TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-613
miRNA Sequence: AGGAAUGUUCCUUCUUUGCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr541473 750 355 61 ----1829
NM_000052chrX73419 3056 2505 789 557 383 53 --13369 --
NM_000081chr12270 21 1299 31826 1324 694 --
NM_000084chrX166959 6671 6342 6176 5162 5036 4740 2673 1794 1672 1630 1533 1463 1172 1043 83 35971 5837 1407 35030 2184 1803 --
NM_000092chr2104059 3956 3594 3384 3360 3120 1322 779 340 138 34200 3161 646 23408 1278 21679 469
NM_000125chr6113957 3676 3569 3439 2932 1491 1461 1227 583 495 367 11538 11158 --
NM_000138chr1582553 2286 2229 2125 1671 967 854 629 12467 12313 --
NM_000161chr1461681 1586 1467 704 511 115 11294 31735 1706 608 183
NM_000163chr521813 517 --22225 197 --
NM_000165chr61643 ----21616 485
NM_000168chr7103235 3217 3171 2645 2201 1336 1055 790 759 321 31092 622 207 1144 12732
NM_000176chr543872 3563 2470 2413 --11168 --
NM_000212chr1752381 2025 1947 1602 878 31917 1886 413 --11763
NM_000222chr452095 1858 1615 1409 706 --41987 1602 246 206 --
NM_000245chr751576 1487 1411 463 83 --32052 820 505 --
NM_000259chr15116303 6092 4083 2193 1990 1922 1622 1600 1366 822 86 16169 25272 35 15708
NM_000297chr441391 815 414 354 21858 1682 ----
NM_000314chr1083298 2747 2545 2348 1307 1231 620 244 21178 292 --21201 481
NM_000332chr6196978 6620 6466 5814 5542 5451 4766 2875 2835 2436 2358 2264 2204 2178 2061 1968 1807 731 602 12754 11565 11265
NM_000337chr5156287 6218 6184 6009 5983 5818 4722 4273 4226 4159 2514 1282 1120 1067 390 14584 36230 1127 330 12080
NM_000346chr1751334 649 429 155 91 ------
NM_000351chrX64265 1620 1297 1150 664 280 1833 12875 --
NM_000362chr2272741 2487 1158 1011 272 221 127 23015 466 13571 11147
NM_000408chr293469 2769 2625 1284 1152 892 702 369 304 12352 1289 2564 131
NM_000430chr1721367 567 11457 --12746
NM_000461chr373841 3610 2817 1455 1426 952 188 152 11029 --
NM_000522chr7121191 1157 1142 1110 1014 988 929 909 503 491 428 333 ------
NM_000555chrX177859 7848 7841 7772 7542 7143 7111 6957 6666 6344 6299 5946 5559 3044 2060 1868 1571 23150 246 26923 668 27232 1234
NM_000599chr274641 4529 4292 1117 1092 784 770 43963 1620 669 93 ----
NM_000618chr1286531 6185 5649 4100 2200 1946 1793 112 --24219 2283 1158
NM_000621chr1351429 1093 1058 566 558 1204 ----
NM_000719chr1286428 6165 5465 5360 1418 994 385 121 24139 1985 36653 1906 1524 --
NM_000806chr54670 558 530 358 11272 11280 21928 1472
NM_000813chr5125398 5319 4913 4553 3603 3473 1591 1344 1204 986 505 310 21906 145 ----
NM_000814chr1583707 3423 3251 3190 3096 2615 978 260 12676 1454 1837
NM_000828chrX52180 1481 517 410 331 21611 1569 ----
NM_000866chr331429 1322 464 --21342 449 --
NM_000868chrX62575 2215 2054 778 424 326 --1460 --
NM_000875chr15126933 6914 6849 6001 4920 2770 2616 1240 1185 1125 209 168 44862 4840 2810 1109 --14451
NM_000891chr1763247 3195 3163 2992 2468 1138 11095 --11083
NM_000962chr972779 2634 2105 1009 551 127 21 52322 1169 372 312 51 ----
NM_001001396chr131638 1592 1198 23816 1435 21511 600 --
NM_001001419chr594991 4165 3813 3362 1929 981 603 164 140 --1667 --
NM_001001433chr202638 543 11028 21227 696 11043
NM_001001484chr105759 649 590 114 52 --1842 12189
NM_001001664chr263891 3529 1366 1033 756 606 34110 561 145 ----
NM_001001890chr2174184 3387 2697 1288 856 790 744 1410 23234 2784 --
NM_001001936chr1031153 1068 906 ----11046
NM_001001971chr1031426 1089 500 --21165 898 --
NM_001002009chr7------1556
NM_001002257chr273008 2650 2328 2170 1167 772 294 1859 23115 850 --
NM_001002838chrX61712 1700 1205 1168 308 169 ----11749
NM_001002860chr14114081 3792 3683 3542 3309 3029 1675 936 617 360 308 24703 3432 44594 3567 751 715 --
NM_001003652chr18178082 8038 7950 6359 6338 5329 3335 3320 2726 2163 2026 1648 1445 746 645 446 359 26114 5255 57696 6888 6828 2988 1497 --
NM_001003679chr162067 1865 1547 1467 1404 81 11833 1291 --
NM_001003688chr41813 21174 1076 --1225
NM_001003712chr1283984 3718 3614 3168 2877 2775 1583 1395 22732 1617 43970 1254 226 98 13349
NM_001003760chr6113670 3524 3457 3116 2561 2468 1191 1047 440 331 98 13288 23591 666 --
NM_001003800chr983436 3369 3362 2759 1265 1112 683 548 --21147 266 --
NM_001004065chr993957 3760 3321 3169 1583 1547 770 741 564 ----13721
NM_001004317chr674452 3623 3339 1616 1328 1025 164 14460 12839 --
NM_001005242chr1231589 1326 359 --1366 --
NM_001005335chr192275 97 --143 1305
NM_001005386chr272350 2318 2291 956 840 454 274 32087 920 745 ----
NM_001005404chr1743248 1504 1417 538 --24237 57 --
NM_001005463chr1082571 2129 1958 996 794 758 711 404 12231 1243 --
NM_001005609chrX83658 3460 2872 2666 974 906 805 137 23622 2603 13666 13214
NM_001006612chrX2297 61 --2409 71 --
NM_001006617chr951451 1321 1272 1170 441 --2381 331 --
NM_001007257chr121041 139 --11057 11180
NM_001007278chr1365180 3880 3574 1781 893 112 24466 1064 11586 15109
NM_001008408chr7135794 5658 5539 5503 5188 5051 1804 1298 1261 1207 1136 1105 990 25567 4394 44451 3975 885 220 --
NM_001008738chr552421 2363 900 829 149 --12895 --
NM_001009555chr461455 1305 451 395 388 152 11444 ----
NM_001009899chr3126477 6423 5708 5391 5066 4514 4477 4330 1992 1777 914 745 35079 4285 880 31960 1730 242 --
NM_001010861chr142724 2138 1798 292 1501 --2618 509
NM_001010867chr166679 6558 6178 6093 4391 1570 15547 36207 4518 1954 --
NM_001010888chrX54255 3164 1233 1218 734 ----11120
NM_001010935chr13952 903 710 2305 78 ----
NM_001010942chr12--172 1274 1167
NM_001010986chrX72411 2232 2068 1592 819 542 397 22238 1605 2699 390 --
NM_001011553chr76958 928 818 670 278 230 ----1329
NM_001011666chr786462 5707 5180 4842 4316 2399 617 301 11735 14294 24251 4095
NM_001011713chr1441381 1035 478 171 ----1391
NM_001011720chr821451 1420 11399 --1558
NM_001012393chr1194919 4336 4262 3611 3564 3370 1225 622 307 13733 14345 14670
NM_001012755chrX135046 5038 4501 4471 4424 4154 3515 1890 690 459 281 200 180 --24885 727 25066 997
NM_001012968chrX52143 2089 2072 638 629 22397 805 12685 --
NM_001012977chrX61345 1300 1269 1146 882 318 ----11291
NM_001014342chr171738 1510 1133 713 652 362 101 --1462 21865 169
NM_001014434chr13805 699 585 ----1758
NM_001014797chr10147837 6478 6039 5594 5516 2939 2726 2325 2157 2016 1892 1142 774 29 26155 5148 27040 2033 27788 3142
NM_001015877chrX62949 2375 1170 1161 1118 724 12386 13001 --
NM_001015880chr1041637 1424 1417 223 11235 --1235
NM_001015882chr931051 382 180 --2902 734 --
NM_001017371chr211115 ----1164
NM_001017395chr362972 2813 2623 1377 1219 125 --12832 1459
NM_001017440chr7117132 6370 5846 5767 5698 3106 3022 2726 2573 845 395 26344 1325 26549 1761 16149
NM_001018056chr92575 177 ----1191
NM_001018065chr9115902 5023 4924 4772 4282 4249 2100 1834 1520 1068 814 --44892 4374 3797 1726 25867 2175
NM_001018111chr752781 1483 927 717 299 13259 1175 11157
NM_001024808chr1211959 22856 2814 --12583
NM_001024847chr342532 2154 595 267 1184 22283 400 --
NM_001024934chr61451 183 --1168
NM_001024948chr163370 3345 1196 838 171 64 ------
NM_001025079chr3134083 3982 3601 2942 2705 2598 1532 1376 1242 1095 899 621 605 13687 44039 2540 1169 629 --
NM_001025105chr561505 1404 1239 1076 981 442 1375 1493 --
NM_001025107chr172487 1770 867 549 333 298 68 --12709 --
NM_001025108chr2103924 3710 3473 3247 1652 1623 1613 1300 874 515 2678 362 33663 3362 116 --
NM_001025252chr872985 2962 2688 2167 433 261 203 1694 32727 772 122 --
NM_001029863chr623211 2170 12930 21155 743 32572 2217 930
NM_001029875chr592794 2364 2183 2131 1182 913 810 557 544 11961 12953 --
NM_001030007chr16133957 3781 2963 1332 1126 1097 891 868 782 488 441 272 23 --22949 292 12531
NM_001030055chr14134093 1642 1233 1110 955 882 850 707 364 278 144 120 108 13223 33479 557 437 13895
NM_001031679chr1243230 2861 1154 262 --23282 2212 22786 2378
NM_001031804chr1694276 3776 3509 2978 1256 1223 1075 1053 876 14220 13757 --
NM_001031812chr561849 1730 1522 1493 472 295 --3941 555 159 --
NM_001032280chr621224 525 11101 --11585
NM_001032296chr1352833 2220 865 588 538 --12276 1279
NM_001032999chr2044770 4281 517 199 --25383 1329 13311
NM_001033117chr374058 3986 3818 3487 3315 1354 256 11892 24329 329 24269 1957
NM_001033507chr161698 717 650 446 160 51 11967 1274 --
NM_001033925chr1062154 1673 798 492 463 300 1321 --1701
NM_001037132chr772026 1894 897 872 741 692 326 1857 --126
NM_001037332chr572426 2245 2194 2094 1689 774 619 1572 22557 911 --
NM_001037339chr161783 1442 1263 620 419 297 11855 --131
NM_001037954chr1163048 1112 1086 929 747 361 42434 2350 1362 980 ----
NM_001039091chrX51415 968 894 428 171 --11096 11402
NM_001039199chr2064515 4490 3992 1606 1065 225 21802 1700 14876 13131
NM_001039538chr263611 3311 2893 1186 532 81 1362 32329 2290 328 13146
NM_001039547chr3137823 7275 6713 6436 3177 2550 2008 1647 1462 1251 647 272 261 15727 57831 7191 6353 6070 1748 --
NM_001039569chr221052 490 1874 --2843 694
NM_001039618chr11125973 5876 5624 5388 4963 4619 4355 3609 1974 1215 842 273 --34151 2207 1405 24871 98
NM_001039840chrX125448 5063 4997 4447 4102 1522 1258 1074 853 813 122 39 --25011 4075 1922
NM_001039937chr13113433 3385 3049 1620 1391 1316 1140 744 556 217 80 23036 505 1243 14149
NM_001040101chr421159 436 1192 11170 21595 66
NM_001040142chr222483 902 --1519 11759
NM_001040157chr492639 2630 2377 2092 1882 1058 663 293 143 1990 12201 1370
NM_001040159chr431255 599 444 --2199 35 --
NM_001040202chr422397 749 21996 1854 --12009
NM_001040284chr16185891 5501 5019 4649 4612 4510 4490 4392 3993 3758 2111 1892 1645 1571 1302 1014 961 82 15190 55758 5117 3732 3613 1494 23883 1196
NM_001040427chr161175 ----1136
NM_001040429chr1311420 --33382 2619 551 1596
NM_001040441chr165370 4049 3453 1552 453 165 1281 --25497 1961
NM_001040450chr1552342 1067 575 299 233 --22506 967 --
NM_001040624chr811006 32218 830 491 1508 3952 687 572
NM_001040665chr7144965 4941 4246 4131 3887 3689 1724 1616 1090 742 499 444 381 69 --44363 1747 1655 1223 11112
NM_001040712chr94805 718 544 454 33314 2697 160 ----
NM_001040876chr461426 715 640 450 307 223 21558 691 --1241
NM_001042355chr1685418 5195 5103 4809 4580 4348 1908 1158 23579 1352 15273 --
NM_001042404chr141955 1887 1612 1218 1433 21846 355 --
NM_001042440chr511710 --1440 1352
NM_001042506chrX51457 1431 1311 1280 318 --11301 --
NM_001042533chr332457 2052 1273 12463 12645 1672
NM_001042555chr12114714 4529 4192 3702 3676 3271 3209 743 291 220 76 24640 1817 11088 13962
NM_001042599chr2157670 7628 7143 7010 6914 6407 5282 3033 2072 1467 1185 885 875 490 221 27779 2092 ----
NM_001042603chr1274894 4445 4191 1999 1981 1335 770 1910 24695 173 --
NM_001042749chrX2438 354 21403 483 1754 11823
NM_001043318chr1483719 3345 3298 3205 3039 2636 1535 882 --13881 --
NM_001043351chr172099 2091 1977 1849 1425 284 225 --1414 1334
NM_001046chr542832 2696 1132 781 12789 12818 --
NM_001071775chr1331833 1394 265 --2562 397 --
NM_001100108chr196355 5839 2220 2072 1535 1276 1148 853 842 11297 21218 35 17957
NM_001106chr3109533 8663 7160 7044 6601 6208 1297 1221 890 695 --37713 7682 951 --
NM_001123chr101615 --1333 1255
NM_001148chr491978 1674 1615 1582 1563 1551 1508 206 136 --21881 280 --
NM_001153chr2--3318 255 202 1906 1698
NM_001172chr143623 303 115 140 1124 --
NM_001186chr2152727 2570 2401 1260 1190 --13214 --
NM_001200chr202255 222 11162 11110 --
NM_001233chr782089 2062 2051 871 564 285 132 86 --21724 321 11894
NM_001259chr7195945 5650 5023 4986 4777 4575 4503 4246 4059 2520 2472 2448 2408 2234 2152 1483 1414 800 613 35107 4192 723 12513 15034
NM_001268chr133391 250 37 ----1932
NM_001271chr1562791 2570 2454 2306 2191 1103 1222 12845 1704
NM_001278chr1031190 285 85 --2959 134 --
NM_001310chr1293104 2765 2333 2192 1237 344 244 207 40 2801 549 1589 12002
NM_001356chrX62454 2276 1807 1585 1543 708 1670 ----
NM_001358chr41168 --1351 1143
NM_001364chr11114790 4591 4205 4058 3752 3652 3295 3239 3185 3107 1008 14606 ----
NM_001386chr842409 1794 647 507 31767 1662 914 157 --
NM_001390chr1873470 3397 3256 838 822 721 535 ------
NM_001401chr921180 1088 --11287 11145
NM_001412chrX43460 3397 3055 2331 --23193 414 2398 25
NM_001419chr1954706 1335 1279 1108 905 --13823 23471 709
NM_001431chr621129 237 3773 92 66 --1874
NM_001432chr473937 3465 3419 2943 1239 779 538 1740 159 --
NM_001438chr143327 362 305 292 13189 2681 227 --
NM_001448chrX31831 499 316 ----11699
NM_001449chrX11256 --21264 1221 1972
NM_001543chr574652 4037 3420 3245 3195 1047 234 11895 33653 3256 446 --
NM_001546chr62197 183 1146 1263 2529 209
NM_001616chr273264 3176 3000 2974 1326 821 760 23518 404 11072 --
NM_001621chr752487 1908 1860 556 329 21061 134 --22415 255
NM_001627chr341816 1758 1641 1553 1133 2831 431 --
NM_001650chr18114149 3981 3646 3443 2869 1270 1240 1094 669 451 347 24012 600 --13714
NM_001655chr1162123 1600 1495 1474 863 785 21421 1399 1184 22161 1660
NM_001656chr521340 745 --21691 240 --
NM_001656chr521340 745 --21691 240 --
NM_001690chr352279 2221 2215 2100 945 --2249 178 --
NM_001701chr951457 1292 1244 1102 103 ----11128
NM_001709chr1161769 1073 790 664 643 406 12013 3854 396 226 --
NM_001717chr1511120 11196 11293 21471 1103
NM_001755chr1661936 1412 906 520 492 233 --11432 --
NM_001759chr1264585 1900 1785 1436 1220 883 24565 959 31963 1183 1169 --
NM_001845chr1351097 1087 1021 1014 357 11004 11216 11194
NM_001858chr674975 4886 4191 1665 1270 780 157 1206 137 --
NM_001938chr131532 562 357 --11898 1704
NM_001949chr672684 2095 1267 1010 839 729 148 2862 413 ----
NM_001955chr63977 963 271 ----2390 150
NM_001987chr1273804 3665 3627 3279 3252 2845 1051 33161 2887 1127 14093 12825
NM_002009chr1542588 2230 2213 761 --1353 --
NM_002024chrX51726 1681 509 284 38 2432 54 1338 --
NM_002026chr22775 753 ----1690
NM_002074chr151388 504 479 395 226 21421 44 --11540
NM_002076chr1262904 2253 1151 1023 553 303 1435 ----
NM_002107chr1------127
NM_002158chr253394 2498 2416 941 125 22471 641 13453 --
NM_002160chr9----1570 1440
NM_002203chr543617 3143 2900 1510 23290 3157 11555 1281
NM_002239chr231046 864 300 --2799 354 --
NM_002264chr3125013 4890 4461 3700 1985 1835 1811 1694 1369 804 584 350 13221 --33853 3614 3355
NM_002267chr1382388 2278 2227 2182 1602 977 470 32 ----1311
NM_002270chr5125645 4852 4719 4373 4205 3913 3764 3598 2163 1625 1379 880 11581 13850 --
NM_002397chr541835 1386 691 356 11765 12050 --
NM_002480chr121419 ----21275 1103
NM_002505chr621267 1081 --2538 95 1245
NM_002514chr821159 942 --11091 1407
NM_002547chrX84200 4169 3102 3089 3001 2764 2724 1352 14148 43977 3064 1510 801 --
NM_002552chr2--132 3973 830 103 193
NM_002556chr1131856 727 611 21709 263 22011 624 --
NM_002601chr22444 420 --2508 435 123
NM_002645chr11103101 2962 2898 2882 2793 2358 1103 1096 965 876 32060 860 157 11980 --
NM_002646chr152209 1703 1375 1367 853 11901 11841 --
NM_002655chr8115162 5153 3794 2130 2071 1466 1124 1032 683 554 235 14942 ----
NM_002657chr2053892 2634 796 679 527 2694 609 ----
NM_002731chr152898 2888 1057 792 272 22227 110 12345 --
NM_002738chr1641074 334 66 30 ----1778
NM_002740chr342727 2551 2241 374 21800 390 ----
NM_002745chr2284439 4271 3728 3323 2944 1666 1534 842 ----24537 977
NM_002748chr1531104 1067 380 --2424 272 --
NM_002822chr1241819 1194 703 365 176 11769 21620 1174
NM_002838chr131177 847 374 --1460 --
NM_002843chr1163433 2953 1247 784 718 214 --1653 --
NM_002844chr62900 124 11353 --1216
NM_002850chr191137 11190 1234 1482
NM_002869chr1162019 1805 1575 414 273 262 ----1234
NM_002890chr5----1397 1112
NM_002906chr11102389 1693 1661 1543 884 580 423 360 338 246 1746 21914 408 --
NM_002924chr11409 2446 181 1502 1143
NM_002959chr154239 3791 3424 2751 223 --23809 1457 --
NM_002968chr1661107 1052 769 751 294 28 --1141 --
NM_002994chr431900 1653 1336 11316 31752 674 370 --
NM_002998chr821883 109 --21850 1715 1151
NM_003012chr883177 2779 2649 2544 952 366 290 146 --11233 13053
NM_003013chr46828 617 238 161 81 55 --1702 1576
NM_003022chrX4930 839 388 139 11022 1523 --
NM_003036chr131007 346 281 ----1275
NM_003043chr344119 4030 1415 1021 1920 14327 --
NM_003081chr2031183 975 821 ----1367
NM_003108chr2137299 6540 6462 5975 5595 4994 4841 4435 1839 1712 1653 916 247 15474 26366 998 --
NM_003112chr732757 2621 111 32746 2421 131 1821 23244 2574
NM_003144chr662152 1843 1677 711 337 170 --11653 11669
NM_003155chr892679 2557 2214 2059 565 490 311 217 189 --1174 --
NM_003161chr1773159 3109 2374 2189 1424 1217 789 --13006 1864
NM_003189chr162995 2933 2293 1162 921 471 ----12873
NM_003205chr1562331 1889 1684 760 634 512 11728 ----
NM_003246chr1532003 1657 194 2784 295 --12022
NM_003257chr1541172 562 440 405 --11355 --
NM_003262chr3122080 1925 1813 1762 1611 1421 1230 1011 754 143 129 95 2704 407 --35215 912 379
NM_003304chr361593 1544 1214 1202 1081 121 11518 ----
NM_003339chr541349 1088 560 465 21176 1114 11196 --
NM_003344chr74621 248 178 67 11642 1204 1213
NM_003348chr1241661 1108 1081 266 ------
NM_003392chr374013 3258 1743 661 624 590 347 23212 1570 12775 1638
NM_003406chr821516 187 132 --1597
NM_003412chr333161 3091 2858 --22852 672 --
NM_003453chr132523 208 ----181
NM_003454chr16----11340 1189
NM_003458chr352508 2491 1356 1285 917 1885 --1534
NM_003468chr274137 3909 2960 1710 1585 1488 1124 ----11281
NM_003473chr104987 760 222 131 --1820 1775
NM_003478chr1172751 2049 1197 1172 391 235 180 12697 ----
NM_003489chr2162612 2519 893 775 514 392 23227 3069 --12858
NM_003566chr12103236 3203 2935 2829 2770 2601 2319 2213 991 451 12148 23491 3175 --
NM_003567chr11392 ----1368
NM_003574chr1884266 4095 4080 3920 1448 1176 918 435 34824 1497 76 25218 4157 13912
NM_003583chr1263408 3205 3086 1234 604 335 1761 --4929 898 614 516
NM_003590chr283479 3226 3177 3138 3086 1613 1396 340 --1470 23351 3113
NM_003607chr1133536 3438 3240 3178 3058 3047 2995 1409 1288 1083 853 700 266 43824 1688 1490 237 --13388
NM_003615chr3103877 3578 3403 2738 2561 1261 1234 1087 1014 492 13356 --22456 466
NM_003617chr174460 4375 3512 3232 1128 990 62 44101 3409 3186 1677 11683 --
NM_003618chr22449 397 ----2937 906
NM_003633chr542534 2212 761 345 --11753 --
NM_003659chr271207 1188 487 222 185 139 104 2276 238 1826 --
NM_003714chr552591 2482 990 611 73 --32568 2265 2193 165
NM_003743chr262105 1860 1800 1598 642 104 22150 1924 11506 --
NM_003749chr1342146 2060 1672 210 --1651 12032
NM_003762chr13948 498 433 ----1563
NM_003800chr672357 1667 1496 710 335 174 116 --32395 487 455 --
NM_003831chr1851803 1767 1637 1502 708 ----11601
NM_003873chr1082568 2462 2003 1885 1869 998 374 278 1444 --12544
NM_003884chr351817 1448 1174 353 192 --11652 --
NM_003895chr212838 511 21658 706 32179 1349 345 --
NM_003934chr921103 78 --11125 1296
NM_003941chr732312 2029 1888 32452 819 261 1411 --
NM_003955chr1711585 ----11602
NM_003966chr5167645 7203 7188 6868 2918 2675 2641 2614 2394 2083 2030 2012 1856 1812 1731 919 56094 5795 1284 764 118 17071 25888 107
NM_003972chr1041305 538 120 57 11359 146 11316
NM_004056chr81397 --2892 374 1214
NM_004060chr52277 204 ----2499 460
NM_004093chr1372981 2389 1146 1034 956 413 178 ----13235
NM_004100chr641832 1808 1787 1037 12004 1359 --
NM_004124chr1473210 3008 2253 2184 1125 700 686 1849 23127 2228 13248
NM_004161chr241589 1430 1228 167 --11390 --
NM_004162chr341264 851 464 323 --1396 1496
NM_004171chr11209593 9492 9338 9330 8881 8238 7435 7378 7194 6879 6046 3711 3552 3185 2912 1931 1536 815 404 278 13139 58973 8202 7460 2248 1236 19571
NM_004229chrX62075 1888 846 728 266 119 --1704 1220
NM_004232chr1843847 3297 1349 928 11394 13520 23247 345
NM_004235chr93828 702 591 1226 1251 --
NM_004274chr1483202 3172 2580 1977 1238 1099 686 506 33087 2480 617 --1663
NM_004337chr841974 1901 1854 716 --21557 256 --
NM_004379chr251232 1220 703 634 78 --2482 95 --
NM_004392chr1352391 1969 631 524 56 1737 ----
NM_004419chr101102 2690 301 --173
NM_004423chr352503 1665 368 53 27 22556 2224 22518 765 --
NM_004432chr952356 1574 1502 490 439 1246 1304 --
NM_004438chr262814 2766 1304 1164 779 446 --32956 2387 2063 13130
NM_004441chr351254 1027 305 168 118 --21204 403 --
NM_004458chrX62136 1753 1686 983 840 747 21042 107 12228 --
NM_004459chr1741850 1657 778 151 ----12055
NM_004501chr193704 3636 3583 2972 1182 769 355 256 169 --13600 193
NM_004529chr92428 375 31407 923 357 ----
NM_004586chrX125417 4909 4544 4361 4042 3652 3572 3376 1937 1037 448 354 --21988 486 13334
NM_004598chr563323 3014 2869 2471 999 57 23069 2757 --12352
NM_004612chr9114635 4337 3931 3889 3672 1775 1405 1259 1234 1132 909 --34879 1451 413 14245
NM_004657chr231255 339 104 21159 353 --11059
NM_004660chrY32181 1737 1527 1666 11490 --
NM_004663chr1521584 43 --1431 11592
NM_004685chr1392984 2534 2303 1958 1085 799 741 200 182 1832 ----
NM_004709chrX21295 447 21603 1523 --21618 379
NM_004730chr572118 1910 1877 715 525 471 446 11550 1109 --
NM_004745chr8186986 6630 6489 6439 5996 5170 4720 4280 2783 2241 1920 1677 1213 1092 918 702 485 336 --11150 12632
NM_004748chr1554254 3697 3423 3023 562 1425 23932 2837 1152
NM_004755chr1421240 42 --1867 11199
NM_004774chr1752395 2320 1936 1093 322 --22878 427 --
NM_004788chr1141805 964 373 281 ----12692
NM_004801chr241191 1078 576 304 --21180 276 --
NM_004808chr1083369 3333 2477 799 492 413 389 155 174 1245 --
NM_004815chr1154771 4425 4249 3898 3559 3334 3257 3174 1942 1877 884 854 727 687 190 --11108 --
NM_004859chr1772922 2879 2745 2152 1144 1073 283 21200 711 12355 1182
NM_004898chr432847 2813 597 22312 881 22174 1085 --
NM_004926chr1461745 1357 1256 664 544 87 1524 --11645
NM_004936chr943036 2580 1974 175 23042 1980 --32413 1176 268
NM_004947chr382383 2346 2218 1830 727 703 462 233 --22120 227 --
NM_004973chr631646 1267 54 ----11216
NM_004985chr1274305 3696 2928 1782 1582 662 192 23669 3505 --22955 1650
NM_004999chr6144323 3777 3578 3403 2817 1538 1425 1129 831 703 692 491 481 257 44443 4297 3143 81 23522 405 --
NM_005063chr1043143 3101 1022 770 2928 119 ----
NM_005065chr1465320 4429 4156 1382 942 559 --25112 2065 23280 3267
NM_005095chr142122 2046 1830 1680 --12237 1714
NM_005100chr661005 979 893 731 335 149 --1206 --
NM_005116chr20103828 3115 3079 2997 1676 981 903 302 284 98 23660 741 44276 4090 3361 105 --
NM_005156chr995021 4258 1880 1553 901 484 278 165 122 11975 1351 15296
NM_005171chr1221336 224 ----11244
NM_005180chr1011707 1469 1361 11449
NM_005188chr11128279 8160 8122 5690 3125 3108 2795 2615 2430 2073 1806 1027 27517 2449 26645 1861 1921
NM_005233chr332586 1928 569 12065 11798 --
NM_005238chr1132939 2875 2451 21349 1141 --23111 2356
NM_005245chr45624 543 511 206 156 ----1526
NM_005259chr251546 1196 622 523 250 ----21279 1033
NM_005277chr461668 1639 1560 1434 1356 1189 ------
NM_005324chr1741976 1393 571 549 31535 701 118 1812 --
NM_005339chr4104285 3567 3522 3423 2923 2820 1017 849 647 102 ----11205
NM_005359chr1865053 4604 4435 4387 2608 711 35292 352 278 24160 238 15613
NM_005375chr651103 818 796 470 64 ------
NM_005381chr2------2150 97
NM_005388chr921368 1070 ----21712 1103
NM_005392chr931693 1318 616 1268 21778 1477 --
NM_005399chr1114166 3434 3388 2808 1422 1281 1259 1250 809 558 53 22951 568 43381 1105 574 493 13162
NM_005400chr272963 2827 2225 1954 880 697 141 --12122 12408
NM_005402chr751593 1193 636 227 99 11468 ----
NM_005433chr1852736 2707 2270 642 305 1442 ----
NM_005436chr1073792 3654 2553 1105 566 321 242 11066 14032 --
NM_005440chr1743332 3055 2131 824 21194 374 ----
NM_005458chr952314 1880 1555 755 703 12068 22185 1539 11757
NM_005476chr91993 --11440 21333 1102
NM_005504chr12125956 5838 5601 4345 2519 2245 2166 2126 2051 1620 754 601 15054 36571 416 344 12009
NM_005522chr721031 224 --11024 11203
NM_005578chr3164916 4412 4347 4107 3946 3870 3543 1733 1201 1179 868 481 455 421 273 234 11609 13909 24211 180
NM_005584chr134695 625 534 516 ----2662 85
NM_005596chr9136259 5961 5741 5162 4715 4643 4426 2507 2457 2062 1688 1399 498 24321 2535 14104 --
NM_005639chr1241729 1549 1519 104 21426 455 --11697
NM_005715chr672546 2494 2348 2292 2158 2113 1743 --1120 22628 841
NM_005721chr21714 ----1778
NM_005746chr722261 923 1630 32659 1952 1101 --
NM_005748chr1272951 2854 1365 650 198 95 78 --21070 184 --
NM_005813chr242390 2348 856 309 12276 11907 --
NM_005819chr163259 2731 2457 987 978 484 22292 349 194 12659
NM_005822chr642255 2015 1981 606 --2682 466 1583
NM_005868chr752215 914 726 578 555 12419 32020 1013 83 --
NM_005898chr1152903 2393 2047 829 506 33029 3005 471 11240 --
NM_005924chr73743 126 26 --1977 2385 228
NM_005933chr1173035 2524 2151 1910 1056 919 707 12974 11852 --
NM_005935chr4104557 4287 1583 1544 909 813 797 406 132 75 24022 3758 1296 --
NM_005941chr874190 4065 3604 3568 913 765 373 44165 3822 2699 1563 --13201
NM_006016chr671906 1832 1740 1718 1628 885 205 31525 434 101 12252 1557
NM_006037chr284775 4325 3922 3780 3436 1670 1592 1394 23553 1166 13520 11156
NM_006047chr2043386 3139 3065 2868 --12175 --
NM_006079chr64808 736 710 217 --169 1677
NM_006080chr762984 2064 2027 1862 993 782 32924 2767 2083 13019 1420
NM_006094chr852269 1724 1580 318 150 32030 1632 725 1666 --
NM_006106chr1173468 3279 3132 2819 953 871 308 ------
NM_006148chr1742927 2061 621 74 --1414 32774 360 36
NM_006190chr22770 323 ----1810
NM_006212chr154819 3799 1646 714 22 34868 3761 1346 15311 14019
NM_006224chr1741721 333 296 114 ----11862
NM_006237chr1352027 1967 1956 249 153 1744 --11855
NM_006256chr152512 2249 1992 1096 783 22281 155 12466 --
NM_006267chr231242 638 621 21711 1360 --11767
NM_006313chr1281692 1447 1204 1195 1159 629 494 205 ----11306
NM_006321chr321556 507 ----11503
NM_006330chr81519 21374 416 --11607
NM_006371chr354387 3772 2076 1038 273 21576 1348 1707 11150
NM_006380chr1784368 4288 3961 3630 357 228 190 180 22859 1161 13971 --
NM_006403chr61127 31377 1197 311 --11766
NM_006420chr2083340 2851 2764 2472 2138 1334 235 55 1245 12151 --
NM_006547chr752073 1751 1646 1587 307 --1326 --
NM_006557chr931361 398 391 41739 1240 1228 458 11639 --
NM_006557chr931361 398 391 41739 1240 1228 458 11639 --
NM_006557chr931361 398 391 41739 1240 1228 458 11639 --
NM_006595chr114604 537 492 72 21738 364 11395 11612
NM_006599chr16188240 8085 7985 7543 7401 7061 6832 6668 6058 6047 5791 5147 3101 2500 2081 1620 1037 841 57456 7130 5829 5643 2224 47438 7387 3186 211 1544
NM_006618chr121327 128 --11428 11492
NM_006624chr1052080 1598 425 355 271 21768 1555 11857 1734
NM_006682chr752406 2332 2185 922 737 12299 ----
NM_006734chr64513 267 34 27 ------
NM_006738chr1584493 4436 3889 3073 1811 1603 766 656 1635 ----
NM_006777chrX62834 2763 2494 2338 2149 2085 11104 1841 --
NM_006826chr261301 1205 1010 468 160 59 3381 231 67 1406 --
NM_006852chr1752412 2350 1953 1839 622 1672 22222 1064 --
NM_006873chr272686 2448 2191 1402 1339 1036 359 13007 32864 2674 2474 11184
NM_006874chr451054 1043 1036 103 57 --1314 --
NM_006885chr1673771 3344 1391 1151 994 938 448 --1189 --
NM_006888chr1442898 695 461 107 1836 13532 --
NM_006902chr153246 2885 2750 2359 2227 --12410 12556
NM_006908chr71292 ----1224
NM_006915chrX3907 460 263 ----22371 2041
NM_006916chr251377 957 474 187 152 21262 123 ----
NM_006940chr12--21754 1483 --11395
NM_006951chr103298 231 178 ----1693
NM_006981chr953014 1207 942 789 87 11916 --12321
NM_007011chr1565947 5844 2694 2031 1930 576 16047 26559 6502 12447
NM_007017chr54830 698 630 311 --1298 --
NM_007038chr2186051 5191 5119 4512 4473 2205 993 277 55949 5211 4622 2309 1729 32129 1259 398 14078
NM_007050chr20107499 6126 5915 5044 3152 2044 1302 646 606 506 27032 6752 35129 2373 1673 37605 7515 1359
NM_007106chr1362735 2041 1781 1757 1725 178 ------
NM_007114chr3163199 3140 2911 2814 2695 2667 2603 2556 2311 934 776 702 432 387 236 57 --22823 2344 --
NM_007124chr671425 1313 1276 763 733 397 276 --1406 --
NM_007139chr761209 1144 914 904 814 430 --11116 --
NM_007146chr1742786 2394 2064 556 2615 507 22082 1800 --
NM_007172chr2283000 2954 2824 2746 2564 1154 1026 221 1627 22046 1323 195
NM_007175chr883301 2815 2622 2443 1219 1100 513 497 13428 1655 --
NM_007187chr131314 1305 2989 413 1715
NM_007218chr84709 671 322 247 ----1959
NM_007249chr13219255 8071 7357 7099 6394 6147 5913 5818 5749 3748 3724 3454 3412 3267 3000 2907 2592 1590 606 318 299 49451 9192 2892 2662 36496 5741 1838 16997
NM_007269chr1----1127 1618
NM_007276chr75793 768 450 258 237 1356 11139 --
NM_007331chr452506 2269 1858 1813 512 1481 12679 12631
NM_007331chr452506 2269 1858 1813 512 1481 12679 12631
NM_007350chr1294543 3880 3792 3412 3255 1822 1678 994 908 24640 879 34445 356 63 --
NM_007375chr162786 2302 980 600 150 131 22792 552 1369 --
NM_012081chr543295 2964 938 168 43596 2984 1230 945 --12822
NM_012104chr1153854 3803 3161 1117 308 13439 --12728
NM_012120chr622544 755 ----12791
NM_012156chr2043043 2374 72 26 --1269 23235 1008
NM_012158chr1331197 382 346 --1711 --
NM_012214chr2115907 4286 2356 1779 819 699 691 332 214 132 23 55982 5843 2505 2399 1166 25628 298 --
NM_012234chr353230 3118 3012 1427 1169 1206 23657 1273 --
NM_012249chr253206 2914 1276 679 36 1430 33435 2342 344 --
NM_012255chr20--138 --1418
NM_012262chr164813 4542 3623 1882 1863 657 15265 24862 4410 --
NM_012281chr7101876 1820 1767 1495 934 832 363 211 177 86 11604 ----
NM_012287chr383893 3821 3279 3152 2998 2921 2753 1389 14312 33268 1689 1070 --
NM_012290chr221399 345 --21234 457 --
NM_012293chr242308 766 753 350 11624 1681 2645 113
NM_012297chr462430 2376 2341 332 109 56 21685 918 --1649
NM_012301chr762205 1546 1419 704 607 534 12031 1314 --
NM_012316chr184069 3729 3537 1939 1232 1174 580 398 13999 --1463
NM_012325chr2021248 586 ----1431
NM_012330chr1061334 1214 626 525 219 114 1414 ----
NM_012347chr622276 924 1792 23033 2101 12568
NM_012388chr1533174 3129 119 --22178 843 --
NM_012395chr783114 2351 1021 827 627 476 386 48 --13162 21036 758
NM_012465chr1072785 2186 716 622 353 300 276 23214 1230 1839 13389
NM_012471chrX31880 1216 758 11319 21980 151 --
NM_012482chr13681 655 217 1661 1523 3554 493 463
NM_013261chr463544 3305 2353 1453 1211 852 1419 22771 1062 --
NM_013357chr81636 --1278 1287
NM_013372chr1543127 2115 1065 425 11072 23177 2978 --
NM_013381chr1272071 1590 1551 647 513 336 186 1948 1268 --
NM_013436chr25704 566 523 218 195 ------
NM_013438chr951433 1393 1270 510 497 --11350 --
NM_014043chr351592 1512 1326 1066 667 --31421 1046 280 1567
NM_014048chr16105322 5221 5165 4836 4191 4131 1271 1167 782 354 24013 3440 11051 23627 168
NM_014112chr8105419 5249 4579 4219 3948 3806 3359 1994 1626 974 11826 --31938 1581 1515
NM_014141chr7115295 5175 4987 4439 1957 1907 1891 1638 1503 1199 150 --24757 426 11752
NM_014243chr432041 1605 425 --1551 1600
NM_014253chrX62437 2426 2370 2179 1612 551 ----11847
NM_014322chr121272 1255 1282 --11099
NM_014325chr1241883 1465 884 565 1697 --2154 118
NM_014342chr1121072 949 --128 1495
NM_014415chr341328 360 144 60 1480 11215 11587
NM_014421chr421790 241 --11909 11897
NM_014423chr575247 4831 4565 3687 594 507 412 65360 4020 3956 1665 795 640 15215 15552
NM_014445chr361864 1817 913 784 57 29 31679 166 143 --12316
NM_014456chr105676 239 142 127 119 1287 ----
NM_014517chr321730 1499 11337 --11963
NM_014554chr1242246 1499 1425 143 --11783 11558
NM_014572chr1331616 378 348 11489 21374 1237 --
NM_014630chr1564008 3317 2815 2669 1309 925 23632 957 12784 13396
NM_014667chr342382 2020 1732 982 --1581 22263 1697
NM_014682chr842328 1882 1581 301 11600 --11455
NM_014689chr21164 ----1458
NM_014707chr751934 1870 1579 1566 367 --21776 919 --
NM_014711chr1661731 1459 1352 746 644 294 --21934 572 --
NM_014747chr185654 5291 4535 2178 1106 1053 943 205 15449 25745 3723 --
NM_014751chr851606 1346 646 550 228 172 11412 --
NM_014779chr31406 1141 2979 831 --
NM_014787chr142098 1862 1810 704 2284 251 1867 --
NM_014803chr10102428 2310 1932 1025 783 541 445 352 116 82 ----12334
NM_014810chr153436 3229 999 771 519 12528 22582 502 --
NM_014820chr352099 1888 681 438 202 21978 1965 1623 --
NM_014822chr43528 452 32 1258 ----
NM_014830chr1253300 2997 741 246 200 ----13891
NM_014839chr122058 415 11951 1957 12225
NM_014840chr1233069 1088 326 23223 2242 ----
NM_014876chr2232201 1912 895 ----22037 1821
NM_014877chr17145528 5497 5329 5295 4759 2887 2630 2450 1890 1510 1303 1214 631 378 21747 554 21918 1561 1174
NM_014898chr1951901 1742 369 327 277 ----157
NM_014901chr542290 2006 468 120 12107 --1597
NM_014903chr1242249 2233 2219 609 1495 1803 --
NM_014904chr1063944 3154 853 549 487 112 13705 11446 --
NM_014906chr1753211 2884 905 579 434 11198 43935 3462 1500 77 --
NM_014917chr12819 64 ----1954
NM_014918chr1551637 1608 1190 1108 526 1444 21319 318 1386
NM_014924chr1453074 2958 907 837 71 --2601 156 12729
NM_014934chr13133989 3803 3488 3295 2769 2606 2527 1299 1026 776 715 706 691 21344 25 21227 951 --
NM_014937chr102429 392 21280 191 --11184
NM_014946chr231070 373 31 1339 1933 12127
NM_014947chr12791 443 ----13086
NM_014950chr1411246 31666 1252 1141 11742 11788
NM_014962chr20102581 2356 1942 1869 1097 1017 528 518 212 177 1285 12625 12002
NM_014989chr621608 1438 31869 790 24 21305 366 --
NM_014990chr1441345 1163 284 148 1861 --11119
NM_014999chr122634 337 ----177
NM_015002chr1241437 491 340 322 --3671 372 280 --
NM_015020chr1662856 1488 785 524 209 68 --2417 82 --
NM_015025chr2102734 2477 2195 1864 1069 1036 999 504 267 196 1651 ----
NM_015026chr12124617 4574 4193 3818 3477 3447 3240 2997 2988 967 849 619 24098 1690 23165 82 1449
NM_015027chr163742 628 249 ----11359
NM_015032chr1352930 2586 2082 1826 154 22731 2154 --22405 971
NM_015035chr2086716 5668 4620 1465 809 719 292 95 24741 987 16611 --
NM_015045chr1051785 680 262 160 103 ----1440
NM_015051chr932280 599 410 12835 1435 13041
NM_015074chr174553 3712 1949 646 597 155 62 13478 --13553
NM_015076chr694528 3607 3584 3148 1645 1327 741 549 289 --14249 --
NM_015092chr1693713 3550 1836 925 899 854 675 647 460 21396 357 ----
NM_015094chr2254372 2987 1523 883 592 11819 --14039
NM_015097chr321907 390 32228 271 200 --12376
NM_015110chr952542 2459 2357 1748 492 11552 1811 11702
NM_015144chr1663975 3804 3542 3407 1595 1447 --13881 11027
NM_015170chr82624 593 ----32299 878 397
NM_015184chr3297 67 ----1248
NM_015205chr1365069 3538 3501 1428 418 355 --24608 379 25133 1484
NM_015239chr91197 ----1527
NM_015263chr152787 271 1823 --131
NM_015265chr262700 1959 1008 968 885 58 --2844 166 --
NM_015271chr474110 3780 2919 2819 1612 1463 486 --21678 1263 24032 2706
NM_015272chr1661914 1679 1327 696 300 184 1674 11851 --
NM_015275chr1261924 1897 647 615 463 160 11560 ----
NM_015277chr181498 ----1237
NM_015278chr652615 2436 2238 558 357 22376 2163 --11253
NM_015296chr133867 837 332 --21224 860 --
NM_015313chr11114797 4650 4584 4193 3766 3647 3550 3460 375 357 215 2888 572 14447 13581
NM_015317chr272485 2123 1828 1764 1135 981 202 --12084 12655
NM_015326chr153000 2870 2852 903 479 --22024 853 --
NM_015328chr793138 3049 2629 2425 2284 1129 698 364 280 --12065 --
NM_015336chr1232026 1028 192 ----1472
NM_015355chr1751967 1695 766 373 44 11269 1216 --
NM_015455chr583411 3150 1526 1286 1105 1032 801 384 12687 1837 --
NM_015484chr13633 619 183 1661 --1251
NM_015530chr23624 363 272 --1391 1674
NM_015542chr101451 122 --11199
NM_015548chr641002 938 359 180 --1237 --
NM_015550chr742916 2670 2300 1166 22459 910 1220 --
NM_015569chr1104870 4499 3825 3504 3395 3091 1403 1048 795 135 43967 1672 1006 627 1408 14070
NM_015576chr3102978 2443 2276 2265 1894 1032 487 360 230 88 ----1972
NM_015578chr1972006 1639 1448 1382 794 695 105 --11939 1624
NM_015630chr24780 741 369 239 ----154
NM_015678chr133656 571 378 21604 1110 11093 1114
NM_015879chr18178638 7272 7122 7080 6981 6945 6764 6603 5964 5330 3111 2861 1869 1703 1539 1387 1343 58006 1261 1065 883 728 26136 1213 16035
NM_015888chr1103125 2928 2910 2630 2096 729 630 564 255 210 --13086 32558 1213 244
NM_015902chr84923 849 756 186 --1140 --
NM_015906chr1124667 4354 4015 3415 1937 1858 1526 1253 1112 1016 842 791 --24268 181 13949
NM_015912chr862488 2026 1847 524 518 388 31986 413 87 --12423
NM_015995chr1545571 5294 3611 1049 11137 24661 4322 --
NM_016009chr154887 4569 4199 1664 1094 14205 33993 2994 1359 14870
NM_016021chr682805 2420 2360 1998 567 505 157 112 1880 2533 51 --
NM_016040chr12753 646 12308 1631 1581
NM_016045chr2031448 1236 283 ----11529
NM_016073chr156946 849 733 376 179 68 --1147 --
NM_016083chr642629 2529 1491 185 13204 --23389 970
NM_016106chr14------1181
NM_016132chr1552406 2306 2143 1070 658 13258 125 11183
NM_016201chr372356 2243 1675 1532 1461 123 33 21787 71 22021 228 --
NM_016206chr3178631 8183 7734 7145 7098 6719 6434 6259 5831 3594 2970 2936 2276 2264 1879 1502 359 25824 2949 15711 --
NM_016217chr683616 2939 2927 2561 2509 2264 1370 903 33024 1185 1103 23457 76 --
NM_016221chr561885 1847 1593 938 919 454 ------
NM_016248chr1353492 3240 3221 2574 668 --33577 1166 306 --
NM_016252chr23695 615 381 1766 1905 --
NM_016271chr1871921 1873 1825 1493 540 358 328 ------
NM_016275chr342629 1911 562 203 12235 12225 11874
NM_016277chr631260 1159 372 --11199 1600
NM_016287chr141819 1795 1586 662 11904 --1614
NM_016322chr962932 2892 2336 2199 1097 1045 1802 1690 --
NM_016357chr1231244 1086 305 --11212 31108 274 184
NM_016395chr1571960 1809 1619 1349 1320 685 216 --31628 531 145 11536
NM_016396chr1582155 2121 816 714 647 589 524 488 1425 22784 2046 --
NM_016422chr11--23121 2216 13052 13030
NM_016424chr1761600 1304 1231 332 272 187 21431 539 11261 --
NM_016442chr562305 2145 1946 1717 1494 800 41731 1550 653 376 ----
NM_016467chr221225 977 --2364 201 --
NM_016486chr11358 ----1491
NM_016530chr1563726 3693 3368 3251 2843 2536 14095 23418 3264 13328
NM_016531chr4154058 3671 3582 3451 3287 3103 2931 1075 903 810 789 527 336 96 81 --1407 12888
NM_016559chr361426 1364 1343 1226 1069 102 11133 11015 --
NM_016617chr1372100 2080 1918 1579 798 738 353 --1710 --
NM_017420chr1463482 3457 3309 1140 540 75 --33713 2531 555 13381
NM_017437chr144737 585 344 158 31547 650 183 --11746
NM_017508chr1182497 2445 2212 1819 929 914 671 508 1954 21627 373 140
NM_017540chr533240 2068 876 32730 2180 1097 1673 13026
NM_017542chr141741 1449 275 70 21435 233 1554 --
NM_017551chr1062650 2526 1965 438 315 288 12643 31994 962 190 --
NM_017588chr941909 488 443 336 --21944 200 1356
NM_017610chr1571641 1635 1619 689 264 215 37 --21988 482 --
NM_017628chr4135283 5197 4752 4737 4726 4715 3736 3465 2119 1687 484 463 55 24920 1072 24984 1120 23606 1107
NM_017637chr9129055 8704 8184 3774 3422 3176 2754 2588 2118 2062 1307 684 13489 11958 27160 6951
NM_017640chr65875 751 617 219 199 --1264 1866
NM_017643chr1762873 2420 847 731 597 97 21950 967 11158 --
NM_017650chr785955 5816 4382 2344 1670 1130 1095 603 35691 1533 827 35929 4206 945 --
NM_017658chr1484087 4060 3387 3026 1623 1473 839 467 14000 11260 --
NM_017666chrX42071 1615 1405 394 1173 22004 1806 1293
NM_017709chr143525 3444 2967 550 23146 1273 --23665 1002
NM_017769chr1493259 2851 2582 2510 2114 804 476 402 334 11122 --1771
NM_017848chrX83859 3332 3265 3014 1803 1765 1392 1215 13997 22846 1631 --
NM_017964chr221021 796 ----2947 130
NM_017975chr15----1963 1927
NM_017994chr752959 2359 623 443 407 22915 117 --1132
NM_018014chr221071 903 ----1363
NM_018015chrX1370 3317 293 177 --2752 58
NM_018027chr1043282 568 241 143 11299 42100 754 589 276 --
NM_018028chr1961298 1121 534 413 406 111 --21248 543 --
NM_018084chr293304 3261 2214 1070 818 785 710 291 189 12239 13129 11338
NM_018086chr241902 597 510 320 --11424 --
NM_018137chr131385 948 157 --21179 428 --
NM_018178chr161698 1642 775 650 630 251 --12064 --
NM_018181chr1861977 1611 1477 548 117 55 ----11453
NM_018184chr351888 1506 1412 323 60 21860 835 ----
NM_018202chr11253 --1638 1710
NM_018211chr151858 1422 766 713 194 1396 1272 --
NM_018247chr672931 2549 2066 1957 885 868 740 21013 241 32106 1228 1054 1966
NM_018254chr161816 1744 1535 948 491 93 --2597 337 --
NM_018263chr242043 1623 263 164 21726 595 1397 11678
NM_018287chr101973 1244 1866 1854
NM_018293chr3102575 2338 1934 1906 1177 1149 1068 727 233 144 32954 1983 1819 --12031
NM_018327chr201533 1392 --11306
NM_018351chr1234151 2951 261 14374 2900 832 14023
NM_018362chr1184001 3768 2963 2856 1295 883 691 626 33848 2455 1477 42631 1405 978 325 --
NM_018364chr163672 3324 1605 1452 799 23 --12761 1131
NM_018374chr795088 4220 3395 2009 1982 1962 1803 1307 510 13242 14082 --
NM_018403chr364003 3267 1209 1037 900 129 12737 23645 156 --
NM_018424chr951621 1393 556 426 195 21378 51 1364 1529
NM_018440chr8127495 7479 7212 6876 6864 6812 5454 2778 2122 1050 857 686 27507 2322 17935 --
NM_018448chr122940 245 21234 508 1959 --
NM_018682chr71546 ----1220
NM_018704chr131625 830 124 21771 366 21982 1657 134
NM_018710chr86954 389 377 339 276 99 --1537 --
NM_018717chr482874 2737 2723 2697 2687 2638 2321 910 1180 ----
NM_018718chr761985 1846 1782 1543 78 61 --12221 12254
NM_018834chr52761 351 1358 2818 670 1413
NM_018841chr1113980 3759 3693 3357 3185 3065 2771 2678 2618 2595 400 ------
NM_018945chr6102859 2244 1442 1387 1128 1108 790 776 723 198 ------
NM_018970chr742992 2923 2000 1175 22652 563 1129 1433
NM_019004chr722421 342 3937 414 280 22330 1724 1727
NM_019063chr262276 1955 1572 1566 1557 1468 22112 1445 1795 --
NM_019072chr553855 3418 2855 771 148 33544 3461 2755 13537 24215 2704
NM_019080chr1381483 1474 1344 1253 379 290 178 168 --123 --
NM_019600chr152821 270 ----1163
NM_019610chr151844 1735 1707 1393 384 1860 1585 --
NM_020119chr782843 2797 1268 1095 953 910 217 41 --23035 1511 --
NM_020122chr285454 4461 4319 4291 2282 271 163 127 34150 3986 1375 25585 915 11813
NM_020148chr1893042 2631 2191 2082 1918 1070 912 699 413 1584 12023 --
NM_020159chr4295 62 1562 1126 --
NM_020228chr1192508 2497 2081 1767 1589 1038 947 784 543 22087 394 21010 924 12313
NM_020337chr473161 2569 2542 2261 1966 1067 807 1781 12554 --
NM_020342chr242354 2055 451 397 22156 1924 22222 2204 --
NM_020346chr1161608 1306 1275 439 212 193 --11468 --
NM_020348chr1031766 988 386 11062 --1425
NM_020374chr1232037 816 772 31991 1590 150 1780 1655
NM_020390chr3114781 4669 4513 4004 3859 3551 1975 1526 1231 302 105 --1225 14790
NM_020432chr751821 1639 1515 428 179 11590 12339 --
NM_020452chr131649 1633 95 --12114 --
NM_020456chr1332206 712 93 --1815 --
NM_020463chr22518 475 ----11050
NM_020474chr1841437 1293 638 491 11273 32058 73 62 --
NM_020640chr362111 1542 899 325 220 170 ----11650
NM_020648chr1872782 2480 2277 2157 1839 666 433 32268 613 327 12727 12222
NM_020666chr52366 352 --1673 177
NM_020718chr16106411 5915 5859 5645 5572 4796 1795 1264 679 655 26132 4053 ----
NM_020734chr1293030 2928 2592 2465 2053 1076 918 732 476 --1827 --
NM_020742chrX52373 2188 2150 1669 978 1315 42113 1862 416 244 --
NM_020752chr1052492 1892 1037 605 544 3987 554 244 176 12320
NM_020760chr241724 478 448 151 --11659 --
NM_020768chr563041 2957 2496 1159 871 756 11108 42382 2289 847 107 --
NM_020769chrX1973 173 1646 1943
NM_020772chr1797751 6245 6067 5979 5284 2979 976 892 476 26557 1877 26753 843 25621 2632
NM_020774chr1896280 5880 5474 5210 4406 3852 2458 2429 613 45756 5276 2282 369 15777 16144
NM_020783chr1842134 1962 272 222 31663 586 528 11569 --
NM_020801chr532514 2245 500 12412 2985 176 --
NM_020805chr1831600 1263 681 3569 229 87 1385 137
NM_020830chr262424 2365 1134 928 705 123 1895 13313 11204
NM_020839chr321619 27 1552 11510 1424
NM_020854chr1861508 1430 1379 1347 1325 317 2627 543 ----
NM_020858chr1532114 402 386 2858 224 11481 11501
NM_020870chr461900 1802 1715 1437 356 79 1894 ----
NM_020871chrX52337 1998 1959 956 734 11008 184 11936
NM_020872chr351445 1432 1317 616 456 --11339 --
NM_020899chr1732158 2127 1697 --1628 1449
NM_020918chr1052967 2724 2375 502 300 --12285 --
NM_020940chr1062887 2413 2356 2334 966 275 --2374 158 149
NM_020981chr21215 1815 --1584
NM_020988chr1631269 1067 209 21158 281 1238 --
NM_021005chr15----11082 11144
NM_021033chr1352528 2297 1284 476 169 1850 1548 13457
NM_021038chr3102806 1347 1125 993 774 730 330 296 216 171 12229 22798 245 --
NM_021083chrX43493 2436 809 469 ----12337
NM_021097chr283023 2644 2072 1032 802 460 172 84 12560 11965 --
NM_021116chr7118823 8148 7543 7387 6993 6640 6134 3466 913 877 776 --29033 825 18611
NM_021148chr741680 1612 713 353 --32347 1932 1664 --
NM_021180chr11683 1716 2738 621 --
NM_021252chr102263 244 --11808 21467 1411
NM_021255chr1483967 3449 3228 2987 2697 1217 645 590 11233 12848 --
NM_021629chr385055 4862 4785 3112 1103 945 735 345 1806 11868 24616 4317
NM_021637chrX31378 1199 185 11131 11119 11165
NM_021648chr682648 2454 2330 1722 1706 979 381 182 ----1522
NM_021783chrX62319 1952 1520 840 236 195 1172 1688 12435
NM_021813chr695838 5360 4945 4853 3906 1612 963 933 106 34930 4860 1300 21530 559 --
NM_021814chr661716 1633 1528 1447 1338 1241 --1198 --
NM_021961chr11137446 7415 6745 5861 4589 2916 2692 2234 2054 1932 1351 1246 376 25274 1492 22505 1141 16837
NM_021964chr3146608 6548 6010 5046 5023 4490 2655 2630 2312 1611 1521 1252 176 157 34631 1296 252 32330 831 326 24271 866
NM_022041chr1662632 2100 1930 1081 790 545 12584 --12609
NM_022048chr15156342 6330 6075 5311 5203 4948 4227 4090 4058 3931 2152 1992 954 550 70 55417 5132 4204 2103 1789 1896 11530
NM_022058chr252114 1487 582 331 237 --21687 1336 --
NM_022114chr184629 3850 3651 3193 1684 1440 1351 137 24017 3884 24673 1490 --
NM_022130chr541378 447 370 23 1227 11037 --
NM_022133chr871663 1522 1419 696 401 210 173 --1261 --
NM_022166chr1656239 5510 2228 2128 2079 34267 4247 1134 15563 14953
NM_022351chr81203 33736 3181 3017 23174 3006 --
NM_022444chr751525 530 437 345 95 11280 11890 --
NM_022458chr793069 2579 2240 1017 951 750 265 251 82 --22648 61 --
NM_022474chr1452394 2284 2206 920 821 1262 11728 1617
NM_022477chr2051088 692 487 424 148 ----2215 69
NM_022496chr123467 393 191 ----1408
NM_022497chr323921 1411 23875 2639 --23746 3611
NM_022726chr681746 1292 1187 478 432 331 227 202 --11718 --
NM_022739chr173935 223 137 --1281 1414
NM_022753chr131870 1027 667 21739 62 22609 2280 --
NM_022763chr372836 967 841 362 294 54 40 --12528 13020
NM_022771chr123767 320 241 1388 1214 --
NM_022780chr231398 214 200 155 1339 170
NM_022781chr933231 3041 280 1910 2953 258 13132
NM_022828chr551595 1260 683 574 549 ----21529 287
NM_022832chr462490 2454 2129 1707 472 383 --21578 309 --
NM_022836chr161844 1837 1830 1720 1156 429 11747 ----
NM_022893chr222897 2216 --1493 12672
NM_022898chr1484849 1728 1517 1440 1360 1121 857 525 24785 4676 23460 1704 13087
NM_023016chr262596 2474 2450 667 327 104 --12534 12743
NM_023112chr1442537 2144 537 49 --32983 2723 64 1329
NM_024086chr1753876 3729 3206 2981 795 --23258 591 --
NM_024090chr461725 1464 1436 1352 760 243 11946 1368 --
NM_024345chr9105959 5706 5538 4814 4787 4692 2323 1314 384 219 25981 3946 34293 2286 294 13933
NM_024408chr173720 3712 3000 1490 1065 713 548 33183 1086 1040 53631 3126 3059 452 314 --
NM_024491chr34525 227 139 47 --1446 --
NM_024539chrX31191 249 239 ----11274
NM_024573chr66866 856 694 391 226 167 ------
NM_024590chr431869 1692 1290 ----1720
NM_024607chr863488 1300 1196 928 848 662 1697 33754 2820 520 --
NM_024638chr342432 2368 1583 798 --12382 22269 2012
NM_024665chr3114405 3922 3769 3063 1780 1586 1079 640 617 588 386 --34639 4185 3637 --
NM_024670chr1051276 592 441 133 57 ------
NM_024674chr163066 2388 2078 770 727 588 --1409 11969
NM_024704chr203812 742 703 1226 21035 714 --
NM_024721chr862184 1924 1863 1804 833 767 --1437 11794
NM_024761chr9195118 4897 4697 4481 4049 3892 3843 3566 3449 3364 3333 2033 1577 1229 1057 806 782 690 618 21979 1205 1148 1948
NM_024834chr1071524 565 524 447 298 160 65 --1118 --
NM_024913chr73644 453 92 1221 2679 523 1424
NM_024920chr42456 450 ----1600
NM_024947chr3199618 9490 9260 9060 8662 7917 7768 6723 6647 6589 2976 2359 1976 1113 993 719 648 486 388 58822 8578 8485 7188 590 57990 3294 1288 357 146 17062
NM_025054chr8103833 3687 3471 2736 1534 1270 1187 1087 584 529 --13596 11177
NM_025126chr121486 --1554 154
NM_025134chr1652592 2441 2198 1960 618 --22166 1921 2994 111
NM_025138chr1321290 1220 ----11062
NM_025191chr1123309 3104 2477 2358 1315 1113 982 882 871 455 286 127 --23267 1157 23560 3212
NM_025208chr1142138 1523 875 266 --12311 12284
NM_025222chr333030 531 519 --12944 --
NM_025235chr1031730 1618 554 1226 21473 147 22239 720
NM_030621chr1463634 1662 848 616 282 162 12929 1730 --
NM_030623chr261468 1381 1132 588 410 28 142 184 --
NM_030625chr1062661 2534 2413 2090 807 199 1107 2913 503 --
NM_030627chr553464 2657 883 281 59 --11491 --
NM_030647chr7146017 5650 5049 4817 4501 2003 1704 1127 997 882 822 815 535 24 11749 ----
NM_030755chr1482849 1216 1114 958 851 726 686 142 1998 2916 307 1497
NM_030816chr163398 3194 2458 2367 1020 451 11191 2829 462 1628
NM_030885chr381829 1431 751 745 345 338 222 108 ------
NM_030918chr165449 5380 5254 3821 933 775 1880 21682 37 14538
NM_030934chr121305 552 ----1226
NM_030953chr521357 585 11037 1596 1104
NM_031284chr151592 ----3970 155 125
NM_031412chr124793 404 273 154 ----11142
NM_031453chr1062051 2013 1983 1788 882 640 2948 347 --1686
NM_031483chr2073046 1254 1248 1221 1187 546 272 32911 2775 260 1342 --
NM_032047chr31828 1196 --21680 372
NM_032102chr1142961 2699 418 202 1175 ----
NM_032144chr251661 1432 263 123 112 --183 --
NM_032208chr242995 2796 2767 2638 12775 --1113
NM_032217chr44968 498 180 165 191 --11322
NM_032221chr2041798 1529 565 228 1246 ----
NM_032236chr141060 1033 851 727 2943 708 1415 --
NM_032246chr1531290 1099 1021 ----1297
NM_032250chr9------1292
NM_032303chr921488 464 31775 1261 607 11359 --
NM_032325chr1151974 1863 774 707 437 --2795 67 --
NM_032373chr10114312 3835 2372 2297 2206 1491 1453 737 531 192 155 23800 839 24601 1044 1607
NM_032410chr831165 1141 355 ----170
NM_032413chr153381 127 108 --156 --
NM_032439chr1061589 1042 651 616 361 178 --11182 --
NM_032445chr153248 121 43 1814 --12325
NM_032446chr5103136 3031 2883 2529 2433 1207 1152 974 925 783 --1542 11382
NM_032457chr473229 3131 2737 1461 1247 715 704 ----1600
NM_032458chrX53279 2705 1054 310 252 12716 13331 --
NM_032505chr372749 1848 1759 706 595 464 40 1246 --1174
NM_032521chr2072698 2554 2440 1166 976 308 53 --32455 841 278 --
NM_032569chr1651923 1608 1285 111 86 11588 ----
NM_032682chr333514 2653 750 2972 779 33454 3277 826 22764 1083
NM_032810chr1031531 555 418 --1432 --
NM_032826chr7135194 5155 5104 4528 4362 4169 4142 3724 3692 3556 1363 624 268 55177 4017 1785 1764 1436 13527 24539 4324
NM_032846chr1451368 1093 1081 1060 189 11302 --1352
NM_032859chr13153926 3920 3769 3569 3519 3414 3261 2776 2760 1572 1225 788 487 464 196 13806 --1145
NM_032876chr1442035 1799 1632 850 --21744 1668 1160
NM_032961chr421035 315 21283 436 1529 --
NM_033030chr221146 630 41269 283 146 23 11135 --
NM_033055chr121125 321 ----175
NM_033132chr1351983 1664 597 443 164 --12098 --
NM_033211chr511403 1197 12087 1541
NM_033224chr777679 7476 6481 5411 5015 1610 1559 12983 13220 15851
NM_033285chr894227 4192 3333 3006 2796 1188 799 459 195 --1312 --
NM_033389chr1774707 3858 3662 3621 3205 3153 1156 ------
NM_033515chr631043 501 332 --11234 1562
NM_052879chr1253468 2956 2497 1036 409 1124 23137 2708 --
NM_052885chr12134799 4748 4582 4500 4404 4308 4302 3977 3012 1729 1628 717 126 24442 1829 ----
NM_052886chr8------42010 1809 389 99
NM_052898chr821656 1548 --11376 1656
NM_052905chr241656 753 615 107 --21590 1165 21537 574
NM_052927chr541980 1465 711 700 11581 1726 --
NM_052937chr862118 2029 1048 1017 728 393 --1498 --
NM_052966chr151563 1346 1210 1004 684 1745 --13925
NM_053023chr1132007 1271 575 --11281 22658 2203
NM_053025chr341581 1105 534 474 21439 501 11249 11274
NM_053053chr13852 735 139 --1389 178
NM_053056chr1183086 2000 1217 993 863 504 435 120 22193 1006 1615 --
NM_057175chr452653 2575 2557 2096 257 32169 1752 902 11041 --
NM_058172chr431836 1403 43 3736 591 90 1172 11568
NM_080546chr93774 599 314 11417 --22061 37
NM_080743chr661992 1627 774 758 738 540 --1554 12535
NM_130387chr31303 --1177 1788
NM_130768chr72293 259 --197 1111
NM_133264chr1763958 1235 857 653 71 21 --12550 23701 3193
NM_133265chrX63593 3285 3203 2678 673 329 1620 12337 12364
NM_133334chr4136281 6223 5659 5190 4501 4358 4196 2168 2024 1705 465 225 203 35344 1978 1046 24410 65 22010 233
NM_133433chr54902 888 792 153 --172 --
NM_133496chr1134476 3996 3935 3375 3348 2793 1415 1332 1184 1108 1012 524 441 14161 23231 1730 --
NM_133646chr2115288 5023 4478 4275 3676 3617 3481 3445 1307 375 128 --1293 25544 5493
NM_138286chr19164118 4048 3906 3873 3859 3823 3745 3157 2705 1674 1509 1437 838 762 491 386 24083 3338 23069 1617 --
NM_138335chr41796 ----1145
NM_138426chr762245 1816 1594 792 678 633 1243 1659 2907 653
NM_138694chr6113129 3097 2877 2817 1038 1022 981 779 652 444 339 23538 2951 23725 3690 --
NM_138731chr14103810 3787 3566 3315 2732 1715 1294 1271 900 609 33393 1324 987 14091 23831 131
NM_138959chr1116803 6634 6568 5964 5942 4262 4214 2380 2206 2110 243 12028 36315 4319 1680 --
NM_138966chr186552 456 236 187 146 138 1103 ----
NM_139283chr1252127 2107 2013 1720 241 11662 185 --
NM_139321chr2074094 3065 2990 1219 959 858 383 13446 1867 13893
NM_144571chr4126236 6226 5809 5051 4911 4538 4283 4246 2196 1191 269 147 36369 5385 835 26634 5653 --
NM_144632chr24785 668 467 359 11617 12107 12097
NM_144710chr281372 1294 1276 1253 1209 1180 531 521 --11228 1449
NM_144775chr1743544 3491 1371 218 13623 14896 --
NM_144778chr1362732 2602 2415 1918 981 371 11103 12629 32560 435 210
NM_144963chr841774 1715 241 141 12142 12310 --
NM_144973chr1275325 5084 4690 4066 1404 1362 758 --21118 287 --
NM_145000chr56528 418 173 166 151 96 ----1453
NM_145206chr1043325 1167 166 79 13114 11021 1885
NM_145251chr1461355 1254 1246 1023 455 155 --1535 --
NM_145307chr10174483 4441 4266 4205 3827 3630 3522 3471 1851 987 960 718 469 375 266 144 24 24550 1685 14043 13537
NM_145808chr742078 2053 763 302 22493 726 1948 --
NM_145912chr2254532 3177 1194 1161 127 34406 171 116 14141 14382
NM_152375chr161722 949 943 824 250 79 --12535 12011
NM_152400chr491861 1755 1534 1461 1435 1417 821 656 30 ----1376
NM_152422chr95753 423 309 269 189 --21413 292 --
NM_152423chrX31492 592 413 11238 1600 --
NM_152470chr1841485 1443 122 31 ----14128
NM_152556chr732572 2554 2386 12175 --12212
NM_152588chr1241326 1313 622 270 11275 --11771
NM_152594chr1542331 2182 1582 233 1658 21446 731 1611
NM_152608chr151700 964 583 239 81 --12364 --
NM_152622chr542984 2830 2415 949 11193 13293 --
NM_152624chr5107049 7032 6965 5622 5613 4645 4623 1591 448 128 56357 5945 1754 1041 835 --24884 2559
NM_152636chr1142049 2041 603 36 --11992 1860
NM_152638chr1211047 --11069 1418
NM_152641chr1242332 2324 754 408 --1674 149
NM_152734chr654997 4389 1954 1422 553 21967 673 45069 4638 3842 3682 --
NM_152756chr563775 3668 3626 3106 1380 42 23138 1580 --33444 2909 944
NM_152758chr862977 2921 2778 2146 1104 820 12769 2670 594 --
NM_152774chr722083 289 ----1200
NM_152787chrX53937 3648 3573 2758 842 1902 --11384
NM_152996chr121910 701 1177 1851 21787 1340
NM_153020chr641623 1460 1318 422 ----11708
NM_153184chr342010 773 170 79 1730 1205 --
NM_153207chr1274122 3979 2996 2915 1626 1389 224 13274 1166 --
NM_153371chr1352038 1943 853 765 570 --1181 1791
NM_153619chr1553352 1257 1053 467 47 11462 12719 12739
NM_153689chr292243 2197 2181 1975 1798 1574 509 413 372 --31623 845 131 11567
NM_172070chr251455 688 598 429 355 1742 11538 --
NM_172071chr1136310 5978 5354 5115 4987 2677 2595 2138 1929 1308 1221 973 751 12907 26430 2059 --
NM_172127chr452019 834 712 685 70 --1202 1314
NM_172193chr144445 298 224 58 1877 21156 979 --
NM_172373chr1331348 1185 46 1386 1236 --
NM_173156chr152016 1899 1358 881 818 1135 --11918
NM_173359chr341693 1476 1337 618 --2737 503 --
NM_173470chrX42610 1986 950 600 11962 31828 1177 282 --
NM_173496chr1072931 2533 2058 1934 657 535 524 12964 ----
NM_173536chr4125107 4648 3737 3574 3464 3378 2059 1851 1804 1781 1123 527 --15213 13172
NM_173602chr1292869 2418 801 662 537 401 200 115 32 --23534 638 --
NM_173631chr1911208 11138 31159 1101 875 11111
NM_173648chr23725 79 36 --1263 1257
NM_173808chr1123973 3893 3310 3213 2974 2968 1472 913 534 426 392 302 11299 --11228
NM_173822chr231857 1589 775 1309 --151
NM_174890chr104831 758 599 556 1629 1589 --
NM_174921chr43737 284 190 11169 --1276
NM_175061chr762197 1584 1537 1357 182 84 --1265 --
NM_175854chr1372103 1743 772 766 745 376 93 12574 ----
NM_175866chr141189 167 110 43 156 1550 --
NM_175907chr18102792 2168 1853 1046 1040 962 803 530 298 235 1265 ----
NM_175921chr5104310 4203 3979 3956 3428 3214 3025 1632 1406 483 23510 1064 23889 1070 1920
NM_176814chr741307 428 130 118 1199 ----
NM_177424chr131299 460 296 1289 ----
NM_177966chr341779 1623 1273 634 ----1723
NM_178011chr1092948 2806 2782 2762 2724 2319 1174 810 376 ----21129 401
NM_178123chr22860 114 192 1131 --
NM_178313chr261994 1610 583 542 503 332 --1448 1489
NM_178496chr31183 ----11517
NM_181354chr831534 449 259 11247 1552 --
NM_181358chr153521 3334 3123 2961 553 13503 22829 1070 --
NM_181457chr231056 119 62 1363 21173 922 1199
NM_181489chr366557 5855 5129 5025 4745 1736 36249 5149 4324 ----
NM_181670chr1251444 1410 1270 557 149 1478 11149 --
NM_181705chr5115610 5495 5479 4678 4111 1237 900 575 382 275 83 45790 5124 939 860 1764 1219
NM_181706chr1162377 1977 1968 1915 1648 480 --22231 346 --
NM_181784chr252555 2457 2228 854 700 1149 ----
NM_181836chr592547 2344 2120 2036 935 881 782 227 93 --22378 143 --
NM_182485chr473252 2901 2792 2711 2467 573 96 --23497 2567 --
NM_182493chr16165368 5190 5170 5080 4765 4318 4277 3935 3824 3266 2133 2006 1635 452 433 76 ------
NM_182644chr35806 528 200 161 81 1298 --1307
NM_182691chr791341 1302 1167 1040 460 276 149 75 23 11046 ----
NM_182765chr1062097 938 803 720 268 40 1296 ----
NM_182767chr1272018 1863 1708 1567 1390 185 161 11791 21691 443 --
NM_182970chr2034191 3763 2734 23563 3404 11251 11435
NM_182976chr12823 155 1111 137 1722
NM_183387chr143860 768 714 1220 1655 --
NM_194247chr2114323 3885 3569 3502 3495 1732 1180 963 842 580 415 13367 1262 11761
NM_194282chr463090 2369 462 451 385 172 ------
NM_194298chr1041883 1731 1358 439 11645 ----
NM_197941chr532971 2932 2551 32775 587 36 --1808
NM_198279chrX51243 996 820 465 318 --1985 --
NM_198490chr353249 2827 2810 992 811 13369 23495 2393 1244
NM_198859chr3105152 4906 4680 3740 3370 3281 1867 1714 1479 630 34949 1756 695 24570 4260 1205
NM_198990chr7112403 2346 1243 1236 1053 972 934 484 442 351 60 ----22709 156
NM_199051chr1------1232
NM_201439chr12------1130
NM_201613chr12------1710
NM_203301chr1441730 695 426 136 1439 --11168
NM_203394chr1252407 2081 1960 541 347 --12466 --
NM_203459chr152321 1708 998 386 30 32302 2217 1875 2644 177 --
NM_206853chr664159 3327 2708 2533 1064 660 --11444 13003
NM_206854chr685420 4588 3969 3794 3380 1921 973 915 --1464 34264 3704 365
NM_206963chr32361 61 --1563 193
NM_207015chr362157 2045 1828 1762 175 166 32379 1947 617 1200 --
NM_207303chr1084148 4016 4009 3516 3372 615 349 26 --21443 665 12585
NM_207445chr1561700 1691 537 264 210 53 12069 --11508
NM_207517chr1521536 739 --11921 1188
NM_207577chr1152838 2811 2024 1827 880 12426 22540 1098 1714
NM_213606chr1072331 2192 2140 1099 1029 927 774 1960 12446 --