TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-607
miRNA Sequence: GUUCAAAUCCAGAUCUAUAAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX63073 2947 2172 1319 394 316 --62794 2786 2773 2508 360 128 1369
NM_000084chrX106135 6025 5934 5703 5472 5299 5065 4447 2132 691 --56267 4886 4501 2676 95 --
NM_000089chr72594 329 --1214 2540 39
NM_000092chr283718 1818 1809 1426 1324 1317 196 97 23891 752 11215 13528
NM_000112chr575100 4993 3558 1828 1498 924 134 25195 4104 21136 325 14275
NM_000259chr1555475 2305 2185 1565 342 36237 6073 167 15728 15570
NM_000332chr6107115 6046 5537 5116 5102 4476 2662 2001 1090 994 25189 1693 37128 6448 2267 35437 5078 578
NM_000337chr5106260 5820 5648 5183 5138 4558 2571 1759 671 495 45497 4216 2608 1771 11673 35324 4477 1615
NM_000390chrX2788 343 41125 356 81 35 2703 402 1499
NM_000439chr552571 1880 1652 621 465 12423 11774 21012 361
NM_000441chr742024 1814 497 208 2639 487 --12290
NM_000555chrX97900 7222 7214 6891 6046 4891 2456 2372 755 42910 1559 1401 132 27042 6544 37362 1381 728
NM_000618chr12156629 6037 5463 5146 4862 4561 4283 1620 1608 1601 1589 1031 700 526 104 46556 6360 1807 81 12482 26446 1864
NM_000633chr1874944 4489 4179 4064 3280 1401 814 44777 1904 1754 296 13960 23317 1518
NM_000793chr1455147 3455 1379 978 411 33721 963 322 21440 1434 24192 730
NM_000809chr4178832 8750 8374 8303 8088 7642 7126 7003 6459 5975 5614 3466 2930 2212 1225 1121 1097 68938 8390 6267 5664 3069 2011 12389 37522 7298 314
NM_000866chr341884 1782 662 40 21289 1212 11231 21189 714
NM_000875chr1596994 6526 6009 5349 5287 4349 783 402 170 24362 1964 36552 5155 1819 1682
NM_000891chr1763306 1369 811 547 511 302 1384 --22692 2322
NM_000899chr1284361 3743 3559 3391 2961 2824 1241 550 33683 3667 1749 11582 13476
NM_001001419chr5114409 3804 3691 3584 1956 1777 1763 1242 800 249 64 65181 4920 4222 1907 1848 1374 24616 522 23366 318
NM_001001974chr1052250 2032 1596 1500 722 41907 929 668 516 1791 11833
NM_001002860chr1494603 4058 3936 3284 2952 1819 1696 1290 216 23666 2929 21599 1571 13168
NM_001003407chr1094367 4165 4133 4053 3162 3152 1821 1114 568 34917 4880 3757 11655 --
NM_001003652chr18117742 6573 6548 6394 5383 2742 2167 1719 1650 1572 1104 43125 2668 1599 602 38717 3280 168 --
NM_001003674chr1895888 1996 886 831 821 722 316 282 224 46322 6185 2740 1273 26788 5415 --
NM_001003679chr15885 553 215 184 85 --31679 1499 204 --
NM_001003712chr1253418 3366 3191 187 45 11342 33721 3306 865 --
NM_001003760chr662912 1379 1234 1064 775 641 21427 557 12227 43501 2307 1051 335
NM_001004360chr231660 1266 728 11690 41983 1911 1638 153 11873
NM_001004419chr1243995 3809 1854 1545 33466 861 821 --23442 2821
NM_001007278chr1394929 4914 4443 3416 3221 2047 1657 1397 72 55299 4687 3912 380 218 24210 1092 --
NM_001007466chr674662 4395 4334 3449 635 579 268 24053 138 25177 4748 31700 1168 332
NM_001008408chr786387 6185 4445 1851 1200 897 511 396 12035 24179 1231 16410
NM_001008495chr892252 1933 1805 1743 1704 1547 1463 692 198 21605 1426 ----
NM_001008564chr1362029 1882 1821 1515 418 215 1589 1137 11387
NM_001008925chr462387 2284 1417 1295 1079 809 22991 433 22979 1426 13381
NM_001009959chr211844 --32231 348 88 22298 362
NM_001010870chr64477 461 434 375 --1507 2485 84
NM_001010891chr5146692 6571 6407 6187 6150 5299 4508 4228 4186 2287 1494 1356 459 358 26026 2514 26584 1331 46163 6138 4823 1807
NM_001010986chrX32519 2203 2156 --32146 1560 381 2954 898
NM_001011513chr464056 3918 3301 2607 2562 163 33051 604 100 43974 3838 2581 35 --
NM_001011708chr262700 1904 1852 411 352 319 42209 918 897 801 22126 1053 1960
NM_001012418chr653359 3081 2810 599 536 73760 3270 812 797 757 452 69 --22992 24
NM_001012754chr1382167 2059 1896 1803 1641 600 581 497 32127 1830 1573 31739 642 437 --
NM_001013659chr1995135 4960 4571 3841 1334 1232 947 426 53 34212 4187 1622 33350 1224 389 15420
NM_001014380chr13125882 5041 4980 4768 3986 2059 1506 1458 1388 1010 994 462 45109 3707 2263 84 45760 5406 4005 630 11025
NM_001017440chr7107675 6705 5773 5661 5625 5334 5310 5106 2319 821 26274 715 15144 17007
NM_001017930chrX61401 1289 1150 389 305 63 11226 --11079
NM_001018067chr1125152 4844 4786 4640 3471 3462 1670 1576 1204 952 901 658 34425 3985 1094 34659 3531 3369 --
NM_001024647chr12157291 7260 6891 6770 6195 5639 5087 2853 2633 1639 1529 1270 1123 949 719 57624 2176 1694 1003 524 1494 17231
NM_001024948chr1103381 2767 2750 2507 2464 1198 671 439 290 191 1654 32867 841 371 --
NM_001024956chr1184967 4856 4695 4156 3850 1845 872 803 13946 21306 1185 23573 122
NM_001025076chr1075580 4095 1561 1427 1147 190 161 46258 1795 476 199 21520 1493 --
NM_001025077chr1096938 5453 4905 4738 2919 2785 2505 1548 1519 47616 4960 1834 1557 64749 4725 4697 2878 2851 264 --
NM_001025079chr384134 3886 3405 3278 1426 1413 787 542 13509 43798 987 915 30 --
NM_001025580chrX54146 3946 2756 1031 781 33885 1523 877 33893 3586 2940 13383
NM_001030055chr14144306 4231 3940 3462 3386 2894 2875 1441 1346 1079 601 418 405 130 34159 3505 522 24508 33 --
NM_001033087chr2032321 410 209 23308 2925 --32882 2484 977
NM_001034841chr16145510 5493 5158 3964 3804 3744 3578 3496 1862 1815 1647 960 596 117 25205 4034 13618 11593
NM_001037174chr21301 11580 11917 21485 148
NM_001039547chr3138034 7326 6674 6405 6211 6001 5028 3181 2519 2385 1425 1314 1253 22630 484 75181 2957 2121 1479 1270 906 433 24928 1570
NM_001039590chrX123737 3580 3493 2896 2805 2594 1457 1265 972 845 628 543 22948 1342 12653 --
NM_001039618chr11115754 5593 5103 4534 4437 3936 1566 939 725 619 421 74663 3804 2386 2363 2312 1933 398 34992 4803 3698 32257 1881 1634
NM_001039693chr253402 1305 1024 848 778 11428 23290 2786 23426 2622
NM_001039840chrX85228 4683 4191 3719 2033 1264 906 687 55653 5633 1084 1003 966 --41578 1330 1105 67
NM_001039937chr1384057 3778 3387 3336 918 825 473 439 13396 11284 21489 112
NM_001040152chr774192 3922 3779 3654 3388 2061 319 --13438 13251
NM_001040157chr472506 2097 1800 1064 693 174 124 22420 2067 1114 --
NM_001040284chr1655728 5650 4278 1403 237 55327 4927 1940 1450 618 14300 14097
NM_001040441chr114032 31711 856 580 11521 2596 507
NM_001040665chr734158 914 744 35007 4731 3720 23204 529 1626
NM_001040665chr734158 914 744 35007 4731 3720 23204 529 1626
NM_001040709chr141994 1938 953 118 1126 22557 1735 21969 942
NM_001042510chr841915 1654 872 597 2882 827 11950 2852 202
NM_001042555chr1254611 4435 4248 992 915 31587 935 398 23397 670 21005 747
NM_001042599chr2116704 6050 5932 4823 2954 2917 2729 2644 2175 1137 1130 47199 7165 6625 1637 15671 47809 7643 7302 5781
NM_001042601chr373311 2991 2207 840 799 196 118 53179 3088 917 295 211 2538 489 22718 2379
NM_001042603chr12114622 4573 4270 4011 3943 3559 2003 1864 1715 1290 241 45313 3903 1523 744 --13768
NM_001099678chr396193 5666 5529 5200 5145 4327 333 292 228 11200 15206 16286
NM_001100108chr188079 7507 5132 5093 3155 2809 1937 421 57644 7526 6803 6131 881 36941 5366 1167 --
NM_001106chr3117576 6457 3149 3120 2371 1852 1626 797 623 434 184 89626 9538 8811 6438 3454 1407 667 76 26025 1300 19373
NM_001167chrX96496 6394 6359 4822 4630 2694 2667 2290 162 46621 1870 1722 576 14432 1736
NM_001186chr2162955 2618 2473 1149 993 401 63009 2543 2078 1302 783 427 --11113
NM_001204chr2157538 6844 6449 6212 5470 5462 4688 2675 2299 2180 1277 619 505 391 343 26798 5816 32828 2239 2213 36196 5942 5503
NM_001241chr221553 461 12264 21792 427 22386 1572
NM_001259chr795952 5756 5327 4355 4049 1012 398 388 293 54304 1715 909 808 174 14930 --
NM_001304chr17113430 3388 3246 2899 2758 1390 1133 1108 781 573 164 --2996 268 13412
NM_001310chr1282978 2797 2783 2604 2290 2218 2209 1965 --22184 2091 --
NM_001390chr1883626 3589 3421 3335 1395 1071 597 482 2907 500 12405 13433
NM_001412chrX53506 2873 2670 869 320 --33024 438 55 13481
NM_001432chr4103748 3664 3595 3451 1398 1358 925 498 442 426 33433 3273 1254 13735 1542
NM_001451chr16--1476 11262 31228 1221 1088
NM_001527chr6104891 4865 4561 4526 4470 4418 3518 3376 636 72 34072 3869 1099 23729 1575 --
NM_001616chr253178 2788 2443 1196 289 73155 2920 2887 2286 806 312 241 22709 644 1928
NM_001621chr73381 374 32 12632 21182 339 11926
NM_001650chr181299 23613 3094 34152 1131 387 34064 3522 660
NM_001663chr1452642 2368 348 249 104 1884 1110 32410 2403 2361
NM_001690chr332201 2165 403 32491 1962 112 --22208 374
NM_001695chr863432 3189 1712 1682 798 691 33369 2886 578 32697 748 710 --
NM_001759chr1265297 3778 1268 528 251 192 24648 978 45321 3386 1569 204 15286
NM_001858chr6105110 4890 4505 4249 3291 3284 1900 1441 810 147 --11592 --
NM_001859chr983875 2981 2580 1595 1128 821 381 354 43642 2736 1312 909 11382 22950 1033
NM_001918chr199046 9006 8960 8197 7624 6090 3471 2271 31 88488 8039 6914 6143 1560 855 776 374 17419 23491 1071
NM_001969chr1493925 2796 2679 1564 1450 1361 830 700 292 1235 43455 1287 1001 258 1647
NM_002009chr1552659 1885 933 842 324 12787 --1194
NM_002024chrX31779 1408 770 --2586 298 21568 209
NM_002025chrX86854 3491 3471 2975 2923 1774 800 226 36034 3032 1334 63423 3338 3152 2637 1371 751 18422
NM_002035chr1883842 3529 2934 2573 2451 1514 1154 218 23493 1171 143 --
NM_002126chr17104174 3991 3320 3219 2984 2878 2720 1611 1263 1205 21494 29 22565 845 13041
NM_002158chr283650 2744 1284 1136 1112 945 683 337 23269 2431 11234 1247
NM_002210chr243060 3024 2933 2390 53378 3368 2461 2319 900 23527 400 32968 2273 2176
NM_002214chr745474 3764 3746 974 21178 216 35407 4743 3680 24213 3774
NM_002247chr1051764 1732 1719 850 771 ----31609 554 479
NM_002264chr344739 4170 3324 256 23093 1053 --34938 1634 792
NM_002310chr575427 4588 4342 2268 2067 1540 573 26450 646 36399 6367 4702 11692
NM_002336chr12145071 4933 4126 3942 3825 3579 3353 3235 3209 1909 1853 1515 887 56 24095 3112 1471 --
NM_002481chr1167904 7843 7301 6862 6518 6309 5782 5533 5295 4816 3201 2610 1622 1214 950 337 37920 7408 6152 16488 --
NM_002610chr233053 2259 2215 32992 2831 798 2402 118 23159 53
NM_002655chr874910 4872 4770 1835 1248 1137 1034 1171 23429 1261 --
NM_002709chr252999 949 648 383 91 --43457 2811 2577 712 --
NM_002731chr172687 2670 2209 2074 1231 506 463 11016 22762 368 22441 627
NM_002745chr2294341 4273 3750 3244 1559 1215 844 131 122 43366 3294 2996 303 13845 --
NM_002834chr121431 42726 1576 1513 281 2747 106 2158 113
NM_002886chr384966 4347 4047 3866 3510 2079 2001 1730 44251 4056 3425 86 33815 1969 1656 24627 2015
NM_002906chr1192381 2304 2085 2053 1821 1637 656 649 116 11969 11587 --
NM_002941chr31182 --21364 1104 21503 1096
NM_002959chr194433 4025 4006 3338 2967 2689 1257 1235 1166 13531 11536 14426
NM_002977chr293393 2990 2914 2147 1230 1009 868 540 70 11386 --22401 400
NM_003016chr176799 737 345 303 75 59 31542 1303 220 21257 1249 2679 524
NM_003108chr2106983 6632 6191 6031 5479 5435 2201 654 469 451 25041 1358 12116 14888
NM_003112chr722675 2227 62019 1210 483 361 243 55 1657 1871
NM_003161chr1773583 3104 2847 2753 1238 930 694 23206 1325 23628 2905 --
NM_003262chr391899 1488 1363 1161 1144 923 852 217 124 24424 1199 23219 1816 --
NM_003342chr1783013 2882 2612 2391 2359 1272 1063 213 23137 1071 ----
NM_003392chr354194 1583 1198 681 187 33974 2982 239 32941 995 748 12644
NM_003411chrY51731 1696 1509 1458 737 --21474 501 31533 1371 1334
NM_003463chr672451 2436 2206 2175 1062 169 153 32182 962 648 21083 190 12988
NM_003468chr263820 3394 2813 1459 1258 371 12965 14029 24263 1714
NM_003489chr2163312 3015 2151 851 676 25 31241 1095 123 23458 2422 185
NM_003506chr811300 1438 1427 1406
NM_003574chr1865741 5121 4097 1510 1205 1063 43855 2295 2082 1270 --14660
NM_003590chr243883 2492 626 503 21091 154 1536 22877 649
NM_003615chr363998 3580 3438 1408 671 186 12690 --11091
NM_003750chr106925 892 835 793 677 44 1350 1401 1370
NM_003913chr633877 3469 28 1959 34290 127 108 23144 3068
NM_003966chr5147083 6583 6176 5931 5419 4836 2357 2044 1800 871 749 342 285 98 67515 6682 5466 2931 2585 2263 27191 4897 --
NM_004124chr14143544 3306 3241 3088 2983 2893 2837 2502 1399 1257 1209 856 714 431 23348 2343 1149 --
NM_004171chr11159442 8914 8667 7499 7347 7196 6681 3771 3313 2993 2823 1788 1538 876 719 59287 8319 3197 2566 1729 27913 236 --
NM_004229chrX51481 763 653 450 391 21857 792 32085 2014 1720 --
NM_004293chr953317 2976 694 367 227 33378 2498 484 13117 1324
NM_004331chr872399 2363 1726 1708 818 588 488 52289 1869 1678 921 799 21823 70 --
NM_004342chr742120 2079 1946 1901 32094 804 470 12041 1492
NM_004392chr1322119 1854 32284 2103 1976 22597 2092 12126
NM_004412chr102566 76 26024 3797 35440 2309 134 23740 2218
NM_004432chr982401 1901 1648 1557 537 480 260 200 3966 836 734 32307 683 169 --
NM_004437chr182459 1291 1194 880 717 658 455 192 31316 1255 929 12371 12648
NM_004458chrX32504 1704 345 3754 699 691 22510 725 1878
NM_004464chr464280 3634 2809 1628 1252 1143 13709 --23780 3060
NM_004571chr2142965 2810 2449 31 23373 3357 --31349 703 407
NM_004612chr9134434 3806 3531 3499 1825 1327 1309 903 802 722 458 163 61 23479 778 24778 1203 11815
NM_004685chr1382482 2078 1967 1077 801 743 353 228 32529 2400 1900 12826 --
NM_004815chr194339 4306 3998 1901 841 729 704 373 350 --1303 21043 1036
NM_004852chr181912819 12520 11413 10900 10520 10266 9991 8946 8906 8620 4991 4927 4150 3697 2522 2176 1927 1403 1094 414163 11051 4895 1855 12795 411725 10594 4701 117
NM_004857chr1494507 4360 4316 4075 3836 3681 3311 3132 631 54548 4234 3999 1893 1496 ----
NM_004866chr553460 3205 1610 1601 1271 43137 1933 1338 1105 13975 --
NM_004949chr1852180 1991 1727 476 156 11352 3549 327 165 --
NM_004956chr784329 4037 1437 778 679 332 303 256 44555 3488 1469 820 33954 1520 183 13421
NM_004985chr12124368 4208 4012 3288 2869 1560 1122 1022 953 912 347 211 13112 23480 1772 --
NM_005063chr1083484 3176 3145 2515 1458 921 513 406 23810 1152 13167 13690
NM_005065chr1465219 4526 3730 1520 786 68 64132 3737 3366 2056 694 509 24173 1811 15385
NM_005116chr2084403 4260 2833 2782 1500 1076 415 274 44423 3870 937 220 24525 254 --
NM_005156chr995118 4857 4025 3668 3322 1344 921 589 117 --43274 1989 1486 299 34111 3892 661
NM_005188chr11107419 6545 6113 5669 2553 2441 2336 2317 2064 795 37946 2206 1773 37696 1183 217 1898
NM_005207chr2263050 2357 1485 425 225 58 53259 3097 2402 590 518 12858 1147
NM_005339chr463789 2859 1512 1485 893 356 52784 1472 1227 928 735 23114 2732 1508
NM_005436chr1073838 2852 1580 1149 903 812 273 23186 478 190 23850 951
NM_005665chr184315 3699 3652 3571 3431 3396 3291 451 2939 69 23758 3535 13168
NM_005668chr553911 3733 554 429 238 34166 3841 3209 11787 21278 61
NM_005746chr712248 --21917 401 2730 559
NM_005748chr1273450 3180 3129 2735 2575 798 618 --52838 2790 2619 1368 116 1388
NM_005759chr274020 3830 3693 3144 1563 894 698 44328 3729 3684 972 --24767 3230
NM_005857chr141457 1292 324 194 31084 1045 340 --1266
NM_005909chr554273 3919 1509 1104 699 13782 13097 33706 262 62
NM_005935chr4104822 4728 3581 3482 3290 1429 1323 1249 1177 477 25120 1200 1970 --
NM_005941chr864157 3754 3189 1527 804 567 11019 --21288 608
NM_005955chr165409 5118 5044 5011 4501 435 45509 1862 184 112 25274 87 11243
NM_006060chr764329 2808 903 168 148 119 44350 3766 1224 181 1886 --
NM_006166chr1262099 1819 795 716 709 421 22114 1886 42329 2028 449 203 --
NM_006212chr1114951 4443 4071 3826 3801 1918 1911 1603 1111 1058 868 23852 198 14908 25385 3467
NM_006251chr522048 1089 53136 2466 512 300 117 --22552 2140
NM_006252chr1187108 7076 6961 6449 6418 5868 5778 5745 5464 5381 2784 2005 1704 1586 1145 1052 1022 75 77197 6651 5366 4845 2619 2123 1075 25839 3022 27618 1730
NM_006267chr231669 424 70 2415 92 2373 343 21473 1263
NM_006283chr853913 3217 3164 662 37 43712 1797 957 625 54533 4182 1789 1378 750 11767
NM_006313chr1241501 1141 404 308 ----21696 1199
NM_006330chr8--11060 --31245 1135 317
NM_006380chr1764246 3140 1675 1644 1626 1249 --13633 23044 1168
NM_006393chr10114536 4468 4353 4097 3972 3729 3021 2785 948 433 22 74452 3010 1739 1168 905 366 344 ----
NM_006467chr552295 1889 743 150 112 21990 922 2259 52 1666
NM_006526chr2052207 2091 1672 687 350 22022 83 --21838 1529
NM_006544chr14135912 5164 4446 4413 3840 3691 1905 1839 1599 1119 704 181 162 66129 6069 5229 5216 1349 907 24706 1001 12102
NM_006572chr1753473 2532 2245 1172 878 22404 2362 11029 43386 3316 2563 1085
NM_006595chr1131868 675 257 22053 417 41963 1778 1316 696 11680
NM_006599chr16127472 7054 5916 3228 3201 3018 2766 1920 1892 1714 1206 112 67600 5984 2661 2194 1956 425 2805 243 --
NM_006606chr2072926 2285 2262 2190 1280 768 223 32306 629 367 22127 1043 12769
NM_006750chr16116372 5582 5100 2968 2644 2428 1643 1361 1008 948 658 67871 7636 6117 5813 1977 1916 26949 898 15182
NM_006777chrX62448 1891 870 175 96 34 1308 1286 11024
NM_006895chr271966 1464 1441 411 386 115 40 1771 --22036 162
NM_006902chr182604 2596 2522 2142 2034 978 953 581 11329 12634 23019 2728
NM_006915chrX62390 2275 1725 909 582 62 22292 376 22124 665 --
NM_006981chr952268 1924 1096 976 294 32963 2004 75 12360 12415
NM_007006chr1693151 3079 3034 2625 2447 1012 858 797 141 53433 2914 2196 1424 897 23157 2662 23574 2573
NM_007007chr12124764 1934 1644 1598 1358 1065 931 840 758 565 461 277 34205 4096 1411 1213 11338
NM_007011chr15126892 6635 6307 5420 5099 4273 2739 1481 1291 1186 1169 536 66236 4633 1969 1329 1075 743 16313 16015
NM_007038chr21105641 5616 5234 4953 1830 1639 1508 1393 1318 472 44572 2066 1895 654 25140 280 15045
NM_007114chr33975 919 789 42842 2230 420 203 33033 390 189 12215
NM_007172chr2293296 3147 2958 2901 2334 1160 1028 526 378 22411 238 23017 224 11233
NM_007173chr1171779 566 536 365 281 262 221 21719 1584 2940 542 1179
NM_007231chrX52155 1935 1575 695 313 ----32013 741 441
NM_007249chr1368904 8519 3183 2578 1226 865 79429 8133 7660 5796 3699 3228 1214 47808 7650 3018 385 58543 7022 6792 3608 3160
NM_007347chr1533176 884 426 42790 2242 701 434 --13197
NM_007373chr1061622 1543 1382 1320 556 210 1451 11575 1458
NM_007375chr162806 2769 2740 2715 1800 1727 1781 1391 11897
NM_012081chr573608 2991 2849 2600 1321 1084 410 33485 2760 1418 12838 12552
NM_012096chr333509 2368 38 32934 2587 2341 43614 2847 2802 2510 13389
NM_012164chr966098 5300 5064 2879 1730 405 25462 2222 36738 5781 5109 21495 1450
NM_012193chr1175261 3828 1857 1832 99 57 34 53943 3890 1970 1948 195 34357 620 351 --
NM_012199chr184551 4005 3787 3674 3367 3352 729 396 24527 3878 23427 924 23592 1297
NM_012214chr2105968 5898 5881 5277 4330 4177 3981 3961 499 353 76093 4986 2552 1812 564 517 176 --36396 5857 310
NM_012262chr185029 4943 4828 3313 2097 1991 1521 40 11377 23724 985 24794 1693
NM_012287chr374168 4075 3845 3436 3319 3258 1795 34251 3132 1197 13866 33746 3097 901
NM_012343chr53991 801 708 ----21018 457
NM_012382chr5104290 3078 1677 1618 1604 901 652 616 504 323 74383 4313 2805 1713 939 525 169 125 --
NM_013230chrY91724 1660 1272 1200 618 601 381 190 161 --1171 11385
NM_013231chr1454244 3101 930 535 90 53573 2838 1599 1411 991 1123 1636
NM_013255chr7157969 7042 6313 6247 3432 3183 2987 2775 2440 1615 1034 745 418 395 57 37065 5857 2091 12017 23420 946
NM_013374chr332146 404 169 12267 12635 2291 229
NM_013386chr141520 1450 631 403 41742 1618 731 208 11354 1701
NM_013943chr142862 2401 2134 344 33268 2113 446 23029 242 1812
NM_014028chr652427 885 774 291 88 42836 532 400 357 21325 187 --
NM_014034chr631386 589 347 31116 1056 371 1149 1487
NM_014048chr1645277 5152 4548 1834 2615 160 12042 24698 1519
NM_014155chr1197537 7503 7334 7033 7004 6055 1977 1203 285 75162 2569 2448 1923 736 306 72 16473 25939 4766
NM_014283chr14479 454 424 50 11170 21106 71 1277
NM_014294chr841170 1123 1055 264 1475 31111 284 154 1910
NM_014331chr4127847 6806 6627 6386 6314 5884 5804 5575 2126 1793 748 566 11890 22417 1975 11874
NM_014399chr731010 825 704 --2908 756 2930 193
NM_014423chr595099 5086 5079 5064 4979 4399 3492 880 672 21802 1639 25532 3750 35050 4709 541
NM_014445chr361948 1766 1715 441 231 67 11591 22128 396 --
NM_014494chr16102404 2318 2279 1601 888 739 724 701 285 151 32256 777 638 11773 --
NM_014517chr361793 1444 1399 1291 770 562 21451 338 11387 11572
NM_014554chr1222136 1725 12100 11901 21531 1463
NM_014701chr1552456 2433 2392 916 387 32371 2313 309 --22860 905
NM_014702chr642580 2534 771 740 43340 1081 436 385 22318 107 --
NM_014707chr762093 2076 1941 1719 673 308 1836 171 12037
NM_014730chr12105143 4805 4615 4511 4390 3305 1658 1073 869 605 23215 1798 21702 1124 1803
NM_014746chr264304 4252 4185 4150 1504 662 44200 3128 1265 1062 22845 1518 --
NM_014755chr264087 3025 2844 1010 202 148 24046 4004 23031 251 23736 3269
NM_014803chr1042718 957 775 513 2462 202 1998 1172
NM_014877chr17126804 6753 6641 5566 3063 2634 2330 1237 1048 984 744 706 77637 6508 5413 5383 5096 1470 668 17814 15192
NM_014899chr572947 2372 2105 1256 1227 735 529 32637 2396 148 --1488
NM_014904chr1033813 1570 178 13460 2856 840 23867 600
NM_014906chr1784035 3756 3535 2959 1566 1216 694 436 33827 3573 1226 --13520
NM_014920chr683643 3352 3178 1200 1085 1019 574 566 31431 771 372 1184 --
NM_014936chr652477 2417 1919 1050 622 2288 98 12781 1601
NM_014947chr162814 2403 2057 594 277 130 32758 2270 929 32350 2316 248 --
NM_014962chr2041976 356 346 324 2857 447 --22326 1058
NM_015025chr282563 2273 559 416 364 269 183 99 22096 878 11072 1107
NM_015026chr1284394 3337 1760 1610 1548 1147 982 780 24755 789 24352 4028 --
NM_015032chr1322935 1802 42516 1925 1094 40 22421 851 1367
NM_015035chr20126499 6323 4959 4889 4657 2041 1900 1866 1303 873 761 572 21733 1336 16637 16679
NM_015051chr972620 2498 704 601 570 539 104 23217 2765 22478 2245 12198
NM_015055chr1142705 2042 1930 655 42785 1913 869 561 --22601 1108
NM_015071chr596556 6535 6188 5373 4304 1965 1734 814 233 26142 1677 21971 938 11707
NM_015092chr1684212 3887 3046 1828 1171 972 927 453 34612 4276 3141 --1347
NM_015110chr952421 2400 2252 1798 1779 41916 1679 647 111 --1889
NM_015192chr2092777 2281 1898 1845 905 745 698 431 317 22011 388 22881 2686 1625
NM_015206chr1553858 3835 3017 1288 1104 43345 2930 1017 896 --32919 1507 775
NM_015265chr252248 1703 695 608 160 11754 --22451 1818
NM_015310chr8106969 6048 6001 5924 5680 5606 5505 2359 1334 710 48032 6683 6484 3089 --15993
NM_015313chr11104586 4535 3211 3142 3017 3010 1495 1142 825 348 24521 3771 142 31901 1433 367
NM_015349chr643105 2680 563 490 ----41233 1051 770 381
NM_015458chr874711 4319 3436 3282 765 536 382 33640 3380 1461 34883 4860 1134 --
NM_015560chr362738 2516 2229 1794 670 501 1393 1579 22772 709
NM_015565chr2132145 2106 772 2907 197 2696 58 2757 232
NM_015569chr1144773 4633 4174 4028 3834 3632 3358 1935 1272 852 706 304 182 59 23453 1450 24873 3172 23856 294
NM_015576chr3112731 2500 2145 1952 659 643 575 352 320 242 37 --1397 12585
NM_015878chr872042 1842 1593 902 648 473 138 21478 622 22023 1994 --
NM_015879chr18126790 6605 5925 3361 3089 2502 2041 1935 1892 278 260 233 38309 8228 1191 23403 1523 15322
NM_015886chr8115435 4827 4475 4094 3946 3843 1929 1445 1298 854 326 65468 5326 1742 1498 1037 175 65597 5296 3798 3550 1732 622 22299 184
NM_015888chr173301 2647 2397 1345 1101 1065 968 43164 2070 595 266 32952 2825 213 1568
NM_015906chr173882 3689 3608 3013 1481 1122 391 24813 3110 24112 250 24411 852
NM_016206chr3138788 8185 8166 6949 5893 5598 2695 2681 1989 1791 894 710 447 46499 3555 3310 2463 36419 1371 1058 23290 2193
NM_016248chr1363779 3637 2885 2496 2467 1382 33882 2961 1013 2258 81 --
NM_016252chr21697 --1723 2757 738
NM_016271chr1851930 677 552 381 289 21530 316 --12334
NM_016275chr352589 2386 2023 496 356 22734 191 --22814 330
NM_016322chr982766 2682 2338 2162 2041 490 360 29 43241 3126 2752 2489 1666 --
NM_016340chr521004 506 --1451 3478 433 22
NM_016448chr141874 1744 1542 259 11630 --21345 478
NM_016530chr1573883 3009 2893 1292 1115 754 446 --1787 1696
NM_016617chr1352056 1706 1660 775 437 --22150 1539 1324
NM_016630chr153540 232 212 --1218 1578
NM_017423chr462099 1648 862 457 349 134 22029 518 11601 12178
NM_017628chr454171 3646 3217 1876 957 21611 990 1179 1467
NM_017633chr633873 3755 3036 23799 2622 43928 3527 2891 845 12637
NM_017637chr9118958 8291 7597 7342 6857 5775 5704 3743 2442 195 54 58342 6465 2774 1473 490 18147 --
NM_017643chr1762886 2830 2498 1152 995 261 43009 2962 1914 233 42114 1142 614 223 11013
NM_017644chr3104664 4217 4011 1891 1520 1278 1064 723 235 124 24867 3438 14272 13297
NM_017650chr755082 3676 1975 1561 1110 25756 1316 24385 3719 12173
NM_017655chr141535 1078 433 83 1136 --21478 1388
NM_017658chr1454045 1527 1429 972 635 33332 3074 1513 21778 820 14064
NM_017709chr194291 3180 3163 2777 1331 1283 1109 338 89 64298 4172 3656 3470 1463 1265 ----
NM_017742chr1861701 1685 1446 1408 337 179 21565 379 --11903
NM_017813chr865243 4744 4711 3661 3647 3546 31702 1107 217 25831 458 --
NM_017919chr985477 4412 3845 1808 1732 986 518 236 23741 83 12186 15568
NM_018247chr673058 2983 2451 2232 2020 1151 99 2979 908 11960 13147
NM_018293chr342800 2749 2366 2158 32587 1886 1853 22303 1868 --
NM_018351chr1284529 4457 3163 3109 3067 2935 1718 477 23202 3193 11809 24261 3733
NM_018362chr1153134 2865 1362 905 532 23901 3180 1703 23012 1167
NM_018374chr754919 4429 4355 4270 1818 64909 4052 3521 3362 3189 635 14958 43317 3310 906 356
NM_018409chr463240 3139 3015 2553 2438 430 33180 2505 615 13151 1387
NM_018440chr8118127 7322 7207 6803 6759 6654 3381 2811 2193 1805 1619 46216 3073 1174 781 33275 2690 910 22525 1391
NM_018566chr185000 4495 4098 4091 3872 3137 1177 615 11701 34729 3941 1649 --
NM_018638chr12135652 5350 4322 4259 4075 4018 2104 2031 1678 1570 1328 1029 104 44234 3926 892 155 15009 14598
NM_018650chr162256 2058 742 735 331 60 21627 415 --1346
NM_018847chr91535 --21757 463 21768 647
NM_018999chr1074164 4087 3856 3700 3489 1484 200 44358 1920 1791 91 1915 24630 4494
NM_019044chr284720 4269 3968 3250 1697 1623 1150 816 44531 3942 3877 1709 21809 963 --
NM_019094chr1241209 764 507 307 22998 1258 --22871 2833
NM_019114chr941823 1684 351 228 ----22522 613
NM_020119chr743256 1614 1062 749 33215 1165 269 34049 2585 927 1742
NM_020122chr255204 1971 1738 989 515 34414 1293 1186 16045 25425 4686
NM_020337chr442903 2761 2315 2062 32656 2471 2294 1301 13155
NM_020390chr374471 3986 3582 1881 1542 196 58 1935 34007 3266 3044 11299
NM_020432chr721424 800 41943 1851 478 392 --22308 669
NM_020640chr362155 1891 1430 878 869 314 31942 1610 822 --11700
NM_020651chr261690 1582 589 287 263 238 21391 226 ----
NM_020718chr1695760 4858 4179 2601 2587 2199 1225 327 103 46532 5628 4696 343 25141 2162 25239 4846
NM_020772chr1778040 7753 7613 7479 5491 1587 1538 47278 7199 6768 2598 11632 26869 2412
NM_020774chr1896171 5946 5823 5530 4466 3880 3831 1759 1261 14733 24143 907 46127 1697 1509 207
NM_020801chr572556 2110 2091 2075 1890 935 922 1468 --2950 318
NM_020854chr1861205 1133 1083 504 307 180 11231 2582 378 11329
NM_020871chrX62475 1896 1762 1626 998 213 1925 3871 408 44 --
NM_020917chr1983156 3094 3069 2827 1544 1513 1436 258 33769 3380 60 23243 414 12843
NM_021033chr1372740 2661 2273 2180 1106 730 171 23317 1262 23512 3342 1271
NM_021083chrX92830 2713 2466 2454 1071 1045 665 512 47 43500 3149 3061 2289 23421 616 --
NM_021629chr3104067 3912 3642 1752 1473 769 667 616 486 382 23547 3081 2948 220 1815
NM_021914chr1432258 1693 736 32184 1742 795 --32267 2249 955
NM_021954chr1363189 2455 1068 945 788 488 --43575 3529 2708 548 --
NM_021961chr1187083 5618 2852 1539 1520 1444 1387 157 66136 5830 5460 5081 5016 592 1951 26355 1922
NM_021964chr3165537 5199 4541 4212 4166 2519 2122 1938 1890 1787 1441 987 939 797 581 182 55951 4837 2274 1472 1064 35828 4684 4429 --
NM_022048chr15116325 6027 4965 4697 4151 2311 1932 1702 1398 913 842 11066 11753 15955
NM_022058chr2--41917 1492 551 468 11810 1650
NM_022103chr1931126 228 100 2321 120 --2952 166
NM_022351chr821276 1174 52776 2750 1217 1159 736 --13154
NM_022459chr13145797 5761 5480 5372 4463 4182 1699 1688 1272 1073 555 114 107 97 ----15544
NM_022491chr1293015 2791 2682 2356 1210 1020 419 325 259 22491 308 --13074
NM_022771chr121353 1313 --2932 77
NM_022828chr531238 1168 239 11767 21519 274 21638 1340
NM_024345chr985426 5070 4659 1972 1860 1202 386 40 25145 2366 35973 5889 916 --
NM_024423chr1894038 3657 3523 3451 2887 1665 722 715 328 24139 626 13040 1172
NM_024524chr382983 1144 1116 1060 975 969 492 130 1344 42276 2158 2116 1026 --
NM_024607chr844111 3252 1302 1254 34293 3906 3829 13601 23774 2837
NM_024613chr841486 1294 653 575 31569 1394 1267 --21185 457
NM_024761chr975254 4915 4878 4827 4126 975 444 64971 3940 1724 1253 351 22 13611 --
NM_024828chr961079 988 639 466 78 36 --11398 1419
NM_024841chr1142369 2200 881 408 ----21933 1650
NM_024884chr1494284 4096 3442 2842 1528 1520 1423 1296 1278 24343 407 --23976 1471
NM_024947chr3149646 9286 9262 8917 8651 3433 3306 3024 2306 1818 1593 1384 1240 609 58069 7319 5929 3688 2888 16817 25945 1509
NM_024949chr4104744 4639 4231 1988 1965 1860 1675 1642 1174 939 23301 1537 21136 463 --
NM_024953chr1272729 2477 1054 1046 787 488 214 32168 2102 1861 12278 --
NM_024989chr2178219 8086 7653 6976 6760 6639 5111 3123 2774 1650 1622 1127 968 579 408 156 99 77517 6405 5680 5016 2195 1750 220 55804 5436 5179 2048 2001 13147
NM_025146chr392650 2529 2344 2077 1858 1040 736 223 190 11069 1640 --
NM_025160chr173538 3464 2729 1732 870 607 69 31355 1082 374 --1730
NM_025179chr144552 1105 1098 328 24169 801 11083 23860 1072
NM_025208chr1172500 2239 982 813 458 341 230 1441 --11728
NM_030621chr1424084 329 31280 712 185 33916 3637 1665 13002
NM_030627chr553321 2710 1337 1101 635 33756 3422 1395 --13564
NM_030647chr785753 4588 1971 828 562 530 185 34 16282 22305 1272 1399
NM_030650chr263484 3374 2586 1625 1513 213 21461 1106 43819 749 141 118 --
NM_030755chr145898 646 370 93 71 52455 963 296 226 176 12341 --
NM_030791chr1451752 1345 673 642 246 --21525 420 21802 1158
NM_030806chr1169313 9237 8967 8903 8199 7242 6179 2346 2220 2057 1482 1468 1342 715 629 502 19351 27206 1150 --
NM_030816chr141202 976 777 234 32551 2416 2299 1524 11392
NM_030817chr1252942 2416 776 400 134 63330 2995 2869 2372 2290 1103 23398 3037 --
NM_030885chr382294 1954 1907 1853 1722 696 330 208 31999 1875 867 ----
NM_030953chr561622 1459 546 352 146 136 21155 629 11659 1390
NM_031216chr185669 647 477 292 98 31953 272 218 31417 805 441 2371 209
NM_031435chr1233280 2751 2338 2592 245 1601 32908 458 177
NM_031469chr653994 3446 2808 432 37 3923 402 143 13851 23813 681
NM_032102chr1172990 2364 1922 1913 1081 252 144 42346 2006 1098 308 1260 --
NM_032160chr1884139 4067 3474 3220 1033 677 609 169 32937 2771 445 ----
NM_032228chr11133143 2519 2426 2346 2321 2241 2170 1316 1156 845 821 435 243 23261 677 23563 403 12196
NM_032373chr1042282 2087 1661 482 45522 3629 1377 1356 --23655 1417
NM_032408chr73878 863 87 ----1870
NM_032440chr1062954 2846 2797 767 717 551 22260 544 12609 1746
NM_032446chr5113678 3053 2773 2756 2706 2583 1267 1172 723 572 120 --53003 2532 2504 1295 352 11025
NM_032457chr452969 2713 1540 1316 886 32607 1344 513 11402 11015
NM_032859chr1344011 3288 2473 1444 1116 43878 3849 2763 775 --
NM_032873chr1164307 3622 749 717 231 36 43574 1798 1524 913 24384 1193 13301
NM_032900chr10123850 3457 3446 2596 2470 2426 2405 1262 658 537 448 111 1326 11234 11150
NM_032968chrX43680 3222 2880 988 24153 3620 --12887
NM_032973chrY53672 3217 2875 1689 988 24145 3612 --12882
NM_033222chr941139 1123 121 101 31327 1177 563 --2947 59
NM_033224chr7107611 7088 6513 6498 6038 3167 2194 1590 877 482 27865 6605 37315 7045 1724 45818 5645 5073 2757
NM_033285chr854229 4027 3390 3068 1754 1536 11232 43681 850 745 599
NM_033505chr275356 4898 1586 1313 1218 748 161 16322 12660 32060 658 390
NM_033656chr21145954 5845 5766 4341 4220 3873 2366 2211 1682 1625 1537 1427 1386 246 35578 3850 269 34251 2101 695 --
NM_052879chr1292998 2645 1180 958 722 399 314 138 76 43703 3172 1264 631 --1588
NM_052907chr1284206 2730 573 342 151 100 68 48 2529 182 --44119 4085 3293 841
NM_053042chr472664 2083 2056 936 499 454 52 53149 3031 1993 1957 1094 1189 --
NM_053064chr1432725 2220 761 32831 887 318 22745 95 12667
NM_080546chr911985 21806 1438 --32209 1883 791
NM_080743chr692299 2117 2073 1620 793 678 422 163 148 41864 894 688 662 1761 --
NM_080867chr1484383 3502 3217 1988 1483 639 481 78 23577 812 34651 1032 347 1319
NM_133334chr445938 4568 4472 2087 35764 5224 1897 12027 11462
NM_133477chr452912 2820 2753 2597 957 52872 2686 2435 946 548 12087 13246
NM_133646chr2105486 5307 5294 4921 3595 1632 1528 1430 379 333 64844 4464 3654 3387 2104 39 21554 852 1874
NM_138444chr13134555 4376 4173 3240 3051 1761 1467 1284 1210 1096 527 323 208 44821 3983 1323 620 13116 11070
NM_138459chr673656 3125 2585 1322 912 267 23 43338 2518 1425 1046 43059 2377 993 29 32961 1451 748
NM_138468chr266003 5922 5778 2156 1278 1113 34302 481 343 46243 2249 596 161 1537
NM_138473chr12114142 4042 3661 3634 3533 3433 1567 1228 1003 252 194 23916 2067 11138 24269 1891
NM_138771chr741030 375 243 235 31505 530 295 --1448
NM_138782chr552312 2100 1774 551 415 1401 --1118
NM_138959chr1106283 6093 5590 4639 4578 4430 4206 2702 1638 591 12279 15605 26270 161
NM_144571chr4136917 6158 4913 4378 4362 2714 1070 1052 661 650 471 343 170 25898 2275 36229 5711 294 22784 567
NM_144578chr14103448 2149 1611 1455 818 751 510 461 230 39 65416 4740 3946 3746 1653 1240 32129 2044 1416 14694
NM_144721chr431898 348 107 1157 --22790 2690
NM_144973chr1284744 4601 4001 3466 3362 1263 870 851 44295 3527 1231 589 4784 560 172 64 25248 121
NM_145257chr174051 3984 3564 3408 1556 762 214 33942 1497 1418 --13766
NM_145259chr276393 5074 4800 4787 2526 1990 1499 35340 1110 219 22450 2147 15239
NM_145284chrX71647 1613 1570 543 377 300 216 32489 2247 2084 --22394 2321
NM_145735chr1342260 2097 1841 303 22545 112 --22716 878
NM_147189chr852245 1890 1751 1494 900 32314 1779 387 22034 936 12078
NM_152261chr1262418 2407 2322 289 262 92 1886 --21924 1561
NM_152277chr542023 1914 1501 360 2792 203 31975 1352 514 1232
NM_152305chr352137 1986 1389 248 210 12110 22243 375 1397
NM_152332chr1482697 2586 2019 1965 1038 879 152 21 --2738 521 1982
NM_152400chr462021 1562 468 196 32 25 11666 3688 659 480 --
NM_152422chr941702 241 217 112 3531 314 200 21887 152 --
NM_152437chr1292450 2388 2253 2196 1912 1810 1772 1674 184 1754 11792 --
NM_152556chr782442 2412 2353 2137 1875 1829 714 598 31953 1928 846 ----
NM_152622chr533456 3099 89 13332 1794 33026 2774 2566
NM_152624chr5126465 6222 5673 5458 2958 2850 2392 2175 1627 1269 668 243 97309 6951 6660 5844 5558 2516 2374 1673 906 47374 5218 2803 53 17036
NM_152754chr753763 2355 1507 322 269 53667 3409 2940 2847 277 43473 1203 541 177 --
NM_152756chr533716 900 207 63994 3307 2984 2942 1475 1304 24091 1271 23429 1207
NM_152758chr893055 3037 2687 2389 1227 769 435 323 115 32504 2154 1001 12949 --
NM_152774chr762555 2149 1854 1835 1024 307 32757 2698 2615 22420 1717 --
NM_152787chrX72913 2843 2723 2536 504 352 41 53873 3708 2935 1440 1210 --1916
NM_152835chr13954 716 493 52849 2472 908 514 385 --22343 1102
NM_152903chr1372774 2553 2420 2339 481 336 239 5980 956 390 153 68 11893 --
NM_153207chr1253684 3341 1349 862 854 53966 3229 3077 1129 772 2792 454 --
NM_153371chr1332237 1922 484 52135 1930 1913 1684 52 22284 963 11783
NM_170710chr463157 2423 2334 1220 1166 849 13089 1401 12551
NM_172071chr1167427 7032 6673 6395 2758 2542 2209 1701 1666 1602 1287 1117 975 717 342 287 47223 6323 5410 2457 67004 6639 5207 2392 981 886 27057 581
NM_173468chr4155453 5145 4823 4249 3942 3808 2440 2337 1973 1915 1236 986 902 875 551 14473 25545 4737 14431
NM_173510chr2272822 2616 2320 1937 1908 1894 130 11879 --12829
NM_173552chr372380 2368 1973 1883 544 392 215 22059 484 12435 191
NM_173808chr174216 3926 3722 3580 1579 1521 1477 44407 3465 3119 792 23777 3313 43136 3026 1703 685
NM_174902chr1161756 1471 559 516 420 412 --31237 1217 484 11270
NM_175861chr12125840 5748 5437 5238 4653 4279 3718 2310 2069 1475 1195 603 64497 3971 1442 1087 926 308 11756 1447
NM_177538chr258867 8183 8139 5912 180 108315 7829 6589 6114 5426 2663 2644 1281 1241 462 2998 138 11927
NM_178505chr1083508 3459 3420 2892 1355 937 360 312 1269 32858 2591 2273 --
NM_178509chr1744105 2727 1029 399 42774 1471 459 236 11438 13886
NM_181521chr16186772 6188 6160 5971 5647 5585 5444 5137 4993 4761 4449 2822 2739 2695 1968 1293 736 320 11832 37151 4659 2594 11000
NM_181705chr555759 5481 1199 994 301 34643 3894 2255 15033 21098 322
NM_181836chr542219 2196 1664 1077 42640 2451 1968 197 12247 11724
NM_182493chr1655192 4727 3974 881 87 55165 4037 3724 1737 520 25139 4043 15362
NM_182503chr6155597 4502 4362 3952 3676 3610 3383 2024 1900 1724 1221 957 847 363 247 25468 3870 21194 650 11382
NM_182515chr1986403 6382 6218 6135 6017 5931 5616 1117 76711 6495 5959 4584 1731 1589 872 35597 5477 41 11282
NM_182757chr683310 3077 3047 2595 577 409 334 128 33344 3331 104 23432 2237 1884
NM_194285chr1143279 2340 2254 554 33135 900 334 22362 151 1820
NM_194291chr852955 2904 967 757 728 32596 937 790 12146 12577
NM_194314chr174680 3850 2129 2072 575 383 30 34779 4353 2228 44448 499 198 173 --
NM_194439chr461497 1464 1401 1245 311 303 11150 --1125
NM_198273chr572481 2463 2366 2055 1035 428 154 33151 1945 144 22142 2122 22237 754
NM_198468chr694359 4079 3878 1330 1168 1120 979 906 690 11824 23701 3597 --
NM_198503chr142181 1822 1595 345 1152 1195 2600 220
NM_198549chr152836 2670 2654 657 284 13131 32564 549 26 12643
NM_198581chr2106783 5878 5331 4740 2380 2152 2134 1938 1236 981 87309 6826 6442 5933 5483 5157 4854 385 1577 --
NM_198859chr394668 4581 4251 3244 1426 1419 1079 950 637 1213 15175 24363 1167
NM_203463chr2104820 3397 3315 3305 3069 3024 953 777 612 132 54438 3693 1965 638 494 23589 3322 --
NM_206853chr6113915 3363 3257 3200 2683 2653 1258 1176 1091 474 158 33822 3140 555 22852 1307 1664
NM_206854chr685176 4624 4518 4461 3944 3914 1735 1419 45083 4401 3433 1816 34113 3481 106 33687 1925 226
NM_206855chr6106141 5589 5483 5426 4909 4879 2384 727 540 247 56048 5366 4398 146 44 35078 4446 1071 34652 1191 332
NM_207361chr1365290 5095 4540 1618 1204 145 45631 4325 3818 2493 46221 2117 612 151 --
NM_212558chr963527 3345 2717 1423 1265 406 23192 1001 --1800