TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-601
miRNA Sequence: UGGUCUAGGAUUGUUGGAGGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000046chr532996 328 43 --1660 --
NM_000084chrX66551 6406 6389 2367 2348 1078 36052 2010 1609 2989 503 --
NM_000176chr511151 --1387 --
NM_000210chr221883 1847 ------
NM_000276chrX41934 1902 863 186 1653 2364 335 --
NM_000314chr1042584 616 545 64 ----1554
NM_000332chr636608 5849 2526 ----11667
NM_000337chr584577 2251 2219 1658 1594 1508 386 56 14561 16462 14509
NM_000408chr221044 621 --13037 --
NM_000489chrX12419 ------
NM_000522chr711268 ------
NM_000875chr1555055 2696 1812 794 773 24952 1175 --14591
NM_001001132chr21----11070 --
NM_001003674chr1836954 5356 1465 --36520 6374 174 15397
NM_001003940chr1563227 2903 1484 1433 525 397 --1698 11193
NM_001007466chr654836 3849 1937 447 348 1657 33809 1023 23 14854
NM_001007466chr654836 3849 1937 447 348 1657 33809 1023 23 14854
NM_001007563chr9----1143 --
NM_001009569chr1021629 1274 ------
NM_001009959chr232478 1693 158 --11051 --
NM_001010861chr112032 --1162 --
NM_001010986chrX--22057 375 21957 675 --
NM_001012398chr16----142 --
NM_001012755chrX34734 3754 3503 --11589 --
NM_001012980chrX173 ------
NM_001014380chr1354930 4762 4136 1944 852 --1745 --
NM_001014797chr1067127 6403 5746 5357 2610 1312 16792 12113 --
NM_001015877chrX62799 2597 2290 2025 304 120 12919 ----
NM_001017395chr323576 61 --13469 --
NM_001018065chr955123 2004 954 329 234 32372 1243 986 33991 3985 994 --
NM_001024463chr152772 349 ------
NM_001025077chr1045748 2054 1648 1404 26995 5168 21155 1029 --
NM_001025580chrX2980 211 13426 24110 2698 --
NM_001031710chr71344 ----1810
NM_001033117chr334573 4562 3641 23061 1848 1453 --
NM_001034915chr811141 --11043 --
NM_001039538chr232401 1045 713 --12697 --
NM_001039577chr134266 1811 576 --23194 99 --
NM_001039840chrX55626 4048 1216 397 367 --34634 4254 1033 --
NM_001042383chr343244 3212 849 425 --1234 --
NM_001042603chr1245110 1761 687 533 25126 41 --1672
NM_001042683chr631820 565 390 --11253 --
NM_001167chrX36317 5267 5236 21101 234 12307 --
NM_001204chr256568 6392 5981 5841 2840 57451 5807 1054 527 346 ----
NM_001280chr19----1185 --
NM_001364chr1164538 4439 4270 3416 3026 1290 ----11461
NM_001401chr911062 1287 3635 300 152 --
NM_001416chr171165 ----1348
NM_001419chr1954480 4148 1718 947 410 2678 195 ----
NM_001438chr132498 1299 755 ----1810
NM_001609chr1013166 --13481 --
NM_001621chr752785 2466 2234 1902 1096 12455 --1784
NM_001699chr1951515 1395 1321 1273 292 ----21580 1253
NM_001759chr1224158 2001 ----1125
NM_001769chr122311 137 --1305 --
NM_001859chr942829 2499 1411 859 --12413 --
NM_001957chr422072 155 --11424 --
NM_002014chr121101 ------
NM_002126chr1743257 3030 2786 610 23184 1389 23096 289 13378
NM_002264chr354548 4039 1582 445 250 14457 14419 --
NM_002270chr555180 4640 4362 1516 1098 ----1835
NM_002334chr1121801 213 ------
NM_002546chr8----1289 --
NM_002731chr132193 1964 514 2639 596 22509 614 1223
NM_002828chr18----1960 --
NM_002834chr12--13262 23699 1048 --
NM_002874chr9----1314 --
NM_002892chr1411469 --11479 --
NM_002902chr151476 ------
NM_003010chr1711842 1296 1319 --
NM_003108chr246354 6306 6221 1249 17037 1890 --
NM_003155chr852553 2069 1736 1074 148 12054 --12511
NM_003204chr172325 215 --477 71 65 59 1509
NM_003205chr1531973 1836 36 --1902 --
NM_003250chr17----1400 --
NM_003320chr1154433 3787 3526 916 94 --14344 --
NM_003375chr101148 ------
NM_003410chrX----12167 --
NM_003453chr13----160 --
NM_003566chr1222940 961 11005 --1114
NM_003629chr163063 2900 2804 2701 1296 88 21405 60 22715 2565 13355
NM_003716chr31272 ----1794
NM_003768chr141427 1330 519 32 ----11201
NM_003822chr12818 620 11219 ----
NM_003827chr191517 ------
NM_003932chr22------150
NM_004075chr122537 251 ------
NM_004094chr1472867 2754 2407 1164 1139 867 652 --167 11197
NM_004114chrX21053 150 ------
NM_004132chr101912 1112 ----
NM_004171chr11107039 6947 6543 6435 3602 3307 3162 3106 1954 1667 --28463 3365 17442
NM_004227chr742279 1049 955 627 12912 22712 1979 --
NM_004331chr8----1339 11744
NM_004342chr7------1753
NM_004600chr1------1432
NM_004744chr443710 3346 2923 2886 --33919 1582 1305 --
NM_004745chr876159 5202 4796 2379 2076 1165 433 36886 5899 5244 12560 --
NM_004757chr41172 --1117 --
NM_004779chr51172 ------
NM_004805chr231336 418 389 ----1375
NM_004824chr6----1272 --
NM_004831chr19----11008 --
NM_004852chr18913612 13475 12186 10872 10675 8968 8864 5147 2349 22648 167 310967 10273 9521 213386 3770
NM_004884chr151353 ------
NM_004999chr663033 2973 1779 979 816 180 12867 13427 --
NM_005095chr131548 342 222 ------
NM_005126chr32271 181 1207 ----
NM_005465chr1162 ----1433
NM_005596chr994780 4700 4587 4121 2481 1665 424 331 187 25011 241 --15329
NM_005639chr1231482 1344 355 ------
NM_005717chr11874 ----1468
NM_005725chr112377 ------
NM_005779chr532896 588 173 13215 1234 23231 1180
NM_005941chr833906 2702 629 1876 1249 --
NM_006094chr832335 745 193 ------
NM_006145chr1921082 847 180 2171 60 --
NM_006154chr153906 555 529 ------
NM_006159chr121195 ------
NM_006352chr151965 1668 1368 465 52 11405 ----
NM_006540chr831426 1412 262 ------
NM_006599chr1655519 5460 5230 1412 283 --15016 26807 325
NM_006602chr201175 1209 1811 --
NM_006621chr111472 ----1646
NM_006624chr1021311 365 ------
NM_006682chr7----12320 11089
NM_006704chr131354 ------
NM_006713chr51318 ----1846
NM_006756chr81120 ----270 30
NM_006777chrX11920 ----1665
NM_006842chr111114 ------
NM_007034chr11670 ----1307
NM_007112chr1138 ------
NM_007172chr2222488 1004 ----12741
NM_007202chr17----1151 --
NM_007282chr31196 1941 --1304
NM_007361chr142651 105 --149 --
NM_012104chr113972 679 554 ----23563 39
NM_012193chr1165333 4439 4321 3796 3638 301 44433 3368 1397 1059 24990 2034 --
NM_012199chr173789 3628 3159 1563 1533 539 484 ----23925 262
NM_012214chr234778 839 379 --24588 1528 15497
NM_012238chr1011683 ----1407
NM_012255chr20------1310
NM_012281chr752431 1807 726 637 182 12028 ----
NM_013231chr1443294 1589 1038 39 21664 970 ----
NM_013336chr321304 148 --11626 --
NM_013436chr22700 60 1632 1807 --
NM_014021chr163294 3226 2903 2671 1305 902 --1271 --
NM_014117chr1652611 2542 2479 790 713 ------
NM_014232chr1721595 209 ------
NM_014552chr2----151 11347
NM_014720chr101270 ----1199
NM_014877chr1766589 5686 2106 2013 1784 816 37322 4790 576 25280 145 --
NM_014897chr1743085 789 592 356 --12813 --
NM_014906chr1742946 2586 279 138 ------
NM_014962chr2032880 2602 2035 1642 11131 --
NM_014970chr1----1273 --
NM_014974chr1011679 --1482 --
NM_015002chr1221932 383 --11995 --
NM_015025chr222258 451 ------
NM_015057chr13----1455 --
NM_015071chr576355 5537 4186 2613 1530 1510 1200 11302 15543 --
NM_015076chr634160 1627 1307 23849 3437 1632 --
NM_015092chr1654018 3458 3090 1809 1140 --24152 1784 --
NM_015236chr42974 414 ------
NM_015277chr1831366 615 383 --11571 --
NM_015310chr822583 389 36544 6153 2335 --22068 847
NM_015313chr1141784 1338 910 426 14336 ----
NM_015534chr11427 ----1174
NM_015564chr522749 779 1369 13312 --
NM_015832chr18----158 --
NM_016231chr17----1168 --
NM_016289chr21332 ------
NM_016322chr972635 2576 2259 2096 1147 302 171 --1232 13054
NM_016530chr1574009 3506 2991 1146 372 335 124 23578 1641 12646 --
NM_016570chr12----1459 --
NM_016626chr181229 ----1572
NM_017548chr31586 --138 --
NM_017610chr153814 693 206 --1149 --
NM_017658chr1433972 1235 1180 ----11648
NM_017712chr1955505 5203 5180 2167 1991 --15135 --
NM_017752chrX21899 795 ------
NM_017847chr131579 497 227 --11865 --
NM_017848chrX53290 2851 1606 100 65 13611 --13225
NM_017849chr222828 828 --11221 --
NM_017919chr934675 4023 1184 35533 3732 3652 11835 14594
NM_018241chr4----1192 --
NM_018254chr131896 1609 98 ----1176
NM_018440chr856136 6034 3226 1640 185 --31314 834 614 11203
NM_018638chr1252225 2062 1295 1045 161 11671 ----
NM_018698chrX21478 1280 --11940 --
NM_018713chr12987 88 --2968 99 --
NM_018994chr11450 ------
NM_019106chr2233215 2633 893 22362 568 23425 454 --
NM_019600chr152752 171 ----1121
NM_019884chr19------1105
NM_020066chr12405 138 1257 --1198
NM_020122chr235410 3889 1233 --11352 15633
NM_020338chr1013691 --23153 390 --
NM_020341chr20132 11347 11262 1104
NM_020466chr641778 1732 961 255 --34258 3905 1305 --
NM_020673chr2027209 4901 24699 139 27592 7528 15609
NM_020772chr1767163 5479 2768 1518 991 197 28650 1856 184 --
NM_020850chr162747 725 --43048 2686 1075 733 11198
NM_020899chr1732077 1653 633 12540 --3954 855 475
NM_021038chr322192 675 1399 12186 --
NM_021813chr635830 5221 4938 24251 281 2420 296 --
NM_021964chr326204 1266 25904 236 26555 1100 --
NM_022123chr14168 ------
NM_022351chr832494 939 601 --13446 --
NM_022459chr13116235 6212 5261 4273 2009 1261 471 459 414 388 29 22253 2217 24895 2364 --
NM_022462chr1973232 3216 2681 2650 2383 1428 667 1826 73743 3056 2713 2560 2530 1492 1394 1795
NM_022477chr201370 1479 --2583 23
NM_024345chr965996 5228 5200 5117 1796 190 22374 1325 16051 15291
NM_024852chr1----1509 --
NM_025133chr21913 11195 11073 --
NM_025160chr144152 3680 1611 97 12709 ----
NM_030816chr122877 1347 ----23690 379
NM_030918chr164818 4343 3621 632 270 155 --24499 4453 --
NM_031483chr2022480 337 ------
NM_032172chr71358 ------
NM_032440chr10----11967 1956
NM_032452chr142358 253 ------
NM_032458chrX73129 2927 2620 2355 2110 634 450 13249 --12085
NM_032557chr42223 101 ------
NM_032968chrX11583 13341 2672 143 --
NM_032973chrY23538 1582 13336 2672 143 --
NM_033133chr1763221 3097 2405 2366 1020 833 ----22842 239
NM_033224chr798034 7364 7075 6530 5845 5490 5164 1576 326 47256 6278 2710 2384 1431 1679
NM_033505chr245350 4869 4316 163 21920 237 177 12539
NM_052886chr821947 1596 --12014 --
NM_052900chr81635 1405 --1160
NM_052907chr1263835 3143 2973 1497 1040 414 13536 1367 --
NM_053025chr331238 1111 226 ------
NM_080867chr1454597 3516 3205 1469 1210 11877 ----
NM_133264chr1753463 3137 1298 778 39 13261 22631 129 13175
NM_133265chrX22695 2391 1790 --1336
NM_138288chr14194 --21561 562 --
NM_138423chr1542206 2087 1654 200 12113 11417 --
NM_139321chr2084262 3737 3243 3211 3093 1636 1629 811 --21083 800 --
NM_145025chr621019 465 ------
NM_145203chr13----1355 --
NM_147156chr10------11493
NM_152402chr4----1512 --
NM_152437chr1241498 704 565 192 --12133 --
NM_152556chr71428 ----12471
NM_152622chr522346 1017 12964 --1709
NM_152641chr1222604 610 --1721 --
NM_152695chrX32321 1664 775 --11811 --
NM_152756chr531340 865 89 --1626 --
NM_152860chr1211041 --21255 269 162
NM_153018chr1733192 2734 2631 --11124 --
NM_153207chr1231561 477 182 13093 ----
NM_153262chr132565 2050 732 13239 11147 --
NM_170672chr211681 ----1285
NM_175921chr553721 3713 3232 2641 1446 22972 2875 13165 --
NM_178826chr121499 1224 ----
NM_178863chr16----1436 --
NM_181457chr221218 844 ----1449
NM_182503chr654338 3878 2225 58 44 --13998 --
NM_182569chr17----1275 --
NM_207391chr19----1276 1872
NM_207404chr331896 1766 691 ----12218
NM_213609chr3----1889 --