TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-611
miRNA Sequence: GCGAGGACCCCUCGGGGUCUGAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr831000 832 535 --11727 --
NM_000038chr521579 167 11285 1428 --
NM_000151chr1761683 1364 1288 389 341 263 --11777 --
NM_000222chr42428 292 ----12006
NM_000278chr1032225 1703 877 11962 11990 --
NM_000280chr111686 ----1642
NM_000399chr101733 --1857 --
NM_000462chr1521300 729 ------
NM_000620chr124500 160 141 132 1183 21371 106 --
NM_000627chr22902 134 ------
NM_000719chr1276331 5196 4479 4335 2537 1991 112 --182 --
NM_000813chr575295 5010 4624 1848 1629 1165 408 --25078 193 --
NM_000901chr42563 251 ------
NM_000944chr411602 ----12142
NM_001001344chrX22376 281 --12059 --
NM_001002909chr1731579 1487 203 ------
NM_001003800chr9103556 3284 2680 1487 1219 1105 819 801 398 216 ------
NM_001004342chr185603 4776 4760 4746 4202 4061 1875 668 --45759 1974 1601 961 --
NM_001005611chrX----3512 451 121 --
NM_001007097chr934565 1819 1162 14869 ----
NM_001008220chr553287 3252 2662 2516 561 ------
NM_001008660chr112453 372 ----11039
NM_001009571chr751555 1353 1171 1113 435 11737 172 --
NM_001010897chr13----1392 --
NM_001010971chr1------123
NM_001014812chr15------1114
NM_001015053chr1761531 1513 533 275 265 211 --11595 --
NM_001015882chr9------1868
NM_001018050chr2283154 2762 2567 2401 2136 1281 351 333 ------
NM_001018064chr922139 282 ------
NM_001018065chr985442 5432 5301 4657 895 619 602 543 2426 245 11103 --
NM_001023567chr15----21886 328 --
NM_001025242chrX61208 1172 887 79 62 46 ----11330
NM_001025579chr1751126 825 476 294 44 ------
NM_001030006chr1762521 2237 2050 620 537 246 --12689 --
NM_001033044chr1------1631
NM_001039577chr174389 3957 3870 1642 928 498 147 ----12883
NM_001039840chrX55686 4604 4323 4265 128 14953 14150 11592
NM_001040152chr761888 1792 1735 1165 853 770 1698 ----
NM_001040712chr923208 90 ----1496
NM_001042494chr1563744 3491 1331 821 475 52 ------
NM_001042681chr142615 2193 2085 922 1307 --12460
NM_001106chr3109677 8099 7398 7228 6785 6608 3660 3374 2198 315 ----18671
NM_001119chr441493 1343 982 204 --180 --
NM_001289chrX1183 ----11065
NM_001420chr1962509 2494 2224 2149 1229 1192 ------
NM_001614chr17--1610 --1131
NM_001695chr833375 1538 868 --133 --
NM_001709chr1132703 425 336 1230 ----
NM_001935chr23924 356 178 --1861 --
NM_001987chr1263922 3274 2952 1585 1315 648 ------
NM_002076chr1252844 2704 260 161 84 ------
NM_002081chr241700 1450 642 203 --21762 1104 --
NM_002101chr2----1326 1428
NM_002128chr131476 ----1787
NM_002148chr21657 --1567 --
NM_002211chr10------1729
NM_002334chr1131797 1322 103 --160 --
NM_002499chr1532315 912 455 --1447 --
NM_002501chr1963454 3008 1447 1172 1149 230 182 11585 --
NM_002522chr1743298 1375 1097 151 ------
NM_002607chr72246 128 ------
NM_002613chr1645381 3622 1858 1353 ------
NM_002636chr6142 --1156 --
NM_002651chr13894 712 323 ------
NM_002687chr142497 74 --1405 --
NM_002718chr342325 1878 1863 305 --169 --
NM_002731chr132572 1275 917 1685 180 --
NM_002855chr1121407 1302 --22677 303 --
NM_002892chr141605 --11103 --
NM_002924chr11518 --1483 --
NM_003081chr203389 272 176 1238 ----
NM_003155chr822392 909 ------
NM_003161chr1731260 951 238 ------
NM_003223chr16----1761 --
NM_003246chr1521396 100 ------
NM_003298chr336099 4919 795 12205 1378 --
NM_003300chr14167 --180 --
NM_003405chr222535 64 --1686 --
NM_003470chr163539 532 94 --11534 --
NM_003482chr1242600 2486 1776 574 --12673 --
NM_003590chr263146 1149 951 351 229 43 ------
NM_003633chr51718 --1259 --
NM_003677chr1221498 881 --31979 287 281 --
NM_003722chr332663 2097 764 12293 --11992
NM_003787chr18------1139
NM_003877chr12------1858
NM_003908chr2031097 1061 313 --1141 --
NM_003988chr1032302 1780 954 12039 12067 --
NM_004050chr1442333 763 584 418 --11810 --
NM_004093chr1332122 491 133 1273 ----
NM_004302chr1232791 2287 2186 ------
NM_004379chr221242 594 1360 1618 --
NM_004430chr842255 2187 1042 695 ------
NM_004438chr211062 --192 --
NM_004468chr12540 418 ----1403
NM_004503chr121211 --1233 1825
NM_004586chrX44682 4295 4016 161 --1869 --
NM_004660chrY12147 ----11568
NM_004723chr11137 --1118 1355
NM_004742chr311255 ----11761
NM_004759chr141775 1537 442 352 ------
NM_004772chr541352 586 507 279 --11160 --
NM_004852chr181713927 13573 13483 13378 13345 11993 11986 11848 10776 8747 4247 3822 3089 2286 1236 1079 249 213229 12996 23632 1019 --
NM_004992chrX97087 7074 5700 2607 2293 2010 1377 993 760 17525 ----
NM_005188chr11177927 7794 7285 6896 5928 5774 5658 5436 3075 2841 2781 1916 1738 1682 1176 583 226 --25472 401 --
NM_005336chr242168 2156 803 594 ----1373
NM_005596chr996051 5835 4476 4107 3945 2007 1106 925 810 ------
NM_005610chr1--1797 --1834
NM_005910chr1764010 3792 1122 1010 634 107 --23244 692 --
NM_005911chr221457 99 --1367 --
NM_005920chr183485 3049 2897 1234 1198 1142 940 195 --11037 13828
NM_005934chr1982155 2117 1705 962 821 544 478 148 --1121 --
NM_005955chr174989 4939 4930 4091 1629 1491 814 --1752 --
NM_006015chr12911 207 --21047 363 --
NM_006047chr2041146 886 749 463 --21273 540 --
NM_006051chr53231 214 123 193 1222 --
NM_006195chr921396 517 ------
NM_006336chr91275 --2370 264 --
NM_006454chr463075 2674 551 274 64 21 --21212 927 --
NM_006465chr1542267 1696 830 577 ----12319
NM_006472chr121092 827 1283 ----
NM_006480chr5------1482
NM_006546chr1786196 5936 5371 5122 4865 4378 2511 883 --25453 5036 --
NM_006559chr131242 1133 120 --11147 --
NM_006621chr142016 1699 1641 673 ------
NM_006717chr943304 3128 3064 2442 --13201 --
NM_006741chr121382 --1132 --
NM_006885chr1653056 2756 2696 1368 256 ------
NM_006947chr421547 1180 --11202 --
NM_006950chrX4882 212 189 110 --1804 --
NM_007011chr1566810 6227 5882 1395 821 407 --12668 16795
NM_007087chr163705 665 509 --1170 --
NM_007246chr4----1913 --
NM_007350chr1234393 1424 73 2963 485 13940 13106
NM_012095chr1033480 1211 1046 --11329 --
NM_012301chr721555 588 ----1494
NM_012316chr1115479 4492 4182 3463 1683 1656 1459 1309 1284 972 409 --1998 12121
NM_013250chr1111327 ------
NM_014112chr874908 4699 4589 1166 710 683 527 --12093 1773
NM_014212chr12184 1372 ----
NM_014231chr1272043 1793 1715 1368 638 97 51 ----11762
NM_014292chr2241670 1344 547 343 --11768 --
NM_014660chr73801 129 28 ------
NM_014686chr1942456 851 659 137 12212 ----
NM_014747chr185353 5140 5128 4395 4320 1784 900 62 12108 180 --
NM_014755chr263210 1331 1271 991 497 66 ------
NM_014764chr121505 ------
NM_014767chr1082863 2646 2385 2332 2253 582 405 301 22716 2660 12411 1248
NM_014904chr101777 ----13787
NM_014906chr1723919 2877 23387 3140 --13096
NM_014912chr1022884 2789 ----1109
NM_014943chr81947 --1241 --
NM_014962chr2022373 2119 ------
NM_014997chr752352 2337 2266 2154 1945 1257 --11100
NM_015039chr143549 3343 3329 89 13432 1258 --
NM_015045chr1021433 150 ----184
NM_015051chr942848 2524 1342 615 12984 ----
NM_015075chrX32249 1958 1624 ------
NM_015097chr33906 291 77 ----1898
NM_015206chr1541218 1070 722 619 1834 1906 --
NM_015210chr183990 965 816 --3909 878 165 --
NM_015285chr1872227 1820 1609 646 448 69 37 --12365 --
NM_015296chr131404 --1113 --
NM_015315chr533435 1317 964 1754 11182 --
NM_015347chr1222853 2299 ------
NM_015511chr2031136 959 950 ----11178
NM_015627chr141647 1622 1311 506 --11881 --
NM_015680chr23546 538 115 --198 --
NM_015850chr852347 2267 1908 1729 419 --22411 2358 --
NM_015995chr1535130 1279 887 --13698 --
NM_016018chr84764 549 463 283 ------
NM_016073chr15----2988 101 --
NM_016173chr372992 2949 1658 1634 1603 488 421 --13750 --
NM_016230chr6121 --1436 --
NM_016322chr922355 81 --1252 --
NM_016338chr51969 1985 ----
NM_016530chr1533428 3306 247 ------
NM_016531chr443715 915 326 172 --1394 --
NM_017602chrX1655 --1937 --
NM_017633chr61280 --1603 --
NM_017668chr163792 256 51 1149 1679 173
NM_017709chr143461 2818 1630 964 --11185 --
NM_017848chrX43519 1876 1818 1771 ------
NM_017873chr952389 2376 1926 1185 908 ------
NM_018078chr4------182
NM_018086chr2------1331
NM_018116chr12247 69 ----1583
NM_018243chr453803 3447 1612 1579 1100 1718 ----
NM_018254chr122260 1674 1820 1710 --
NM_018293chr322859 933 --13001 --
NM_018364chr154146 3598 2933 2817 2570 --1673 --
NM_018371chr81593 --11441 --
NM_018394chr3------1213
NM_018403chr343565 3139 1586 203 1915 11229 --
NM_018840chr201390 1339 ----
NM_018976chr1242280 2233 823 118 ------
NM_019102chr71457 --1113 --
NM_019593chr2053080 3030 2745 2437 2109 --1803 --
NM_020148chr1833084 1100 694 1306 ----
NM_020337chr442837 2437 2264 375 ----13060
NM_020408chr61188 --1326 --
NM_020451chr13561 393 58 ------
NM_020692chr1431010 968 729 ----11084
NM_020708chr204795 750 589 480 1658 2385 230 --
NM_020713chr2032932 92 84 --23085 2106 --
NM_020752chr1052833 2815 2691 2506 210 --12539 --
NM_020795chr1741674 1612 1357 1251 --1251 --
NM_020801chr522637 248 --12573 --
NM_020826chr1152866 2573 880 483 47 --13585 1667
NM_021003chr141720 --1297 --
NM_021136chr142292 159 ------
NM_021155chr1962444 1922 1164 1008 179 123 12848 13009 --
NM_021183chrX1252 1338 ----
NM_021202chr2031121 314 67 --11943 --
NM_021255chr1411364 12991 ----
NM_021260chr145533 392 107 43 24 --21087 480 --
NM_021814chr621573 1473 ------
NM_021961chr1165371 4763 2686 2490 406 278 16629 15670 --
NM_022719chr2243747 2866 2469 83 --33292 2380 2362 --
NM_022735chr131421 706 387 1158 11714 --
NM_022737chr191837 --1899 165
NM_022912chr242838 2764 303 43 ------
NM_023079chr1741742 1284 464 187 11643 ----
NM_024563chr531929 1570 679 --11873 --
NM_024946chr16------1521
NM_024949chr474948 4039 3852 3820 1713 1213 585 --14298 --
NM_025009chr42771 541 ------
NM_025130chr101490 --1138 --
NM_030647chr755939 5522 4752 2282 1020 14459 --16319
NM_030806chr1107156 7057 7034 5823 3782 2856 2089 2050 1362 776 ------
NM_031445chr252170 1275 1072 890 566 --22969 2794 --
NM_032153chr321888 105 ------
NM_032193chr1151878 1618 712 496 477 12099 1632 --
NM_032509chr83727 618 329 ----11714
NM_032521chr2032032 830 591 ----13016
NM_032932chr17106481 6157 6029 4955 4789 3939 1709 1671 1145 951 --25403 476 --
NM_033132chr1321896 502 --147 --
NM_033387chr952542 2482 1987 947 249 --12600 --
NM_052845chr1252325 2059 2015 1285 1276 --1940 --
NM_052905chr221293 381 ----1398
NM_058170chr111092 --1220 --
NM_080836chr20113518 2904 1820 1454 1374 1085 902 576 411 393 49 14697 ----
NM_101395chr2133314 1161 355 1375 ----
NM_139015chr12141 --11218 --
NM_139076chr411329 ----11312
NM_144979chr4------1540
NM_145185chr192657 368 --2728 434 --
NM_145203chr13----1650 --
NM_152263chr185906 5361 5228 5104 2240 1504 906 47 ------
NM_152342chr163153 137 130 ------
NM_152375chr162110 911 843 788 258 133 --12423 --
NM_152835chr122719 325 --12154 --
NM_153029chr1684107 4083 3389 3133 2710 2700 1473 1085 --13931 --
NM_153634chr122462 237 ----1340
NM_171999chr182330 84 ----1189
NM_173075chr43370 153 108 11138 1335 --
NM_173359chr32479 29 --1127 --
NM_173570chr33516 496 313 190 ----
NM_175607chr32345 261 ------
NM_175736chr12117783 5453 5346 5331 4881 2632 2456 2388 2076 1913 611 --21880 582 --
NM_175861chr1265264 4302 3998 3889 1705 1480 ------
NM_175898chr1551620 1085 321 233 78 ------
NM_176812chr202626 587 --1697 --
NM_178831chr762909 2519 2429 2211 2104 438 12534 ----
NM_181077chr15----21884 328 --
NM_181358chr143556 3315 2885 195 13894 ----
NM_181458chr2--1522 147 --
NM_181489chr3106719 6139 6078 5274 1923 1343 1021 396 208 36 --14368 --
NM_182511chr181190 ----1442
NM_182580chr141723 1611 745 420 --12546 --
NM_182970chr2084148 3651 3415 3227 1454 1388 920 341 ------
NM_183397chr2064513 4152 1393 591 195 139 ------
NM_194282chr422567 273 --22777 106 --
NM_194285chr1112197 ----11300
NM_197941chr521893 317 --193 --
NM_198213chr122636 180 --1302 --
NM_198511chrX----164 173
NM_198513chr831921 704 698 --11395 --
NM_198560chr313266 --23731 2449 --