TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-608
miRNA Sequence: AGGGGUGGUGUUGGGACAGCUCCGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000074chrX--1141 3850 783 77 --
NM_000084chrX106199 5385 5187 5125 4539 4344 2505 2143 1336 1248 --47015 4422 1820 924 14533
NM_000088chr1761205 1132 524 516 378 34 --31122 496 401 --
NM_000112chr535026 3970 1924 --11855 14257
NM_000118chr96658 619 329 309 210 21 --189 --
NM_000217chr1255178 4237 3688 1000 785 --11334 23525 1815
NM_000245chr74741 489 407 233 22020 1670 41674 1384 654 602 1747
NM_000260chr112505 203 1516 3208 100 72 --
NM_000278chr1071895 1811 1786 1734 843 784 165 1133 61846 1836 346 250 231 73 32139 138 122
NM_000282chr13295 28 ------
NM_000304chr172876 381 ----1426
NM_000314chr1012073 23208 2050 32448 1182 410 12672
NM_000335chr331467 1396 564 21709 265 --11577
NM_000393chr21261 ----11479
NM_000408chr2180 12248 11201 --
NM_000458chr174843 762 163 61 1151 ----
NM_000461chr343390 848 428 294 --22892 377 14100
NM_000476chr911128 21260 950 41080 294 90 44 21136 40
NM_000530chr17771 447 370 364 302 285 251 --2406 202 1211
NM_000539chr331517 1098 1031 --145 175
NM_000540chr191138 --126 133
NM_000554chr1933324 2231 682 --2837 157 --
NM_000555chrX117645 7415 6003 5600 4999 4991 2167 1741 1623 514 229 --67659 6983 6788 5168 2688 2579 15762
NM_000599chr2113643 3633 3555 3514 3316 3106 2989 2873 216 87 29 34067 3217 541 43494 3194 3161 40 54072 3476 1402 1309 76
NM_000612chr11153747 3570 3462 3173 2934 2414 1535 874 846 819 698 663 497 244 39 23430 373 32924 504 84 --
NM_000682chr281283 1247 1203 754 657 505 423 51 11812 1226 11468
NM_000719chr12216567 6455 6447 6437 6354 6347 5948 5237 5010 4300 4251 4066 2606 2267 2110 2004 667 568 554 300 161 45908 5387 5266 5257 24202 2353 16022
NM_000723chr1781230 1073 1057 610 604 477 284 234 31186 1109 547 41224 1204 688 681 1160
NM_000725chr124645 247 188 21 11011 --160
NM_000761chr1531361 973 402 --1450 --
NM_000801chr2031061 1013 177 ----1114
NM_000809chr466508 3195 1851 1613 388 243 --26060 5905 1367
NM_000827chr551838 1762 1689 455 202 --2574 460 156
NM_000833chr1621214 175 1578 --11163
NM_000836chr195942 756 622 197 143 --5746 640 324 311 26 1768
NM_000875chr15135864 5853 2797 2043 1716 1693 1559 1489 1471 977 711 703 430 21977 1353 74964 4776 4630 1933 1478 1332 982 24318 1859
NM_000922chr111220 --1168 --
NM_000924chr1271337 1282 1156 372 172 121 60 --21307 253 31303 1298 431
NM_000950chrX----21461 686 13040
NM_000961chr2073814 2687 2436 634 429 274 260 23772 1495 23299 1217 --
NM_000966chr124818 435 421 168 --31050 760 111 --
NM_000984chr172443 167 ----1177
NM_001001323chr121248 12829 1167 --
NM_001001344chrX92031 1902 1874 1831 1811 860 581 534 335 --31998 1635 866 --
NM_001001396chr153659 1777 1683 308 47 34214 589 190 33760 107 67 1594
NM_001001433chr2052707 2634 871 762 69 42591 2319 1023 979 ----
NM_001001502chr53378 236 171 --4569 527 457 57 1465
NM_001002909chr1731654 586 265 1645 21914 270 11622
NM_001003652chr1888499 7723 7612 6349 5718 5476 2371 1611 16628 11538 1944
NM_001003681chr22----11348 --
NM_001003891chr223837 817 656 ----1878
NM_001004419chr1264346 4220 3552 2789 1804 581 24403 4303 11624 --
NM_001005209chr23510 504 71 1666 --1688
NM_001005271chr174986 849 89 26 --31102 183 99 --
NM_001005336chr9--1419 4500 491 438 41 1424
NM_001005404chr1793636 2879 1379 1342 1330 810 296 116 96 21600 1027 1134 12857
NM_001005415chr191395 --1438 --
NM_001005609chrX33356 3039 2320 1368 23552 3218 1609
NM_001005845chr82363 213 --1300 --
NM_001006115chr342664 2442 543 402 --32779 2348 716 1727
NM_001006636chr21905 ----1197
NM_001007026chr123410 88 53 1497 2379 59 --
NM_001007156chr1551852 1673 1319 174 141 ----11858
NM_001008220chr5143860 3760 3550 3541 1068 1001 839 710 697 604 586 187 164 30 43668 2467 195 175 63658 3529 2572 890 878 199 33448 3348 718
NM_001008567chr92354 339 --1311 --
NM_001008701chr1952697 1190 1077 336 107 12953 32943 2646 329 12704
NM_001009555chr4----1678 --
NM_001012426chr6153167 3139 2991 2872 2860 2509 2452 2421 2391 1301 1193 933 902 747 625 --111198 1183 1088 717 688 682 642 547 511 376 188 2974 500
NM_001012643chr19--2460 93 2376 126 182
NM_001012977chrX31313 508 214 --4515 219 185 71 --
NM_001013031chr1072959 2949 2651 1337 1109 662 226 12575 1934 1394
NM_001013615chr141167 1098 1080 955 --21072 788 --
NM_001013640chr1941055 501 218 21 --1872 --
NM_001013693chr1102491 2448 2393 2329 1980 1931 1921 837 775 241 12758 62644 2256 2161 1882 960 888 11863
NM_001014342chr121444 266 21695 1416 ----
NM_001014796chr13146 79 60 --2160 153 --
NM_001014797chr10128141 7891 7661 7302 6284 5846 5398 2814 2513 2210 1005 787 27885 5553 52229 1837 1805 1795 1056 --
NM_001014809chr42890 348 --3762 223 54 --
NM_001014839chr1--2856 119 3891 189 161 --
NM_001015053chr1721488 1176 --31528 514 499 1168
NM_001015881chrX1151 ----1163
NM_001017371chr2------11328
NM_001017395chr3103014 2648 1319 1223 1094 627 535 414 391 30 13362 ----
NM_001017440chr7197284 6918 6669 6520 6005 5947 5937 5894 3127 3014 2771 2461 2173 1689 898 592 517 382 332 47980 7142 4985 3234 76186 5597 3137 2543 698 499 388 1495
NM_001017523chr1231654 244 85 ------
NM_001017999chr131745 1528 931 --42129 1434 547 199 11534
NM_001018108chr1531815 1404 211 21872 247 41762 911 515 190 11608
NM_001018111chr752998 2526 902 887 606 --1591 2565 55
NM_001024226chr13882 722 25 1910 1914 --
NM_001024401chr1672807 1854 1083 865 705 407 350 --62265 1802 783 480 87 46 2460 436
NM_001024660chr3196 21153 180 11420 --
NM_001024666chrX1164 --1659 1564
NM_001024948chr132878 1224 1077 ------
NM_001024948chr132878 1224 1077 ------
NM_001024959chr3274 42 --1335 --
NM_001025076chr1085640 5026 4959 4733 4144 4123 2269 1446 34773 4197 4016 11346 --
NM_001025077chr10116998 6384 6317 6091 5502 5481 2804 1334 437 169 156 46131 5555 5374 1178 32704 1198 459 --
NM_001025108chr222642 1085 13673 1720 --
NM_001025580chrX53792 3601 3264 3192 595 --23847 3152 --
NM_001025616chr431675 634 348 ------
NM_001029859chr1141625 1546 188 154 22392 894 42404 1523 987 882 12130
NM_001030007chr1642559 1536 1234 34 --22754 262 --
NM_001031690chr7113051 2861 2136 2096 1991 1972 1063 952 472 363 308 12851 32736 839 31 --
NM_001031801chr22----150 --
NM_001033117chr374479 3576 3031 1922 1336 817 734 11709 21341 786 44738 3464 1714 797
NM_001033507chr141666 1561 1502 617 --11971 --
NM_001033561chr172320 39 --2839 325 --
NM_001033677chr123353 128 73 --2158 145 1335
NM_001035003chr41544 --154 1988
NM_001037164chr7------1209
NM_001037334chr1842285 419 331 144 1111 --1510
NM_001037954chr1133267 840 42 ------
NM_001039141chr2292647 2626 2239 2047 899 797 671 245 47 31977 816 805 52376 820 526 418 95 32279 2250 964
NM_001039538chr242637 872 742 117 12959 ----
NM_001039577chr133768 2838 940 14124 44221 3391 3012 843 1867
NM_001039590chrX43949 3615 1365 448 13626 --11389
NM_001039618chr1145932 4723 3715 35 --1435 --
NM_001039690chr1631597 908 124 --163 1383
NM_001039711chr15744 219 101 82 41 --4920 908 165 46 --
NM_001039802chr131315 378 127 ------
NM_001039888chr13788 752 515 --1655 --
NM_001040056chr163751 632 193 --2760 311 2588 45
NM_001040272chr951624 1532 928 124 28 --3920 142 59 1114
NM_001040402chr463161 1298 864 842 715 51 ------
NM_001040439chr1661175 355 330 205 60 49 1529 81327 1319 1222 1109 1071 433 408 95 1588
NM_001040613chr811576 21594 158 ----
NM_001040712chr943321 2700 1124 425 --11149 13343
NM_001042506chrX31151 508 214 --4515 219 185 71 --
NM_001042539chr161980 11052 21063 1056 1950
NM_001042632chr2062487 2178 1659 604 507 361 --3615 494 380 --
NM_001044305chr631573 1152 36 ----1369
NM_001080418chr17609 465 248 225 217 123 46 --2449 92 2445 106
NM_001092chr173520 481 163 2208 107 22122 212 --
NM_001095chr1291682 1374 1355 1320 1239 1217 660 547 103 11623 --2716 668
NM_001096chr171166 ----1832
NM_001106chr369226 8234 3482 2956 1635 1132 49735 7233 7122 1446 1307 11145
NM_001140chr17138 --2111 93 1471
NM_001148chr441410 857 326 272 11932 1431 --
NM_001191chr2061152 578 449 320 112 21 1198 51171 1136 492 486 35 11413
NM_001194chr197651 499 263 218 198 175 98 1635 1209 --
NM_001204chr236345 5282 105 35128 5073 4813 1115 --
NM_001222chr1051255 360 338 170 150 21623 487 ----
NM_001271chr1523071 549 1212 1195 1217
NM_001273chr12----122 --
NM_001292chr1551015 966 854 456 212 ------
NM_001356chrX123 --1251 1258
NM_001364chr1154573 3350 1629 969 627 1301 23622 3260 --
NM_001365chr172314 160 1183 2272 106 --
NM_001390chr1852601 2551 1163 331 25 22332 2251 23190 186 --
NM_001402chr612007 1733 --127
NM_001406chr1771620 1341 472 342 311 123 82 21722 628 1578 31571 1287 633
NM_001417chr1221933 461 --142 --
NM_001420chr1972718 2706 2589 1159 1072 984 494 11105 72936 2750 2673 347 337 331 26 31132 234 215
NM_001453chr611163 --1218 --
NM_001478chr123867 789 175 2831 697 2928 82 --
NM_001493chrX2305 95 --2742 237 1101
NM_001497chr921979 999 2280 257 1493 --
NM_001543chr5134525 1835 1387 1121 877 807 697 690 576 365 345 337 173 24181 50 23214 1917 41530 1525 1239 621
NM_001554chr1--1453 1432 --
NM_001610chr112577 493 --129 --
NM_001616chr223463 2981 11097 13522 --
NM_001635chr71788 --2968 926 1701
NM_001654chrX1298 1362 1120 --
NM_001655chr113837 594 156 11470 11769 1600
NM_001664chr32768 230 1797 ----
NM_001678chr17121761 1616 1354 1285 1131 665 597 442 367 352 301 79 11679 21321 572 185
NM_001707chr73767 695 674 2589 233 2755 626 1259
NM_001709chr1141906 1872 772 760 1754 ----
NM_001742chr72487 81 ------
NM_001759chr12114902 4855 4697 4458 4014 3208 1720 1153 559 382 119 23954 3716 ----
NM_001773chr151334 1308 412 125 44 1493 4439 314 90 68 --
NM_001810chr202715 153 --2801 551 149
NM_001859chr953323 1475 248 142 84 23811 759 ----
NM_001895chr2011032 --21170 50 --
NM_001949chr651247 1134 684 373 294 --1723 --
NM_001970chr17----1148 1435
NM_002014chr122489 240 --2536 60 156
NM_002045chr34131 80 63 27 --133 --
NM_002074chr161666 1657 1651 1521 1491 109 1103 21482 1477 --
NM_002103chr191124 2179 142 3997 823 146 --
NM_002134chr163486 478 208 --155 186
NM_002137chr7----12313 --
NM_002204chr175318 282 132 114 29 --31292 208 119 11106
NM_002229chr192143 28 --3354 164 95 --
NM_002232chr12845 468 --1960 --
NM_002264chr374898 4490 3309 1547 608 226 44 24816 1007 1613 --
NM_002293chr152496 2418 609 565 28 12337 2491 100 --
NM_002355chr1231380 1367 99 --1575 --
NM_002356chr622230 1960 --1868 --
NM_002373chr1531260 945 475 31144 907 892 41357 1283 494 34 11126
NM_002382chr142415 408 31053 1025 263 --1335
NM_002390chr1792015 1942 1926 1795 1612 1508 1488 221 69 21414 621 21892 226 1280
NM_002398chr261191 1071 431 197 189 137 --1231 1227
NM_002399chr153229 197 116 1139 2234 189 --
NM_002401chr1732363 1881 799 22048 1726 62347 1976 1887 1767 1690 293 22369 1009
NM_002442chr1251709 1359 1346 1262 323 21173 28 81273 714 670 337 304 237 227 99 21597 287
NM_002501chr19123781 3681 3458 3216 3002 2982 2706 2519 1107 937 566 172 43635 3013 757 665 204077 4072 4067 4062 3941 3670 3537 3529 3421 3384 3225 3115 3017 1229 943 761 674 471 444 370 43662 3380 977 670
NM_002515chr1451508 1371 1344 1334 1257 21530 46 21361 705 --
NM_002520chr5----1195 --
NM_002522chr17123292 2546 2530 2443 2391 1538 971 941 884 115 38 27 22478 715 53853 2497 1234 840 736 --
NM_002556chr113841 659 334 --21723 1591 --
NM_002569chr15101358 1302 978 953 453 384 217 158 150 133 1204 51414 582 460 433 208 --
NM_002588chr571480 1428 1334 536 341 291 224 --41713 1401 589 170 41709 374 369 347
NM_002596chr151298 1037 1005 949 380 1885 41341 1334 850 293 31322 1075 546
NM_002613chr16134776 4103 3948 3934 3468 1785 1453 1079 816 371 306 87 67 --44043 2137 1532 1516 --
NM_002616chr172232 226 --1379 --
NM_002634chr172733 22 --2727 218 186
NM_002655chr834417 3945 841 ------
NM_002657chr20163689 3613 3606 3465 3247 3069 3054 1550 1508 1152 1050 1029 613 544 522 397 1595 73408 2874 2481 2452 1381 1037 60 12913
NM_002698chr1992751 2743 2610 1211 1121 1038 871 640 111 --22720 2711 --
NM_002699chr141262 608 243 56 1517 4521 421 300 282 --
NM_002710chr121696 2267 187 ----
NM_002718chr321652 347 12168 --1985
NM_002721chr9--149 1211 1207
NM_002730chr19121239 1160 1126 1116 1093 998 867 399 392 210 202 120 --1132 41274 1231 406 128
NM_002748chr15------11112
NM_002779chr102186 85 --1558 --
NM_002827chr2051720 1537 1154 1141 175 31105 335 308 31333 1148 24 1394
NM_002840chr12243 183 21122 1113 128 11269
NM_002850chr1921122 1114 --21220 978 1186
NM_002855chr11143665 3439 2939 2869 2280 2272 1095 876 854 439 324 271 204 59 --63548 1294 1279 357 77 70 62829 2689 1395 975 892 85
NM_002859chr1291667 594 546 490 240 233 175 75 44 1314 --31704 1557 273
NM_002868chr1231582 955 884 --52252 2184 204 69 63 --
NM_002886chr354301 2069 1824 1030 197 --1165 --
NM_003011chr921231 687 11461 1210 --
NM_003026chr911276 2351 87 --1327
NM_003028chr9123823 3797 3680 3637 3279 3123 1556 1222 1087 1018 752 386 --53773 3593 484 230 224 1213
NM_003047chr191431 1340 1263 1239 1111 535 523 503 385 --21068 963 1147
NM_003076chr1241355 1197 677 616 1179 31361 1328 193 --
NM_003107chr662466 523 465 400 227 206 --21932 200 --
NM_003108chr296733 5994 5497 4496 2754 2615 2408 1882 1851 27259 6697 37211 2905 1863 16820
NM_003110chr175838 694 410 316 43 1858 3351 344 112 --
NM_003131chr641929 1915 1512 182 21897 151 41922 1423 327 219 2878 215
NM_003155chr822315 1135 --32099 2000 295 22432 1048
NM_003156chr1121339 241 --51229 1162 1153 389 297 1466
NM_003164chr111373 --3191 172 155 --
NM_003165chr981940 1511 1400 1278 708 166 130 115 139 21481 603 1137
NM_003179chrX71471 1378 1286 1233 1119 255 236 21106 184 61193 1129 391 188 94 73 --
NM_003185chr20----3534 483 92 --
NM_003194chr6----2485 32 --
NM_003214chr681273 1204 1150 335 252 158 139 66 --21261 345 21027 145
NM_003234chr311910 ----1114
NM_003259chr193133 120 37 --1138 --
NM_003319chr211019 --1694 --
NM_003336chrX4890 182 156 63 --1148 --
NM_003339chr52518 364 --1632 --
NM_003342chr1763024 2482 2029 776 557 82 13244 1712 --
NM_003347chr2242203 584 365 64 22015 1782 1375 --
NM_003367chr194385 212 176 32 --1428 1424
NM_003370chr194748 689 208 54 --2242 122 2560 130
NM_003458chr3143769 3750 3204 3003 2972 2749 2740 2620 2564 2538 1266 991 964 294 32673 2648 797 53462 2965 1499 1484 775 11495
NM_003459chr23624 128 105 123 1657 --
NM_003468chr21704 --31165 1065 954 13323
NM_003482chr1252665 2498 584 309 39 --72656 2417 2410 2043 501 489 175 22406 763
NM_003507chr221651 1639 ----22023 31
NM_003557chr131364 1233 231 11339 31310 1138 511 1241
NM_003559chr17173785 3697 3178 2740 2728 2576 2496 1486 1390 1370 1089 799 647 603 531 408 221 23731 3323 33272 2982 413 13815
NM_003615chr322960 809 12865 --22575 2553
NM_003624chr1991259 1212 1135 1097 472 378 371 318 53 1114 3928 387 66 173
NM_003637chr1----41511 624 407 224 21228 435
NM_003644chr17186477 6341 6335 6149 6119 5975 4077 4030 2154 2140 2132 2034 1796 1249 1183 966 953 732 25350 5262 66493 6384 4007 1036 774 89 --
NM_003654chr111536 1134 3641 227 138 1101
NM_003684chr14447 425 288 280 ------
NM_003737chr113381 284 62 --1136 --
NM_003741chr3--1333 3337 252 134 --
NM_003743chr242301 1784 1472 574 --11630 22014 483
NM_003768chr181783 1510 737 645 468 457 97 60 --31788 322 48 --
NM_003893chr103341 113 21 --2327 47 --
NM_003913chr623494 1055 ------
NM_003932chr221528 --21349 138 --
NM_003936chr25953 779 482 261 104 2757 232 3886 761 26 134
NM_003947chr33317 187 82 --187 --
NM_003955chr174584 502 496 209 1594 21473 1195 1508
NM_003988chr1081972 1888 1863 1811 1442 920 861 242 1210 81923 1913 423 327 308 150 43 28 32216 215 199
NM_003993chr11100 --1223 1287
NM_004050chr143877 754 392 12031 22559 865 --
NM_004082chr22316 132 ----174
NM_004093chr1322714 127 22368 534 --1552
NM_004094chr1442338 874 828 307 11960 12940 --
NM_004140chr172306 30 --1286 1589
NM_004177chr1151576 1262 1228 1219 280 147 2146 65 --
NM_004185chr13758 474 24 1749 293 86 --
NM_004187chrX51461 1043 478 414 123 --3444 132 115 --
NM_004193chr101348 --2388 368 --
NM_004200chr11122928 2791 2738 2694 2568 2561 2308 2237 2153 2134 2111 1202 22349 1000 92071 1213 1109 1101 1086 770 460 382 181 22934 2541
NM_004228chr19----1112 --
NM_004229chrX21567 1491 1493 ----
NM_004311chr1032890 2823 2546 42998 2832 1175 670 52836 2498 2266 2048 683 22018 675
NM_004331chr8----1108 --
NM_004349chr8----11044 --
NM_004395chr54522 152 40 25 --3590 266 111 --
NM_004399chr124773 622 361 270 ----1669
NM_004427chr161168 1161 910 822 791 149 --21011 915 --
NM_004428chr13569 555 217 160 2205 109 1810
NM_004429chrX101258 1220 1064 919 334 323 246 98 73 65 --31263 933 926 11294
NM_004430chr84905 700 401 345 2612 371 2949 628 11029
NM_004438chr232440 897 343 --12667 --
NM_004440chr6----11792 11410
NM_004454chr352116 1875 622 532 152 11626 22028 577 --
NM_004458chrX22684 1882 --12034 --
NM_004494chr15858 348 338 195 183 --31178 328 31 2141 105
NM_004504chr213018 11046 22893 61 --
NM_004529chr92504 229 ----1514
NM_004583chr172173 63 1624 2613 537 --
NM_004588chr11103062 2627 2513 968 344 249 186 176 118 52 12559 33229 852 156 13769
NM_004637chr331167 434 261 1154 1465 --
NM_004706chr191101 --4295 289 281 68 --
NM_004745chr8106782 6245 6038 6009 5988 5029 2030 623 130 69 36099 1687 411 45424 2424 2195 418 11465
NM_004758chr1751165 839 227 106 88 --51095 1088 880 819 762 11084
NM_004772chr521242 385 --1322 --
NM_004774chr1732370 2291 2231 32165 1157 1060 ----
NM_004824chr621143 103 1588 11289 --
NM_004857chr1414386 1882 23591 1565 13601
NM_004860chr174385 377 182 135 --1205 1201
NM_004863chr1484199 4139 1682 856 805 527 453 39 24906 4208 45232 789 744 138 --
NM_004872chr11306 --150 --
NM_004922chr103971 216 169 2760 52 ----
NM_004924chr19279 27 --11057 --
NM_004947chr35792 675 556 541 29 41800 1741 739 56 1128 189
NM_004952chr13908 838 387 1895 2157 148 --
NM_004965chr21------1140
NM_004973chr631672 1430 537 --11111 --
NM_004977chr191527 --5550 465 415 408 72 --
NM_004979chrX3444 282 99 --1785 1196
NM_004980chr1----181 --
NM_004992chrX218497 7848 7592 7437 7337 6714 6674 6540 6432 6179 6012 2966 2880 2526 1563 1300 1279 553 391 331 320 17741 88143 7788 7488 5876 1542 1402 454 445 27746 7367
NM_004995chr1441331 1322 1278 154 1432 2380 25 1561
NM_005022chr173169 160 47 ------
NM_005027chr193417 303 143 1884 133 1255
NM_005028chr1031790 856 792 12186 2740 601 --
NM_005056chr1235574 4744 1608 1846 1188 24632 1621
NM_005065chr1494766 3577 3512 2086 1985 1946 1734 758 96 --24036 1990 --
NM_005094chr95647 577 553 135 109 --3570 474 468 160
NM_005096chrX1128 --31211 433 357 --
NM_005121chr1721501 1460 --13326 --
NM_005161chr1162180 2012 1652 472 398 132 ------
NM_005206chr1731056 926 433 --1553 --
NM_005215chr182123 110 --1653 --
NM_005229chrX1230 141 2342 25 1948
NM_005238chr1152551 1206 1101 956 863 ----12685
NM_005256chr111632 1382 ----
NM_005266chr161741 767 646 400 228 198 --1222 --
NM_005274chr1----136 --
NM_005281chr12896 94 1937 1941 1848
NM_005336chr251919 1793 1441 854 273 11489 32202 1758 415 --
NM_005370chr193492 249 99 --3821 519 90 --
NM_005374chr1762383 2324 1835 1503 438 290 12148 4432 367 222 59 1411
NM_005386chr201679 --1853 2615 327
NM_005413chr21165 1390 2106 47 1172
NM_005418chr111689 --3620 585 132 --
NM_005430chr126928 807 207 113 92 21 1134 41053 781 650 643 --
NM_005439chr124504 366 166 55 --4384 356 128 87 --
NM_005440chr1743257 2529 1021 882 --52663 2537 1286 539 329 13241
NM_005465chr161751 1728 1544 151 144 134 2185 112 ----
NM_005491chrX102140 1882 1812 883 509 263 243 169 121 66 --12128 1340
NM_005507chr111317 1133 2183 157 --
NM_005522chr731397 473 245 ------
NM_005529chr17960 771 754 740 365 300 128 2227 40 2917 159 2760 687
NM_005578chr344836 4081 4035 412 ----1258
NM_005584chr132275 154 --2159 89 --
NM_005596chr922206 2120 15797 --15905
NM_005634chrX163 --6552 56 50 44 38 25 --
NM_005678chr153782 767 712 --3882 744 717 --
NM_005704chr161008 734 407 346 102 53 1390 1236 --
NM_005737chr232079 488 329 --3521 389 236 --
NM_005759chr274656 4136 3390 1883 867 692 609 --14718 180
NM_005768chr122206 67 --2618 254 --
NM_005778chr31151 --1369 --
NM_005789chr1762177 2032 1589 1476 766 113 31583 535 218 31763 1743 1481 --
NM_005802chr9----1189 --
NM_005819chr183071 2536 2408 2359 2295 1357 650 211 --23061 2628 1166
NM_005828chr1795014 4396 4137 3789 1793 1522 1296 942 685 23203 163 24568 61 14598
NM_005853chr161565 --1108 --
NM_005876chr23797 752 563 --1785 1190
NM_005880chr1611505 --11382 --
NM_005898chr111256 21192 132 11012 --
NM_005909chr574086 3984 3516 2835 1684 842 829 --22699 1595 32695 885 237
NM_005911chr21309 11147 ----
NM_005920chr1103694 3687 3191 3078 2751 1211 647 237 222 58 11260 103669 3514 3083 2518 1485 1246 1194 1127 877 397 23205 393
NM_005933chr11152413 2401 2231 2126 2049 1940 1209 1185 809 718 562 520 464 362 48 1863 12801 --
NM_005937chr1743903 1277 917 688 23447 1225 74068 3921 2920 2869 1229 514 271 21093 927
NM_005941chr822917 831 13508 ----
NM_005984chr221505 --3518 482 362 130
NM_006015chr111006 1190 3925 244 171 2240 93
NM_006032chr14125 --184 --
NM_006079chr61221 --3624 615 226 --
NM_006094chr852055 1931 621 600 534 --32060 1937 589 --
NM_006133chr11102119 1774 1560 997 956 905 788 579 312 155 --92238 2197 2124 2102 2018 1707 770 669 451 52234 2169 1986 889 820
NM_006148chr1752379 2302 2123 606 529 --42384 1945 792 123 12710
NM_006160chr1751551 1334 518 292 80 --41303 1045 91 46 --
NM_006190chr221059 352 145 156 --
NM_006194chr144451 297 53 30 182 186 --
NM_006201chrX6814 740 452 219 177 50 1155 2748 307 31105 893 339
NM_006224chr1742147 2132 893 812 1756 42152 2081 1972 67 --
NM_006245chr61280 1668 2730 672 --
NM_006247chr192443 332 128 --189
NM_006265chr83986 516 479 1228 ----
NM_006268chr1141091 1020 972 922 --1175 --
NM_006301chr12--1680 --1248
NM_006321chr351917 1843 1391 454 140 11906 1118 1460
NM_006325chr121620 ----186
NM_006371chr384290 4165 3925 3888 3673 3451 781 564 13288 34620 3457 3292 24876 193
NM_006400chr12198 --140 1105
NM_006424chr431878 1706 78 --31684 1332 89 51884 1448 1431 1343 1328
NM_006451chr5------1871
NM_006458chr111259 1383 5387 288 267 152 146 2354 317
NM_006465chr1552075 1945 1722 792 31 21762 1493 41729 903 731 290 --
NM_006516chr191482 1331 1317 545 537 488 461 367 305 1295 11322 --
NM_006517chrX81674 1616 1599 1532 749 426 334 124 31445 925 50 41537 726 249 54 11978
NM_006534chr2052622 2427 1125 852 608 12615 21182 257 --
NM_006557chr931231 1202 264 1453 11110 --
NM_006565chr16------1320
NM_006624chr10124 --11720 --
NM_006662chr16----3300 255 42 --
NM_006690chr2082051 1882 1787 823 406 400 370 271 22230 841 62010 1967 1481 934 470 350 1477
NM_006736chr221630 331 1150 1739 --
NM_006750chr1677377 7233 3156 2189 2091 1729 609 25983 1220 56672 5455 4997 2497 2046 154
NM_006761chr171733 --257 38 153
NM_006772chr6101586 1225 1198 595 572 509 371 348 303 285 145 101705 1662 1567 1425 1323 355 266 193 144 49 41658 1595 1414 444
NM_006775chr621975 33 1272 --1304
NM_006801chr192236 79 --2123 107 --
NM_006807chr17------1193
NM_006833chr74370 344 311 120 ------
NM_006856chr123286 222 44 --11066 21150 774
NM_006885chr16103516 3413 3129 3100 3043 2932 1564 1353 726 412 1359 11110 --
NM_006888chr1432449 2379 591 --13454 --
NM_006943chr20122836 2033 1265 1062 911 478 449 325 303 276 233 29 31009 177 95 81073 983 797 526 508 350 198 135 --
NM_006946chr112400 74 --3503 497 236 1524
NM_006950chrX5879 862 734 680 226 1897 3901 287 124 --
NM_007008chr2------1598
NM_007052chrX----2508 395 --
NM_007067chr1741275 1150 1075 371 1324 21037 123 --
NM_007144chr173809 359 103 --71083 1060 1054 966 524 76 44 --
NM_007159chr31385 ----11551
NM_007174chr1262382 1591 953 882 220 149 11705 3791 135 107 --
NM_007185chr171103 724 704 415 405 363 47 1423 1163 --
NM_007219chr202757 361 --1199 --
NM_007245chr164754 736 385 377 --2611 597 --
NM_007245chr164754 736 385 377 --2611 597 --
NM_007245chr164754 736 385 377 --2611 597 --
NM_007249chr1388429 8414 7065 7031 6666 6052 5709 1474 21099 404 37673 3255 408 26634 110
NM_007286chr51566 --31311 613 23 1754
NM_007327chr9111177 1090 1071 1026 785 774 446 404 336 148 118 --61189 1035 751 455 425 177 2410 259
NM_007365chr152121 2023 1992 1621 1422 --42050 593 508 187 --
NM_007375chr11376 --11088 --
NM_012104chr1183493 3296 2684 2456 1225 660 120 45 63472 3428 2795 702 247 105 1894 12786
NM_012137chr152833 959 629 510 160 22036 836 4993 568 166 67 12806
NM_012161chr41964 --193 --
NM_012202chr11--198 2151 102 --
NM_012288chr6145043 4912 4127 3585 2250 2223 2171 1948 1910 1269 1115 967 812 253 24454 1603 34902 4687 240 14100
NM_012316chr1135333 4196 3947 3648 3637 2167 2147 2133 1794 1553 1341 169 109 24859 3569 31869 1863 148 --
NM_012326chr24767 642 306 289 --3781 703 61 2295 229
NM_012330chr1011660 ----1392
NM_012340chr20----1262 --
NM_012396chr12588 35 --2626 546 2489 44
NM_012402chr1141212 1147 518 512 11386 1276 --
NM_012414chr1----1177 --
NM_012473chr223565 503 237 --2576 512 --
NM_012478chr175989 685 268 181 41 --3322 47 28 --
NM_013236chr222828 467 ------
NM_013260chr1771378 1243 1193 1146 554 201 113 ------
NM_013261chr423678 2318 13071 22882 1365 1591
NM_013262chr61911 --11122 --
NM_013354chr8----11259 --
NM_013372chr1522320 225 13363 1891 1277
NM_013381chr1211670 11517 ----
NM_013411chr142729 2110 665 41 12563 22591 2030 --
NM_013433chr1961939 1884 1452 1423 712 166 --11428 21557 704
NM_013446chr721359 499 --11096 --
NM_013449chr1232997 168 44 1899 52943 2357 838 569 562 --
NM_013960chr84739 237 118 98 --145 --
NM_014048chr1665126 3892 3661 3333 1041 404 ----11419
NM_014232chr1741182 447 257 236 --3390 94 67 11642
NM_014240chr383920 3343 3075 2978 2830 1474 1432 665 --12671 13371
NM_014271chrX121 --1613 1602
NM_014280chr11619 ----188
NM_014286chr9123505 3353 3293 3274 3091 2851 2676 2199 770 561 92 34 --33521 1456 176 163
NM_014289chrX41281 566 549 462 1314 21240 40 11270
NM_014331chr435125 840 819 14757 --15983
NM_014417chr193304 291 67 --2655 57 3750 663 156
NM_014421chr411834 --11970 --
NM_014456chr10----1317 --
NM_014491chr7------160
NM_014494chr1641804 679 672 212 --21854 335 --
NM_014554chr1241640 749 229 110 --12206 11589
NM_014630chr1551429 1149 960 639 54 12750 --1952
NM_014636chr9104202 3825 3407 3314 3008 2708 1490 1016 274 180 1409 13014 1152
NM_014663chr12147 34 --1152 --
NM_014682chr81544 --11657 --
NM_014727chr192102 34 --1109 --
NM_014730chr1285054 5041 4606 4537 3203 1972 594 179 --45240 5219 4959 3624 35236 906 828
NM_014732chr16175042 4683 4628 4444 4339 4259 2071 1880 1845 1345 1332 1097 482 449 425 255 197 24514 77 45400 3708 891 119 13871
NM_014742chr2051493 1341 1288 531 482 11688 152 31097 418 392
NM_014764chr123967 481 251 --1470 1487
NM_014770chr1281027 946 260 219 176 104 84 23 --3494 129 29 1110
NM_014790chr5189 1383 ----
NM_014830chr1283683 2719 2669 2473 1436 1365 1259 1166 13102 13691 22631 1344
NM_014840chr1263361 2616 2367 1151 829 244 ------
NM_014847chr1----3174 168 114 1129
NM_014860chr212520 --22176 209 --
NM_014871chr12------1577
NM_014901chr542325 377 274 223 1583 41570 1473 1430 607 11438
NM_014903chr1252441 2186 1994 695 96 32174 490 395 1704 --
NM_014905chr232030 1597 494 --11702 --
NM_014924chr1442243 971 771 234 --12703 --
NM_014926chr33895 122 104 --2806 764 --
NM_014977chr144493 171 150 36 --187 --
NM_014982chr1443702 1508 164 147 14522 21445 189 --
NM_014990chr144426 211 46 33 --11123 --
NM_014991chr432751 2649 533 12172 --1788
NM_014994chr1592203 2147 2115 1976 1532 884 832 487 452 11834 31960 796 622 22251 2246
NM_015020chr1621158 590 --23093 350 12410
NM_015035chr20136023 5917 5735 4841 4274 2227 2205 2192 1635 1531 1478 1448 166 15514 1332 11158
NM_015075chrX121822 1811 1733 847 838 828 775 666 619 584 538 430 --12852 815 803 790 748 739 565 383 365 44 38 32 51773 786 781 342 330
NM_015094chr22114503 3771 3662 3644 3197 1855 1638 1357 729 382 33 24124 3563 124339 4252 3841 3671 3254 1868 1862 1631 1510 1338 777 673 44304 3610 3277 226
NM_015097chr312212 --156 --
NM_015100chr151605 1557 821 744 701 --31576 826 129 11572
NM_015107chrX62157 1823 317 71 35 26 --3488 437 281 --
NM_015125chr193455 149 37 ------
NM_015134chr173576 475 174 2441 56 ----
NM_015138chr1592827 2416 992 816 803 411 307 216 54 --22780 2323 --
NM_015155chr1062957 2772 2762 1272 532 65 1674 --1624
NM_015178chr892663 2525 2322 2047 719 490 199 54 44 177 1373 --
NM_015272chr16--11968 1207 --
NM_015278chr611294 --139 1978
NM_015282chr232869 2295 641 12069 32696 2640 70 22265 696
NM_015288chr563867 3792 3377 2821 2571 2481 1452 102829 2528 1163 1131 1111 634 626 399 251 116 23016 1159
NM_015299chr1463515 1431 1276 819 105 28 1768 23189 308 13032
NM_015305chr142556 108 11723 --1199
NM_015327chr12497 379 21303 87 21307 861 11196
NM_015338chr2011400 --1398 --
NM_015347chr121352 1474 1930 11142
NM_015355chr171735 ----11769
NM_015361chr21361 1180 ----
NM_015388chr61253 --1258 --
NM_015396chr321386 1129 133 137 --
NM_015457chr112998 64 ----11011
NM_015481chr1281063 926 893 802 304 280 257 91 1193 6937 751 214 123 76 38 1424
NM_015503chr16----2628 601 --
NM_015526chr195510 425 349 199 74 21086 293 11134 --
NM_015537chr95768 411 334 294 220 1128 3755 463 39 1831
NM_015557chr1113322 3032 2857 2673 2265 1281 1009 276 121 100 66 32867 1242 937 21286 1019 1207
NM_015564chr532882 2424 215 ----22888 399
NM_015567chr131914 21164 470 3505 405 394 --
NM_015584chr1731362 1228 183 158 1333 --
NM_015630chr2------1908
NM_015652chr101590 --1427 --
NM_015686chrX82200 2080 1829 947 739 518 348 134 22167 1869 62376 2229 1873 1808 308 148 62214 2206 2177 612 410 155
NM_015726chr141343 660 582 420 2654 134 21421 497 2558 513
NM_015872chr181754 1501 1469 1326 1299 1212 686 593 --41796 1236 714 379 21783 579
NM_015878chr81390 --1234 --
NM_015898chr19152507 2488 2439 2337 2141 2021 1861 1785 1717 1709 1698 837 815 541 65 12355 62264 1840 1817 823 803 73 31853 644 264
NM_015982chr172393 77 ----1326
NM_015995chr15185219 4644 4547 4388 4361 3930 3887 3812 3772 3707 3593 3557 2037 1742 681 665 288 186 34253 624 124 24899 34 --
NM_016081chr412131 ----11822
NM_016131chr23129 69 29 --137 1810
NM_016144chr5------143
NM_016147chr1141086 1078 929 133 1902 21102 92 --
NM_016201chr352299 2213 1898 198 59 --42179 2167 1762 1508 --
NM_016257chr153076 2616 2242 993 118 22176 97 43442 444 224 48 1174
NM_016287chr121409 1362 11368 1801 1504
NM_016322chr92387 40 --1853 --
NM_016339chr1771718 1244 641 588 393 336 141 --31667 1263 633 --
NM_016376chr1794174 3634 3370 3176 1177 865 689 78 41 14211 33010 2937 556 23312 349
NM_016441chr21501 ----1547
NM_016545chr1----1295 --
NM_016588chr62352 32 144 --1283
NM_016604chr53234 140 100 ----1477
NM_016605chr572583 2414 2080 2050 939 828 512 21938 1060 22518 717 11694
NM_017409chr123614 606 283 --2594 48 --
NM_017508chr11143 11950 1873 --
NM_017514chrX5791 692 236 125 54 --3375 279 242 2761 220
NM_017519chr61480 1474 ----
NM_017551chr1042498 455 405 35 12429 128 --
NM_017569chr13------128
NM_017582chr141612 1602 1581 228 21154 498 21516 507 1503
NM_017596chr1133967 3757 3729 3681 2976 2925 2887 1729 1591 749 494 363 278 53312 2993 1616 558 357 64325 3459 1741 1455 957 375 44128 953 573 515
NM_017602chrX1842 --3251 236 156 2232 64
NM_017607chr195557 479 350 175 57 --1343 --
NM_017633chr61222 1428 13310 --
NM_017644chr344897 3892 3874 1190 34134 4129 976 33940 3897 3751 --
NM_017649chr105492 301 247 38 22 --1887 --
NM_017670chr115772 720 684 600 98 --2788 677 1690
NM_017686chr121138 967 --1118 --
NM_017772chr651511 1382 1207 1094 128 21357 310 21100 100 1159
NM_017778chr831492 1223 528 123 ----
NM_017784chr32915 158 ----11117
NM_017848chrX43762 3582 762 501 11342 34459 540 519 14495
NM_017880chr22377 45 --151 --
NM_017893chr1061474 1312 560 459 315 97 --51327 1144 528 400 83 21334 104
NM_017902chr10104615 4276 3969 3772 3710 3564 3551 1673 1549 1348 35253 1778 173 35387 4212 177 11269
NM_017907chr112505 354 2392 42 2330 57 153
NM_017910chr2------1286
NM_017966chr1151389 1073 978 266 38 --1966 --
NM_018013chr663010 2357 1058 635 278 67 22381 819 22153 97 1345
NM_018026chr1191262 1202 1104 1056 553 515 456 311 94 11225 1187 --
NM_018031chr31517 ----1498
NM_018084chr223003 2323 ----12678
NM_018128chr1731468 372 223 ----1482
NM_018240chr12628 156 --1336 --
NM_018327chr2041642 1413 445 431 ----11311
NM_018464chr10----174 --
NM_018482chr821652 230 --1667 1124
NM_018553chr174548 484 405 120 ----1236
NM_018571chr22640 140 ------
NM_018650chr122267 1385 ------
NM_018719chr7--21038 382 --21095 29
NM_018952chr174676 215 207 154 --1443 --
NM_018977chrX41101 347 315 147 2913 133 ----
NM_018999chr1044516 1104 358 254 1610 2996 529 --
NM_019074chr152628 24 --2856 643 --
NM_019106chr22113211 2996 2969 2958 2565 2178 2121 1224 688 658 72 22241 52 53195 3016 2392 2192 619 22809 2520
NM_019884chr191166 1501 3505 440 140 --
NM_020184chr262106 1976 1901 1540 861 765 11553 31631 771 30 --
NM_020214chr151230 136 2206 26 --
NM_020309chr195943 863 339 239 48 --21094 700 --
NM_020310chr17132229 2172 2020 1941 1793 1723 568 342 291 241 112 66 58 1709 52521 1962 1834 177 117 22509 1821
NM_020338chr10133299 2823 2735 2352 1426 1352 1331 1319 913 537 527 232 71 1631 72765 1041 765 273 224 97 24 147
NM_020341chr20----1768 --
NM_020348chr1052688 2355 2221 307 135 32198 1851 1034 52672 2638 1718 1020 63 12695
NM_020418chr33409 136 130 2483 63 186 --
NM_020647chr83689 521 303 ----194
NM_020653chr172351 331 --1427 --
NM_020699chr1125304 3881 3796 3433 3402 2037 1556 1331 1164 744 416 28 51899 1831 1452 954 634 134123 3896 3875 3827 3801 3785 3766 3415 3409 3370 1336 958 181 14119
NM_020708chr2061706 1623 729 179 124 67 22043 975 51664 993 781 474 371 --
NM_020713chr20103056 2611 2241 573 495 468 456 392 142 45 --63095 2467 631 625 105 98 1377
NM_020714chr19114577 4302 3943 3898 3550 1710 1561 1544 1460 1163 903 1681 13903 1340
NM_020717chrX124766 3631 3560 3503 3071 605 561 491 346 200 121 28 14930 33296 702 141 24395 754
NM_020750chr611140 --2493 315 2441 93
NM_020769chrX3786 176 107 1135 ----
NM_020772chr1767833 6717 3422 3081 2446 1287 --21567 488 16524
NM_020795chr1751758 1350 598 550 112 1396 61333 571 428 416 347 51 11983
NM_020796chr532928 2682 715 1245 32829 326 319 21156 315
NM_020805chr1821337 648 1596 1113 --
NM_020845chr12122458 2278 2263 1883 1770 1732 762 653 638 373 355 253 12272 72327 2252 2216 2032 502 367 348 12362
NM_020850chr1662916 2790 2554 1251 850 515 2712 589 62932 2837 2389 861 176 114 1857
NM_020858chr15----11505 --
NM_020888chr13424 293 217 1335 41640 1402 684 483 21636 37
NM_020899chr1751689 1604 1022 817 501 --31613 259 39 --
NM_020956chr19104429 4057 3210 3104 1391 1121 1014 496 378 144 34757 3703 2923 54639 1182 538 149 70 23187 127
NM_020971chr193760 540 215 1160 3735 616 223 1230
NM_021064chr621453 70 --1572 1644
NM_021117chr1132063 831 546 1930 22007 1986 1663
NM_021132chr1031331 265 54 ------
NM_021155chr1982940 2099 1959 368 351 244 176 44 --72604 2599 2376 2315 1205 495 359 --
NM_021174chr84609 581 238 24 ------
NM_021189chr12122 26 1752 4993 947 127 98 --
NM_021202chr20172915 2880 2793 1950 1152 953 923 904 435 392 379 298 258 201 194 187 138 11045 3910 857 280 23002 1101
NM_021238chr1221670 1656 --21973 383 --
NM_021239chr14----2419 48 --
NM_021643chr221652 453 --1259 1289
NM_021648chr661916 1906 1004 950 848 570 --2744 45 1576
NM_021813chr6125325 5251 5164 3565 1681 1276 1091 1081 735 290 41 33 24662 1468 34666 1509 204 11879
NM_021914chr14--1444 1811 --
NM_021946chrX71395 1338 1188 1036 985 935 399 --61313 1059 1009 1003 944 57 --
NM_021947chr1721061 880 --1277 --
NM_021961chr1195285 5278 2415 2239 2138 2078 1746 736 134 12601 16417 15938
NM_021999chr13----155 --
NM_022048chr1586159 5609 5174 3876 2355 2209 1924 1307 31133 556 361 45179 4350 4194 365 --
NM_022060chr143463 250 69 1444 51315 1197 431 259 215 1449
NM_022171chr321531 174 11574 1338 --
NM_022351chr8----1481 13453
NM_022450chr16------1234
NM_022463chr1781571 1446 1397 1062 520 165 106 70 ------
NM_022465chr1282890 2882 2055 1890 1150 1054 447 115 1236 72816 2250 2167 994 790 323 315 134
NM_022574chr761620 834 569 494 284 158 --52138 2127 1940 1934 1794 --
NM_022658chr123360 253 183 --2366 287 --
NM_022719chr22103660 3325 3276 3070 2835 1509 1476 939 696 572 23348 191 13064 --
NM_022726chr6----1519 --
NM_022728chr72785 36 ----1749
NM_022733chr1180 11107 2837 68 1213
NM_022821chr14390 181 81 28 ----1399
NM_022822chr1110758 746 714 704 678 614 601 344 46 36 156 2735 197 1187
NM_022823chr21138 1394 1112 --
NM_022898chr1484364 3548 3212 3180 2980 1068 100 21 2791 135 33204 328 93 14082
NM_023079chr1751262 675 304 226 30 ----164
NM_024007chr512677 --1605 --
NM_024050chr194115 108 80 54 ----1616
NM_024523chr7------1446
NM_024541chr1031650 1638 362 --11218 --
NM_024779chr122143 129 1607 31334 1172 1065 --
NM_024798chr1542335 1067 701 137 1825 ----
NM_024811chr111194 11666 51886 1644 1638 756 91 187
NM_024887chr182088 1584 1570 611 564 539 398 83 11428 2722 55 --
NM_024949chr474309 4015 3953 3367 3099 1777 508 34045 3109 311 --14434
NM_024954chr102444 241 --2422 55 --
NM_024963chr7135659 5265 4762 3739 2216 2208 2108 1886 1806 1513 736 585 36 55039 1396 1318 1164 121 44007 1826 1645 1432 45378 4147 742 562
NM_025160chr123372 1519 --23788 3305 --
NM_025179chr1124913 4683 4490 4361 3892 3185 1983 1018 742 411 212 123 11115 24720 1271 --
NM_025182chr97883 857 427 411 259 173 44 --1709 2928 916
NM_025184chrX--2786 777 --1791
NM_025191chr1--1260 21259 249 1926
NM_025248chr17153042 3033 2900 2718 2214 1300 1194 1182 612 364 347 330 262 158 44 --33047 2125 553 52253 2082 91 86 81
NM_030627chr523308 1651 --1514 --
NM_030648chr464864 3472 1805 1378 1341 559 --14539 --
NM_030761chr1112639 2559 2228 2219 1921 742 718 424 275 77 32 --22498 706 32654 655 83
NM_030806chr1168909 8877 8612 8507 8353 8213 8120 6627 6340 3468 3293 3263 2113 1011 976 881 78947 8896 7350 7146 6580 136 56 49266 7981 7756 2107 28365 1950
NM_030913chr13295 102 95 --2259 87 --
NM_030964chr553086 2966 2542 2276 1107 33550 563 518 73539 2846 1376 1001 377 130 123 43588 2494 2283 523
NM_031445chr232879 851 375 21152 668 128 --
NM_031475chr12648 628 1731 5755 735 611 599 140 153
NM_031492chr11----1540 --
NM_031866chr101675 --2418 94 --
NM_031936chr13610 602 62 --1305 --
NM_032017chr131527 1507 677 2530 327 21476 614 1332
NM_032153chr382553 2206 2143 1855 1082 1064 781 52 1861 21946 1018 11100
NM_032172chr7----164 --
NM_032181chr21205 ----1579
NM_032192chr175542 238 165 75 64 --1214 --
NM_032268chr1683073 2677 2432 2171 400 229 119 46 --32438 1083 804 --
NM_032294chr1761748 461 301 224 43 26 --51709 123 117 82 64 --
NM_032345chr12195 --2400 118 --
NM_032420chr53812 575 303 --184 --
NM_032452chr144618 347 221 48 --1556 1234
NM_032457chr443416 3341 365 196 11374 1258 12587
NM_032512chrX3716 353 264 1846 21135 293 --
NM_032558chr951217 1202 964 486 63 ------
NM_032569chr163163 100 24 1315 1474 --
NM_032595chr1741410 1264 995 544 2333 75 91478 1365 1337 1167 1001 553 137 124 79 31270 588 133
NM_032765chr51392 1998 --1198
NM_032772chr104213 206 185 152 --1454 --
NM_032840chr125760 740 483 267 39 1341 --11163
NM_032971chrY1687 1851 1958 --
NM_032982chr751974 1793 1759 585 435 --32566 1966 801 --
NM_032983chr792788 2607 2573 2246 1249 823 805 278 149 --33380 2780 784 12252
NM_033102chr121222 475 1868 51076 1059 1001 961 137 --
NM_033132chr1321477 643 ------
NM_033133chr1783516 3334 2395 1512 932 796 697 170 32446 819 375 33595 3566 2607 12661
NM_033141chr142622 193 22211 854 1269 --
NM_033201chr1621098 415 1810 3420 165 45 --
NM_033224chr798022 7551 7135 6564 5794 5716 461 76 31 47265 5322 3197 2998 143 11545
NM_033274chr583532 3407 2350 2298 2205 612 378 369 --43141 592 467 112 12212
NM_033315chr1792110 1875 1695 1652 772 670 440 401 135 --22078 489 22045 407
NM_033396chr112168 25 2399 370 1124 --
NM_033449chr561850 1573 1439 780 284 126 --61477 785 327 315 175 120 1346
NM_033626chrX51491 1358 1351 717 399 --61758 1386 1266 1150 423 329 --
NM_052848chr1931932 1716 1617 --6620 287 207 168 40 34 1695
NM_052874chr162100 59 4672 656 269 78 3127 82 68 --
NM_052875chr1171945 1647 601 589 567 43 35 --1554 --
NM_052896chr182207 2146 2136 2022 1972 1850 486 339 2637 541 52165 2051 2044 1834 1819 22239 492
NM_052897chr125288 187 155 117 78 --2209 201 --
NM_052898chr831826 502 205 11677 ----
NM_052910chr1351721 1624 1435 1354 65 --62001 1726 1372 1360 601 562 21736 1368
NM_052934chr171463 606 592 244 237 206 107 1286 21759 299 1291
NM_052948chr193329 261 39 ----1104
NM_052953chr32201 80 ------
NM_053023chr1142791 2285 560 154 --4616 439 169 161 --
NM_054033chr23175 80 38 --295 69 --
NM_057175chr442287 2133 835 266 ------
NM_080415chr172939 120 1260 2702 329 --
NM_080616chr204714 682 637 608 1137 ----
NM_101395chr212348 303 1930 11093 1339
NM_130783chr1152090 1486 763 748 641 133 ----
NM_133457chr721073 184 125 31275 229 223 --
NM_133478chr2--22170 975 22275 195 --
NM_138300chr12534 378 11665 61520 1514 1370 539 462 106 --
NM_138357chr1051569 1512 1130 537 523 21141 357 11593 --
NM_138385chr441052 1009 457 186 1419 21014 423 2564 90
NM_138426chr7------2492 26
NM_138479chr141354 552 503 330 --21403 201 1464
NM_138795chr171190 1141 587 243 216 104 67 --41255 288 95 72 11526
NM_138962chr171128 ----1136
NM_139014chr652043 1961 872 479 337 1511 21511 54 --
NM_139159chr1931060 954 114 --31239 1124 155 11131
NM_144571chr466142 4304 4295 2676 2260 89 --16598 --
NM_144635chr32461 32 --2390 208 11038
NM_144654chr9274 25 ----151
NM_144691chr193152 103 87 --3481 475 57 --
NM_144973chr1264820 4280 3974 1478 943 454 --2963 948 --
NM_145008chr111158 2594 185 2350 94 --
NM_145113chr142279 82 31325 1297 535 1137 1607
NM_145206chr1042047 377 298 211 12109 --32858 2590 2585
NM_145239chr164834 314 240 200 --3401 103 61 --
NM_145263chr412112 1131 --11720
NM_145296chr193807 663 641 1130 1668 --
NM_145349chr1741992 640 440 377 --3631 600 122 1529
NM_145891chr1641691 1340 1213 669 --31308 1200 653 --
NM_146388chr1941088 1043 487 403 --81145 1062 994 875 870 864 859 506 11035
NM_152237chr2241465 624 536 98 1432 31527 1416 487 --
NM_152253chr2283606 3183 3127 3092 2627 1363 527 88 53745 1337 1015 649 272 31493 1485 1467 32764 1201 901
NM_152263chr176122 5318 5240 4916 4092 2377 67 13728 2204 158 32383 2248 165
NM_152264chr113286 271 22 --1408 1982
NM_152344chr1721341 300 11149 --11154
NM_152345chr1721006 433 1875 31115 834 828 2953 391
NM_152346chr1761058 985 937 739 375 86 178 3456 362 236 --
NM_152384chr251616 1579 1567 1440 1392 --101706 1666 1629 1531 1453 1405 1356 1278 797 735 --
NM_152414chr821444 177 --21498 67 --
NM_152424chrX84631 4157 3969 3046 1895 1644 1421 1279 54530 4312 1659 667 232 24610 604 23329 1240
NM_152437chr121965 --1556 --
NM_152493chr141378 1099 570 549 11030 21276 273 122
NM_152523chr22256 65 ----1238
NM_152641chr1232048 474 313 ----12341
NM_152753chr631679 1391 74 ----11595
NM_152857chr6----1258 --
NM_152860chr1261341 1164 347 333 256 102 2993 90 31376 1347 1035 125
NM_153035chr152922 2012 1199 315 264 23241 636 42112 513 416 367 --
NM_153040chr15180 1458 ----
NM_153335chr1741225 511 265 253 --31040 516 382 --
NM_153350chr1681295 1106 628 621 614 283 176 110 --31096 440 191 31245 696 222
NM_153487chr6144783 4722 4716 4413 4401 4204 3350 1597 1589 1489 1258 1250 1070 701 23702 648 64630 4318 3760 3322 3154 21 54750 4621 4314 771 766
NM_153619chr156776 592 519 391 266 129 --42743 2303 1027 868 1463
NM_153685chr1281108 1037 982 918 300 263 142 132 --1228 162
NM_153756chr141891 1789 1730 1293 1210 21913 1742 --
NM_170707chr11938 157 4979 593 384 67 --
NM_171998chrX41932 1806 736 643 --12149 --
NM_172375chr142854 81 1813 --1846
NM_173468chr423709 462 --21265 677 --
NM_173469chr15----1252 --
NM_173475chr16----11298 --
NM_173500chr15----1421 --
NM_173588chr111320 --170 --
NM_173595chr12205192 5079 4998 4872 4813 4234 4128 4116 3635 3610 3341 3248 1987 1388 1085 1046 592 280 219 149 21294 204 145135 4879 4479 4334 4218 4133 3728 2069 2000 1702 1516 1427 733 443 --
NM_173681chr741604 739 287 228 22032 1525 41835 1515 452 264 1595
NM_173683chr8------1344
NM_173825chr352833 2781 1190 1151 116 21979 991 --1458
NM_173833chr861612 1472 1236 105 54 43 1139 21534 83 11353
NM_173854chr172081 1813 1597 748 584 461 89 --52062 1705 1485 95 28 32069 1971 83
NM_175736chr12227697 7672 6592 6413 6367 6040 5847 5464 5397 5378 4928 4800 3142 2471 2333 1742 1680 1395 1372 1299 627 30 37684 4963 2774 57649 6424 5263 1978 819 21378 120
NM_175767chr551277 758 484 323 204 ------
NM_176871chr883059 2693 2364 2194 836 747 404 31 --33024 1231 412 12974
NM_177551chr12----1764 --
NM_178126chr1742058 1833 1516 166 11491 11822 155
NM_178423chr71496 --1285 161
NM_178502chr121450 --2201 163 --
NM_178835chr43813 804 797 1736 2765 72 194
NM_181358chr133391 3149 986 23420 2970 ----
NM_181670chr12184 --3454 445 268 1296
NM_181671chr174143 97 74 36 --2256 148 --
NM_181844chr171303 --31380 396 127 --
NM_181846chr1992728 2651 2583 2010 1034 693 254 240 160 2849 642 32872 2703 453 1483
NM_182485chr433068 2414 631 1113 --12516
NM_182527chr2282043 1961 1858 751 364 274 148 22 --51871 1848 1692 240 229 2805 51
NM_182546chr7----1116 --
NM_182553chr113564 516 54 --2444 164 --
NM_182557chr11142092 2079 2046 1898 1824 1814 1440 1398 862 850 745 463 316 299 21725 1605 61938 1609 829 531 438 251 --
NM_182830chr1421996 590 11625 --1603
NM_182970chr20134214 4171 4083 3986 3556 2814 2684 1290 952 587 297 160 45 13949 83793 3158 2784 1712 1516 1260 957 179 --
NM_183397chr20104706 4292 4267 4213 4207 4186 3537 1163 773 31 44898 4586 1957 986 54192 4058 3516 1306 118 --
NM_198273chr542555 2358 707 466 ------
NM_198334chr113683 303 192 ----1202
NM_198560chr383849 1496 1306 1080 960 579 390 124 33702 991 71 11140 --
NM_198686chr1462548 2529 1049 1004 880 174 22422 163 62502 761 708 682 428 344 --
NM_198859chr374245 3959 3685 1614 1558 711 558 23597 1818 43295 1267 846 730 13800
NM_198904chr531625 1349 384 --1823 --
NM_198963chr2----1191 --
NM_198991chr18------1613
NM_198993chr1761527 1133 392 372 265 30 1282 41504 562 548 501 21188 90
NM_199141chr193876 725 268 2807 613 4921 718 184 60 2637 173
NM_199245chr12102499 2441 2370 2317 2102 1984 531 494 443 329 --32322 1669 420 --
NM_199262chr1762107 2049 1501 1470 447 261 1471 22067 812 --
NM_199320chr4----12845 --
NM_203374chr193741 686 206 --2823 660 --
NM_203382chr53504 230 222 1247 1255 --
NM_203413chr1751112 1004 754 374 285 --1255 --
NM_203446chr2142189 1136 786 732 --1712 1138
NM_205848chr142793 2422 2413 41 22261 242 32315 1776 112 12382
NM_205864chr6------145
NM_207371chr1021387 97 11274 ----
NM_207372chr1052249 1564 651 548 461 1181 12290 --
NM_212464chr1581916 1723 1717 1667 1620 797 251 37 11688 1184 11373