267 176 12472 --
NM_006675chr1243335 2379 333 326 --33316 3155 2651 --
NM_006686chr9------165
NM_006690chr2021764 1752 --12327 --
NM_006698chr2021072 109 1504 11403 --
NM_006717chr922087 823 13396 13212 --
NM_006734chr641317 513 360 129 1632 21167 34 --
NM_006750chr1677996 7730 6939 5580 5150 4955 3105 36896 6171 1386 --26426 5524
NM_006754chr71380 --21120 237 --
NM_006769chr11737 1516 ----
NM_006775chr682979 2351 2278 1902 998 931 773 122 12420 ----
NM_006777chrX42613 2313 371 107 22413 2150 12859 --
NM_006790chr52164 61 ------
NM_006791chr151403 --145 --
NM_006805chr51546 --21215 223 --
NM_006813chr62779 260 --1206 --
NM_006815chr1221325 1247 --21226 535 --
NM_006826chr261301 1145 1101 1010 514 136 1260 11163 --
NM_006832chr141212 ------
NM_006852chr1752412 2221 1063 859 622 --11953 --
NM_006885chr1633771 3724 363 1939 23037 521 --
NM_006888chr1463531 3327 3018 2866 291 234 21416 696 12834 1462
NM_006898chr21250 --2724 569 --
NM_006902chr142930 2409 2359 2214 13247 12227 11098
NM_006915chrX72369 2057 907 678 547 367 71 12185 22039 460 --
NM_006920chr272076 1922 1619 1378 1319 1291 330 22046 581 2385 376 --
NM_006930chr551924 1529 1444 115 78 21382 149 ----
NM_006951chr102691 672 2299 232 1178 --
NM_006988chr2111286 21186 367 ----
NM_006993chr101277 --1259 --
NM_006999chr521831 1683 11485 1443 --
NM_007005chr941335 1300 611 45 ----1242
NM_007006chr1652543 2174 1255 548 408 22519 2426 33172 2569 223 13048
NM_007007chr12114134 4117 4086 3844 3299 3041 2985 1432 528 275 63 1885 --13278
NM_007011chr15126557 6500 5864 5416 5266 2444 1951 1540 1477 615 585 22 --26243 4839 --
NM_007013chr8------1854
NM_007026chr172211 122 --1196 --
NM_007033chr112233 --21697 653 --
NM_007036chr53687 189 64 1158 ----
NM_007038chr21145757 5454 5379 5284 4640 4597 4076 3931 2205 1296 1145 992 810 277 15120 ----
NM_007039chr1492358 1888 1859 1631 855 735 624 148 92 --31826 274 78 --
NM_007046chr22371 346 ------
NM_007084chr1331017 468 294 --21298 233 --
NM_007085chr372117 864 668 634 595 587 515 ------
NM_007087chr16----138 --
NM_007111chr131610 ----1814
NM_007125chrY31461 500 361 ------
NM_007137chrX105579 5362 4307 4203 3967 2201 1808 1391 500 232 --13604 --
NM_007144chr17----11323 1177
NM_007146chr1721806 1798 --22081 2064 --
NM_007150chrX52165 1754 1662 828 506 ----12156
NM_007172chr2273253 3123 2954 1321 1026 487 221 --12746 --
NM_007173chr1122356 880 --32222 792 231 --
NM_007190chr1021042 757 --21106 216 --
NM_007191chr123676 540 444 194 ----
NM_007197chr123925 744 161 ------
NM_007207chr12790 140 --1355 --
NM_007218chr81972 --1247 --
NM_007231chrX62094 2044 964 539 514 102 12390 1437 1135
NM_007236chr1542483 1795 654 452 ------
NM_007246chr44838 674 103 83 --1715 --
NM_007249chr13219424 8840 8196 6946 6641 6502 6495 6393 5912 5740 3694 3473 3412 3373 2592 2553 2208 1771 905 318 299 46922 5854 3776 3725 33454 3242 149 11073
NM_007271chr63589 392 68 --11856 --
NM_007347chr1532058 1136 523 ------
NM_007349chr7----1435 --
NM_007350chr1294542 3880 3412 2844 1678 1102 1027 509 355 21823 909 4994 978 177 62 --
NM_007375chr1102599 2460 2341 2103 1072 1043 574 485 265 150 22497 2303 ----
NM_012081chr563480 3048 2996 1197 722 687 --12820 1352
NM_012083chr1031283 421 396 ------
NM_012090chr1----21163 955 --
NM_012092chr261959 1543 1501 630 536 420 ----21600 326
NM_012104chr1122726 2525 12392 ----
NM_012120chr662833 2544 2039 755 544 232 ------
NM_012137chr112731 ------
NM_012157chr31318 1398 1738 1950
NM_012161chr461088 979 358 244 190 60 --3790 431 76 --
NM_012175chr111809 1295 1942 --
NM_012207chr101235 --1188 --
NM_012214chr2126088 5973 5610 4326 1896 1594 1293 1160 691 508 332 214 1465 24511 23 --
NM_012218chr1921196 681 137 1289 --
NM_012234chr393470 2918 2876 2820 2330 2316 1272 549 194 13231 ----
NM_012238chr1041749 1513 635 343 --11277 --
NM_012245chr142372 72 1482 ----
NM_012247chr102865 702 1275 1976 --
NM_012249chr293528 3433 2914 2888 2874 2745 2340 1265 217 13207 2679 343 --
NM_012255chr201416 ------
NM_012257chr741045 859 853 203 1837 11013 --
NM_012290chr261719 1540 1398 1233 674 345 21415 336 1206 154
NM_012294chr7153849 3804 3643 3589 3172 3131 2735 1576 1422 1356 952 846 780 274 37 21011 995 12914 --
NM_012297chr452341 1973 1714 801 189 --1332 --
NM_012300chr562208 1673 1617 586 375 164 ----1860
NM_012301chr751921 1724 1469 704 533 ------
NM_012306chr1253199 2223 1357 467 409 --12818 --
NM_012316chr154960 4647 4449 542 250 --1580 --
NM_012323chr2231254 1030 126 --21168 558 --
NM_012325chr2041242 1125 280 140 1587 1429 --
NM_012326chr22268 67 ------
NM_012330chr1031214 445 114 --11334 --
NM_012333chr12643 127 --1566 --
NM_012388chr1572502 2307 2127 1017 938 879 720 ----13175
NM_012395chr743298 1021 835 756 12577 3476 399 386 1628
NM_012399chr2221480 285 --21646 258 --
NM_012417chr171458 ----1423
NM_012421chr12420 56 ------
NM_012428chr154890 861 378 173 ------
NM_012463chr1241642 1464 1426 1278 31252 1194 329 --1466
NM_013230chrY51753 1547 1390 1338 1169 2508 312 11381 --
NM_013231chr14104377 3650 1727 1593 1276 860 834 459 88 54 --14350 --
NM_013243chr15164 --1464 --
NM_013261chr463544 2809 1489 1247 852 111 --11453 2449 89
NM_013263chr16----138 --
NM_013286chr333820 3560 485 ------
NM_013293chr72135 29 ------
NM_013305chr18----1318 --
NM_013354chr841342 1300 431 227 11189 ----
NM_013372chr1522977 2580 13128 ----
NM_013396chr2131074 198 25 1595 11140 --
NM_013436chr22194 173 2705 524 1818 --
NM_013438chr951821 1601 1393 1270 522 --1497 --
NM_013444chrX2897 340 1856 ----
NM_013449chr12----12680 --
NM_013995chrX62529 2381 2041 1036 888 603 2979 973 ----
NM_014016chr31672 --1432 --
NM_014048chr16185322 5197 5165 4944 4680 4322 4190 4131 3588 3380 3230 1861 1670 1646 1484 782 448 166 1355 23625 230 25222 2010
NM_014057chr951604 1566 1386 1150 41 ----11286
NM_014112chr8114897 4375 3806 3699 1936 1868 1626 1513 885 623 96 21817 1185 ----
NM_014154chr341253 1150 1057 559 --1207 --
NM_014157chr1653903 3836 3166 1485 232 --11339 --
NM_014166chr1311081 2982 968 ----
NM_014178chr141179 2492 114 ----
NM_014181chr232854 1974 846 2324 205 --12110
NM_014191chr12----1978 --
NM_014231chr1231609 747 42 1659 22127 80 --
NM_014243chr472110 2050 1605 1355 802 550 375 1772 ----
NM_014263chr1031453 522 80 ----1147
NM_014267chr112578 159 ------
NM_014268chr1841259 502 127 25 --2996 423 --
NM_014271chrX4710 546 254 209 ------
NM_014283chr131563 1227 225 1584 ----
NM_014300chr151472 ------
NM_014317chr102268 68 ------
NM_014325chr1232256 386 151 ------
NM_014331chr4157845 7372 6583 6384 6234 5923 5765 5401 2946 2788 2043 1380 1051 562 389 35265 2707 2020 47763 5880 5743 1724 --
NM_014363chr1331138 267 108 11021 21279 1219 --
NM_014388chr1115392 3678 1967 1652 1383 876 776 763 423 387 364 1327 14225 11582
NM_014394chr1031157 1129 946 1469 1214 --
NM_014415chr351585 360 144 60 43 1596 21214 1053 --
NM_014421chr451908 1895 1790 1579 672 1846 1241 --
NM_014423chr5115247 5214 3638 3612 3455 1478 1387 1225 1011 412 227 21816 886 25550 3520 --
NM_014432chr641510 1129 618 585 1462 1335 --
NM_014473chr52430 402 ------
NM_014494chr1652224 1778 697 210 157 --1117 --
NM_014517chr321499 323 11831 21961 1200 147
NM_014550chr224787 769 634 247 ------
NM_014553chr233089 2702 2190 ------
NM_014572chr1341632 1616 348 167 31558 369 269 11722 1379
NM_014577chr223816 787 610 ------
NM_014584chr1461609 1598 1545 1101 209 101 2543 435 21655 155 --
NM_014586chr2174262 4239 3766 3340 1844 1303 359 ------
NM_014602chr3----1343 --
NM_014612chr941352 1332 1251 89 --2627 168 1251
NM_014637chr821089 302 --2568 322 --
NM_014647chr1632233 1959 807 --11710 --
NM_014667chr352261 1774 580 455 361 2941 885 11695 --
NM_014670chr231305 1159 1059 --11270 11653
NM_014671chr751287 1260 1051 278 86 11593 ----
NM_014682chr842328 1882 642 301 12280 21453 532 --
NM_014686chr1962544 2281 2045 1978 1779 739 12605 1313 --
NM_014689chr21456 --1164 --
NM_014701chr1563046 3002 2625 2098 304 77 1826 ----
NM_014702chr653281 3097 2147 1096 857 --22988 2212 1964
NM_014705chr792082 1959 1798 1780 1562 564 374 367 85 2510 73 ----
NM_014709chr21192 1613 1546 --
NM_014712chr16----1609 --
NM_014720chr1011479 11698 11305 --
NM_014729chr831660 886 431 1119 --1699
NM_014730chr1234967 1900 1044 1256 ----
NM_014741chr1112139 ------
NM_014751chr831606 714 375 1647 31411 1346 228 --
NM_014755chr273770 3363 1421 683 194 133 72 11611 21575 1472 --
NM_014757chr521510 318 --12097 --
NM_014761chr16----11123 --
NM_014764chr1241236 296 148 52 11248 ----
NM_014772chr1822427 2366 --11412 --
NM_014774chr182932 2043 1986 1275 970 388 234 114 --13051 --
NM_014787chr11341 --11810 --
NM_014819chr542254 1744 793 182 11695 1821 --
NM_014822chr41528 --1452 --
NM_014824chr1111568 ------
NM_014830chr1243031 1525 1356 610 --11328 1201
NM_014840chr1263127 3104 2942 2802 2685 372 ------
NM_014846chr8----1235 --
NM_014864chr154027 3208 513 398 304 ------
NM_014872chr92626 568 22149 409 --2873 283
NM_014873chr174537 3386 1549 729 654 330 229 34333 3404 986 2416 259 --
NM_014877chr17127343 7190 6880 5528 5497 5081 4983 2630 2213 1560 1510 717 1379 15378 31891 1304 693
NM_014898chr1942400 2209 1695 1672 1974 11742 --
NM_014900chr26400 310 94 67 55 27 --2798 730 --
NM_014901chr512120 --12006 --
NM_014906chr1773934 3255 2996 2704 862 434 76 --13510 13212
NM_014910chr192854 563 --1805 --
NM_014925chr123828 648 158 ------
NM_014926chr371018 947 908 821 434 208 85 ------
NM_014927chrX2101 87 ------
NM_014949chr11982 --2974 302 --
NM_014961chr41559 181 ----
NM_014962chr20112527 2356 2228 2051 1942 1065 923 813 707 587 528 11018 22000 1961 --
NM_014969chr13787 374 357 21213 1003 ----
NM_014978chr1021704 636 --11535 31487 1402 714
NM_014982chr1471887 1843 1684 1498 803 237 25 1606 34586 3555 1860 --
NM_014988chr492581 2504 2228 2061 2008 1925 717 570 379 12838 ----
NM_014989chr641932 1805 1782 1608 --21438 365 --
NM_014990chr1411237 1285 11163 --
NM_014991chr472852 2795 2685 2477 2281 2125 237 ------
NM_014996chr31182 --11080 --
NM_014999chr1231561 1386 86 --11069 --
NM_015009chr31583 1576 1310 --
NM_015018chr62196 60 ------
NM_015020chr1663698 3594 1541 880 416 81 ----1525
NM_015025chr262647 2602 1929 1069 761 504 21718 1000 32734 267 196 --
NM_015032chr1352403 2082 959 931 154 --32930 2434 2159 --
NM_015035chr20106413 5752 5300 4541 4167 2468 1950 1021 980 809 15669 16610 --
NM_015045chr1031827 1785 1622 2810 263 ----
NM_015051chr941165 599 473 443 12281 1566 --
NM_015052chr741390 1154 320 25 --11083 --
NM_015059chr1543235 1412 893 317 182 21106 572 --
NM_015061chr92730 571 ------
NM_015071chr5136272 6245 6126 6030 5877 5378 4434 4408 4293 2301 1872 805 368 15852 26137 781 11764
NM_015076chr631645 416 270 13585 --13998
NM_015087chr1342531 2498 2315 856 12173 ----
NM_015091chr143631 347 90 ------
NM_015092chr16124003 3550 3260 3121 1836 1547 1176 940 925 748 593 479 11190 24403 4255 13714
NM_015100chr161615 1547 783 559 469 150 11425 ----
NM_015116chr1331390 558 483 --11738 --
NM_015122chr192224 32 ------
NM_015132chr711311 ----11625
NM_015144chr1673975 3949 3196 2536 1595 1025 672 --12898 --
NM_015155chr1062951 2492 1208 1062 745 715 --22738 837 --
NM_015156chr1473946 3890 1291 497 219 132 23 --1573 --
NM_015192chr2062586 2324 2006 910 696 494 11947 42946 2302 2169 725 --
NM_015199chr382350 2274 2101 1885 754 663 221 67 ------
NM_015206chr1573747 3072 2807 1198 1109 624 205 --23799 3320 --
NM_015213chr111112 --2600 194 --
NM_015215chr152691 2227 925 799 204 --12515 1604
NM_015245chr672636 2562 2126 986 338 315 267 ------
NM_015252chr24777 320 97 33 ------
NM_015263chr154271 193 46 29 1788 ----
NM_015265chr272261 2158 1959 968 766 255 165 1328 11008 1812
NM_015268chr34645 527 174 51 --1250 --
NM_015271chr483831 3227 2703 1677 1612 1261 486 411 21464 306 13164 --
NM_015278chr653212 2238 1250 558 470 22616 238 42447 2436 774 652 --
NM_015294chr1731148 980 893 ----1824
NM_015310chr8188099 7768 7608 7062 6809 6749 6716 6529 6119 6094 5740 5645 3138 3081 2836 1244 638 559 58236 5451 5101 2228 382 12615 --
NM_015313chr1194650 4526 4446 3647 3607 1334 920 769 754 --34584 3766 375 --
NM_015315chr563497 3341 2789 2530 2135 1161 --11311 --
NM_015317chr252525 2112 1135 1048 743 21829 696 22653 2037 --
NM_015320chr22657 221 ----11036
NM_015326chr163000 2416 2132 2087 903 852 11034 32852 2060 479 --
NM_015335chr1282649 2561 2409 879 756 492 192 72 --12659 --
NM_015336chr1292397 2026 911 683 470 257 184 150 73 ------
NM_015344chr83731 325 151 11540 --1223
NM_015347chr1242271 1902 1153 657 --12780 --
NM_015349chr662917 2329 2239 1041 341 181 ------
NM_015375chr1125046 4999 4507 3962 3893 3131 1673 1364 1290 726 326 97 2600 79 14831 --
NM_015382chr142597 103 1736 --1686
NM_015393chr453035 2844 2578 2329 360 13108 13807 11137
NM_015435chr84968 569 467 128 1562 --1283
NM_015440chr62331 271 ------
NM_015455chr573532 3411 3205 3088 3048 1032 919 1802 21105 393 --
NM_015461chr181622 ------
NM_015477chr153931 804 70 1924 1366 --
NM_015484chr12633 619 --1183 --
NM_015493chr1932095 743 99 12215 11626 1498
NM_015508chr331037 247 111 11358 1263 11378
NM_015520chr352517 830 714 525 318 12723 1921 --
NM_015534chr121031 285 ------
NM_015549chr14----1600 --
NM_015567chr1321336 193 --173 --
NM_015568chr2032916 1333 334 14038 1688 --
NM_015569chr1104870 4723 4702 4306 3825 3504 1803 868 406 258 --23091 1111 11049
NM_015570chr741673 1317 1161 503 --1152 1681
NM_015576chr322023 360 12444 21894 970 --
NM_015595chr31121 145 1214 --
NM_015622chr7150 ------
NM_015630chr24842 780 369 259 ----1742
NM_015635chr931983 600 479 --2861 260 --
NM_015678chr1391369 1308 1194 1091 679 656 576 463 427 11579 ----
NM_015691chrX31146 932 544 --1114 --
NM_015695chr641834 1492 590 455 --11443 --
NM_015702chr21211 --1329 --
NM_015713chr843566 2351 2262 921 23630 2864 13313 22332 1015
NM_015726chr151682 1492 1294 619 562 --198 --
NM_015888chr1133279 3125 3000 2724 2556 2272 2096 1096 825 803 729 564 255 1363 31211 242 210 --
NM_015912chr841847 868 686 282 ------
NM_016009chr1104779 4586 3390 3164 2993 1450 1357 1094 1002 979 11479 14887 --
NM_016018chr821066 391 --32681 2216 1830 --
NM_016039chr14154 ------
NM_016059chr61158 ------
NM_016073chr153733 376 179 ----1947
NM_016078chr172828 252 --1801 --
NM_016081chr452177 824 401 276 106 ----21968 421
NM_016090chr112840 260 --2769 114 --
NM_016124chr131490 1322 1037 --11275 --
NM_016132chr1562850 2406 2377 967 899 841 11071 11181 --
NM_016205chr411273 ------
NM_016224chr651701 1688 751 702 556 ------
NM_016231chr1721739 403 --11677 --
NM_016248chr13113347 3326 3017 2956 2814 2574 2432 1571 1165 1121 304 11565 1175 --
NM_016252chr21695 ------
NM_016255chr6112989 2680 2593 2302 964 585 425 256 151 76 30 23368 3058 13236 --
NM_016257chr133070 2800 965 --12477 21071 785
NM_016271chr1842062 1493 1485 904 1541 --1359
NM_016277chr641223 1198 1057 429 --11159 --
NM_016281chr1231123 1102 78 1740 11031 --
NM_016308chr11342 11286 11460 --
NM_016315chr221367 1255 11814 1209 11722
NM_016322chr922483 2415 --22336 1097 --
NM_016340chr521106 953 --21262 1185 --
NM_016356chr652897 2485 2331 680 314 --157 --
NM_016376chr17114308 4188 4019 3903 3254 3153 1446 1413 797 781 308 22710 1431 13688 11319
NM_016422chr1163027 2687 979 632 438 294 22511 1278 ----
NM_016424chr1731473 1395 187 21601 774 21773 272 11356
NM_016436chr2052182 1786 998 991 983 ------
NM_016441chr262421 2325 1818 1676 669 81 ------
NM_016442chr541946 1699 567 557 32306 1785 801 ----
NM_016529chr13----31054 400 116 --
NM_016531chr4124154 4068 3753 3671 3582 3564 3468 3353 836 789 222 96 23452 3288 181 --
NM_016532chr1741136 1008 927 125 --1411 --
NM_016559chr341364 1343 1154 1069 11227 1985 --
NM_016578chr11------1591
NM_016598chr321304 1182 --1173 --
NM_016604chr531246 506 294 155 ----
NM_016626chr1851595 1479 1276 437 414 ------
NM_016631chr212902 354 --1219 --
NM_016952chr1153841 2722 1500 1471 750 --22899 1118 11203
NM_017413chrX42567 2503 2421 528 ------
NM_017415chr574520 4477 4008 3658 3463 3301 1171 33665 2846 980 ----
NM_017420chr1483712 3482 3457 3379 3177 1335 1180 75 11141 2554 540 --
NM_017423chr442121 860 632 326 11722 22088 369 1538
NM_017437chr1452334 928 737 344 158 --2823 585 --
NM_017450chr1721396 1074 ------
NM_017508chr112671 38 32446 2213 1759 1929 --
NM_017519chr61401 --11215 --
NM_017577chr34478 135 95 32 1151 11571 --
NM_017610chr1541691 1619 1330 215 21636 690 1825 --
NM_017628chr495197 4485 4140 3360 2013 710 672 463 55 23720 1765 13736 --
NM_017633chr683371 3165 2643 2477 1067 1054 982 965 --1668 --
NM_017637chr9147389 7338 6099 5994 5714 3176 3090 2783 2588 1957 1745 1094 833 820 --57158 5941 2754 890 684 --
NM_017640chr62864 821 1618 1219 --
NM_017643chr1742326 751 648 97 ------
NM_017644chr3115135 4345 4338 4315 4306 3381 1896 1707 1547 1309 31 55109 4876 4803 3347 1489 --14820
NM_017650chr7115816 5361 5047 4828 3701 3672 2157 2094 1670 1197 1095 14998 24382 1141 --
NM_017658chr1494563 4087 3963 3124 1472 1259 1152 561 255 13828 24060 467 --
NM_017664chr1341095 1049 233 113 --1664 --
NM_017680chr93309 63 54 ------
NM_017686chr11864 --2361 200 --
NM_017712chr1956357 5914 4611 4509 787 --23942 2208 --
NM_017715chr72751 38 --1668 1588
NM_017730chr33657 547 60 ------
NM_017745chrX2622 269 ------
NM_017747chr5------1325
NM_017752chrX41889 637 266 179 21976 1521 21770 223 --
NM_017753chr931002 135 54 ----1267
NM_017772chr621695 314 ------
NM_017778chr831248 1157 262 --11031 --
NM_017780chr8164 ------
NM_017784chr32377 164 --11211 1274
NM_017811chr932478 982 763 12931 21983 744 11180
NM_017824chr1032001 439 79 22292 139 1667 --
NM_017848chrX64282 4173 3660 3380 3332 631 14669 11180 --
NM_017857chr11288 21 --1700 --
NM_017893chr1031368 1167 910 21133 297 ----
NM_017902chr1064841 3826 1082 973 888 98 25755 105 34398 3694 1950 --
NM_017913chr93464 91 74 --1417 --
NM_017964chr221021 331 --2796 128 --
NM_017969chr2182 --1197 --
NM_017994chr732531 407 130 --22344 623 --
NM_017998chr9----193 --
NM_018013chr672932 2048 1168 671 608 568 447 11941 12130 12594
NM_018027chr1073282 2714 2110 1249 1196 540 219 13307 ----
NM_018043chr1131314 1044 146 ------
NM_018061chr161702 1656 1609 1357 91 27 2679 561 11254 --
NM_018071chr144771 747 598 219 --2540 49 --
NM_018078chr41365 31074 924 94 1377 --
NM_018079chr23579 216 135 ------
NM_018084chr263261 3128 2178 1256 1070 564 22994 2853 12223 --
NM_018110chr1631407 1105 257 ------
NM_018112chr9----1821 --
NM_018133chr3----12174 --
NM_018144chr102328 44 ------
NM_018150chr13920 322 123 --187 1151
NM_018169chr121490 1556 1542 --
NM_018176chr411319 1342 1154 --
NM_018178chr141698 1518 251 197 --12063 --
NM_018181chr1861760 1477 1355 510 55 37 --21451 548 --
NM_018227chr452583 2439 1098 186 168 156 ----
NM_018243chr4103911 3646 3461 2606 1420 1083 958 924 906 551 --21512 471 32493 1590 703
NM_018247chr662105 1957 1919 1052 757 473 12550 22931 1103 1592
NM_018263chr272504 1765 1675 455 396 164 22 1237 1263 1843
NM_018293chr382652 2189 2165 1906 1149 1063 882 873 22608 728 31934 233 144 --
NM_018330chr1021277 399 ------
NM_018339chr941546 1184 436 98 ------
NM_018362chr1194001 3768 3083 2630 2563 1295 1108 494 179 ------
NM_018364chr173728 3672 1191 1185 1132 965 582 23754 3312 2799 23 13208
NM_018374chr764220 4081 1515 950 269 114 65089 3396 3174 1308 589 511 23495 1764 45080 2010 1983 1963
NM_018375chr1451555 779 570 325 246 ----1188
NM_018383chr241667 1560 596 563 12088 12044 11994
NM_018403chr374003 3644 3612 3362 3059 969 860 --11485 --
NM_018439chr1822651 1804 ------
NM_018444chr82218 85 2474 43 21479 654 --
NM_018445chr152504 200 --175 --
NM_018462chr32552 240 ----1836
NM_018464chr10----1174 1137
NM_018482chr822513 867 1247 11903 --
NM_018566chr1165010 4651 4292 3933 3500 3452 3119 1717 1646 1606 1544 1534 1143 990 866 855 31845 1594 490 53997 3487 1127 448 341 14162
NM_018569chr431470 1358 649 11639 11630 --
NM_018571chr25599 526 94 39 32 1495 ----
NM_018638chr12135523 5414 5364 4851 4384 4202 4138 4115 2087 1862 1548 1398 981 34394 1147 1125 11008 --
NM_018652chr152977 681 ----1192
NM_018685chr721014 832 ----158
NM_018704chr1--1125 11625 --
NM_018710chr851384 1317 1114 954 389 1277 --1378
NM_018718chr751846 1791 1543 635 368 --11782 --
NM_018834chr53817 761 351 --1861 --
NM_018836chr1------11172
NM_018840chr20----1480 --
NM_018841chr162771 2627 1447 1331 1254 295 23317 485 --12904
NM_018847chr941764 771 661 48 --21754 1704 --
NM_018898chr542273 2264 1912 350 21457 842 ----
NM_018940chr54995 984 423 411 ----1978
NM_018948chr121475 1045 ------
NM_018970chr752630 1174 1164 437 431 --1528 --
NM_018976chr1242684 2495 1061 619 1455 ----
NM_018979chr1282545 2482 2429 2408 2231 900 870 788 --22194 1639 --
NM_018993chr2021421 1059 2586 318 ----
NM_018999chr1054318 3989 3846 3656 1704 --14490 --
NM_019004chr762320 2305 2004 1787 884 284 32422 343 330 ----
NM_019012chr122588 199 ------
NM_019030chr5181 1219 1151 --
NM_019042chr71231 ------
NM_019045chrX4967 773 720 630 --185 --
NM_019049chr13122 91 31 1655 ----
NM_019058chr102782 601 ------
NM_019080chr1321474 247 21345 380 1290 --
NM_019084chr1052142 2070 1931 1925 815 32599 745 712 ----
NM_019091chr251100 895 777 259 103 --1150 --
NM_019094chr12103621 3500 3487 3402 3185 2805 2755 2713 1172 87 --12367 --
NM_019114chr942127 980 830 449 --11853 --
NM_019555chr321456 88 --198 --
NM_019593chr2042753 2567 934 298 2375 335 --1715
NM_019600chr15----1270 --
NM_019613chr1741034 999 992 301 ----11300
NM_020122chr255913 4735 1696 913 270 --35198 4461 1811 --
NM_020123chr102495 106 31222 1194 404 11114 --
NM_020144chr771914 1640 1465 1413 1333 604 396 ------
NM_020180chr181191 ------
NM_020193chr1161159 921 915 476 89 23 11264 1955 1235
NM_020205chr143489 2641 1203 906 23250 1057 1473 --
NM_020228chr1162427 2311 2211 2080 287 143 22498 948 ----
NM_020337chr4143161 2943 2847 2787 2542 2200 2191 1188 1173 565 435 421 265 243 22767 1967 ----
NM_020338chr1063695 2902 2276 641 309 32 --33516 3376 63 --
NM_020340chr661779 1763 879 575 224 177 12067 ----
NM_020346chr1131467 1306 387 3615 440 372 ----
NM_020357chr351397 1140 1116 199 138 1570 11072 --
NM_020381chr61127 --21798 224 --
NM_020403chr1351689 712 501 425 214 --11632 --
NM_020432chr781821 922 896 719 655 619 428 260 1180 --11686
NM_020452chr122121 601 --12113 --
NM_020466chr6134113 3958 3900 3570 3342 1983 1700 1537 1348 1096 784 611 544 34267 3236 1358 44997 3448 3265 3090 --
NM_020546chr541977 939 923 289 --21258 56 --
NM_020647chr832164 1778 815 1929 ----
NM_020648chr1832276 2016 407 12481 12726 --
NM_020651chr261832 1334 1317 1172 631 604 21407 133 ----
NM_020673chr20137774 7717 7213 6907 6844 5754 4793 2722 2515 1040 549 346 325 11068 47676 2657 2616 2102 --
NM_020689chr2021524 1126 --21693 1073 11674
NM_020699chr165302 4496 3737 1713 1464 197 21916 581 14899 --
NM_020734chr12113202 3042 2487 2301 2192 2176 2148 826 712 387 302 1919 11076 --
NM_020740chr171258 ------
NM_020742chrX92530 2373 2112 1929 1737 787 415 380 357 --1243 --
NM_020752chr1062492 2474 2254 2200 1943 857 ----1606
NM_020762chr123807 413 296 2762 235 ----
NM_020765chr11317 --1272 --
NM_020768chr541159 1010 907 715 --1106 --
NM_020770chr11207 11094 --11338
NM_020772chr17137751 7128 6752 6067 5914 5721 5619 2630 2478 1138 637 476 444 45285 2889 2830 977 --12980
NM_020773chr442593 2393 1086 22 --1991 --
NM_020778chr15114897 4465 4403 3659 3142 1754 1076 1038 953 636 292 ------
NM_020787chr172426 406 1569 1230 --
NM_020796chr542672 2076 470 402 ------
NM_020802chr1192625 2296 2160 2119 2089 1073 699 612 116 1168 13130 13325
NM_020810chr1462993 2324 859 833 690 528 12439 1941 --
NM_020834chr14----21604 79 --
NM_020839chr371478 1118 1096 1042 651 395 336 --21619 1509 --
NM_020858chr1542114 1950 386 326 --11681 --
NM_020860chr41300 --1893 --
NM_020861chr61881 1234 1279 --
NM_020870chr421789 1689 --2899 79 --
NM_020871chrX82337 1934 1811 956 734 725 422 319 12554 ----
NM_020872chr351726 1655 1585 456 295 21446 1433 31338 1317 226 --
NM_020873chr32833 729 ------
NM_020925chr111448 --21246 187 --
NM_020940chr1062855 2795 2621 966 228 47 12649 32887 2356 2334 --
NM_020956chr1943954 3516 481 376 --11132 --
NM_020964chr1854123 4019 2951 1856 988 23830 49 44760 4751 1739 1453 14639
NM_020988chr1631303 547 237 ----1210
NM_021003chr14--1727 1781 --
NM_021033chr1353455 2528 2297 1284 169 12508 1547 --
NM_021035chr2041329 984 489 139 11257 21072 453 --
NM_021038chr3103136 2989 2806 2452 1124 954 885 206 192 171 23194 217 1730 --
NM_021072chr532404 2140 1740 22377 1717 ----
NM_021073chr6----169 --
NM_021111chr931160 1115 262 11282 1969 --
NM_021132chr101445 ----1293
NM_021140chrX2773 470 1937 ----
NM_021180chr13829 683 620 --1737 --
NM_021183chrX31880 782 513 11864 32227 972 567 --
NM_021255chr1432847 1533 446 23349 3229 11455 13968
NM_021629chr3194902 4778 4696 4479 4443 4315 4013 3899 3613 3223 1866 1316 1103 1022 945 765 735 345 301 ------
NM_021648chr64667 381 291 104 12649 1410 --
NM_021785chrX----1233 --
NM_021813chr675769 5141 4944 4659 1528 963 116 --35529 3906 106 --
NM_021914chr1472451 2130 1967 1884 672 511 405 11945 ----
NM_021942chr4----1153 --
NM_021961chr11117446 6834 6592 6334 4863 2736 2504 1257 855 186 63 46790 6746 4965 377 27415 5212 35430 2055 1247
NM_021964chr3146620 5445 4795 4579 4490 4269 4100 1848 1521 906 418 395 362 34 24309 927 32329 1420 659 --
NM_021977chr663653 1530 1183 968 939 746 23047 2943 13259 --
NM_021999chr13163 1859 ----
NM_022037chr21163 1869 11023 --
NM_022048chr1535203 752 608 14451 1988 14210
NM_022049chr11680 11367 11867 --
NM_022058chr251686 1487 331 227 209 1612 12114 --
NM_022098chr2221196 372 ----1322
NM_022118chr131221 --1253 --
NM_022130chr541035 576 447 97 2520 479 ----
NM_022136chr21--1441 1474 --
NM_022166chr1676320 6239 5974 5387 4100 1574 1436 ------
NM_022170chr721708 1163 21701 1539 ----
NM_022171chr32411 55 --31567 1433 1360 --
NM_022340chr383428 2697 2635 2513 2362 808 552 293 13439 1155 --
NM_022374chr2----1357 144
NM_022454chr81770 --2804 51 --
NM_022458chr7103146 3078 3069 2708 2611 2579 1960 951 784 265 12536 ----
NM_022461chr33875 439 137 21296 38 --11022
NM_022465chr1272695 2635 2548 2411 2198 800 243 ------
NM_022474chr1482815 2808 1756 1069 821 676 667 503 31857 1850 404 22150 920 --
NM_022477chr202204 67 --1376 --
NM_022495chr14------1367
NM_022574chr73422 172 126 ----1490
NM_022719chr2273843 2875 2688 2490 1376 948 31 --12385 --
NM_022739chr173280 222 137 1307 1412 --
NM_022753chr121870 1780 --12279 --
NM_022756chr111129 --2516 392 --
NM_022763chr352488 2434 2322 967 918 --140 155
NM_022771chr123308 241 33 1768 ----
NM_022776chr311276 1636 ----
NM_022781chr9103347 3231 3041 2269 2228 2138 952 935 628 595 ------
NM_022782chr123148 133 30 ------
NM_022824chr571957 1798 1552 1508 389 145 61 1438 ----
NM_022832chr462594 2390 2186 1794 1577 308 1786 12240 11708
NM_022893chr252848 2590 2187 1991 1076 22997 2217 ----
NM_022894chr21204 1467 ----
NM_022898chr1464796 4631 4232 1360 1179 663 14850 11381 11729
NM_022912chr263094 2897 2463 1023 493 403 12226 12935 1426
NM_022918chr1131402 777 394 1321 11353 --
NM_023002chr191103 --11736 --
NM_023016chr222714 1055 32643 2062 772 12741 --
NM_023076chr1672956 2937 2166 1196 992 612 385 ------
NM_024052chr1752495 2431 876 861 733 --1262 --
NM_024063chr15132 --174 --
NM_024090chr441691 1630 1321 684 11290 21725 367 --
NM_024345chr9105705 5007 4861 4383 3931 2285 2121 1576 506 384 34693 4546 2455 35959 4787 138 12324
NM_024408chr153711 3058 740 684 378 13721 23157 1065 13001
NM_024501chr2--1714 1489 --
NM_024524chr352662 2612 2264 1232 247 22017 1264 12964 22371 366
NM_024548chr331568 241 49 11252 ----
NM_024551chr1252265 2015 872 587 51 1412 12488 --
NM_024561chr131444 --11320 11354
NM_024590chr471869 1595 718 702 668 529 162 21693 1291 --1212
NM_024595chr131007 461 57 1115 184 --
NM_024638chr362432 2010 611 481 457 33 --12368 --
NM_024665chr344003 3769 3636 617 24569 1881 14638 23923 3541
NM_024675chr161187 197 1231 --
NM_024699chr81792 --1133 --
NM_024713chr1551335 1075 526 514 178 1440 ----
NM_024719chr132106 35 --1201 --
NM_024721chr882146 1945 1863 1804 1060 833 587 436 21925 898 11792 --
NM_024811chr1111579 ------
NM_024852chr11644 --1487 --
NM_024896chr962154 1649 336 225 201 139 ------
NM_024911chr12773 145 --1239 --
NM_024947chr3239315 9060 8508 7936 7176 7068 6723 6394 3766 3697 3301 2729 2559 2508 1286 1025 931 719 486 388 356 145 117 78663 6823 6632 3394 1332 649 93 59490 9260 7060 3293 1976 --
NM_024948chr102667 267 --1131 --
NM_024949chr454560 3814 1249 482 157 21624 1028 14954 11334
NM_024953chr1242826 2475 937 785 2855 606 12097 --
NM_024989chr2127533 6822 6607 2730 2623 2508 2209 2162 1918 1833 1380 1145 88010 7958 7833 5117 3100 2693 2480 1897 47471 7083 5433 966 --
NM_025027chr196437 388 115 81 43 32 1934 1267 1827
NM_025133chr23840 423 55 ------
NM_025134chr1662441 2185 1828 636 326 109 --21920 920 1789
NM_025146chr382443 940 623 448 325 159 83 29 22674 284 ----
NM_025147chr211099 ----1383
NM_025154chr741238 343 107 28 11086 1423 --
NM_025160chr1144083 4041 3684 3601 3485 3322 3062 2993 2694 1396 1343 1252 726 605 34277 3677 156 11730 21367 1137
NM_025164chr1132064 1559 342 1580 22138 135 --
NM_025191chr183309 3104 3007 2803 2477 2378 982 736 12183 11113 11316
NM_025208chr1152375 2282 2211 2103 1523 11653 12310 1616
NM_025211chr9----1223 --
NM_025234chr15----1172 --
NM_030625chr1052661 2603 2351 806 626 12105 1199 --
NM_030627chr583210 3055 2874 2657 1061 382 281 85 33465 3406 797 ----
NM_030629chr1641930 1866 1530 1429 --11737 --
NM_030640chr121193 --1690 --
NM_030647chr7125309 5155 5127 4817 4394 3855 1905 1732 1081 997 772 674 16254 --15651
NM_030665chr1731347 391 356 --11147 --
NM_030758chr2211206 --1147 1438
NM_030762chr1251757 1572 780 770 221 --11945 --
NM_030780chr821195 305 --11614 --
NM_030816chr193340 3283 2691 1020 849 626 310 240 112 21170 452 13194 --
NM_030821chr4----2567 191 1329
NM_030885chr341808 1511 903 67 11830 21815 345 --
NM_030918chr195482 5161 4863 4806 4632 4108 1780 1680 775 --14282 15255
NM_030920chr132094 1796 1734 21909 1818 ----
NM_030938chr172985 853 --2160 145 --
NM_030939chr62426 286 --11107 --
NM_030949chr621041 400 1160 1427 --
NM_030962chr1141594 1444 1331 1281 ------
NM_030963chr61256 --1553 --
NM_030964chr563315 2911 2287 690 585 197 --12359 --
NM_031296chr462750 2443 2104 1695 110 46 1720 1133 22522 2190
NM_031372chr411433 --1229 --
NM_031412chr1221140 404 --1154 --
NM_031442chrX72984 2370 2168 938 872 538 91 1367 --1969
NM_031445chr273424 3375 2397 2346 2085 443 328 --12698 --
NM_031911chr421980 992 12319 22309 2011 --
NM_031922chr6----129 --
NM_032016chr71617 ----1189
NM_032028chr5----1618 --
NM_032042chr542191 2028 533 251 12595 11778 1901
NM_032102chr1142921 2050 749 59 --2202 122 --
NM_032121chrX32785 2583 476 22645 249 ----
NM_032144chr241672 538 123 112 11741 21558 1432 --
NM_032153chr372558 2484 812 732 673 332 161 --1644 --
NM_032160chr1874128 4094 3810 3218 2805 1610 1331 33938 2821 39 --1464
NM_032172chr74985 786 695 216 1834 ----
NM_032182chr1021632 1196 11053 --11311
NM_032199chr1043603 3567 1378 930 13465 13344 --
NM_032208chr253447 3187 2628 1125 110 13494 ----
NM_032228chr11113035 2914 2808 2344 1343 1314 1124 1029 780 186 151 1397 23067 879 --
NM_032229chr132999 897 1315 1391 --
NM_032233chr142892 86 ------
NM_032256chr1221064 414 ------
NM_032291chr13276 159 104 11302 ----
NM_032294chr1721610 37 ------
NM_032352chr1451133 1007 951 581 269 31297 1190 333 ----
NM_032373chr10115861 5700 5270 5007 4940 4436 4424 3925 2206 1727 336 14207 43624 2297 1491 1043 43775 1454 738 382
NM_032439chr1041249 616 461 239 ------
NM_032440chr1072740 2158 1081 684 593 412 101 11043 1467 --
NM_032457chr433857 3678 1461 --21287 1247 13132
NM_032458chrX92942 2335 1170 1054 776 687 310 257 49 23280 2706 ----
NM_032491chr1231312 946 829 ------
NM_032547chr411364 21399 1063 1466 --
NM_032557chr44653 394 125 111 ----1157
NM_032560chr1431107 233 127 ------
NM_032569chr1662021 1923 1811 1650 1457 1285 ------
NM_032626chr162282 254 ----1127
NM_032682chr343514 3276 2762 1080 12778 13598 --
NM_032784chr61196 ----1817
NM_032787chr3----1276 --
NM_032810chr10----1418 --
NM_032839chr34510 504 146 53 --161 --
NM_032859chr13123960 3652 3569 2923 2800 2760 1556 1342 930 788 487 196 23921 3415 --11226
NM_032866chr1532671 2613 257 --12894 --
NM_032873chr11104456 4119 3928 3162 1793 1203 908 712 694 85 54127 3044 1225 1011 597 22922 616 1132
NM_032875chr174827 714 647 46 --1674 --
NM_032884chr1--1323 1234 --
NM_032968chrX73987 3837 3199 3069 2724 634 265 --23017 1424 13521
NM_032973chrY83979 3829 3194 3064 2719 1064 821 634 --23012 1424 13517
NM_033055chr131032 865 749 ------
NM_033081chr2011048 --1558 --
NM_033089chr2041399 1201 1054 1023 ------
NM_033116chr14------160
NM_033121chr1231649 1165 442 --21585 281 --
NM_033127chr11634 2285 137 1568 --
NM_033222chr941163 1144 323 30 --1454 --
NM_033224chr747706 6241 6017 2123 --37778 7196 6481 15016
NM_033226chr163715 619 158 ------
NM_033285chr8134372 4227 3851 3143 3006 2796 1316 698 468 459 412 311 211 33334 1189 196 14192 --
NM_033309chr1621020 452 --11101 1735
NM_033389chr1764707 4124 3662 3651 1124 78 ------
NM_033396chr112417 158 ----1151
NM_033426chr1472743 2728 2148 1788 623 581 567 1553 ----
NM_033631chr1----32581 2425 1017 --
NM_033656chr2175464 4369 2383 1644 1235 450 166 11217 ----
NM_052845chr1272744 2605 2595 2311 2235 2105 833 --1495 --
NM_052864chr421981 634 1873 12005 --
NM_052876chr192286 229 --131 12649
NM_052898chr861656 1578 1323 1201 391 73 --21548 654 --
NM_052900chr811739 31676 1495 388 191 161
NM_052905chr241917 1588 1372 571 --11535 --
NM_052906chr2244718 4576 4526 2002 --24771 220 --
NM_052907chr1274180 4081 3417 1059 837 667 486 44326 3014 866 390 ----
NM_052910chr1332182 1527 751 ------
NM_052917chr263342 3061 2322 1050 695 37 22251 933 23240 1143 1580
NM_052927chr52700 146 11466 1711 1397
NM_052937chr862287 2128 1773 1017 951 728 1697 ----
NM_052950chr1352132 1648 684 387 308 --11371 --
NM_052966chr163886 2775 1210 845 368 340 162 33766 684 243 --
NM_052978chr1441535 1320 689 43 11579 11927 --
NM_053002chr31112 --2911 308 --
NM_053023chr1183245 2941 2656 2176 1280 808 509 276 ----32227 2209 453
NM_053024chr341472 1290 1024 996 ----1272
NM_053053chr11139 --176 --
NM_053064chr1452867 2663 1889 1873 1132 --33056 2967 2711 --
NM_057749chr83976 433 126 21219 173 ----
NM_058164chr192466 423 ------
NM_058172chr461835 1566 1544 417 181 171 --143 --
NM_058229chr8397 75 22 ------
NM_080546chr93658 599 314 --1774 --
NM_080616chr205536 168 134 87 24 ------
NM_080664chr1421787 622 12059 1670 --
NM_080671chr252226 2176 567 384 248 --22271 2109 --
NM_080743chr672587 1819 963 774 640 365 186 --1758 --
NM_080764chr2282916 2815 2716 2686 2673 2300 2173 944 1678 --12440
NM_080867chr1484440 4135 1844 1405 1398 524 365 181 2693 248 2344 315 13874
NM_080872chr833049 2750 47 12858 22680 232 --
NM_080874chr421160 533 --11585 --
NM_130387chr32786 423 --1217 --
NM_130808chr33387 338 65 1360 --1110
NM_133171chr2031221 1038 991 161 --11123
NM_133328chr193651 314 291 ------
NM_133369chr53357 214 26 --1665 1916
NM_133433chr52902 153 --1888 --
NM_133445chr953335 2508 1055 948 59 ----1371
NM_133468chr742287 1872 903 335 12157 --1452
NM_133473chr1941837 1270 658 580 --3716 633 555 --
NM_133478chr262513 2476 761 600 451 48 21797 1566 12285 --
NM_133496chr143996 3880 1710 1108 --11184 --
NM_134428chr92381 300 1255 ----
NM_138285chr22190 29 --2167 112 --
NM_138357chr1041200 1187 615 559 11859 ----
NM_138375chr1821183 485 158 1855 1938
NM_138423chr1592211 2189 2091 2067 1893 1648 1508 790 737 --1276 --
NM_138426chr752296 2245 2089 911 657 1108 ----
NM_138459chr663527 3465 2957 2831 2558 990 42845 2499 1385 1367 11056 1308
NM_138473chr1294697 4519 3886 3527 3472 1219 786 387 272 --1234 --
NM_138635chr753197 1967 913 302 123 --13038 --
NM_138731chr14103787 3373 3315 3281 2783 2692 2587 1073 700 128 13567 12732 13811
NM_138771chr731541 1195 95 21093 615 1118 1349
NM_138773chr51132 3806 649 221 1639 1915
NM_138782chr532046 1772 377 31661 663 479 1145 1230
NM_138927chr21--1776 ----
NM_138959chr1126314 6194 5565 4485 4317 2519 2324 1585 1056 888 564 152 25500 2381 46803 6568 5008 4214 14263
NM_138962chr17----1331 --
NM_139246chr952381 1686 1619 572 141 ------
NM_139281chr593609 2639 2519 2431 1116 1068 385 210 147 33253 2887 2267 --12216
NM_139283chr122962 753 32423 2128 2014 184 --
NM_139318chr14--1233 1225 --
NM_144570chr1653016 2859 2299 2271 2136 ------
NM_144571chr4156632 6344 6226 5731 5149 5051 4911 4538 4271 2196 1439 594 492 334 147 --22601 2254 14241
NM_144579chr242130 1835 831 330 --2199 168 --
NM_144594chr121183 --1136 --
NM_144600chr1631685 1318 143 31503 1308 1094 ----
NM_144629chr21208 1192 ----
NM_144657chrX2418 109 1447 ----
NM_144660chr101285 --1166 --
NM_144721chr4102802 2547 2192 858 811 743 654 334 306 224 ------
NM_144778chr1352628 2589 2558 1751 69 12653 ----
NM_144963chr861774 1755 969 932 387 265 --2786 29 --
NM_144964chr9155 ----1455
NM_144973chr1295380 5271 5104 4144 3824 2063 1666 1362 726 25326 5085 24066 1586 --
NM_145000chr54451 173 166 151 ------
NM_145176chr693539 3321 3072 3044 2803 2681 2414 918 269 143 13561 --
NM_145207chr454913 3557 3330 3242 1866 11609 11519 --
NM_145234chrX1763 --1277 --
NM_145243chr1----1244 --
NM_145251chr1461355 1023 584 455 305 155 --3534 314 130 --
NM_145257chr1103954 3581 2912 2597 1506 1127 933 907 819 212 11035 23085 844 12659
NM_145284chrX32006 1020 116 1312 ----
NM_145296chr191137 184 1887 --
NM_145313chr1031515 1371 601 1166 21681 557 --
NM_145735chr1372553 2116 2066 1977 1943 800 334 21873 884 --1943
NM_145753chr32484 266 --11695 --
NM_145808chr772609 1064 782 593 302 106 53 32437 2331 764 13048 --
NM_147156chr1031514 1252 1118 11535 2379 225 --
NM_147189chr811842 --11674 --
NM_148894chr41418 1194 ----
NM_152261chr1242017 1601 801 733 2860 230 --1194
NM_152272chr811162 1488 --1299
NM_152344chr171368 ------
NM_152375chr142441 1721 882 655 --1949 --
NM_152381chr231803 1289 1232 1271 --11577
NM_152399chr43886 340 106 ------
NM_152400chr491921 1861 1755 821 656 534 440 374 30 11462 --11535
NM_152409chr563390 2984 2320 930 755 749 42403 1293 897 469 ----
NM_152450chr1531828 1322 495 1558 ----
NM_152470chr1832807 2726 946 --1122 --
NM_152493chr141514 1367 1193 234 ------
NM_152520chr2----1879 --
NM_152556chr762385 2209 1857 931 858 388 1453 12554 12573
NM_152557chr711515 --11448 --
NM_152581chrX1296 ----1482
NM_152586chr1031040 938 94 ------
NM_152594chr1562156 1762 1677 1526 608 419 1836 --11600
NM_152609chr14365 353 312 278 21186 864 ----
NM_152622chr563162 2830 2126 949 679 606 ------
NM_152641chr123795 318 55 --2408 47 --
NM_152653chr33704 189 43 ------
NM_152666chr12175 76 ----1112
NM_152699chr323490 2992 21210 73 23550 615 --
NM_152745chr72139 107 11178 1279 --
NM_152756chr5133502 3442 3166 3106 2809 2734 1612 1525 1380 941 896 118 32 --13775 --
NM_152758chr86996 668 593 381 220 120 1821 1194 --
NM_152857chr64355 292 132 124 ------
NM_152890chr12880 486 1916 --11281
NM_152994chr2------1635
NM_152996chr151801 1785 614 129 48 --1236 --
NM_153020chr661706 1629 1543 1524 1482 1460 1423 11318 --
NM_153042chr621596 727 1194 21677 328 --
NM_153207chr1294122 3979 3914 3756 3600 2979 1537 1323 86 --1224 --
NM_153251chr13--1236 1276 --
NM_153252chrX3349 142 111 ------
NM_153260chr1561347 954 622 581 424 117 ------
NM_153341chr1----2331 36 --
NM_153371chr1351836 803 789 446 180 12101 11539 11472
NM_153453chr61778 ------
NM_153607chr5112843 2736 2655 2608 2436 2166 886 879 465 287 166 21189 105 ----
NM_153634chr1221342 411 --11061 --
NM_153646chr141124 --32164 716 304 --
NM_153687chr1241588 661 622 592 1247 ----
NM_153689chr272275 2219 1798 1622 372 129 49 31976 1644 788 12243 --
NM_153695chr9------149
NM_153702chr4289 42 --134 --
NM_153713chr11103 --187 --
NM_153810chr10125093 3853 3620 3554 3374 3348 1717 1253 617 362 91 44 --24756 1768 --
NM_170606chr741524 1418 598 241 1591 ----
NM_171998chrX12459 --21601 626 --
NM_171999chr183853 115 92 ------
NM_172070chr271970 1611 1537 809 688 355 92 1329 11656 --
NM_172071chr1156667 6310 5785 5115 4986 2821 2608 2058 1929 1658 1507 1004 973 334 180 --16125 --
NM_172127chr441965 1908 717 223 ----12020
NM_173172chr251377 1124 1025 327 297 ------
NM_173463chr453186 1731 690 238 213 13368 33968 3390 759 --
NM_173468chr475733 5043 4576 4527 2073 726 202 55645 5527 5348 1789 472 14876 --
NM_173469chr1531326 1109 243 --21478 1132 --
NM_173470chrX31827 1176 870 --1281 --
NM_173471chr331076 1046 1024 1998 --1792
NM_173473chr1032640 2089 602 1163 32402 1911 120 --
NM_173475chr1631764 561 168 ------
NM_173497chr103446 271 176 ------
NM_173511chr283934 3842 3687 2939 1226 1156 947 448 23344 3337 1773 --
NM_173576chr1052150 1816 1800 1520 1500 1617 ----
NM_173595chr1265246 3512 1522 1455 616 82 174 1758 --
NM_173611chr15----174 --
NM_173645chr22234 48 --1462 --
NM_173648chr21969 2797 726 1262 --
NM_173654chr362241 2234 2211 1621 1610 264 ------
NM_173666chr521294 116 --1932 --
NM_173803chr162428 170 --2393 109 --
NM_173808chr1104096 3973 3887 3815 3310 1472 807 724 208 156 13214 12968 1427
NM_173822chr292145 1857 850 706 557 135 80 69 49 22190 1590 ----
NM_173825chr323024 357 1804 11208 1948
NM_173829chr575275 5031 4880 1239 1001 690 122 21452 1266 45447 4150 4027 1629 15640
NM_173851chr853570 2790 2455 1422 472 23301 2954 31445 588 125 23944 1358
NM_174911chr853695 2911 2904 2560 205 52784 2738 1205 849 292 23203 1222 13227
NM_174916chr154743 736 471 320 ------
NM_175039chr92158 70 185 1386 --
NM_175061chr762098 1537 855 816 733 182 --1264 12198
NM_175630chr21912 1152 1753 --
NM_175767chr531187 687 292 --11419 158
NM_175768chr631632 1410 419 ----1166
NM_175854chr136959 745 376 341 145 131 3773 767 350 21743 93 --
NM_176814chr761234 578 505 428 205 118 11308 ----
NM_177968chr221932 230 ----11380
NM_178011chr1063280 2998 2318 1127 376 183 --22948 399 --
NM_178123chr22890 57 --1130 --
NM_178135chr4----184 1252
NM_178140chr542701 2188 751 480 1320 12380 --
NM_178313chr251945 1711 1610 583 331 ----1193
NM_178439chr23505 217 64 --1560 --
NM_178557chr431413 1364 184 ------
NM_178812chr841218 613 215 40 ------
NM_178815chr1072482 774 679 574 189 125 50 ----11953
NM_178826chr123250 171 72 ----1692
NM_180989chr1312155 4934 715 197 87 ----
NM_181077chr1542103 1766 1683 910 1536 11531 --
NM_181358chr163410 2827 1444 1349 1091 1069 2598 554 ----
NM_181552chr73979 923 736 ----2810 302
NM_181571chr1031055 1027 778 --1257 --
NM_181645chr112700 627 --1181 --
NM_181671chr171769 --1230 1734
NM_181672chrX11789 32034 1766 1390 177 --
NM_181701chr932388 2336 2108 --32367 1677 340 --
NM_181704chr2131327 145 24 --1398 --
NM_181807chr11----190 --
NM_181836chr592376 2344 2120 2036 935 782 280 114 93 22548 1820 ----
NM_182485chr463233 2824 2756 1189 665 573 22793 346 22901 2771 --
NM_182488chr13126 --1123 --
NM_182524chr41260 --1661 --
NM_182526chr1422246 2079 --23118 2095 --
NM_182663chr151649 1388 668 449 75 ----1542
NM_182700chr721898 1817 21832 1626 11540 --
NM_182758chr15123674 3534 3409 3266 3224 3170 2960 2765 1506 1263 188 131 23546 397 ----
NM_182765chr1082097 2014 1692 938 750 364 259 93 ------
NM_182767chr1251690 1633 1390 808 185 11964 1442 --
NM_182830chr1422247 1405 ------
NM_182970chr202215 81 --11250 --
NM_182975chr12239 88 21067 448 ----
NM_194071chr7135407 5092 4818 4465 4153 4083 3735 1670 1212 1199 1087 772 459 14537 11142 --
NM_194282chr4103090 2645 2314 2194 1906 579 462 450 172 60 12370 ----
NM_194314chr1135449 5403 5338 3637 2118 2105 2070 1609 1442 1422 1255 676 421 23522 1572 35535 4641 208 11748
NM_194449chr183856 219 71 ------
NM_197941chr543015 2960 2901 806 ------
NM_198074chr1172 1170 1978 --
NM_198243chr153653 385 124 147 ----
NM_198270chrX13396 12131 12146 --
NM_198279chrX2996 465 --1820 --
NM_198317chr1----1515 --
NM_198490chr333493 1367 241 1812 --13250
NM_198513chr83595 444 309 11541 ----
NM_198560chr323839 1034 13760 ----
NM_198581chr2117496 7390 6919 6727 2514 1910 1649 1620 648 488 109 25788 697 16151 12438
NM_198834chr1752316 2254 1934 1461 545 --12293 --
NM_198859chr385152 5091 4479 4259 4104 1867 1714 1544 23741 1480 1203 --
NM_198904chr53815 783 525 12060 --11793
NM_198935chr2073106 2401 2306 2204 1214 1099 204 33175 2423 2327 21189 1153 --
NM_198947chr113745 403 305 169 ----
NM_198965chr122296 148 ------
NM_198991chr181546 169 1599 1128
NM_199000chr741580 915 870 612 11738 1161 --
NM_199072chr752789 991 326 244 73 --22460 1225 --
NM_199168chr1031334 1142 135 --11230 --
NM_199262chr1721436 867 ------
NM_199320chr422953 2680 --12297 22172 115
NM_199464chr132510 60 ------
NM_201613chr121119 --1708 --
NM_201628chr153411 2678 2123 1186 1148 12182 1727 --
NM_203434chr921213 796 ------
NM_203451chr1362298 2232 1947 1580 618 501 --1344 21672 571
NM_203459chr162321 2257 1021 998 868 47 --22585 1708 --
NM_205848chr141874 648 283 175 --1873 --
NM_206853chr674067 3327 3264 3007 660 435 117 24160 2563 --1280
NM_206854chr6125328 4588 4525 4268 3701 1921 1696 1378 1104 670 363 111 25421 3824 1463 11541
NM_206886chr1----179 --
NM_207015chr362128 1762 846 561 199 166 ----1176
NM_207303chr10114148 4016 3516 2995 2583 1470 1441 1218 1159 436 349 24010 3373 11212 12743
NM_207306chr144432 3420 2901 1541 13427 24491 3494 --
NM_207372chr1011630 --1951 12301
NM_207387chr1721185 682 --11842 --
NM_207442chr141706 ------
NM_212558chr9103943 3703 2636 1669 1157 1021 947 808 668 92 1753 32710 477 176 --