TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-614
miRNA Sequence: GAACGCCUGUUCUUGCCAGGUGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000138chr1512029 ------
NM_000165chr61539 ----178
NM_000212chr1732310 2263 1535 --1329 --
NM_000421chr171226 --1238 --
NM_000495chrX------1435
NM_000555chrX15055 ----26868 6432
NM_000806chr5----1405 --
NM_000813chr515245 ------
NM_001001549chr72642 457 ----12496
NM_001003712chr12----12849 --
NM_001004065chr92511 467 --23340 977 13295
NM_001005476chr21245 ----1205
NM_001005910chr3----1145 --
NM_001006600chr511997 ------
NM_001007097chr91143 --11967 --
NM_001008660chr11------11007
NM_001009959chr2------1580
NM_001010861chr1----1243 --
NM_001010891chr525822 2777 --16589 --
NM_001012329chr122186 1601 --1471 --
NM_001017973chr51286 --1278 --
NM_001033059chr612016 --1389 --
NM_001033081chr1--11774 ----
NM_001037132chr7------11583
NM_001037172chr3----11247 --
NM_001037582chr421209 482 --11719 --
NM_001038707chr1----11707 --
NM_001039350chr741578 1498 1204 113 ------
NM_001039590chrX23853 240 ------
NM_001040441chr145408 5012 4441 1771 --24528 395 --
NM_001040708chr811096 ------
NM_001040715chr161112 --199 --
NM_001042599chr217002 --16601 --
NM_001087chr2132 --1303 --
NM_001106chr333905 2211 583 --1250 --
NM_001206chr9----12692 --
NM_001222chr1011283 --1205 --
NM_001356chrX32530 2006 436 ------
NM_001554chr1----1511 --
NM_001681chr12138 --1493 --
NM_001800chr19----1137 --
NM_001918chr148287 7978 3289 1486 --1923 --
NM_002074chr111414 --11095 --
NM_002214chr7------15711
NM_002247chr10161 --11699 --
NM_002270chr5----1169 --
NM_002356chr621791 796 ------
NM_002399chr15------11430
NM_002515chr14----1244 --
NM_002519chr1111276 ----132
NM_002547chrX34040 3466 3225 --22922 183 --
NM_002618chr2----1119 --
NM_002657chr2033501 3119 2974 1731 13371 --
NM_002892chr141538 ----1319
NM_002897chr21484 --124 --
NM_002912chr6----1243 --
NM_002948chr31412 ----170
NM_003017chr61163 --21395 1275 --
NM_003178chr3----12138 --
NM_003234chr31919 12216 1768 --
NM_003418chr3------1209
NM_003452chr9------1637
NM_003471chr31142 --1871 168
NM_003644chr1785799 5779 5724 5187 4850 4736 4378 425 --16571 --
NM_003701chr13183 --1915 --
NM_003850chr13------132
NM_003876chr17----1103 --
NM_003877chr12----1166 --
NM_003934chr9----1889 --
NM_003972chr10----21262 283 --
NM_004050chr142279 28 ------
NM_004093chr131465 12797 ----
NM_004229chrX----12205 --
NM_004472chr5174 ------
NM_004499chr5----1179 --
NM_004506chr6------1180
NM_004593chr3------1697
NM_004715chr182597 227 --1163 1214
NM_004744chr412460 --11573 12894
NM_004772chr521139 157 --1639 --
NM_004852chr18313202 3281 1596 --1173 --
NM_004856chr15----1540 --
NM_004947chr311865 ----11876
NM_005207chr2222810 1287 --13288 --
NM_005277chr431898 1262 43 ------
NM_005284chr61426 ------
NM_005324chr1731416 603 23 ------
NM_005407chr1411186 --11598 --
NM_005439chr12----1549 --
NM_005442chr3157 ------
NM_005607chr81244 ----11056
NM_005665chr11773 ----13484
NM_005796chr16----1147 --
NM_005828chr1734788 1389 349 --23632 297 --
NM_005859chr511391 ------
NM_005911chr211239 11288 1199 --
NM_006089chrX2517 40 --11871 --
NM_006141chr1612661 ------
NM_006166chr12------1153
NM_006245chr6----1189 --
NM_006352chr1----1210 --
NM_006540chr8----11382 --
NM_006549chr1212874 --12959 --
NM_006624chr10----12018 --
NM_006807chr17------1901
NM_006813chr6----1269 --
NM_006888chr141653 22489 902 22733 2481 --
NM_007030chr575097 5091 4354 3507 817 461 312 ----15231
NM_007034chr1--1918 11035 --
NM_007192chr14----1221 --
NM_012081chr52871 538 --1646 13614
NM_012158chr13----1421 --
NM_012479chr722520 981 --11046 12295
NM_013233chr2----11359 --
NM_013363chr3------1408
NM_014048chr161589 --14918 --
NM_014141chr714109 --1313 --
NM_014188chr1----186 --
NM_014292chr2231450 1362 126 --11833 --
NM_014342chr11----1129 --
NM_014452chr61246 --11228 --
NM_014607chr211813 --1152 --
NM_014717chr19----1706 --
NM_014720chr10----1120 --
NM_014729chr81351 ------
NM_014732chr1623900 728 --25821 4182 --
NM_014820chr31120 --1154 --
NM_014827chr1----1325 --
NM_014841chr6----11205 --
NM_014912chr1021112 364 --12822 --
NM_014920chr6168 --13780 --
NM_014934chr1322852 531 --2414 212 --
NM_014962chr20----12711 --
NM_014969chr1--1163 2434 152 --
NM_014988chr421002 947 --11773 --
NM_015025chr211747 --12725 --
NM_015042chr1533403 1441 101 ------
NM_015057chr13----1237 --
NM_015079chr15----12672 --
NM_015091chr14------1731
NM_015170chr8----12369 --
NM_015192chr2011934 ----12022
NM_015252chr2----1287 --
NM_015347chr121685 --1710 --
NM_015469chr9------1106
NM_015557chr153185 3005 1128 909 733 --21398 690 --
NM_015630chr211092 --1914 --
NM_015878chr811388 --1858 --
NM_015886chr8------14204
NM_016441chr222189 324 --11938 --
NM_016512chr8----2242 101 --
NM_016937chrX----1624 --
NM_017519chr611085 ------
NM_017602chrX1726 --1908 --
NM_017633chr6----13760 --
NM_017749chr11----1837 --
NM_017919chr941453 1155 1136 170 15720 25653 4100 --
NM_018027chr1023025 934 --11156 --
NM_018084chr2----1312 --
NM_018126chr4------185
NM_018181chr1821576 607 ----11415
NM_018330chr1011241 --11372 --
NM_018351chr12----1168 --
NM_018475chr4----1477 --
NM_018638chr12----15301 --
NM_019063chr22544 189 --11425 --
NM_019071chr7--1713 --1791
NM_019593chr20132 --1889 21224 767
NM_019605chr1------1658
NM_019849chr19----160 --
NM_020403chr1311711 --1681 --
NM_020651chr2----1653 --
NM_020742chrX42131 694 329 188 --1580 --
NM_020791chr17----11064 --
NM_020825chr1663527 3259 2841 2832 980 827 --23760 1295 --
NM_020981chr2176 --160 --
NM_021229chr12----1416 1470
NM_021638chr454394 4353 3692 3450 3054 --24559 256 --
NM_021728chr14----1364 --
NM_021813chr611798 --35516 4265 48 --
NM_021958chr1----1257 --
NM_021964chr311799 --12306 --
NM_022048chr1541652 662 505 294 ------
NM_022058chr2----172 --
NM_022130chr5----11348 --
NM_022373chr7----1115 1247
NM_022465chr12----12575 --
NM_022728chr71289 --1104 --
NM_022771chr12----1891 --
NM_022781chr933089 2760 34 --12526 --
NM_024090chr4----11194 --
NM_024293chr2----1831 --
NM_024308chr17----170 --
NM_024524chr342180 732 579 314 12931 12076 --
NM_024665chr3----11250 --
NM_024692chr2----11832 --
NM_024700chr1----1413 1393
NM_024953chr1211095 ----1151
NM_025146chr31804 --1924 --
NM_025179chr131717 1039 203 --24804 1095 --
NM_025191chr1----12165 --
NM_030623chr2----11260 --
NM_030627chr523514 2776 --1157 11402
NM_030650chr234147 4010 2879 --1486 --
NM_030762chr12----1518 1163
NM_030784chr6----1336 --
NM_031244chr6------11111
NM_031445chr253017 1063 809 620 402 13179 ----
NM_031469chr643194 2609 472 269 --1136 --
NM_032268chr1631190 1135 348 --1978 --
NM_032682chr311009 --1722 --
NM_032812chr10------144
NM_032867chr11----1255 1556
NM_033055chr1----1332 --
NM_033274chr512388 --1216 --
NM_033449chr511537 --1605 --
NM_057161chr6----1132 --
NM_057175chr42648 329 12477 21962 599 --
NM_133468chr7----1277 --
NM_133496chr133178 950 817 ----11149
NM_138396chr121633 --190 --
NM_138426chr71745 --2839 412 --
NM_138459chr6----11267 12529
NM_138473chr1225102 118 --13430 --
NM_144571chr426039 2462 --36570 6319 1845 --
NM_144635chr3--11050 11243 --
NM_145290chr4----1317 --
NM_145753chr3----11605 --
NM_147223chr2----135 --
NM_152380chr111604 --11503 --
NM_152624chr522005 1266 11200 189 --
NM_153262chr11429 --12857 --
NM_153619chr153977 630 58 ------
NM_171998chrX1567 --1485 12321
NM_173078chrX----1110 --
NM_173468chr425305 3744 12273 16040 --
NM_173552chr3----1505 --
NM_173582chr11----15844 --
NM_173667chr5123 --1497 --
NM_173683chr8----11686 --
NM_175854chr13----12383 --
NM_175866chr111276 --1260 --
NM_175907chr18----1981 1126
NM_178313chr2----11964 --
NM_178812chr8------11542
NM_181670chr121217 ----11001
NM_181705chr533999 3954 1980 15696 15171 --
NM_182485chr413635 13510 --1615
NM_182767chr1222140 2077 --1107 --
NM_182894chr14----11719 --
NM_182975chr1------1139
NM_194247chr2----1455 --
NM_203459chr1--1573 1666 --
NM_207406chr4----16483 --