TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-609
miRNA Sequence: AGGGUGUUUCUCUCAUCUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr841847 584 76 46 155 1515 --
NM_000068chr19133 31276 1270 1254 ----
NM_000089chr71239 --1231 --
NM_000090chr21288 1948 1271 --
NM_000176chr543931 2933 1279 850 21258 1156 23513 945 --
NM_000176chr543931 2933 1279 850 21258 1156 23513 945 --
NM_000208chr1974694 4015 3535 3434 1485 1207 319 14477 33020 1413 1348 22899 441
NM_000217chr1244957 1286 600 429 ----22151 1393
NM_000245chr752257 2062 1668 1561 435 --22018 232 --
NM_000321chr1321136 35 11293 1427 --
NM_000332chr6157018 6734 6296 5975 5685 5069 4946 4488 4417 2742 2676 2635 2097 1251 526 --25872 4408 1854
NM_000345chr42758 737 ----1275
NM_000389chr631449 937 137 1430 21338 121 --
NM_000435chr191310 ----11029
NM_000441chr711983 --1162 188
NM_000474chr71258 --1454 --
NM_000489chrX42097 964 946 919 --11217 12934
NM_000493chr611041 1712 --1437
NM_000536chr111474 ----1395
NM_000575chr22162 139 --1193 --
NM_000610chr1122939 2687 1530 ----
NM_000615chr1152934 1174 809 281 72 1228 12867 --
NM_000618chr1286210 5582 2491 2316 1563 1393 1204 1021 25437 488 --187
NM_000719chr1276454 6446 6436 5235 4952 4912 2515 25974 1234 1299 14490
NM_000724chr1012014 1741 1593 --
NM_000726chr22972 476 21153 910 11345 --
NM_000813chr565048 3684 2211 2037 887 113 14293 24352 4194 --
NM_000814chr1543760 3347 1151 39 33247 2919 1230 13894 13355
NM_000828chrX3654 636 360 --1183 --
NM_000875chr15116596 5797 2787 2684 2042 1470 1063 702 457 447 261 36578 2739 1556 46609 6482 5373 1975 --
NM_000901chr442478 1970 1917 585 156 ----
NM_000944chr42870 688 22125 1964 1215 --
NM_000945chr231476 684 28 --1445 --
NM_000965chr32846 417 ----1268
NM_001001436chr16144 --1678 --
NM_001001484chr1031795 687 25 --12261 --
NM_001001933chr13575 120 64 ----1104
NM_001002838chrX51810 1536 1260 1194 200 158 ----
NM_001002860chr1484673 4344 3645 3261 3194 2913 1414 846 11751 142 --
NM_001003688chr42923 171 --11058 --
NM_001003800chr953213 3016 1132 311 34 32839 1377 949 12691 2359 210
NM_001004317chr694438 4329 4056 3842 2927 2789 1482 445 349 1562 ----
NM_001005473chr5126459 5981 5761 5636 5486 5471 4819 4751 4580 2340 1654 352 14849 174 --
NM_001005474chr311507 1210 11130 134
NM_001006610chr162785 171 2230 65 ----
NM_001007214chr111766 --21781 188 --
NM_001007278chr1353975 3807 1485 1447 694 1520 23384 1504 --
NM_001008220chr593792 3342 2705 2465 795 696 585 193 163 1571 23859 838 --
NM_001008392chr373406 2776 2362 2233 1205 815 726 --12656 --
NM_001008660chr11--11457 --1283
NM_001009899chr385774 5344 5125 2340 2131 1949 1937 1484 14874 15502 --
NM_001010861chr132481 1822 917 ----167
NM_001010862chrX12849 32693 341 243 1303 --
NM_001010888chrX43855 3575 1809 1525 1257 1164 --
NM_001011666chr785876 5545 5305 5230 5101 1001 917 550 11615 14771 --
NM_001011885chr1531801 238 100 --11622 21297 42
NM_001012329chr132242 2052 177 12065 122 --
NM_001012977chrX31312 1129 51 ------
NM_001013031chr1043434 2969 2573 1217 --22201 225 190
NM_001013438chr32818 103 1335 --1123
NM_001013620chr1257092 5622 5279 5242 1563 12564 15975 16198
NM_001013693chr152756 2328 1822 266 44 22320 2314 ----
NM_001014342chr121693 1494 1386 --1200
NM_001014839chr131019 854 750 11092 1117 --
NM_001017395chr333562 3360 1093 --21318 390 --
NM_001017424chr121481 590 21850 126 --1684
NM_001017926chr82664 211 2656 113 --1134
NM_001018054chr12470 54 --11077 1186
NM_001024218chr142610 121 ----1173
NM_001024460chr63504 299 181 ----1497
NM_001024649chr572016 455 371 280 161 139 81 ------
NM_001024948chr162273 2204 1076 1033 766 503 --11223 --
NM_001024948chr162273 2204 1076 1033 766 503 --11223 --
NM_001025077chr1087015 6951 6323 6090 6072 5931 5372 1333 36928 6022 5706 27025 1186 --
NM_001025079chr343551 812 771 72 --11489 14145
NM_001025108chr264007 3670 3035 2874 1252 225 2698 330 1620 --
NM_001025366chr631790 752 667 1342 --11474
NM_001025616chr4------1146
NM_001030006chr1752261 1734 741 394 295 ----12479
NM_001030007chr1683514 3398 3063 1261 1233 1145 671 480 ----24047 361
NM_001031684chr23369 268 180 --11056 --
NM_001031695chr2285468 5117 4593 4495 3866 3766 2006 1342 --41317 1305 873 732 --
NM_001031804chr1663060 2866 1312 331 208 201 --11770 --
NM_001031812chr532316 2271 1637 11627 12090 --
NM_001033059chr661729 1632 1307 730 703 291 1448 11573 --
NM_001033117chr374477 3078 1796 1765 890 540 278 14076 14823 --
NM_001033925chr1051891 1871 869 584 58 ----11967
NM_001034837chr53822 712 523 --2113 61 --
NM_001034915chr821100 1057 1118 31309 608 23 --
NM_001034954chr1042235 1197 1086 915 --12294 --
NM_001035511chr121513 744 ----1375
NM_001035521chr22549 540 --1637 1259
NM_001037339chr141761 1633 1436 448 ------
NM_001039538chr282987 2976 2957 2633 2316 1426 871 741 23367 3099 ----
NM_001039590chrX43751 3624 877 572 3764 347 41 23614 1364 --
NM_001039711chr141040 743 324 100 2916 177 ----
NM_001039905chr1541478 1058 317 111 11551 11078 --
NM_001039937chr1333859 3744 1363 --31069 853 579 --
NM_001040113chr166969 949 848 629 296 103 ------
NM_001040152chr7143186 1828 1715 1327 1318 1267 1153 940 922 889 570 487 463 108 --11942 --
NM_001040284chr1635814 4161 832 ----1647
NM_001040712chr911031 23049 1173 11233 --
NM_001042355chr1645122 4937 1830 252 --25300 5253 --
NM_001042510chr842025 1810 1798 28 --11933 1128
NM_001042603chr1251276 1050 1004 916 388 24383 4377 1600 --
NM_001042681chr142503 2124 373 341 12592 --1257
NM_001043318chr1482573 1667 1422 1291 992 757 529 234 22762 1408 33250 3233 1593 --
NM_001079874chr152034 1683 1491 546 22 --21814 121 --
NM_001106chr369733 8285 5895 3733 2628 1459 59503 9480 3851 2988 1359 33616 1634 978 --
NM_001116chr16102778 2516 2405 1946 1916 1884 1188 851 730 622 --32280 863 419 --
NM_001186chr2132946 1245 350 22868 1999 ----
NM_001198chr621697 246 11849 11635 --
NM_001204chr277045 6281 5735 5328 5024 1202 591 --1104 --
NM_001206chr972994 2561 1997 1966 1060 580 395 --1205 11157
NM_001219chr731997 1547 479 12174 ----
NM_001270chr54978 934 727 279 ----1435
NM_001390chr1863667 3425 2249 1036 311 24 22803 161 12600 --
NM_001412chrX53561 2592 1085 884 665 --1744 --
NM_001419chr1923476 763 --13327 11003
NM_001431chr62897 154 1867 --130
NM_001455chr694975 4732 4707 4319 3463 1113 776 671 289 --34671 280 126 --
NM_001483chr73792 250 93 --2687 222 --
NM_001530chr1431159 1126 401 --2980 778 --
NM_001614chr172509 79 --1228 --
NM_001621chr712856 --1575 11056
NM_001627chr352409 1924 750 591 478 1520 11898 --
NM_001656chr511635 --1550 --
NM_001663chr1412019 --12136 11010
NM_001670chr223769 688 155 ----1819
NM_001690chr3------11747
NM_001695chr853468 1519 1342 752 113 32744 1637 1176 14126 1504
NM_001759chr1294854 4012 2053 1316 1151 736 700 542 381 --13714 --
NM_001797chr163625 243 181 ----1327
NM_001830chrX94003 3333 3319 1526 1470 760 630 172 33 --13985 11120
NM_001859chr963166 2442 1445 1230 986 141 ------
NM_001938chr111800 11616 11737 --
NM_001981chr132404 1957 1869 1816 --1303
NM_001999chr52576 345 11376 1936 --
NM_002032chr11------1110
NM_002128chr1341831 1581 608 375 ----1669
NM_002140chr91903 --1343 11221
NM_002158chr242706 1385 1129 1080 1844 33166 654 549 --
NM_002264chr354905 4565 4315 1564 675 --24489 193 --
NM_002268chr331739 1518 1202 --11357 --
NM_002270chr544476 3621 3552 212 176 1663 --
NM_002293chr142733 2495 2259 1841 11743 2523 174 --
NM_002356chr652574 2256 604 559 148 --22229 248 1612
NM_002397chr532026 493 226 ------
NM_002501chr1963755 3633 3416 3271 3236 754 11487 23001 2705 --
NM_002508chr141222 355 257 168 11597 147 --
NM_002581chr9115288 5181 3714 1954 1796 1384 522 452 370 49 36 1360 --1119
NM_002594chr201859 --11628 1215
NM_002613chr1644702 1078 1062 40 ----1167
NM_002655chr824352 3936 35169 4236 851 24416 1601 --
NM_002687chr1421166 456 --1251 --
NM_002709chr232881 113 95 13324 2888 858 --
NM_002719chr1431988 604 364 196 1293 12035
NM_002731chr123016 1922 133 --12823
NM_002740chr322176 298 11908 11940 22850 116
NM_002851chr71713 --1749 --
NM_002868chr123954 350 174 ----12021
NM_002886chr322068 708 1314 23413 1029 --
NM_002959chr143652 767 532 57 13251 1635 --
NM_003028chr953538 3121 1083 1016 385 ----52726 1441 1375 1307 1042
NM_003037chr1158 --1557 --
NM_003079chr17------2878 267
NM_003108chr2137257 6622 5992 5730 4483 2771 2753 2745 2646 2517 2407 2187 876 --25496 5313 --
NM_003161chr1773409 3243 3229 2297 941 744 123 12505 23541 572 --
NM_003185chr2011198 --11182 --
NM_003211chr12--21587 523 11565 --
NM_003253chr2131648 693 177 11759 11772 --
NM_003255chr1742270 961 542 75 2724 560 11809 1106
NM_003319chr22681 616 130 1324 --
NM_003338chr102777 638 --1171 11824
NM_003347chr2262238 2013 1780 646 583 62 --1550 --
NM_003356chr1111111 --1195 --
NM_003373chr1051528 320 308 238 106 11563 11489 --
NM_003374chr51825 ----1694
NM_003403chr141826 1125 1813 --
NM_003404chr2061928 1569 1298 778 653 276 ------
NM_003439chr743098 2962 1210 1155 --1425 1929
NM_003463chr653172 2742 2456 1252 421 ----1360
NM_003468chr264085 3412 3189 1651 1050 714 11161 ----
NM_003471chr31250 --12130 1773
NM_003507chr221668 1357 --1805 --
NM_003615chr323119 149 --12534 1685
NM_003624chr1931258 377 112 ----11398
NM_003624chr1931258 377 112 ----11398
NM_003672chr121684 1347 11448 1145 --
NM_003679chr153465 3186 3110 2767 1266 1219 --1367
NM_003714chr532858 2635 977 21997 960 12763 --
NM_003795chr6150 --1504 1122
NM_003850chr132578 446 --2623 500 --
NM_003884chr311240 ----1531
NM_003895chr212757 123 1712 --11744
NM_003908chr20--11359 21221 193 --
NM_003913chr663516 3410 3116 1663 552 135 11183 ----
NM_003968chr31540 ----1456
NM_004093chr1342067 531 126 109 2235 42 --1578
NM_004112chr1751392 489 482 335 276 2711 267 ----
NM_004229chrX41899 734 664 491 1548 ----
NM_004311chr1052881 2545 1929 668 59 12532 ----
NM_004425chr1----182 167
NM_004432chr922114 876 1755 ----
NM_004438chr292968 2867 2295 1230 1097 1041 896 342 287 ----1976
NM_004440chr61138 --1262 1255
NM_004504chr242983 2353 703 143 12909 23017 181 --
NM_004588chr1123752 1516 23764 1463 ----
NM_004598chr532885 1267 119 22934 699 --13056
NM_004710chr173975 848 169 ----1622
NM_004730chr521445 230 165 --11768
NM_004745chr8136916 6018 5849 5622 5367 5228 5079 2496 2153 1982 1685 1470 622 2850 438 --36277 2825 683
NM_004801chr211535 ----1229
NM_004852chr181614133 13653 12195 9655 9556 9318 9107 9077 5418 4767 4480 2504 2058 2035 553 80 511630 9349 4810 932 837 313090 10436 9401 14291
NM_004922chr106858 784 758 737 687 139 1301 150 --
NM_004929chr831360 1088 622 1236 ----
NM_004932chr52498 323 --11584 1625
NM_004956chr723587 3334 --1971 --
NM_004992chrX107906 7765 7739 6659 6481 6286 6090 2268 1880 390 13409 28496 7961 25753 2152
NM_005086chr1231846 1816 246 --21662 586 --
NM_005116chr2094264 4185 3786 3723 3292 1460 1045 758 615 13777 11809 --
NM_005121chr1783751 3727 3508 2800 2776 2721 2612 1392 --12585 --
NM_005168chr221162 308 ----11459
NM_005184chr1921085 105 11430 176 1642
NM_005188chr1177246 6290 5305 2490 1354 1058 812 25176 513 2599 543 18320
NM_005238chr1132324 1205 862 --22981 1152 --
NM_005256chr112890 631 1365 ----
NM_005257chr183971 924 915 1400 11023 --
NM_005327chr41247 1776 133 --
NM_005385chr351024 811 705 656 585 --12612 11888
NM_005458chr932050 255 75 1778 11765 1699
NM_005465chr13709 183 110 --11543 --
NM_005491chrX31967 1881 709 32067 387 274 1508 --
NM_005596chr985795 4336 2431 2119 2090 1852 1256 863 135 ----
NM_005604chr641708 1640 762 336 --11884 --
NM_005688chr31973 --11313 --
NM_005704chr131007 903 101 235 24 ----
NM_005766chr1341410 1272 1244 318 1449 190 --
NM_005862chr33333 322 87 --11033 --
NM_005898chr1121155 774 --1934 --
NM_005909chr564085 3343 3115 2920 904 646 1454 13983 21019 874
NM_005964chr1741429 1345 1077 52 --11548 1586
NM_006022chr13--1807 --1162
NM_006047chr2022640 1286 --13274 --
NM_006148chr1742704 2301 2122 326 2788 351 ----
NM_006194chr146865 450 296 138 80 51 ------
NM_006197chr82158 75 11749 ----
NM_006246chr142883 497 --2849 465 --
NM_006265chr841162 985 456 437 21240 1064 1226 --
NM_006310chr172963 155 --1306 --
NM_006380chr1754162 3344 1748 508 106 11208 1318 --
NM_006421chr8134 1491 1155 --
NM_006469chr1--21171 1053 1424 --
NM_006557chr941282 1249 1201 1193 ------
NM_006599chr1638292 1320 194 1155 15800 --
NM_006609chr232569 1089 317 --22873 999 --
NM_006628chr1574522 4315 4255 3366 1656 890 648 11102 14644 --
NM_006667chrX31024 867 133 1967 --11078
NM_006717chr942973 1206 668 482 --13030 --
NM_006754chr71294 --161 --
NM_006774chr721350 108 21584 546 1146 1279
NM_006814chr2042470 2229 1777 166 32418 2362 2295 122 --
NM_006815chr1241324 1246 253 153 --152 --
NM_006827chr1462470 790 777 555 91 50 22776 168 1457 12523
NM_006838chr122373 289 1356 127 --
NM_006885chr1653468 3424 3099 2725 1563 --1357 --
NM_006943chr20123340 3123 2834 1189 1017 477 324 302 275 175 93 28 2784 212 23175 2384 --
NM_007011chr1566543 5865 4953 2170 778 140 1128 24214 1083 --
NM_007036chr53919 252 188 ----1174
NM_007236chr1552168 983 903 722 196 1282 ----
NM_007249chr1388264 7875 7252 6434 3401 2333 2166 1770 48426 7991 466 53 38787 8682 1097 16200
NM_012064chr1231157 724 373 1861 11027 --
NM_012134chr131749 1578 513 2661 357 --11189
NM_012156chr20113342 3296 3265 2617 2268 1266 753 606 502 193 92 ----1263
NM_012199chr144626 3949 3243 1455 1687 1876 --
NM_012223chr2------2948 878
NM_012234chr352919 2901 2774 2686 173 23002 1235 ----
NM_012238chr1041326 1097 511 194 ----11421
NM_012300chr511674 12161 1723 1434
NM_012316chr195628 4561 4370 4195 3931 3647 3567 108 37 15588 21473 168 --
NM_012325chr20125 ----1216
NM_013230chrY21515 123 --11686 1259
NM_013233chr21575 2950 340 1189 11054
NM_013261chr453069 2579 991 112 41 21361 889 ----
NM_013262chr6------1100
NM_013277chr121767 ----11059
NM_013302chr1611176 1446 11810 21417 889
NM_013309chr1522233 219 1424 ----
NM_013377chr121141 --2537 501 --
NM_013449chr1283011 2812 2729 2418 897 493 167 151 --1421 --
NM_013450chr22853 321 2452 245 ----
NM_014034chr61956 1988 1116 --
NM_014117chr161741 122 12754 --
NM_014141chr7114512 4336 3966 3581 3521 1863 1319 1271 1110 788 95 13979 171 --
NM_014154chr341506 532 306 259 --1504 --
NM_014319chr121254 --1789 --
NM_014444chr152567 288 --169 1152
NM_014452chr6--1477 --1265
NM_014614chr251333 1307 1215 1002 51 ----1351
NM_014615chr1653486 3032 2993 2573 312 1702 --13638
NM_014636chr984360 3824 3100 1527 1254 407 256 222 23431 210 1297 --
NM_014663chr111079 --21022 712 --
NM_014686chr1962378 881 566 500 430 91 --21025 675 --
NM_014707chr742208 451 394 194 --11743 --
NM_014726chr1741245 985 389 270 ----2440 59
NM_014732chr16145696 5613 5474 5041 4612 4568 4512 4443 3914 3778 1879 1843 1414 582 35652 1950 399 11193 1109
NM_014751chr841966 1583 1463 139 ----1798
NM_014755chr283636 3400 3301 3111 2665 1164 1146 84 2849 800 1885 --
NM_014765chr142099 1854 671 648 ----1316
NM_014790chr55481 412 393 381 375 ------
NM_014810chr173579 2616 1247 616 563 247 159 33557 2515 72 2290 260 --
NM_014841chr631372 853 454 --11393 1475
NM_014906chr1763271 3256 3189 878 238 46 12706 13151 13296
NM_014912chr1052464 2194 1397 718 240 --12439 --
NM_014991chr463306 2545 2280 857 532 236 22479 2178 12774 --
NM_015000chr1232026 399 259 --32890 658 336 --
NM_015064chr1293165 3150 2968 1181 511 462 327 290 102 --31359 1330 348 --
NM_015071chr585326 5284 3995 1165 946 763 643 542 25709 4742 --1320
NM_015075chrX51821 827 583 536 485 51841 1768 772 515 459 1618 --
NM_015093chr641323 402 313 163 --1620 1298
NM_015094chr2264490 4383 3561 1356 1240 1218 21334 145 13335 --
NM_015097chr342211 2026 227 87 ------
NM_015130chr41198 --1177 --
NM_015134chr173575 439 54 ------
NM_015156chr1483212 2891 1573 1482 1376 1141 220 22 --12807 --
NM_015176chr1----11491 11742
NM_015191chr1162596 2331 1912 797 664 331 ------
NM_015205chr13123640 1779 1570 1536 1302 1189 1079 996 970 297 78 30 14170 12006 --
NM_015213chr111594 1114 1836 --
NM_015267chr1241858 509 212 30 31735 1661 845 ----
NM_015313chr1154786 1688 703 549 67 1446 11399 --
NM_015315chr5103496 3096 2396 2345 2218 1339 1229 662 228 193 12606 11361 23159 947
NM_015326chr152740 2670 2131 2088 804 11973 12321 --
NM_015455chr533565 3271 2955 12780 --23985 373
NM_015526chr1981338 1183 1083 475 424 385 224 54 1103 ----
NM_015550chr743241 1423 1020 297 --22655 211 --
NM_015568chr2034253 4036 581 13963 11072 --
NM_015569chr133788 3048 1707 11508 --11856
NM_015678chr1321584 187 31310 1180 123 ----
NM_015981chr543114 2580 1170 457 --22805 1265 --
NM_015995chr15104918 3672 3571 3556 1181 796 680 664 286 182 31308 922 212 24387 3706 15347
NM_016018chr81640 11068 --12785
NM_016019chr74768 415 408 101 1184 ----
NM_016076chr133149 2752 594 --32515 1976 641 --
NM_016081chr492217 1917 1878 1704 1431 808 329 234 61 ----131
NM_016131chr222305 2064 ----1468
NM_016255chr633189 2301 1007 ----1400
NM_016300chr3------1106
NM_016322chr932471 918 752 12417 11960 --
NM_016525chr9------1837
NM_016531chr431478 1437 221 ----13027
NM_016588chr61768 139 --1120
NM_016653chr231003 136 111 --21043 931 --
NM_016734chr92394 29 --11920 1384
NM_016929chr674424 3432 550 417 362 332 172 --33864 1467 1197 1774
NM_017412chr831047 191 174 --11397 --
NM_017420chr1473839 3032 1336 1211 924 870 495 1344 197 12340
NM_017423chr421981 883 1328 21620 722 --
NM_017542chr13538 372 106 1163 11635 11234
NM_017633chr622721 1518 ----1752
NM_017637chr989425 8892 8722 8312 7525 2367 1093 182 46330 6211 2785 612 26011 1504 11303
NM_017643chr171697 12157 22652 812 --
NM_017658chr1413826 --22917 56 23922 1083
NM_017778chr821491 1255 ----11391
NM_017919chr9145712 5128 5005 3984 3678 2239 1816 1781 1765 1713 1632 1443 1081 68 --21250 712 --
NM_017923chr4------1694
NM_018046chr51384 ----1275
NM_018084chr273195 3098 2609 2036 1214 1115 702 198 13002 12451
NM_018293chr31831 --12764 --
NM_018439chr1842523 2087 1805 359 ------
NM_018444chr832236 1825 384 ------
NM_018566chr133932 1901 1339 21062 44 --2414 307
NM_018593chr62470 103 --1726 --
NM_018841chr153900 3207 1332 1255 345 --1177 12516
NM_019004chr721948 285 --11492 --
NM_019106chr2262798 2120 1223 999 58 50 23398 32 12957 13094
NM_019106chr2262798 2120 1223 999 58 50 23398 32 12957 13094
NM_020122chr266007 5545 3794 2204 2119 1051 --11492 --
NM_020193chr111357 ----1507
NM_020205chr142640 2457 2403 2391 --11134 --
NM_020432chr742183 897 673 333 --1521 --
NM_020526chr161553 1472 624 582 523 213 ----21319 540
NM_020673chr2046509 6414 6119 1462 55193 2117 1916 1885 985 11363 --
NM_020689chr2041252 1201 323 65 1233 --1240
NM_020699chr155303 3401 1829 1745 167 24239 1553 1632 --
NM_020713chr2042610 2240 479 195 --22142 494 --
NM_020718chr1655888 5750 2224 559 233 1265 35833 4128 880 --
NM_020796chr552936 2927 2681 2411 243 12668 --22721 2581
NM_020856chr1961538 1505 1494 1445 980 333 ----11048
NM_020860chr421010 417 ----1145
NM_020956chr1941197 513 495 377 ----1594
NM_020988chr163973 854 504 1317 --11085
NM_021003chr14------180
NM_021155chr1972830 2739 2043 1985 1883 421 367 1457 ----
NM_021183chrX11887 ----11908
NM_021813chr685833 5247 4885 4660 4029 3995 1676 32 --1289 14751
NM_021945chr683385 3180 2889 2770 2638 2289 975 962 33174 2840 1334 32952 2609 1043 1405
NM_021949chrX82924 2105 1823 898 394 332 187 67 2747 93 1101 --
NM_021961chr11115816 5755 5605 4669 2661 1858 1745 1331 1256 679 64 34865 1729 1347 22077 1765 27321 5202
NM_021964chr386524 5798 2505 2203 1568 1556 1196 541 --21772 1592 --
NM_022114chr143534 3310 731 224 1963 11598 --
NM_022351chr831328 1028 969 --11527 22958 2604
NM_022465chr1253104 2811 2606 2054 127 --12477 --
NM_022552chr24896 406 158 76 ----1111
NM_022719chr2272834 2452 1508 661 463 402 189 161 33346 3275 1475 33060 2935 252
NM_022893chr231990 185 39 23169 2189 ----
NM_022898chr1443722 3159 789 99 11833 12979 1492
NM_023002chr1961450 652 437 410 265 77 --21578 676 11788
NM_023927chr561209 509 373 285 85 31 --21199 322 --
NM_024086chr1733754 2399 598 1683 --13834
NM_024529chr11982 ----1423
NM_024554chr151696 542 508 437 279 1247 11579 --
NM_024689chrX11401 --1653 11149
NM_024713chr1541231 1146 1074 438 --143 --
NM_024811chr1141837 1773 1664 193 21402 132 1142 21882 1298
NM_024835chr17--1355 --137
NM_024887chr141576 1426 840 322 --1610 --
NM_024889chr1051740 593 427 275 186 --161235 1220 1205 1168 1154 1139 1124 723 708 694 679 664 650 638 623 609 --
NM_024915chr842328 1922 539 501 --22439 2365 1357
NM_024939chr1651589 1526 1313 1300 1223 --177 11160
NM_024948chr102634 89 --1808 --
NM_025010chr342436 2421 2166 702 --12869 --
NM_025057chr1421272 953 11165 11173 2495 313
NM_025134chr1631910 775 663 21850 380 22091 70 --
NM_025160chr164275 1518 907 802 216 161 ------
NM_025179chr174516 1164 1017 972 780 638 226 14403 14912 --
NM_025191chr133392 2532 68 --2482 258 12266
NM_025195chr821841 300 1519 138 1502
NM_025208chr1142374 1940 951 581 ----1737
NM_025222chr352272 2221 1929 1213 362 --1112 --
NM_030621chr1443284 1467 1360 1089 11029 23210 913 --
NM_030625chr1042431 2313 1975 471 1418 ----
NM_030627chr522544 412 ------
NM_030647chr734954 771 113 1164 --1663
NM_030761chr142545 991 880 423 --11920 --
NM_030791chr1421431 1176 2164 52 --11194
NM_030806chr1168894 8011 7834 7817 7493 7456 7348 7304 6578 6339 6306 3291 2297 945 134 54 33334 2354 1596 28908 8555 48052 7977 7560 2424
NM_030885chr332363 423 33 22086 1810 12377 --
NM_030918chr175481 3960 1979 1779 1395 1305 1024 13927 14544 14932
NM_030958chr8----1344 1410
NM_030980chr12480 466 ----2146 46
NM_031417chr1962840 2210 2061 859 794 237 --1787 --
NM_031431chr1361293 1176 418 410 194 77 --11695 11688
NM_031445chr253423 2616 2341 994 374 ----12930
NM_031469chr683205 3043 2706 1225 633 506 305 251 --2534 43 --
NM_032199chr1043734 2569 2556 517 ----13768
NM_032207chr1941251 1134 1066 49 2900 505 21289 417 --
NM_032457chr453609 3337 1371 956 364 --13834 1240
NM_032538chr63609 416 137 --32804 2733 2052 11792
NM_032682chr333114 367 282 --23130 2371 --
NM_032727chr1021238 1181 21291 439 186 --
NM_032737chr1972113 1954 1796 1090 1060 845 25 11025 12725 --
NM_032777chr851443 1338 1135 303 292 --11142 --
NM_032995chr261246 1229 1179 674 639 253 1471 1120 1540
NM_033027chr32992 126 1238 11157 --
NM_033055chr15864 748 740 260 221 ----21086 36
NM_033132chr1361563 1475 549 473 426 57 12268 11424 --
NM_033136chr541610 1365 1322 578 ----148
NM_033211chr511759 1308 11379 --
NM_033224chr777583 6240 2655 2115 1645 1316 1111 1338 13195 17442
NM_033389chr1744125 1418 1286 1123 24082 3102 21730 265 24418 1080
NM_033394chr221410 602 1398 11147 1560
NM_033426chr1442311 2147 1055 146 12745 32101 1848 384 --
NM_033505chr255860 5091 2692 2582 349 --11959 1360
NM_033542chr2032080 291 21 2773 614 148 11717
NM_052876chr1972730 2538 1836 1815 1697 230 56 2885 288 12589 --
NM_052879chr12104082 4056 3854 3357 3270 2907 1618 1596 1586 356 11246 1834 --
NM_052898chr821353 185 1278 2696 501 132
NM_052906chr22124719 4527 4244 3981 3342 3291 3209 1705 1274 813 666 154 --1187 --
NM_052910chr1342181 1687 64 45 ----21432 597
NM_052934chr132059 744 328 3890 562 538 32088 1692 1462 --
NM_053279chr862772 2760 2407 2001 1894 756 --12042 --
NM_078471chr1721053 371 --1121 1492
NM_080836chr2074702 3905 3724 3087 1805 1392 447 --33452 3316 2979 13343
NM_133263chr5235 27 --1117 --
NM_133264chr171625 --12676 --
NM_133445chr962547 2519 1451 1019 647 501 11102 22347 1403 --
NM_133638chr5--1545 --1143
NM_138357chr102695 634 1561 31511 355 39 --
NM_138473chr1244846 4080 504 39 1169 11233 --
NM_138927chr211272 1839 --1380
NM_139015chr121366 11654 --1583
NM_139057chr1582079 2039 1127 1102 944 428 273 85 12295 22564 378 1891
NM_139319chr122469 292 --1450 --
NM_139321chr2073899 3566 3486 3428 3283 3088 787 24028 303 13785 --
NM_144571chr465778 4871 4799 2669 2024 616 --16587 --
NM_144582chr222063 800 12030 21839 500 --
NM_144778chr1332651 2146 725 ------
NM_144967chrX21080 751 --1333 --
NM_145173chr1982337 1926 904 872 750 110 68 62 32098 693 503 ----
NM_145203chr131702 ----1759
NM_145307chr1063190 2901 1536 1355 1074 676 --1790 --
NM_147192chr141470 303 178 146 1171 ----
NM_147202chr942360 1857 496 474 11953 42589 2160 1769 276 --
NM_148960chr111551 31339 668 225 --184
NM_152261chr1252375 1674 1031 838 615 1977 2949 628 11580
NM_152265chr121179 84 --11545 --
NM_152271chr81159 ----1723
NM_152280chr122475 2191 21160 370 1143 --
NM_152424chrX63733 3204 1894 1657 1643 1420 13259 ----
NM_152493chr151671 1589 1098 1028 58 --11377 --
NM_152557chr751588 1290 1078 997 533 --11562 --
NM_152745chr741176 818 755 227 --1153 --
NM_152756chr543939 3595 545 280 --21598 356 --
NM_152758chr852691 2095 1126 119 34 ----12223
NM_152996chr161901 823 608 455 223 130 11917 11709 --
NM_153207chr1253808 2498 1246 407 41 22573 1365 21331 261 --
NM_153358chr19------1217
NM_153607chr5--1459 --12008
NM_153619chr15103639 3249 3187 2809 2633 2497 1384 1063 350 201 1718 1651 --
NM_153809chr92167 67 ----1111
NM_170606chr731738 1437 515 11158 ----
NM_171998chrX1735 --3874 642 470 --
NM_172020chr741746 1698 1267 314 11296 1273 --
NM_172071chr176054 5486 4921 4667 2822 335 145 25787 398 45519 5334 2976 1595 --
NM_173468chr445643 5587 5525 4575 --11451 11598
NM_173470chrX22868 2486 --171 --
NM_173476chr1651978 1875 1456 476 209 --1247 11811
NM_173495chrX62502 2338 1024 883 521 268 12103 2732 414 --
NM_173552chr332098 2002 1961 1916 --21911 147
NM_173631chr19----11263 1459
NM_173642chr1158299 7309 7170 6584 6458 6294 5768 2648 1701 1585 1351 1143 1047 808 460 28779 522 37062 5585 1005 27260 198
NM_173681chr722030 1523 1394 11543 21684 725
NM_173808chr134242 4187 1386 23817 1605 13302 13637
NM_173822chr221730 314 11749 12059 --
NM_174921chr42939 754 --135 --
NM_174934chr1172585 2331 2213 1010 956 402 281 12573 --13427
NM_175736chr12107760 7682 7560 6585 6228 6038 5396 4960 2922 1460 --45518 5377 4980 2470 27011 6876
NM_175768chr611604 ----2655 225
NM_175884chr7------11087
NM_177538chr2168767 8239 7904 7783 7053 6634 6345 2850 2576 2366 1882 1356 1037 852 675 402 26254 5946 --1112
NM_178123chr2178 --1150 --
NM_178140chr572395 1999 1702 824 814 292 92 2417 364 12783 --
NM_178450chr5----1274 2759 120
NM_178454chr12319 119 ----1208
NM_180989chr13------1979
NM_182485chr463067 2823 2589 1161 535 152 --23578 2413 --
NM_182758chr1533223 2959 1367 12392 --23772 556
NM_182765chr1022062 92 --12233 --
NM_182830chr1411404 --11623 1750
NM_182970chr2033946 3350 2813 33682 1691 1276 11026 --
NM_182976chr1------195
NM_183416chr131307 815 145 1349 1164 --
NM_194247chr244509 3583 2778 828 --23108 540 --
NM_194298chr1031570 1447 1273 11700 --11939
NM_198157chr2272446 2221 1988 1569 854 791 270 --2758 102 --
NM_198446chr1----1199 173
NM_198581chr267373 6701 6177 2335 1951 108 36565 5293 4996 25916 276 11422
NM_198993chr1751526 391 280 95 28 ----1273
NM_201520chr1741812 1491 1311 189 --1346 --
NM_203382chr5--11152 1245 11169
NM_206914chr1241815 598 334 272 --1195 --
NM_207371chr1041610 313 285 96 --11272 --
NM_207380chr1542936 823 735 274 32262 714 348 --11022
NM_207406chr486123 5935 5745 5406 4838 2150 1900 560 12318 --46274 4161 4102 694
NM_212554chr1021319 591 ----132