TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-599
miRNA Sequence: GUUGUGUCAGUUUAUCAAAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000109chrX42312 1055 995 135 1494 ----
NM_000134chr431591 1458 1275 21188 33 ----
NM_000163chr522295 2123 ----1530
NM_000165chr641441 1312 664 279 21574 138 ----
NM_000176chr553197 2903 1307 1064 574 --12929 --
NM_000208chr1953507 3359 1789 1459 660 44634 4210 4091 2893 34299 3711 1140 --
NM_000216chrX93611 3443 3025 2770 1397 460 378 367 159 11313 ----
NM_000217chr1242019 1745 1703 1429 21439 846 24378 882 --
NM_000248chr352789 2713 1149 616 499 22813 30 12116 12073
NM_000267chr1723021 2794 --22538 441 12256
NM_000330chrX81859 1730 1720 1545 820 702 666 42 22072 335 11601 --
NM_000332chr677015 6845 6139 6068 299 219 81 36013 5592 5149 ----
NM_000333chr311001 ----1736
NM_000337chr544719 4223 617 353 65691 4980 2551 1199 756 89 12509 --
NM_000362chr2232222 1340 639 1426 22863 1035 21059 435
NM_000390chrX42557 2253 439 174 21368 1245 ----
NM_000430chr1741374 912 769 564 23522 151 13653 13298
NM_000484chr211147 1847 --1988
NM_000533chrX41812 1694 1398 50 31941 1874 1368 ----
NM_000555chrX66635 3098 2737 1565 1405 431 --35978 5396 4966 23069 1318
NM_000611chr1176682 6009 5203 4918 4435 1066 747 27099 7060 45954 5933 5569 4291 15282
NM_000618chr1254968 2581 1814 438 146 26197 1635 1999 35731 1086 640
NM_000719chr12116394 5863 5758 5348 5228 4640 4541 2664 1812 1498 1432 46714 5161 4798 4711 24731 4258 14872
NM_000726chr241149 897 299 266 21483 1008 ----
NM_000813chr5135534 5492 5427 5389 5173 4580 4304 4266 4256 2122 2026 821 215 51326 1031 1018 954 741 22244 1585 14107
NM_000814chr15113491 3412 3134 1346 1213 818 811 384 209 125 106 22600 90 24189 1442 --
NM_000826chr452480 2143 1991 330 199 12622 12125 --
NM_000868chrX62484 1895 1641 516 490 371 1908 ----
NM_000875chr15146967 6238 6205 5491 5228 5088 4790 4353 2241 1751 1430 748 699 688 66823 6387 6297 6217 5423 2328 1798 21634 994
NM_000891chr1772288 2241 973 964 602 210 134 23647 408 12794 --
NM_000899chr1233751 3353 2694 33214 1416 646 --21513 393
NM_000901chr432135 2032 775 41596 781 463 410 ----
NM_000933chr2041500 1331 640 252 21094 54 ----
NM_001001323chr1251985 1175 727 406 63 ----12006
NM_001001349chr1741675 1607 1496 390 1472 11724 --
NM_001001395chr1252312 1112 793 552 72 5672 558 502 320 31 184 --
NM_001001396chr123625 1679 1204 13048 24178 3192
NM_001001419chr574316 4129 3323 1694 1303 1176 123 23541 1421 --1593
NM_001001433chr2062728 2222 1104 906 390 238 22202 955 12994 --
NM_001001664chr244068 3778 1568 835 53657 3628 2814 1157 73 ----
NM_001001971chr1051397 1333 263 193 160 --189 --
NM_001003665chr143207 2748 2672 1191 33538 1006 736 33495 2209 69 --
NM_001003674chr1886874 5218 2622 2084 2033 1761 1611 1521 27071 1227 --1187
NM_001003712chr1253195 2759 1460 623 283 13071 1480 1427
NM_001004065chr963514 3247 2433 649 413 145 11065 13457 11184
NM_001004317chr663088 1613 1316 699 479 295 13253 ----
NM_001004360chr25662 634 558 364 160 --1613 11279
NM_001005463chr1062612 2410 2211 2114 1818 59 21809 1799 ----
NM_001007466chr664424 3524 767 644 525 450 14081 24753 3201 --
NM_001008541chr101361 22067 58 --12342
NM_001010846chr144306 4218 1812 59 23419 1634 24246 2894 12937
NM_001010888chrX74430 3115 1355 1060 452 251 64 34458 3130 30 ----
NM_001011666chr796159 6107 5981 5838 5216 5198 1477 1063 483 25319 1094 15273 11685
NM_001011708chr232290 314 30 42574 2267 2249 1940 1528 --
NM_001011885chr153244 203 27 1264 --21431 70
NM_001012393chr1164976 4597 3561 3326 1661 332 34005 1783 1115 34981 1698 393 --
NM_001013031chr1043523 2814 2684 2279 150 --2415 124
NM_001013399chr641067 887 238 174 182 ----
NM_001013659chr1993671 3482 2034 1798 1441 1000 990 925 804 95320 5087 4608 4362 3648 3363 1074 972 868 11748 1774
NM_001013699chr121501 ----1431
NM_001014797chr10178204 7762 7575 7563 6655 6495 6308 6302 6028 5969 5935 5121 2125 1928 1744 925 889 67796 7693 6337 5710 5505 2283 37850 6989 2307 12315
NM_001017440chr7127510 7042 6710 5979 5426 3151 3093 1773 1161 375 86 78 37363 6327 2854 12694 12617
NM_001017523chr1231707 1600 1350 3740 73 67 ----
NM_001017970chr1421848 1774 --21779 572 12162
NM_001023567chr1531530 680 76 42512 969 318 299 ----
NM_001024649chr552941 2078 367 230 78 12759 --11082
NM_001025076chr1096192 6037 5759 4937 4254 4063 4003 3849 2198 22355 874 15412 1435
NM_001025077chr1097550 7395 7117 6295 5612 5421 5361 5207 5076 52232 871 807 799 332 16770 11793
NM_001025108chr263689 3680 3267 348 337 205 23743 3404 --11580
NM_001025580chrX43818 3214 1638 858 63727 2949 2854 2723 2665 1402 13981 --
NM_001029863chr642988 2421 2322 1992 53254 2350 2127 493 226 --1322
NM_001029875chr541039 774 650 82 1584 ----
NM_001029884chr631064 281 143 ----22442 891
NM_001030006chr1722110 488 22713 2457 22014 154 1978
NM_001031732chr483465 3372 3124 3021 2422 1417 960 897 1970 --2842 37
NM_001031804chr1623326 358 43683 3486 2817 155 --13210
NM_001032280chr621673 646 2565 557 11614 --
NM_001033044chr141862 1849 1722 1509 2644 564 1265 --
NM_001033117chr374018 3610 1808 1523 1311 1303 461 23841 649 13751 --
NM_001033557chr221320 262 ----1196
NM_001033602chr1382069 1959 1843 1718 1004 819 553 427 21998 605 11984 --
NM_001037339chr141230 1146 605 257 21609 476 --21730 281
NM_001039538chr273194 2650 2545 2481 2383 1396 762 --11024 11437
NM_001039577chr184260 3756 3556 3234 3019 2924 2852 405 24020 670 14189 14540
NM_001039577chr184260 3756 3556 3234 3019 2924 2852 405 24020 670 14189 14540
NM_001039590chrX63088 2831 2823 2792 2538 1379 34034 3254 317 12979 --
NM_001039618chr1155614 3629 1597 1361 93 45182 4654 1545 737 21182 162 --
NM_001040152chr764394 1313 1264 643 522 105 34277 4153 3964 11937 11543
NM_001040429chr1393332 3023 1285 1017 949 826 687 585 572 33408 3095 421 ----
NM_001040450chr1552771 1873 666 402 173 11159 ----
NM_001040458chr551706 1515 1307 1167 687 --11852 11542
NM_001040712chr963457 3122 1062 965 612 369 2954 136 13580 --
NM_001042404chr121865 662 41655 1561 205 80 2493 485 11669
NM_001042413chr953847 3599 3009 2804 2520 23511 2780 21398 458 13462
NM_001042473chr1032054 1650 335 3883 245 169 1658 --
NM_001042494chr1541035 846 828 693 23049 1484 12566 --
NM_001042533chr343356 2657 517 170 1476 33346 2716 265 --
NM_001042599chr287448 7307 6077 2820 1313 803 126 33 66882 6227 5862 2250 1462 1435 15493 26385 2487
NM_001042601chr31299 32778 2557 2492 --12145
NM_001042681chr142573 2120 370 362 171 --22662 1665
NM_001106chr3118778 6598 6342 6133 5972 5888 3601 2219 692 447 238 27647 103 38044 2771 964 1372
NM_001149chr1031369 1353 268 41334 918 896 565 ----
NM_001186chr2132849 2745 2271 11170 --12207
NM_001204chr2107701 7313 7212 5935 5852 4918 2939 2549 1921 568 55628 4947 4751 4702 1699 1433 --
NM_001364chr1154633 1153 950 711 512 1142 --13428
NM_001412chrX23189 1362 1569 32989 707 432 13743
NM_001415chrX21808 256 12001 --1748
NM_001420chr1971279 1245 1089 899 868 839 827 82787 2480 2017 1975 1064 977 790 672 1850 22059 956
NM_001423chr1221836 283 1810 --12038
NM_001438chr132743 2606 2576 23217 707 12850 11231
NM_001455chr624950 1410 43743 1656 1185 579 2652 52 --
NM_001482chr152809 37 ----1167
NM_001491chr651874 1724 1710 1087 491 21961 324 ----
NM_001621chr753055 2267 1965 1905 765 52913 2515 640 414 285 ----
NM_001627chr33788 669 660 ----2716 83
NM_001650chr1833367 972 331 22618 767 --12654
NM_001655chr11--32172 1836 211 1118 1205
NM_001695chr863944 3626 3478 2770 1304 909 33648 704 332 1399 --
NM_001701chr921077 585 21387 1208 1599 --
NM_001759chr1264071 3893 3297 1485 1229 1118 11588 24572 664 --
NM_001769chr121410 1328 --1358
NM_001858chr674188 4130 3837 3594 3455 1835 1825 24537 3122 ----
NM_001859chr933579 3549 2906 23689 637 1517 13863
NM_002009chr1552632 2435 2125 1094 816 22597 206 ----
NM_002015chr1343074 2218 2078 350 23274 2849 13229 --
NM_002025chrX129128 7921 7233 7057 6387 5637 3694 3685 2767 2342 938 613 28232 6023 23160 398 18140
NM_002126chr1784008 3275 2898 2762 1644 1500 500 116 32772 695 72 --13976
NM_002214chr795538 5507 5108 4269 2180 1872 1598 851 757 25324 5128 22266 539 --
NM_002242chr241769 322 176 138 31648 1541 593 11813 1725
NM_002264chr374786 4722 1832 1478 1114 736 417 44703 4534 3878 1274 13638 14044
NM_002267chr131398 11825 11678 1535
NM_002270chr574730 4315 4280 2021 1528 1164 405 44572 1330 650 537 25661 3772 --
NM_002336chr1244608 3075 923 431 1276 ----
NM_002481chr177967 7434 7063 5786 5641 2574 1116 56985 6094 5855 2172 1752 ----
NM_002486chr911747 31965 1776 979 --2282 237
NM_002487chr151519 1796 2661 570 --
NM_002501chr1973961 3566 3370 2848 2732 479 418 22787 1630 ----
NM_002522chr1773961 3574 3523 3114 2945 523 136 1162 12676 --
NM_002581chr995520 5471 5303 3888 3694 2022 914 552 286 34076 3675 366 --35270 4401 3669
NM_002655chr864825 4232 4144 1511 719 530 34112 633 118 --14328
NM_002709chr253273 2473 2431 2314 45 --13374 11379
NM_002710chr122833 692 ----2431 366
NM_002737chr1776413 5141 4505 4204 2224 1941 1861 25339 1922 11346 --
NM_002753chr43573 227 203 1217 1656 1709
NM_002825chr72433 114 124 --1575
NM_002834chr1253503 3044 2871 2793 2745 --33271 1565 78 --
NM_002869chr1162217 1923 1664 712 259 172 12251 ----
NM_002977chr273447 2240 2125 1316 1249 1073 1047 43481 2921 1125 240 ----
NM_003043chr384167 3967 3628 3333 1585 1274 1076 890 21680 665 13531 --
NM_003051chr111415 11271 1631 11487
NM_003071chr331682 1334 451 21594 580 1145 --
NM_003108chr266357 5419 5371 1401 924 509 15883 15923 1182
NM_003112chr753161 2712 2302 1115 256 23127 177 1664 --
NM_003153chr1241156 840 434 255 1780 ----
NM_003205chr1542368 2315 1924 279 11526 --193
NM_003221chr693912 2988 1577 1054 926 417 328 222 126 24199 41 11421 --
NM_003238chr1192 ----1197
NM_003253chr2141817 1377 719 372 1425 --1729
NM_003257chr1541315 1197 1123 953 11023 11263 --
NM_003298chr365677 5076 3931 2247 1852 980 22172 59 1187 --
NM_003337chr541429 1161 1094 415 11116 1636 11680
NM_003339chr531366 1330 135 21596 1223 --11216
NM_003369chr1142800 2159 1981 1034 ----192
NM_003410chrX62633 2616 2567 1168 923 85 12940 12853 --
NM_003412chr342972 2199 850 62 1106 1842 --
NM_003483chr1252915 2906 2684 247 166 11993 21156 256 --
NM_003489chr2143302 3266 3184 385 13172 12499 --
NM_003506chr811084 21306 171 11071 11233
NM_003574chr1875468 4981 4915 2240 1605 1304 167 55781 4310 3511 2106 580 13828 --
NM_003774chr1242706 1324 868 617 23263 285 ----
NM_003800chr652117 2071 865 748 111 1901 ----
NM_003913chr632761 1618 839 42872 269 231 39 ----
NM_003955chr174629 79 65 43 11331 173 --
NM_003966chr5127161 6482 5940 5565 5492 5423 4991 3054 1542 1487 1444 102 36904 6762 1128 46457 4820 1762 691 15528
NM_004050chr1462050 464 388 338 286 223 12582 1885 1188
NM_004061chr52221 25 2106 65 --1473
NM_004064chr1251151 1077 832 149 42 1287 ----
NM_004113chr371880 1733 1574 1433 1373 481 114 21519 220 ----
NM_004124chr1411234 --23489 2533 164
NM_004227chr732459 669 372 --1631 21152 960
NM_004279chr731543 648 288 11652 --1609
NM_004397chr1153950 2628 1136 342 49 23284 1602 1501 --
NM_004459chr172594 32 21671 26 ----
NM_004464chr422835 349 21572 1566 2491 91 21312 231
NM_004501chr173984 3562 2927 1462 1393 1221 26 53880 3312 3113 3107 2785 ----
NM_004586chrX21426 49 11609 --12008
NM_004598chr543272 2778 2688 965 22640 35 123 11207
NM_004654chrY41340 327 319 176 2885 425 11150 --
NM_004745chr8116053 5705 5404 5386 4935 4915 4598 4588 4451 2591 566 22257 975 21336 138 --
NM_004776chr2032058 1245 88 22303 162 13046 1582
NM_004801chr21363 61249 1037 369 357 345 100 2339 59 --
NM_004834chr243343 2955 2923 2314 33279 2470 1299 41231 1100 580 406 --
NM_004852chr181913185 13122 13040 12622 12001 10375 9168 8931 5666 5622 4716 3721 1818 1269 926 916 775 576 123 414182 13464 9393 4336 511504 9467 5122 454 25 111221
NM_004869chr18--1287 --11751
NM_004956chr744279 1400 348 57 64078 2934 1822 1724 899 123 1672 1752
NM_004999chr673587 3400 1763 1422 1039 669 364 24497 3954 11173 13414
NM_005065chr1475334 5283 4421 4411 3647 1282 556 34954 4497 954 1116 1885
NM_005156chr954253 3869 2050 345 60 23884 388 11077 --
NM_005259chr22965 196 1614 1540 11054
NM_005359chr1855578 4757 4447 1705 56 11314 32071 1257 787 --
NM_005458chr962022 1601 875 742 690 568 22363 2040 ----
NM_005502chr942655 2312 464 288 12643 1959 --
NM_005530chr152405 336 1441 2472 432 --
NM_005596chr9146117 6110 5958 5357 5038 4467 2271 2249 2182 1541 1396 1075 129 74 31913 768 200 --1299
NM_005604chr622583 429 62569 1685 1583 806 519 398 ----
NM_005665chr154199 4002 1708 1029 461 2917 885 13908 --
NM_005668chr554408 4018 1306 1154 369 1659 13712 --
NM_005759chr2----11256 2811 104
NM_005779chr563176 2828 2424 1376 674 507 32998 2274 163 ----
NM_005786chr1821248 268 11167 --2499 308
NM_005853chr162553 397 1173 --1151
NM_005909chr544003 2970 1337 789 34316 1614 362 23309 718 13037
NM_005941chr8114217 4152 4101 4031 3537 3451 3398 2761 2632 2589 785 23632 1185 ----
NM_006037chr294882 3963 3603 2988 1051 360 255 247 181 1392 1354 23791 3454
NM_006108chr1141733 1718 1493 1458 1945 ----
NM_006154chr1562810 2551 2178 2025 276 199 12381 12858 --
NM_006186chr251182 1045 880 427 261 1421 1843 --
NM_006206chr432747 1032 729 12881 22610 321 --
NM_006252chr197225 6411 5504 5127 4833 2714 2473 2314 127 57542 5489 4608 1278 751 --14640
NM_006256chr142072 2004 1874 520 22328 430 ----
NM_006313chr1241394 1301 1264 169 --1566 --
NM_006330chr82491 475 21551 136 --11187
NM_006390chr1211285 21625 450 1444 --
NM_006420chr2053296 3015 2759 1263 66 21394 725 ----
NM_006439chr4154 1199 --291 32
NM_006544chr1425781 4005 14565 35935 1127 106 --
NM_006546chr1755274 4766 4653 4233 666 --1735 14546
NM_006547chr762125 1771 1549 1340 584 102 --1776 --
NM_006595chr1141934 796 732 22 1802 11553 1667
NM_006599chr16137049 6747 6535 6512 6271 5598 3196 3077 2641 1663 1415 605 479 47689 5085 2747 592 ----
NM_006614chr353306 3183 1045 920 260 63059 2967 2935 2705 2295 238 ----
NM_006626chr952714 678 175 129 49 --11974 --
NM_006628chr1594129 3779 3211 2953 1262 809 741 465 214 1824 ----
NM_006633chr51535 ----1194
NM_006717chr963325 3281 2497 1009 870 609 2443 171 2521 448 161
NM_006729chrX55411 3769 3455 1757 195 35128 1722 771 --25396 2026
NM_006775chr621222 942 ----12858
NM_006813chr65339 314 283 103 32 1137 ----
NM_006826chr241160 812 386 242 1996 ----
NM_006852chr1752809 2737 1950 1795 1101 2470 39 ----
NM_006873chr253026 1264 871 839 702 12938 --1423
NM_006885chr1654256 3740 3622 3541 1560 3768 43 23 ----
NM_006939chr142828 77 2382 165 ----
NM_007011chr15106203 6052 5152 4950 4944 4910 4821 4512 2360 1411 25242 2262 1458 --
NM_007035chr122325 312 --184 1221
NM_007106chr1351051 730 569 439 355 12494 ----
NM_007124chr62434 373 11418 --11410
NM_007214chr621207 338 --1487 1982
NM_007249chr13129252 8194 7867 7491 5982 3684 3643 2714 2302 903 755 146 56045 5725 3446 2287 93 12974 1227
NM_012104chr1153844 2376 1268 1196 654 1570 --180
NM_012234chr383007 2907 2836 2328 905 564 547 297 12940 --11395
NM_012259chr631127 447 362 --11270 1136
NM_012281chr742108 442 320 242 2307 132 1944 --
NM_012287chr343081 2967 1060 516 34229 4084 4029 ----
NM_012288chr685051 4433 3807 2091 1364 1155 761 597 34814 3848 1484 13839 --
NM_012290chr241538 453 420 117 1256 11145 --
NM_012297chr411720 3622 439 377 193 11904
NM_012382chr532947 2814 61 21053 548 12983 --
NM_012464chr452659 1798 1054 450 54 62369 2280 1816 606 98 26 --2372 85
NM_013231chr1473492 1622 1322 1250 998 327 76 64105 4025 3759 3421 105 70 ----
NM_013372chr1542850 2246 742 205 33077 3041 878 ----
NM_013436chr2--1793 --1722
NM_013447chr1983767 3207 3081 1520 1145 859 528 265 12486 --13566
NM_013450chr231023 98 91 178 11265 --
NM_013943chr143075 2780 1089 899 33131 2254 961 --22986 2409
NM_014021chr143149 2563 547 503 12200 ----
NM_014106chr1521845 165 32507 2406 1964 ----
NM_014112chr843727 3524 1534 883 --14170 1931
NM_014141chr794894 3398 3359 1969 1785 1727 1196 668 112 55222 4671 4664 1406 236 43265 1057 1024 659 --
NM_014155chr1177063 2710 2012 1657 1588 696 473 37459 6576 2926 11208 26467 2936
NM_014240chr363652 3186 2740 1273 1070 457 33800 3024 1166 23559 1571 --
NM_014372chr142061 1851 1519 462 41767 1513 468 106 ----
NM_014393chr841783 1761 796 384 21537 133 1481 --
NM_014572chr1331719 1368 491 11357 11808 1393
NM_014636chr973864 3812 3724 3612 2793 131 81 23307 1304 21160 547 --
NM_014637chr831087 961 490 2967 292 --1382
NM_014674chr353738 1371 1351 269 227 13835 ----
NM_014705chr731957 412 152 11518 1331 1836
NM_014877chr1796454 4836 2931 2764 2568 2099 1994 1780 1183 15140 37256 6770 542 --
NM_014932chr361923 1239 559 371 363 273 41949 1650 461 171 ----
NM_014962chr2032883 2676 2506 22812 984 ----
NM_014991chr463237 2962 2470 1257 977 203 32489 1268 806 12299 --
NM_015027chr1631947 719 315 ----22028 131
NM_015032chr1322927 1958 32961 2006 99 --1241
NM_015035chr2044667 2327 2092 1523 46732 6177 5392 1101 16329 2512 303
NM_015076chr643755 3552 1610 439 34152 3453 946 ----
NM_015090chr166105 4750 4155 1893 1721 321 35951 5576 4379 14293 --
NM_015092chr1684713 4195 3851 3677 1519 1491 1318 591 53735 3251 1637 1480 826 ----
NM_015097chr352204 2074 1858 1621 540 ----1243
NM_015144chr1633756 3121 1038 43686 2853 2529 62 32745 634 45 --
NM_015192chr2022643 2137 22214 972 ----
NM_015215chr132968 2355 2315 2516 132 --12051
NM_015265chr252491 1911 982 764 184 11778 32006 802 778 --
NM_015267chr1231936 800 27 22135 1705 1578 --
NM_015288chr553522 3117 3030 2745 516 13649 --23405 347
NM_015317chr262395 1950 1936 645 410 76 22210 728 ----
NM_015345chr652510 2143 1729 327 21 --22746 1828 12195
NM_015347chr1292599 2583 2569 2236 1197 865 562 445 367 12392 12311 1133
NM_015458chr854928 3545 1539 778 702 34787 4029 507 ----
NM_015508chr341585 1095 999 166 21275 1059 ----
NM_015525chr621055 32 ----1911
NM_015554chr1582815 2604 677 650 613 438 209 78 32889 2545 43 12598 --
NM_015564chr5103412 3398 3109 2829 2301 2282 1408 1297 659 272 ------
NM_015723chr71568 ----1553
NM_015912chr862142 1656 866 684 650 405 12383 ----
NM_016083chr673771 3240 2927 2569 1327 763 279 ------
NM_016206chr3148808 8404 7542 6668 6637 5759 3235 2634 2484 2431 1868 1340 920 372 78547 7064 3577 2039 1618 1193 413 15924 196
NM_016231chr1721674 1136 31105 387 381 ----
NM_016257chr142921 2723 2654 562 23402 696 32874 2276 1269 12960
NM_016315chr241790 1692 524 260 1269 ----
NM_016322chr933005 556 147 23103 808 1821 --
NM_016570chr12--1100 --144
NM_017420chr1473454 2579 2430 1466 1343 389 122 63694 3616 2798 2496 1150 442 --169
NM_017519chr631180 1161 514 1976 ----
NM_017551chr1031886 1652 63 52414 1744 220 113 80 ----
NM_017594chr993325 3148 3128 3094 2845 2826 2404 848 517 13188 ----
NM_017599chr1221785 1579 1798 2499 246 11823
NM_017628chr494712 4693 4536 4286 4199 4009 3733 1751 539 24069 4003 ----
NM_017633chr642845 2487 1086 918 12609 2633 289 --
NM_017637chr9118874 8666 7479 7190 6313 1906 1580 1043 1026 1004 325 31169 986 805 --36070 1246 956
NM_017666chrX32022 680 448 188 1503 11950
NM_017704chr114730 641 363 262 --1299 --
NM_017813chr875110 4763 1205 613 470 317 244 25559 4585 15782 11563
NM_017824chr1051812 1743 1730 956 649 --1425 --
NM_017902chr1032168 1464 747 1691 34865 2082 708 --
NM_017944chr1152957 2827 1980 1238 1217 32227 1958 1228 --12140
NM_018027chr1042708 1150 801 184 32638 2627 723 --1968
NM_018092chr161471 21399 1132 11315 --
NM_018121chr1022169 1948 12564 --22733 471
NM_018157chr1241303 1210 1013 547 12317 --12944
NM_018243chr483644 3404 3351 3155 3117 2518 1507 440 33483 2698 1003 --14071
NM_018293chr331174 1163 1155 22248 1143 ----
NM_018364chr154017 2676 1369 1123 419 1161 --12498
NM_018374chr795076 3567 3194 1774 1485 821 485 349 331 24250 3352 25235 4559 --
NM_018416chr1232255 898 105 11980 11858 12354
NM_018509chr1721576 1567 21169 527 174 11363
NM_018566chr153900 3763 3484 1452 1336 24840 4010 23645 99 --
NM_018650chr1134 42140 906 823 546 --1611
NM_019022chr183968 951 348 1207 --13199
NM_019035chr451845 1480 409 313 161 22110 1917 ----
NM_019072chr552665 1081 768 759 204 12767 --33104 2970 31
NM_019083chr161431 1334 528 473 307 292 1606 ----
NM_019106chr2221173 1048 32910 908 406 13219 --
NM_019117chrX62883 2483 1214 1157 732 723 23095 2834 --1765
NM_019891chr11989 1934 11250 134
NM_020122chr295922 5441 5308 4233 1800 1623 697 499 432 32019 562 460 25643 4958 12260
NM_020144chr721835 1772 31390 569 82 --11886
NM_020336chr2052851 2736 544 278 51 --2797 199 --
NM_020340chr62912 387 12162 1772 31445 727 202
NM_020346chr1121152 314 51580 1171 1145 409 61 --1609
NM_020403chr1341147 1128 708 146 ------
NM_020466chr654887 4709 4357 3543 1059 33040 423 77 23355 259 13509
NM_020640chr381639 1581 889 844 798 339 144 48 12147 ----
NM_020673chr20107428 7107 6851 6663 6495 6374 2909 2758 2720 1155 46963 6786 3034 2969 ----
NM_020699chr135182 4058 1201 24345 475 14890 11069
NM_020718chr1626612 5244 26286 4011 26200 5933 --
NM_020752chr1031173 834 382 --21119 598 1340
NM_020768chr593206 1115 1056 1002 574 548 542 118 90 13266 12863 --
NM_020772chr17115838 5656 3466 2871 2383 2174 2101 1791 1387 827 442 57960 6819 3257 1432 135 38047 1412 64 --
NM_020776chr1842557 544 422 364 --32659 976 711 12460
NM_020791chr1721384 1033 11046 11123 --
NM_020800chr321099 563 21237 163 ----
NM_020801chr561002 960 682 443 231 84 21831 966 12386 --
NM_020925chr131026 409 179 1292 11374 1421
NM_020940chr1042727 1132 503 219 --1246 12666
NM_020951chr1942280 2171 821 779 --2554 417 --
NM_021033chr1323389 1334 52867 2833 2725 1403 1125 ----
NM_021038chr332587 2550 848 2854 111 11003 --
NM_021097chr233015 1084 1005 22292 50 11192 12970
NM_021205chr132768 690 423 42150 1029 960 702 1954 --
NM_021229chr1241149 1036 838 22 21137 50 --1928
NM_021252chr1031489 1296 103 1218 --1313
NM_021255chr1454085 2607 2515 1107 525 13733 ----
NM_021629chr3105044 4730 4395 4269 4003 3107 1864 671 407 363 33313 1841 1133 ----
NM_021813chr655859 4980 4801 4387 1526 25539 4536 25225 1517 15151
NM_021961chr1187412 5444 2348 1639 1328 1137 851 107 75320 2300 2177 1222 484 422 392 24843 442 --
NM_021964chr386517 5125 2345 2171 2004 842 684 295 36108 4365 854 --15349
NM_021998chrX31511 1252 346 ----1322
NM_022048chr1534885 4869 4855 46099 2529 2181 2024 22198 619 --
NM_022343chr93956 152 138 2486 480 --1459
NM_022351chr843862 2398 1107 782 21555 899 12819 --
NM_022497chr333097 2456 401 23402 3304 12747 --
NM_022552chr2167 21298 61 --134
NM_022817chr242091 1724 611 98 11898 ----
NM_022841chr1542607 2016 786 42 21058 737 11704 --
NM_022898chr1444405 4090 1820 753 43278 2945 1080 945 11932 1997
NM_022912chr263069 2849 2086 769 655 454 11088 22574 2539 12482
NM_022918chr1121967 727 22077 67 1849 --
NM_024007chr583055 2574 2506 1978 1093 893 841 341 22235 2076 168 --
NM_024052chr1732267 1016 843 --1521 13032
NM_024090chr42420 411 31678 1670 122 31560 485 71 --
NM_024665chr364635 3308 1569 902 840 720 34243 2995 1153 1871 --
NM_024721chr852696 2374 2111 1789 431 1571 --12203
NM_024817chr1595771 5078 4534 4284 3946 3836 1127 457 177 24985 3909 25884 4238 23641 542
NM_024939chr1631175 1130 1109 31635 1541 1091 ----
NM_024949chr423538 3188 51632 1263 686 661 243 24331 1649 21994 752
NM_025009chr431804 1694 625 21426 680 --21368 114
NM_025134chr1652300 2153 1876 913 785 2320 214 ----
NM_025160chr174092 1428 1194 1133 847 773 665 11208 11071 --
NM_025179chr174768 4730 4018 3562 3101 1089 622 1717 34936 4326 4086 --
NM_025235chr1071741 1380 904 715 384 366 344 11560 ----
NM_030621chr1473490 3429 3044 1224 1085 1020 219 11114 ----
NM_030759chr102645 496 ----1260
NM_030762chr12----21840 1311 11887
NM_030918chr144462 3759 2184 1183 25347 1218 15352 13539
NM_030938chr172933 157 1324 1301 11041
NM_031442chrX52698 2484 2460 534 214 2982 192 --12745
NM_031483chr2053078 3043 1230 383 233 13124 --12491
NM_032153chr352114 833 670 641 254 22511 91 1216 --
NM_032172chr73830 704 690 --1779 --
NM_032217chr42955 401 21240 1056 21284 261 --
NM_032289chr531346 666 61 11940 --1636
NM_032373chr1095432 4701 3897 3580 1433 970 640 588 97 65572 4561 4016 2258 1581 1197 14153 --
NM_032439chr1071469 1308 1270 1247 537 327 289 11669 ----
NM_032440chr1042179 1876 1832 267 32468 853 454 1567 --
NM_032457chr473800 3128 3086 2786 730 469 357 23382 2937 --12528
NM_032499chr1511586 11617 21212 215 11406
NM_032505chr352765 2414 2102 2058 2004 1438 12378 164
NM_032804chr1032552 2068 592 31715 1615 324 11761 --
NM_032968chrX32778 1586 1226 43942 3394 1652 1272 22771 61 1715
NM_032973chrY42773 1585 1226 538 43934 3389 1646 1272 22766 61 1715
NM_033211chr522044 207 1130 --1701
NM_033224chr731789 863 138 33033 1879 1826 26425 839 16535
NM_033261chr106595 495 472 446 73 54 ------
NM_033427chr72839 775 147 --170
NM_033505chr245655 4850 1851 134 25136 1126 --11607
NM_052879chr1244022 3611 2813 1607 --13345 --
NM_052900chr841547 1526 1202 132 147 1570 --
NM_052904chr641243 887 540 316 --1347 11054
NM_052937chr82703 528 22650 146 --1866
NM_080836chr2054678 4157 3256 1141 892 --2522 279 14538
NM_080872chr842659 936 833 769 12816 33919 3277 595 --
NM_133493chr634457 3330 3248 --21699 863 --
NM_138285chr21187 --1147 1380
NM_138426chr732458 2072 439 1900 ----
NM_138473chr1254695 897 647 561 27 23180 1872 23512 143 14677
NM_138782chr552266 1790 1722 801 111 22396 354 --1432
NM_139207chr124833 568 237 54 22093 204 ----
NM_139321chr2063125 3085 2618 850 783 46 44237 4192 3885 770 13631 --
NM_144571chr446775 5865 1596 1334 15167 15043 --
NM_144664chr111296 1413 12292 11720
NM_144778chr1332107 615 601 ----1261
NM_144979chr4------2579 493
NM_145011chr1051800 698 421 301 62 11864 11493 --
NM_145176chr683052 2976 2692 2441 1083 955 471 383 53532 3348 3003 1236 452 22833 995 --
NM_152381chr211421 --1141 21185 675
NM_152409chr532185 489 83 12191 13334 11330
NM_152470chr1854123 3243 2833 2803 1568 24023 3754 11244 11559
NM_152636chr1132656 1988 385 23078 2899 22611 2486 --
NM_152680chr431684 1549 530 --2594 117 186
NM_152695chrX41500 599 500 222 2292 31 ----
NM_153184chr331986 1688 628 21957 533 1428 --
NM_153262chr142615 2443 2264 368 12449 12649 1166
NM_153343chr452319 1555 1492 779 103 31520 374 156 12242 1184
NM_153367chr1043226 3020 902 660 --1851 12536
NM_153607chr542819 2259 2116 455 42959 1109 561 349 ----
NM_153686chr4--42445 2013 1699 295 32456 2265 601 --
NM_153712chr233244 2921 1103 23050 243 12970 33518 3091 2427
NM_170710chr462054 840 799 565 375 294 33103 2280 978 ----
NM_172240chr12192 ----1979
NM_173468chr425324 3875 34899 4518 589 11659 15195
NM_173491chr52513 226 11313 --11166
NM_173495chrX52232 2071 2046 1654 229 11036 12372 --
NM_173519chr871658 1579 675 354 316 90 72 --21739 109 --
NM_173531chr1943072 1524 778 484 43793 2704 216 49 22837 132 --
NM_173631chr19--1535 --21356 964
NM_173683chr82611 277 61463 1195 617 441 213 96 --11802
NM_173808chr133031 623 386 14259 34171 3418 1672 11024
NM_173829chr566147 5541 4628 4330 4066 1339 46181 4094 3984 831 32088 1850 973 26051 433
NM_175736chr1287220 7072 6800 5184 4891 2613 1734 297 31596 1054 842 16607 11531
NM_175921chr554200 3098 2950 2931 332 23522 2698 ----
NM_177538chr268018 6839 5771 1351 1208 948 107876 7160 5684 2815 1974 1628 1327 923 645 509 ----
NM_177968chr251725 1679 1665 376 78 12022 ----
NM_178011chr1043035 2996 2316 903 32956 2260 105 ----
NM_178423chr731076 387 101 1119 --1132
NM_178566chr93428 299 179 21761 549 11786 --
NM_178815chr1012158 2155 107 --11796
NM_181077chr1531528 680 76 31937 318 299 ----
NM_181504chr583566 3119 2949 2798 2586 716 481 270 23111 276 ----
NM_181705chr5135251 5194 4914 4869 4270 3590 3503 1989 1813 1767 1192 1004 179 55078 4150 3941 3521 1561 --14300
NM_182485chr453411 1106 694 663 312 22318 479 ----
NM_182691chr741217 1150 982 966 ----11199
NM_182765chr1072207 1911 652 561 455 420 385 31745 880 188 ----
NM_182830chr1452276 2165 1905 1707 713 2353 204 ----
NM_194247chr273699 3283 3144 3063 2973 2840 1049 11366 11096 --
NM_194286chr1235687 2376 1112 14965 16128 2757 255
NM_194314chr154291 3768 1744 836 550 85313 5034 4967 2216 1960 1370 730 471 ----
NM_198076chr11729 31860 1430 53 --11241
NM_198270chrX32970 1316 247 2880 553 --21012 278
NM_198281chr462842 2713 2136 1331 780 359 33477 2117 472 ----
NM_198503chr111826 3644 534 239 12186 1365
NM_198715chr155469 1971 1840 1628 1082 76339 6209 6078 5646 1171 1048 180 14112 11689
NM_198859chr354440 4271 3485 661 219 1588 13530 --
NM_198947chr113751 727 160 11022 --1901
NM_199000chr741845 1535 1524 657 ------
NM_199131chr1063087 2633 2617 2520 731 527 22506 1211 23129 2847 --
NM_199320chr422609 1945 42279 2264 348 107 ----
NM_203349chr1531784 1389 291 1101 22088 1615 21982 61
NM_206853chr683415 3273 3061 2915 2741 929 593 180 23044 1078 1529 --
NM_207406chr466559 2620 2590 2406 912 482 35511 1483 1430 1782 --
NM_207517chr1551805 1650 1340 649 377 2801 624 ----
NM_212554chr1041419 1227 197 140 31364 1235 130 --1160
NM_212558chr953144 2798 968 265 173 12689 1512 --
NM_213589chr231399 905 161 23650 1186 15151 --