TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-606
miRNA Sequence: AAACUACUGAAAAUCAAAGAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000809chr488385 7350 6765 5990 5844 3309 1244 676 ----11671
NM_001003652chr1888407 7334 2836 2599 2522 1655 655 295 12546 11101 1300
NM_001039618chr1195254 4971 4610 4543 4162 3766 2282 1717 1427 24946 3836 21864 1161 --
NM_001233chr711877 1632 --21649 945
NM_002025chrX99190 7743 6901 6749 6694 2305 1900 1310 369 --47258 6905 3141 2987 --
NM_003108chr296121 5098 4923 2527 2248 2171 1155 300 71 --36873 5816 236 16687
NM_004501chr163241 3140 2542 507 496 436 14055 --1885
NM_006599chr1662899 2736 2254 1824 1212 59 13068 67972 7873 6180 3239 3015 783 17778
NM_018374chr755222 4721 1587 784 470 ----21336 1156
NM_018440chr848544 7120 469 286 12895 11362 23484 2536
NM_032160chr1863791 3666 1310 1153 962 257 --11366 21381 835
NM_033656chr2145333 5089 3675 2187 11611 24918 374 1399
NM_152624chr5107075 6477 5513 5179 5171 4999 2711 1792 1463 1327 34908 2934 677 22483 2051 14616
NM_173468chr435893 2091 2068 --25445 4185 11326