TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-600
miRNA Sequence: ACUUACAGACAAGAGCCUUGCUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX126980 6784 6293 6278 5076 4382 1575 1429 1202 1051 890 507 26845 4511 15568 1371
NM_000090chr23904 825 607 ------
NM_000110chr13362 149 26 ------
NM_000112chr5114927 4473 3865 3453 2146 1611 1312 766 656 384 274 15517 ----
NM_000115chr1372526 2422 1042 937 846 498 397 ------
NM_000138chr15112642 2489 2416 2372 2306 2276 670 661 600 459 364 ------
NM_000210chr242321 2054 1769 1447 --181 --
NM_000217chr12105008 4909 4708 4535 3835 3375 1939 1683 1586 862 --1632 11799
NM_000248chr372942 2603 2553 1115 563 349 239 1979 ----
NM_000252chrX81525 1403 1394 1354 1276 1209 1160 71 ------
NM_000259chr15125789 5552 5470 4930 4837 4192 2497 2071 1201 1066 942 663 14984 34861 2352 1590 --
NM_000280chr113967 675 263 ------
NM_000332chr676907 6476 5602 5233 4422 1818 1255 17011 167 --
NM_000378chr1121236 868 ----1286
NM_000430chr1762771 2599 1108 715 648 188 22344 636 21129 474 --
NM_000461chr384602 4512 3778 3527 3004 1654 1576 205 14180 ----
NM_000495chrX21163 454 1947 ----
NM_000522chr751274 1203 1179 396 310 1832 ----
NM_000555chrX207743 7734 7639 7028 6841 6827 6807 6590 6427 5702 5413 2562 1853 1792 1746 1540 1436 348 168 144 --17751 1890
NM_000586chr41101 ------
NM_000719chr12126516 6495 6284 6123 5855 5711 5473 5444 5299 4983 1439 831 16637 12056 26660 1963
NM_000724chr1072018 1882 776 721 568 187 115 --11272 11660
NM_000814chr1584094 3744 3680 3504 2620 2569 1508 731 12741 ----
NM_000826chr442602 1737 745 308 12150 ----
NM_000829chr1162325 2206 745 688 486 341 --12245 12143
NM_000901chr451996 1867 1009 895 765 --12550 --
NM_000910chr421675 1400 11638 --11831
NM_000934chr171684 ------
NM_000944chr432030 1481 907 ----11701
NM_000945chr25790 618 603 171 115 ----11534
NM_000958chr521266 1156 ----1489
NM_001001323chr12113169 3077 3041 2899 2771 2699 2666 2219 2175 323 292 ------
NM_001001323chr12113169 3077 3041 2899 2771 2699 2666 2219 2175 323 292 ------
NM_001001323chr12113169 3077 3041 2899 2771 2699 2666 2219 2175 323 292 ------
NM_001001419chr564952 3615 1320 1270 544 208 34151 987 661 25050 79 --
NM_001001668chr1984180 3926 3365 1300 1232 719 584 483 1879 1154 24286 1615
NM_001001890chr2164274 3699 1597 1276 353 327 --23628 157 --
NM_001001928chr22107156 6666 6350 6079 2170 1932 1481 956 747 614 23121 1850 1134 18297
NM_001001933chr14567 451 391 190 ------
NM_001003652chr18218573 8371 8343 8266 7997 7900 7557 6900 6794 6697 6263 3367 2718 2497 2474 2381 2298 2241 1406 1149 532 16504 --12424
NM_001003674chr18146967 6810 5682 5598 5475 5297 5140 5060 4984 2765 1963 1891 1643 664 14657 26403 2572 --
NM_001003688chr43231 218 118 ----1873
NM_001003712chr1284037 3957 3882 3446 2752 1572 1420 1048 1240 ----
NM_001004317chr693618 3213 1810 1570 881 873 855 770 124 44063 3453 1772 236 13299 14019
NM_001005366chr124860 829 807 783 ------
NM_001005474chr331396 358 99 ------
NM_001005910chr31162 ------
NM_001007097chr995003 4922 4904 4360 3400 1851 1586 187 64 14798 32036 1019 181 --
NM_001007237chr142886 2700 339 61 22844 2326 1955 22528 1966
NM_001007466chr684741 4414 4352 3828 3716 1604 1407 1094 15186 ----
NM_001008408chr7125164 5132 4997 4919 4689 4517 4081 1525 1123 872 740 558 11627 25313 1093 15859
NM_001008495chr842003 1685 369 175 ------
NM_001008564chr1342174 1966 1440 533 1229 ----
NM_001008710chr821310 443 1244 --11150
NM_001008738chr522375 1162 11133 ----
NM_001008800chr11185 ------
NM_001009569chr1061580 1432 1363 1268 196 30 ------
NM_001009899chr3186489 6357 6304 6260 5999 5882 5696 5600 5538 5419 5208 4810 4730 1747 1189 953 366 140 24061 4012 26156 4928 --
NM_001010888chrX94638 4535 4436 4385 4240 3403 3213 2891 692 1347 23947 145 13586
NM_001010927chr63471 207 143 1461 ----
NM_001010986chrX62278 2176 1725 1011 664 148 --1174 --
NM_001011666chr776344 6308 5211 5011 1603 951 38 --14273 14116
NM_001012423chr1582931 2854 2742 2437 2100 507 244 153 ----12468
NM_001013620chr1298402 8057 7509 7274 6950 5143 2772 1065 24 48313 6622 5927 158 26392 1605 --
NM_001015877chrX62962 2796 2334 2134 1031 95 ----1886
NM_001017395chr363566 3327 2602 2437 1001 442 13494 ----
NM_001018053chr161973 1876 1804 1613 1474 319 ------
NM_001018067chr1104505 4294 3896 3770 3742 3612 2095 1210 1123 931 ------
NM_001020658chr181637 1577 1507 1458 1393 1118 1111 173 ------
NM_001024455chrX22097 934 ----12504
NM_001024948chr173218 2694 2592 2562 2536 137 126 ------
NM_001025076chr1095782 5606 5542 3884 1363 932 796 770 514 21306 1137 ----
NM_001025077chr10127140 6964 6900 5242 2721 2290 2154 2128 1872 1086 846 833 32664 2495 1261 --24688 4582
NM_001025079chr373956 3942 3123 1494 1113 887 182 ----13544
NM_001025580chrX83996 3840 3595 3199 2671 1661 1323 942 23288 1714 14248 --
NM_001025780chr971446 642 533 448 387 291 226 ------
NM_001030007chr1673814 3772 2607 1141 792 738 666 ----12808
NM_001032288chr2051079 1040 610 319 157 --11546 --
NM_001032293chr172566 426 ------
NM_001032380chr1051936 1854 1718 1312 437 ------
NM_001032394chr642554 2285 602 385 --12774 --
NM_001033057chr392096 2071 2010 1537 1392 629 493 441 289 --11626 11465
NM_001033578chr852200 1985 1697 619 387 --12229 --
NM_001034850chr52636 372 --197 --
NM_001037339chr131670 718 412 ------
NM_001037535chrX41322 1185 1050 978 ------
NM_001037639chr31208 ------
NM_001039590chrX103707 3554 3386 3368 3034 2632 2551 646 519 202 13857 ----
NM_001039618chr11105861 5790 5469 5144 4957 4334 1680 1603 1529 253 11270 ----
NM_001039840chrX155078 4964 4379 4079 4020 3930 2410 1912 1405 1393 1113 775 756 558 384 --13911 --
NM_001039937chr1373855 3214 1653 665 452 375 188 ------
NM_001040100chr311290 ------
NM_001040284chr16104871 4435 4075 3627 1485 1379 1147 794 589 537 --15635 --
NM_001040402chr483127 3071 2983 2697 2053 1958 334 246 --12904 --
NM_001040429chr1343495 2713 2689 1142 41074 987 648 340 ----
NM_001040441chr1105166 5030 4612 4477 3475 3468 3322 1789 1656 1100 24433 380 ----
NM_001040712chr993435 2858 2205 1323 1026 686 673 658 517 ----13080
NM_001040875chr872524 2080 879 736 571 374 55 ----22466 676
NM_001042599chr2127349 7252 7041 6688 6596 5965 5797 5130 2929 1504 1096 277 46454 5229 2861 2437 16257 12153
NM_001042601chr33550 386 322 --12434 22340 176
NM_001042683chr621778 57 ----11849
NM_001099678chr3126438 6185 6175 5878 5849 5716 5502 5467 5221 4893 1951 774 12427 ----
NM_001100108chr1168259 8204 7805 7407 6207 6075 5814 5569 5435 5275 5184 3113 2371 2306 771 526 15314 --16662
NM_001106chr3219110 9017 8898 8699 8457 8449 8014 7790 7775 7674 7333 6323 6036 3596 2124 2034 1642 1539 1482 972 366 49198 6353 6197 2704 37250 3423 1663 --
NM_001167chrX116753 6169 6036 5334 4176 1734 1384 1286 1142 888 308 ------
NM_001198chr642043 1985 1570 437 ----21712 65
NM_001204chr2187760 7652 7552 7225 7163 6908 6510 6032 4980 4847 3006 2859 2542 2315 1863 1384 916 546 22922 2170 11207 --
NM_001206chr943083 2990 2184 933 --12730 13000
NM_001218chr1572723 2658 2283 1005 805 246 101 42695 2410 1970 256 11022 --
NM_001238chr191483 ------
NM_001241chr2102414 2221 2149 1821 1682 1661 639 435 309 222 --1816 --
NM_001259chr7105396 5188 4644 4441 4081 2344 1587 758 486 461 1451 1821 --
NM_001304chr1793800 3778 3649 3051 2480 1348 1044 821 144 --1623 --
NM_001315chr672246 2048 2001 754 595 543 391 11520 140 --
NM_001390chr1863483 3229 3047 893 661 318 --22612 682 13392
NM_001396chr2142566 2488 2147 992 12536 1529 --
NM_001412chrX63092 2539 2425 925 856 638 23357 737 ----
NM_001420chr1923012 605 --12161 --
NM_001494chr10293 78 ------
NM_001584chr1151111 248 211 111 28 --199 --
NM_001663chr1472689 2682 2440 1899 649 430 337 21816 693 ----
NM_001704chr62235 212 ------
NM_001709chr1162832 2680 2306 2288 1132 944 ------
NM_001742chr731539 702 139 ------
NM_001830chrX63980 3722 3012 1319 1127 360 ----11107
NM_001845chr1321385 1282 ------
NM_001854chr151491 1426 525 379 284 11318 ----
NM_001969chr1483800 3478 3126 2397 984 554 518 470 21172 634 23152 140 --
NM_001980chr1251524 1403 231 124 98 2794 241 ----
NM_001981chr152238 1580 362 289 121 22030 759 3582 258 88 --
NM_002015chr1383107 1193 1003 852 802 432 424 226 ----12487
NM_002025chrX119220 8011 7349 6921 6718 3514 3230 3097 2158 158 139 --13075 --
NM_002076chr1283155 2876 2770 2029 399 330 181 75 ----12976
NM_002089chr43599 475 469 ------
NM_002128chr1352197 1968 384 237 96 1107 ----
NM_002137chr772172 2110 1702 1509 630 340 232 1300 ----
NM_002158chr293536 3277 3129 2585 2523 1507 861 520 378 23567 332 13205 --
NM_002214chr785618 5363 4857 4606 3469 814 410 244 --12280 1354
NM_002264chr3104546 3920 3713 3259 2027 2009 1853 1686 1027 858 --14141 --
NM_002270chr5115626 3682 3625 3603 2207 1693 1630 1299 1084 668 485 15226 ----
NM_002271chr1362392 2276 1637 985 412 112 --1424 12057
NM_002306chr141110 ------
NM_002356chr662868 1086 939 882 807 543 ------
NM_002499chr1582431 2419 2280 2248 845 642 334 144 ----1708
NM_002515chr1461973 1964 1917 1616 671 535 1256 1429 11779
NM_002519chr114272 224 170 62 11427 1587 --
NM_002578chrX1178 ------
NM_002655chr895113 4990 4695 4571 3733 1870 1744 1064 1047 ----15281
NM_002657chr2073814 3752 3697 3274 2562 2431 451 ------
NM_002687chr1461288 1170 957 204 110 77 1181 ----
NM_002709chr283580 3114 2720 2361 1400 1147 184 73 ------
NM_002731chr1103114 3029 3022 2938 2582 2164 2039 1125 1071 635 32986 2614 2495 1798 --
NM_002745chr22104481 3975 3868 3815 3772 3277 3230 1628 1101 722 1800 24063 1831 --
NM_002835chr73563 556 542 ------
NM_002849chr121191 ------
NM_002869chr1151905 1800 1648 1579 1560 11548 1538 --
NM_002901chr1111011 ------
NM_002922chr11563 ------
NM_002941chr321008 587 11578 ----
NM_002942chr331446 550 118 --1525 --
NM_002998chr862172 1424 884 721 610 206 --11755 --
NM_003010chr1772452 2301 2212 2184 1757 288 175 12197 11589 --
NM_003016chr1732006 1941 1933 191 ----
NM_003017chr631399 895 439 ------
NM_003042chr352234 1942 1834 1585 895 11553 --11935
NM_003051chr162004 1930 1906 1460 1369 72 11500 11719 --
NM_003081chr203924 360 352 ----11111
NM_003155chr852293 836 662 334 156 ------
NM_003157chr34739 640 363 224 ----1815
NM_003205chr1582303 2046 1908 1771 934 920 792 355 22151 1937 1389 --
NM_003262chr3105101 5093 4905 4777 4091 3968 1739 1055 874 823 1593 11465 --
NM_003274chr2192993 2985 2850 2161 1162 1022 936 183 59 --1651 12807
NM_003298chr386020 5912 5806 5732 5408 1034 623 523 15168 24803 1114 14037
NM_003304chr341443 602 362 340 11615 11306 --
NM_003325chr223708 655 490 1559 194 --
NM_003339chr561518 1439 1262 1256 1027 313 1264 ----
NM_003392chr363581 3170 2826 1613 780 452 11116 23883 3549 --
NM_003406chr831940 1882 607 --11367 --
NM_003410chrX53106 2976 2921 2873 1016 22399 1981 ----
NM_003468chr2144394 4081 3959 3461 2691 1747 1210 1145 1008 691 682 457 340 271 --13706 --
NM_003478chr1173184 3050 2329 2141 973 519 63 ------
NM_003505chr731642 290 266 1281 ----
NM_003507chr271936 1903 1719 1566 674 622 96 11955 3401 355 319 --
NM_003583chr12103685 3602 3517 3418 3132 2843 2771 1554 905 707 1144 22382 1036 13769
NM_003590chr293861 3091 3047 2959 2664 1579 642 407 207 ----12715
NM_003615chr393247 3227 2940 2893 2614 1033 551 497 141 ----11377
NM_003618chr271317 1221 930 520 505 249 115 ------
NM_003626chr1151107 1036 393 375 334 ------
NM_003633chr592547 2327 2222 2106 1977 1818 267 248 151 --12148 --
NM_003713chr151681 1666 463 91 31 11453 --1344
NM_003718chr71343 ------
NM_003800chr672426 1941 1637 875 846 410 159 --1368 --
NM_003850chr132543 106 --1628 --
NM_003909chr862928 2769 2255 722 667 470 ------
NM_003913chr684296 3773 3121 2932 2642 1193 1118 202 --11523 --
NM_003927chr183965 732 231 ----192
NM_003968chr33519 183 143 ------
NM_004035chr17105192 5141 4248 4000 3990 3891 1871 1730 1178 256 --1946 1638
NM_004064chr1231277 1181 1085 1993 1876 --
NM_004093chr1383095 2995 2758 2681 2538 2408 2230 1234 --1349 11087
NM_004094chr1452953 2322 1952 1897 57 1700 --22315 518
NM_004124chr1463108 1220 924 761 667 188 1335 --11411
NM_004136chr1553277 2460 808 734 286 --1247 --
NM_004161chr241568 1300 547 138 1439 ----
NM_004232chr18123819 3626 3497 3210 3109 2871 1372 905 853 763 719 319 11189 ----
NM_004241chr103508 499 177 ------
NM_004242chr6180 ------
NM_004253chr91125 ----1178
NM_004331chr862425 2324 2217 716 86 39 ------
NM_004379chr261669 1534 1248 1125 290 170 ------
NM_004392chr1362345 2242 2234 2205 469 218 22615 2440 ----
NM_004432chr962290 2209 895 526 363 91 2579 147 21970 338 --
NM_004457chr231718 1231 338 --11413 --
NM_004458chrX71847 1674 987 716 585 288 94 ------
NM_004501chr1114122 3369 1590 1514 1482 920 903 791 494 425 265 ------
NM_004502chr171366 ------
NM_004506chr62480 87 ------
NM_004586chrX85439 5276 3319 2038 1641 1505 463 37 --14845 --
NM_004612chr984413 4169 3638 3197 3106 3095 1623 1281 11249 11077 --
NM_004622chr282076 1926 1896 982 574 501 226 136 ----11946
NM_004663chr1551547 1514 1435 568 72 1290 ----
NM_004685chr1352188 880 582 410 54 1156 167 1212
NM_004715chr183713 654 201 ------
NM_004733chr32615 473 ------
NM_004744chr472871 2478 899 628 389 322 159 --13185 --
NM_004745chr8126788 6741 6416 5445 4528 2355 1800 1784 1208 1041 802 592 --24922 4435 16706
NM_004748chr1573515 3468 2964 2677 2668 567 48 23582 2727 --33312 2691 1068
NM_004779chr541325 1298 955 204 --1425 --
NM_004849chr671577 1439 1174 560 477 261 223 ------
NM_004852chr181513851 13472 13083 11892 11547 10363 9936 9879 9551 4644 3019 2594 1343 425 157 211531 10583 19182 29071 3438
NM_004949chr1842153 1872 1443 693 --22053 111 --
NM_004973chr661262 1131 1078 405 320 43 ----178
NM_004996chr1631719 1665 188 ------
NM_005116chr2083286 3065 2822 2812 1142 1065 1032 48 --1151 --
NM_005121chr1773574 3091 2866 2767 730 619 452 11215 ----
NM_005126chr382184 1807 1692 1672 867 587 134 122 --12214 --
NM_005156chr9135181 5147 5013 5003 4818 4712 4492 4331 4210 3986 1784 1352 411 21545 474 21810 1299 1613
NM_005164chr1242262 2146 241 188 ------
NM_005180chr1061678 1634 1386 488 403 273 1660 ----
NM_005238chr1173536 3417 1157 1057 657 394 152 --12486 --
NM_005239chr2162021 1872 1648 1633 658 528 ------
NM_005249chr14152 --123 --
NM_005259chr231440 978 70 ------
NM_005295chr73259 115 58 ------
NM_005342chrX72828 2741 2555 2088 494 407 339 --1514 --
NM_005381chr21362 ------
NM_005386chr201828 ------
NM_005389chr65774 630 594 321 50 ------
NM_005418chr112202 165 --1180 --
NM_005433chr1842781 2630 2475 2253 --1889 --
NM_005436chr1053001 2606 842 341 143 34058 3399 3071 ----
NM_005455chr151811 1579 1551 601 587 --11835 --
NM_005509chr571848 1499 1449 539 348 221 210 ------
NM_005520chr51499 --1583 --
NM_005544chr25999 930 643 411 239 ----1794
NM_005573chr53551 475 166 1522 ----
NM_005593chr123536 125 117 1515 ----
NM_005595chr13293 208 171 1834 ----
NM_005596chr9145781 5721 5403 5193 4035 3912 2568 2163 2107 1870 1734 798 623 290 25937 1267 15975 --
NM_005603chr1851981 1799 1785 1639 230 ------
NM_005748chr1252208 2150 1386 1306 661 ------
NM_005759chr251409 1346 1098 546 538 34430 3378 1619 11317 --
NM_005839chr12708 103 ------
NM_005871chr105955 912 788 330 323 ------
NM_005880chr1631065 536 352 --11480 --
NM_005896chr23715 537 105 ------
NM_005898chr1132499 806 113 ------
NM_005935chr4115302 5221 4392 4175 3988 1847 1746 1733 1677 603 523 ----15139
NM_005966chr252133 1543 1472 915 282 ------
NM_005999chr151546 1490 566 363 266 160 ----
NM_006022chr1321041 692 ------
NM_006094chr852418 2340 1766 964 700 31608 212 124 ----
NM_006186chr281150 918 892 828 497 485 124 90 ------
NM_006265chr861397 1372 1040 947 405 65 ------
NM_006267chr221510 564 ------
NM_006282chr2074596 4582 3919 3587 1880 1582 1364 14533 --1465
NM_006313chr1241418 1252 600 314 --11438 --
NM_006352chr151909 1751 1712 1608 705 ----11866
NM_006371chr354420 3776 3537 3332 2018 23230 1758 24476 2127 12050
NM_006380chr1794349 4320 1369 1259 613 429 369 211 58 ----1166
NM_006393chr10124360 4205 4054 3767 3429 3098 2878 1747 1654 1503 795 397 23752 3126 ----
NM_006424chr431938 1724 1675 ------
NM_006449chr242182 836 739 618 ------
NM_006504chr1041031 490 306 51 11053 ----
NM_006537chr153515 250 223 ------
NM_006538chr294150 3949 2846 2792 2722 2642 1505 1496 660 23853 283 13457 --
NM_006540chr831388 1297 1214 ----11507
NM_006575chr1441332 1009 452 290 ------
NM_006599chr16158266 8193 7611 7485 7315 5749 5323 3010 2514 2486 2099 1469 930 727 456 --12755 --
NM_006624chr1062093 2044 1934 1531 1439 761 1376 ----
NM_006628chr1584268 1763 1755 1635 833 722 636 412 11732 --13205
NM_006729chrX104680 4385 4226 4021 3499 2208 352 272 251 150 21398 288 --21911 502
NM_006751chr21386 ------
NM_006805chr541391 1223 405 357 ------
NM_006888chr14123487 3418 3333 2942 2931 2565 2439 1343 1298 1088 914 844 12509 --13223
NM_007007chr12124692 4482 3904 3607 3240 1513 1112 1023 787 744 414 376 13560 24150 104 --
NM_007011chr1596877 6294 6142 5539 5405 2019 1742 1710 1215 ------
NM_007038chr21126127 6075 6043 6009 5567 5395 4803 4707 3755 1387 389 152 14812 35663 4792 4750 --
NM_007114chr3113244 3094 2770 2104 2032 1221 1122 883 360 112 37 --12491 --
NM_007187chr132202 80 11059 ----
NM_007249chr13119306 9115 9083 9045 9003 7982 6137 5939 2216 1088 769 28233 7238 ----
NM_007375chr182367 2331 2167 1105 748 594 295 76 ----12181
NM_012082chr82761 275 ------
NM_012090chr151269 454 326 209 150 ------
NM_012096chr383526 3520 3479 2889 2524 1277 1099 318 ------
NM_012104chr1133808 3776 2591 --23020 2899 23169 191
NM_012193chr1175384 5050 4267 4203 1630 1543 239 25096 1292 1358 --
NM_012214chr2105989 5164 4730 4523 1416 1282 1040 807 113 33 34458 4345 2493 --15948
NM_012234chr383491 3298 2721 2276 1164 1099 933 553 --13073 --
NM_012247chr101130 ------
NM_012249chr283383 1248 1075 984 703 415 311 288 ------
NM_012287chr364517 4466 4355 3755 883 237 24510 3881 ----
NM_012301chr782059 2002 1988 1840 1671 1558 681 479 --12128 --
NM_012316chr175632 5092 4949 4769 4636 4498 4250 13968 21252 1015 14331
NM_012322chr71150 ------
NM_012342chr101334 ------
NM_012345chr1381800 1655 775 726 641 427 115 104 1281 ----
NM_012388chr1582688 2672 2588 1139 1006 962 279 195 13151 ----
NM_012392chr11720 ------
NM_012414chr14770 752 697 120 ------
NM_012463chr1231572 1150 171 ----1137
NM_013261chr4103732 3593 3459 3438 3394 3003 1294 1161 866 375 12306 12547 13109
NM_013262chr641410 565 478 349 1403 ----
NM_013372chr1553341 2781 2671 1327 236 13278 22649 2629 --
NM_013386chr111676 ------
NM_013390chr971508 1455 1148 666 592 274 214 ------
NM_013396chr2171552 1413 1354 1067 987 447 399 ------
NM_013437chr85405 281 271 160 62 11062 ----
NM_013438chr92553 233 ----1442
NM_013444chrX21035 124 ------
NM_014011chr282389 2300 2210 1864 1815 1681 959 110 ------
NM_014016chr391615 1515 1396 1156 1123 1098 539 498 225 ------
NM_014028chr653164 2232 1262 598 83 ----1962
NM_014043chr331247 423 372 ------
NM_014048chr1684141 3838 3212 2082 1874 1752 1157 425 13614 14531 --
NM_014155chr11107218 7172 6526 6149 4910 2853 2107 1899 1811 718 12630 1466 11690
NM_014181chr252411 2301 1902 592 429 --32340 2201 732 --
NM_014207chr111406 ------
NM_014319chr1251821 1697 1471 1263 543 ------
NM_014331chr4147599 7260 7054 6934 6749 6523 5667 5323 2514 1369 1151 948 408 372 --11343 --
NM_014368chr932122 2076 2061 1809 ----
NM_014382chr341641 1496 503 497 ------
NM_014423chr585560 5276 4276 4174 3761 3476 1257 696 ----11314
NM_014584chr1421379 122 --21081 195 --
NM_014602chr31320 ------
NM_014667chr342371 1976 1908 1841 ----11755
NM_014746chr274418 4311 4232 1705 1193 973 650 --1671 1264
NM_014751chr852160 2000 299 200 101 11537 1739 --
NM_014810chr183693 3610 3597 3101 2933 2398 1074 39 13245 ----
NM_014873chr1134741 4728 4688 4639 4479 4456 4271 4185 1711 1705 1248 801 380 11666 13108 --
NM_014877chr17103078 2026 1978 1789 1768 1527 1339 890 596 363 12650 12429 --
NM_014897chr1752854 2384 2175 673 49 ----1391
NM_014904chr1093973 3420 3390 3342 3307 3061 3047 1603 144 ------
NM_014906chr17103874 3771 2645 2575 2540 1125 686 634 592 224 --12892 --
NM_014912chr1053412 2740 1221 577 339 11116 ----
NM_014920chr683804 3475 3390 2884 2755 2520 1400 305 23033 2729 ----
NM_014924chr1473050 2780 2707 1262 1127 847 177 22370 2313 12999 --
NM_014936chr682677 2161 1972 992 746 529 397 75 ------
NM_014962chr2062743 2531 2432 2059 464 106 ------
NM_014982chr1495327 4833 4617 4423 3660 3458 1215 1193 1173 --15289 --
NM_014991chr483182 3016 2255 1088 473 425 389 36 ------
NM_015025chr262642 2442 2375 1096 214 63 1706 --1680
NM_015026chr1272992 2928 1726 1590 1063 442 204 14418 23581 1032 172
NM_015032chr13122944 2777 2720 2616 2559 2235 2165 1130 845 441 255 29 12815 ----
NM_015045chr1052249 2173 2088 2076 1397 --11471 --
NM_015056chr2162379 1663 471 164 95 22 1272 1981 --
NM_015087chr1352455 2150 812 578 489 ------
NM_015093chr651847 1538 1369 546 384 ------
NM_015097chr362384 1900 1741 1533 629 152 ----11836
NM_015125chr191142 ------
NM_015138chr15122847 2757 2431 2305 1946 1924 1903 1769 1138 778 610 138 ------
NM_015141chr352482 2336 2231 2133 99 21809 151 22750 2093 --
NM_015143chr451411 1226 1020 939 590 11263 ----
NM_015153chr62687 59 ------
NM_015156chr1493845 3831 3535 3315 3097 2858 1243 836 687 ------
NM_015215chr173188 3054 3039 2665 2231 1262 889 --11965 --
NM_015275chr1272094 2001 1983 1456 1440 325 310 11361 ----
NM_015278chr673359 3288 3278 2609 2191 734 644 12295 11027 --
NM_015284chr152114 1698 1557 1326 136 ----21375 1358
NM_015294chr1771112 872 747 456 223 217 56 11036 ----
NM_015310chr8148219 6567 6125 5848 5175 2422 1811 1788 1723 1630 1442 1367 398 101 --1230 26725 6135
NM_015317chr261154 1139 1040 320 305 144 1716 ----
NM_015323chr641717 1645 1374 185 ------
NM_015349chr682946 2922 2467 2396 2373 1970 1066 318 ------
NM_015352chr2083966 3477 1584 1576 1164 1102 615 428 13810 12423 --
NM_015355chr1731669 1235 360 1368 11396 11908
NM_015359chr862977 2933 1095 807 674 155 12950 ----
NM_015458chr8105154 5112 5082 4630 4522 4062 3928 1627 954 801 --14996 --
NM_015461chr181535 ------
NM_015523chr111195 ------
NM_015530chr23629 238 115 --1105 --
NM_015542chr1051272 1192 1184 775 222 ------
NM_015554chr1592938 2785 2483 2185 2162 1879 645 433 192 1301 ----
NM_015569chr164150 3336 3278 3013 2933 942 44253 4235 1303 957 33990 3147 2945 --
NM_015578chr1952012 1722 1500 607 484 ----11417
NM_015630chr271070 821 467 445 381 185 160 --11013 --
NM_015711chr192831 208 ----1754
NM_015888chr153314 3172 2405 2222 733 ------
NM_015906chr164740 4340 4250 2929 1081 979 --11295 --
NM_015976chr11339 ------
NM_015986chr1741050 496 140 67 11335 ----
NM_016009chr1114788 4292 4258 4131 3947 3889 3513 3379 3273 3187 1710 13685 --1443
NM_016018chr83928 411 328 ------
NM_016021chr682880 2508 2225 628 509 291 130 27 ------
NM_016083chr6113844 3648 3370 3009 2545 1222 1148 1112 1072 424 334 ----1445
NM_016121chr111019 2941 865 --1909
NM_016132chr1573163 2696 2488 1140 744 159 99 13108 33083 2911 445 --
NM_016133chr261605 1277 204 193 178 86 ----1237
NM_016231chr1741481 1367 181 94 ------
NM_016271chr1861590 1544 704 609 572 276 ------
NM_016356chr682901 2708 2003 1172 1088 1061 696 279 12113 ----
NM_016436chr2092306 2171 1858 1816 1717 893 838 480 347 21668 1021 11730 --
NM_016441chr252279 1812 1788 763 266 ----22380 257
NM_016557chr33705 256 226 1407 ----
NM_016628chr104913 224 177 43 ----1141
NM_017420chr1443765 3407 2915 1430 1815 --11408
NM_017423chr472135 2055 1680 1479 1441 1432 154 --12018 --
NM_017580chr1051742 1596 261 212 44 1298 1773 --
NM_017582chr131811 1462 1246 --21784 1303 --
NM_017594chr973076 3047 2981 2430 2373 2292 2232 22256 360 22954 810 --
NM_017612chr122521 475 ------
NM_017637chr9109433 8004 7549 6629 6442 5841 5765 3663 2033 526 17849 16579 12125
NM_017644chr352008 1880 1515 528 251 22060 263 --13550
NM_017645chr983159 2121 2090 2079 1045 837 279 196 12670 --12977
NM_017650chr786010 5212 4976 4899 4610 4585 2043 568 --12203 15699
NM_017655chr141501 1169 573 228 11096 ----
NM_017658chr14134647 4422 4251 3954 3874 3695 3272 3205 3194 1669 1519 1388 528 12898 --1938
NM_017694chr251997 1958 1604 1426 820 ----11743
NM_017736chr16102840 2249 2063 1178 1160 795 766 424 397 311 21171 563 ----
NM_017754chr695038 4540 3929 3599 3573 1969 1836 1196 930 14710 1308 --
NM_017778chr821535 1091 ------
NM_017780chr85927 834 669 318 106 1900 ----
NM_017813chr8105755 4645 4554 3823 3711 1095 797 631 279 154 --1872 --
NM_017831chr18104440 3309 3229 3145 1602 1094 871 697 639 557 --14754 --
NM_017925chr981415 1371 1352 755 745 729 573 442 ------
NM_017944chr1193014 2942 2712 2632 1974 1908 1018 675 213 ----12508
NM_017993chr131154 ------
NM_018018chr1231823 1365 639 1251 1522 --
NM_018092chr1621509 1292 ----1652
NM_018121chr1052456 1004 833 676 523 ------
NM_018126chr461547 1468 1153 972 639 72 ------
NM_018199chr1411252 ------
NM_018351chr12114726 4118 3613 2999 2879 1431 1200 549 378 350 26 14594 1673 13715
NM_018362chr1172940 2496 1622 1399 1233 1078 430 192 11459 --
NM_018364chr164110 4070 3777 3121 2606 247 --13805 --
NM_018440chr8168713 8669 8587 7877 7500 6767 6298 6160 3009 2549 2273 1796 1517 1438 1066 32 --26781 6577 --
NM_018464chr101364 ------
NM_018489chr172294 1909 1640 935 780 589 566 --12199 --
NM_018490chr1141655 1647 1540 95 ----1497
NM_018557chr22681 392 ------
NM_018569chr441544 1316 118 90 1105 ----
NM_018638chr12185687 5670 5297 5229 4758 4744 4666 4463 4348 4296 4103 4089 2095 1658 1076 459 353 318 ----11740
NM_018682chr72534 208 ----139
NM_018957chr221325 ------
NM_018970chr772932 2709 2560 2162 545 486 208 --11267 22900 2741
NM_018999chr10124893 4783 4258 4073 1752 1642 1535 1281 1127 776 423 176 --11184 --
NM_019050chr492211 2189 1859 1729 1711 1469 808 685 88 11778 ----
NM_019084chr1062437 896 877 752 591 68 11999 11010 1982
NM_019116chr1663606 2661 2493 1501 1457 670 --12856 13769
NM_019610chr152088 1680 511 260 161 --11875 --
NM_020122chr2105137 4854 4724 4275 3648 1649 1518 689 201 90 11978 25496 2077 15276
NM_020177chr573372 3121 3061 2916 2670 2638 655 ------
NM_020214chr151239 ------
NM_020311chr23762 668 639 ----1279
NM_020341chr2062018 2000 1941 1547 1482 445 21737 327 11344 --
NM_020390chr393686 3373 3364 3260 3036 1593 746 736 465 13741 ----
NM_020403chr1351704 1616 1142 531 505 ------
NM_020432chr762343 2213 1411 906 605 588 12195 --1625
NM_020456chr1332307 2069 780 --1760 --
NM_020651chr231418 609 379 1618 ----
NM_020673chr20127134 6428 6362 6016 5382 2312 2225 1483 465 329 304 183 27759 7612 ----
NM_020699chr195401 4831 4449 4289 4010 3628 3307 937 468 --12047 --
NM_020742chrX52291 2239 615 495 223 2894 232 1641 --
NM_020772chr17166880 6688 6078 5778 3429 3401 3152 3041 2963 2939 1911 1884 1596 1110 1001 429 27898 7663 1909 --
NM_020783chr1892324 1988 1835 1733 1710 1486 701 687 541 32422 2408 2364 ----
NM_020796chr5102885 2877 2620 2416 2391 2080 1860 1128 913 574 22965 1175 ----
NM_020858chr1592352 2150 2144 2119 1735 948 512 316 65 1813 ----
NM_020918chr10133583 3563 3352 3128 3055 2678 2380 2343 1243 669 332 161 53 ----12760
NM_020940chr1082917 2901 2035 2019 1108 486 287 118 11100 12523 --
NM_021003chr144281 236 206 188 ------
NM_021038chr332993 2160 395 1551 --13032
NM_021072chr542411 2283 860 713 31987 845 276 ----
NM_021110chr81782 ------
NM_021116chr7158797 8679 8256 7636 7475 6401 6018 3532 3195 1882 1463 1076 930 723 339 --48917 7578 6262 2498 13092
NM_021140chrX31054 747 401 ------
NM_021183chrX112564 2493 2422 2045 1806 912 794 691 645 545 479 12538 ----
NM_021190chr121079 872 ------
NM_021194chr11134 ------
NM_021638chr494827 4673 4359 4247 3703 3695 1434 580 179 1206 ----
NM_021814chr671151 490 370 351 326 89 44 1124 ----
NM_021961chr11187263 6906 6740 6306 5946 4778 4575 4529 2014 1670 1616 1317 1200 1112 513 221 202 93 14614 26647 4564 11013
NM_021973chr41633 ------
NM_022041chr1682563 2539 2111 1797 1651 1059 621 233 ------
NM_022048chr15126310 6261 5900 5005 4913 2467 2426 2228 1674 1391 1113 599 --26371 627 1614
NM_022058chr241680 788 335 175 --2275 214 --
NM_022336chr231602 1471 964 --22058 67 11708
NM_022351chr8113600 3524 3134 3037 1008 702 629 564 405 388 239 --1446 --
NM_022465chr1243012 2690 2278 178 --13048 --
NM_022648chr244220 2840 1794 1776 34383 4307 1663 44038 3740 1647 1280 --
NM_022726chr641701 1542 576 545 11502 ----
NM_022756chr171453 494 408 330 245 129 34 11392 --1180
NM_022771chr1221064 827 ------
NM_022818chr1671601 1511 1320 1138 563 336 219 1545 --11542
NM_022841chr1552288 767 421 299 197 --1501 1520
NM_022843chr1351489 1227 1125 529 126 ------
NM_022893chr242902 2856 2119 497 ----193
NM_022894chr261228 1205 513 393 176 167 ----11274
NM_022898chr1494435 4109 4024 3652 3068 1597 1193 930 246 13761 11474 --
NM_022912chr252976 2955 2608 442 407 1576 12499 --
NM_023016chr292887 2878 1832 1048 1011 677 596 422 66 ------
NM_024312chr122649 589 ----11614
NM_024336chr16293 50 ------
NM_024345chr995646 4719 4703 4598 2145 1698 1565 1355 695 12295 16056 --
NM_024501chr22746 197 ------
NM_024613chr821155 123 21828 67 --11600
NM_024665chr364695 4517 4439 4263 4131 3651 13024 14366 22896 716
NM_024944chr2121267 32 --1116 --
NM_024947chr3119609 9511 9465 7940 7928 3715 2993 2947 2318 837 57 49252 7755 3004 1890 ----
NM_025106chr111523 ----21666 1498
NM_025146chr372483 2164 2154 2090 1881 976 214 1539 ----
NM_030571chr561252 1060 1010 320 255 200 1389 11429 --
NM_030627chr574137 3634 3015 2548 1162 1151 112 34144 3651 2806 ----
NM_030647chr796111 5745 5657 4949 4671 4574 4537 2026 1001 44021 2089 791 437 ----
NM_030762chr1231501 1298 252 ----21648 1274
NM_030777chr2022393 2358 11520 --32432 2276 858
NM_030939chr61972 ------
NM_031372chr45609 478 439 314 102 --11614 --
NM_031483chr2092629 2620 2555 1194 762 704 458 119 79 13568 ----
NM_032144chr241656 1504 1436 1417 11405 1387 --
NM_032153chr362718 2686 2489 2332 2311 563 1488 ----
NM_032199chr10103884 3590 3076 2920 2822 1462 1431 1013 975 738 --23641 131 --
NM_032361chr52117 100 ------
NM_032373chr1085687 5495 4591 4048 3914 1135 762 575 15597 ----
NM_032560chr141291 ------
NM_032826chr7115017 4196 4091 3603 1494 903 768 680 399 363 52 --11622 --
NM_032842chr741467 1343 328 165 ------
NM_032858chr11122 ------
NM_032859chr1383193 3036 2979 2917 1097 834 792 412 11170 --13318
NM_032918chr1211227 ------
NM_032968chrX84094 3978 3022 1646 1596 1049 832 94 ------
NM_032973chrY84086 3017 1640 1632 1595 1049 832 94 --13971 --
NM_033132chr136828 820 768 627 601 538 --11517 --
NM_033133chr1743405 2306 141 123 ----11220
NM_033224chr7158086 7927 7749 7573 7555 7460 6403 5382 5232 5111 4885 2545 2343 1341 984 37998 6492 2843 17835 --
NM_033296chr41258 --1908 --
NM_033389chr17123893 3776 3121 1531 1345 1226 918 900 699 173 66 43 24580 3546 13735 11472
NM_033394chr251534 1405 1391 1194 521 --11051 --
NM_033426chr1442930 2732 2338 547 186 22529 2401 --
NM_033505chr2176748 6677 6304 5805 5726 5406 5170 5124 5033 5000 1568 1459 1446 669 398 47 33 2840 772 1758 12588
NM_052832chr851847 873 680 404 384 --1318 --
NM_052855chr172660 610 --1540 --
NM_052879chr12113686 2606 1574 1518 1482 948 819 680 532 414 146 ------
NM_052897chr121801 ------
NM_080867chr14115058 4602 4444 4432 4139 2009 1540 1143 544 509 237 ------
NM_080872chr8103733 3659 3568 3070 2794 2772 1201 922 451 433 23256 2686 ----
NM_080927chr383292 3251 2650 1352 919 570 549 235 --1353 --
NM_130847chr11125659 5515 5388 5142 3881 1763 1407 1264 950 904 492 236 --15363 --
NM_133334chr4106385 6212 5638 5395 5282 4326 2245 926 654 354 26347 954 ----
NM_133445chr993692 2757 2391 2355 2335 655 255 77 64 ------
NM_133468chr751966 1884 1752 412 99 --1243 --
NM_138286chr19114356 4240 4036 4009 3709 3665 3354 3088 2738 986 754 23123 967 11680 --
NM_138288chr1441720 1403 841 443 --1526 12009
NM_138316chr1041032 483 321 127 ------
NM_138346chr11215 ------
NM_138386chr41148 ------
NM_138423chr1541474 103 81 39 ------
NM_138444chr13124397 4099 3954 3728 3438 3088 3071 3059 1771 1544 1534 703 54755 4697 4623 3462 1842 21749 897 1984
NM_139283chr1262207 1693 1651 916 793 118 ------
NM_139315chr71169 ------
NM_144571chr4146303 6260 6240 5664 4503 4452 4397 2692 2409 2234 2114 1803 1261 56 172 27018 6566 1135
NM_144578chr14115462 4996 4774 4725 4591 4343 4133 4009 3752 1166 919 ------
NM_144590chr1093024 2941 2922 2308 1948 1078 962 895 286 --12670 --
NM_144607chr1732572 2545 2531 ----21748 1646
NM_144610chr174537 525 203 48 ------
NM_144664chr11122436 2279 2133 1897 1743 1032 661 649 261 166 138 61 --12325 --
NM_144778chr1382727 2647 2519 2154 2045 1868 1026 245 --1959 --
NM_144973chr1274425 4224 4081 3308 1338 1247 292 34945 3846 1127 24439 1312 --
NM_145175chr211289 ------
NM_145206chr1073167 2629 2219 2099 790 534 407 ----12387
NM_145753chr361598 1507 671 448 153 112 11517 ----
NM_147156chr1051444 1382 551 303 149 --1413 --
NM_152271chr841129 1119 1069 732 ----1292
NM_152287chr1672626 2270 2139 1962 1859 307 265 1652 --1470
NM_152424chrX64699 4347 2980 1257 1088 287 14539 1133 11554
NM_152588chr1251763 1744 442 297 236 11686 1163 1363
NM_152641chr12102653 2398 2359 1066 1014 845 818 737 616 341 ------
NM_152678chr372487 2277 1979 1889 1771 933 798 1964 ----
NM_152737chr652102 1827 1603 1488 1338 --1156 --
NM_152739chr731017 957 213 ------
NM_152745chr741030 864 825 200 ------
NM_152754chr763742 2838 1403 1383 978 252 ------
NM_152756chr5134154 4109 3967 3734 3728 3462 3281 2654 1496 1484 1457 1280 541 13269 11679 24191 3608
NM_152835chr192912 2741 2612 2080 931 618 499 429 393 ------
NM_153207chr1251441 1139 1109 1089 170 34117 2877 883 1421 --
NM_153262chr182639 2474 2128 2122 1206 1140 746 434 1802 ----
NM_153607chr562210 2109 2078 1952 1054 59 11197 ----
NM_153810chr1043336 1518 707 153 --21629 256 11669
NM_172070chr242175 1693 648 552 12239 --11566
NM_172071chr1137433 6962 6650 6563 5421 5089 4672 4659 4646 2784 2640 820 261 ------
NM_172373chr1341172 396 329 107 ------
NM_173468chr4105961 5364 4621 3797 3747 1904 758 690 567 488 15519 1818 14125
NM_173470chrX112864 2849 2737 2572 2482 2071 1939 717 686 258 178 1748 --22530 1164
NM_173475chr161503 ------
NM_173511chr293582 2962 2774 2621 2456 1147 1131 926 93 ------
NM_173582chr11165252 5118 5071 4894 4122 3948 2262 2105 1890 1611 1393 1260 1159 1017 543 403 14267 1810 16250
NM_173683chr821252 234 11475 ----
NM_173808chr184237 1746 1640 758 558 332 279 133 24102 1361 1597 --
NM_173822chr252171 1852 1773 1362 211 ----1320
NM_173829chr5105368 4855 4323 4280 2024 946 676 312 180 174 --16013 --
NM_174916chr1582251 1897 1530 933 882 834 814 421 --22192 625 --
NM_174921chr451079 943 741 298 292 ------
NM_175736chr1257753 6985 6889 2726 1322 --27106 174 21962 1651
NM_177968chr252054 1921 1490 580 384 1393 ----
NM_178011chr1073230 878 466 322 286 189 42 1630 --11107
NM_178140chr542744 722 502 451 ----11877
NM_178554chr373097 2864 2348 696 261 196 157 1793 32744 2361 326 --
NM_178815chr1062486 2442 2170 527 495 39 22301 279 --12459
NM_181358chr154057 2612 1495 1327 1229 32926 1168 735 12900 --
NM_181723chr851898 924 876 770 428 ------
NM_182398chr141385 ------
NM_182485chr453733 3680 3438 3361 1022 11213 ----
NM_182515chr1996655 6205 6001 5560 4702 4158 2102 950 554 12083 12492 --
NM_182691chr741393 492 335 168 ------
NM_182700chr791973 1870 1591 1345 1337 1254 1212 167 154 ------
NM_194250chr22414 309 --1147 --
NM_194314chr1105594 5521 5208 4162 3683 3497 1721 1464 1118 879 54575 3412 2201 636 617 ----
NM_194317chr222748 2730 199 --1343
NM_197941chr563010 2987 2923 2520 2262 173 --21199 634 --
NM_198157chr2241998 383 240 23 11749 --1158
NM_198270chrX93292 3283 2989 2578 1218 1142 1034 792 581 13337 ----
NM_198401chr881668 1632 1441 1343 1150 681 655 135 1234 ----
NM_198513chr872006 1983 1721 1443 1407 385 321 1366 --1659
NM_198859chr3105156 5145 5114 4823 3478 2012 1796 1618 461 414 --1911 23378 835
NM_203301chr1431392 1082 493 --11668 11263
NM_203394chr1282663 2567 2483 2393 919 877 689 670 ------
NM_203406chr562678 2645 2493 2290 681 232 12706 ----
NM_203434chr921087 156 ----11028
NM_203458chr153812 3214 3019 2773 2714 13245 23224 631 --
NM_206853chr694129 3678 3149 2886 1575 1374 515 501 170 12926 1312 --
NM_207372chr1022391 440 12266 --11510
NM_207406chr466180 5918 4541 4510 1508 732 25886 4582 13975 15863
NM_213589chr2145512 5121 4881 4806 4415 4310 3967 2003 1574 1427 999 917 69 34 ------