TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-616-3p
miRNA Sequence: AGUCAUUGGAGGGUUUGAGCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1153492 3139 2832 1415 595 12685 12617 12178
NM_000084chrX126874 6802 6216 6106 5990 4982 2794 2072 2027 1696 934 811 22482 2269 1867 --
NM_000092chr2104602 4421 3678 3005 2871 1654 1372 858 476 435 11054 --13274
NM_000096chr32697 96 2254 199 2768 46 --
NM_000112chr5105316 4887 4261 4123 3847 3733 3671 3610 3448 2157 2946 144 --2952 879
NM_000167chrX71660 1544 1481 1446 1328 640 48 31832 1629 1260 --184
NM_000176chr573782 3428 3242 2831 2570 1146 205 --33692 960 862 12425
NM_000248chr383036 2914 2675 2632 2565 2068 1945 720 32908 2739 999 ----
NM_000332chr6126802 6200 5962 5305 5213 5172 4982 2225 1879 1361 943 198 ------
NM_000337chr5135390 4416 4359 4076 2538 1896 1539 1492 855 816 802 782 592 66353 5144 4717 2296 1776 298 25796 914 26527 2194
NM_000408chr24719 425 91 69 33340 2561 494 12871 --
NM_000448chr11113159 3099 2894 2593 2566 2559 1258 1040 715 554 347 ------
NM_000555chrX97675 6881 6085 5959 1934 1603 692 563 283 21454 424 57346 6615 6511 5481 2160 --
NM_000584chr471111 1001 780 395 157 48 36 ------
NM_000611chr1187067 6244 6221 5206 2090 1897 1272 678 31182 1147 1064 36359 5776 2206 1289
NM_000618chr12106491 6374 6242 4462 2186 2147 1697 1501 771 137 2996 30 11818 14740
NM_000618chr12106491 6374 6242 4462 2186 2147 1697 1501 771 137 2996 30 11818 14740
NM_000813chr574987 4805 4424 1734 1269 176 102 24403 3800 ----
NM_000814chr1564005 2965 2813 1576 1547 604 1720 23908 2850 2832 816
NM_000860chr461460 1385 1161 1107 249 236 1593 11445 1434
NM_000875chr15146998 6828 6630 6208 6178 5911 5185 5138 4652 4511 4455 1839 1095 817 22235 256 14812 16225
NM_000912chr853333 2310 1353 979 398 32558 1302 856 23245 54 1427
NM_000926chr11109188 7448 6851 6792 3601 3583 3255 3129 2709 730 43461 2636 2083 1288 ----
NM_000944chr472181 1487 956 886 713 466 351 1443 1522 --
NM_000950chrX43454 3393 2287 1394 22933 821 12837 1427
NM_001001419chr595023 4583 4371 3792 1879 1860 1639 904 371 64338 4265 3321 758 589 574 ----
NM_001001420chr595023 4583 4371 3792 1879 1860 1639 904 371 64338 4265 3321 758 589 574 ----
NM_001001481chr883244 2768 2519 2104 581 360 112 99 32269 1354 804 2406 322 --
NM_001001484chr1041564 747 605 435 2937 105 1256 1541
NM_001001664chr263696 3664 2820 812 794 580 34061 3120 603 1226 12512
NM_001002926chr792800 2784 2414 2331 2319 895 787 732 71 32397 902 155 --11011
NM_001003652chr1888433 8108 6032 5798 3393 2968 2949 242 ----18129
NM_001003674chr18126940 5661 5502 5276 5032 4461 2768 2495 1780 1614 1495 1290 66601 6233 5099 4281 367 183 --12185
NM_001003675chr18126940 5661 5502 5276 5032 4461 2768 2495 1780 1614 1495 1290 66601 6233 5099 4281 367 183 --12185
NM_001003698chr651816 493 473 307 279 --11951 --
NM_001003699chr651816 493 473 307 279 --11951 --
NM_001004065chr983765 2711 1352 1029 508 357 347 266 13454 1149 13512
NM_001004419chr1293841 3638 3617 3378 1381 1122 1094 782 689 23100 285 ----
NM_001005217chr431135 879 81 2263 122 --192
NM_001005473chr596636 6245 6152 5256 2381 1732 856 597 156 24865 4347 --44341 4243 2494 1454
NM_001008925chr433527 2623 1019 22226 505 42165 442 182 67 --
NM_001009554chr474512 4317 3404 3334 3004 246 156 34167 1307 1015 11390 --
NM_001009554chr474512 4317 3404 3334 3004 246 156 34167 1307 1015 11390 --
NM_001009899chr385640 4573 4225 4073 2335 1099 835 30 ----22031 1722
NM_001009909chr1193921 3808 3688 3199 2874 2435 1473 1096 635 33125 1331 1311 --1930
NM_001010888chrX64631 3081 1041 905 237 197 34447 4163 3670 ----
NM_001010891chr545817 4238 2244 1070 26697 2427 --15893
NM_001012393chr1185060 4906 4879 4297 3873 3260 1475 1207 1468 11729 11695
NM_001013620chr12138154 7614 7247 7026 6630 6171 6085 6028 2506 2005 1853 774 636 31722 568 413 12880 --
NM_001013659chr1975091 4459 4046 1674 1163 916 382 14663 --1463
NM_001014380chr1331305 1142 473 65490 5091 4816 2017 1281 450 14835 11894
NM_001014797chr10168168 8135 7591 6574 6198 2952 2655 2598 2128 1999 1858 1726 1346 593 531 323 27484 6026 36458 5434 600 --
NM_001017440chr777816 7238 7232 5668 2982 1670 1024 26545 5085 47669 3295 3048 2524 16971
NM_001018065chr9135960 5954 5388 4883 4563 3924 2201 1913 1450 1306 820 458 195 14352 ----
NM_001018066chr9135960 5954 5388 4883 4563 3924 2201 1913 1450 1306 820 458 195 14352 ----
NM_001018067chr195361 4765 4604 4486 4189 3392 1643 1390 1330 13359 ----
NM_001018068chr195361 4765 4604 4486 4189 3392 1643 1390 1330 13359 ----
NM_001018069chr195361 4765 4604 4486 4189 3392 1643 1390 1330 13359 ----
NM_001018074chr573782 3428 3242 2831 2570 1146 205 --33692 960 862 12425
NM_001018075chr573782 3428 3242 2831 2570 1146 205 --33692 960 862 12425
NM_001018076chr573782 3428 3242 2831 2570 1146 205 --33692 960 862 12425
NM_001018077chr573782 3428 3242 2831 2570 1146 205 --33692 960 862 12425
NM_001024094chr573782 3428 3242 2831 2570 1146 205 --33692 960 862 12425
NM_001024647chr12117531 6634 6324 5845 5491 2948 1876 1733 1408 443 49 47613 7251 6301 2573 --12579
NM_001024948chr123113 2539 32900 2661 1187 1356 12478
NM_001025079chr384106 3792 3419 3239 3041 2759 511 297 1802 13377 --
NM_001025108chr274209 3651 3587 3511 1572 562 462 1740 23630 135 --
NM_001025356chr1272771 2411 2375 1841 997 858 69 1760 --1674
NM_001029863chr673037 2965 2800 2683 2384 416 270 31151 918 554 ----
NM_001030055chr1463863 3135 1209 1146 724 337 ----14174
NM_001031679chr1283337 3075 3017 2713 2435 1075 868 472 13509 22532 686 --
NM_001031812chr582307 2276 1686 933 274 260 243 79 ------
NM_001033047chr472637 2094 1810 848 181 174 21 ----12532
NM_001033087chr2073125 2471 2009 1074 590 533 442 12353 12017 12097
NM_001039547chr3178047 7598 7025 6885 6563 6534 6454 6227 6107 5702 5039 2275 1913 1286 1146 689 332 27570 6270 189 --
NM_001039618chr11105281 4925 4588 4489 3644 2133 1885 951 924 627 55728 2353 1179 571 181 15221 12018
NM_001039840chrX165941 5267 5168 4911 4786 4388 4127 4026 3964 3842 1506 1344 1301 1196 731 183 35084 2169 485 ----
NM_001039937chr1363893 3482 2982 2966 1079 765 24052 3504 22645 159 --
NM_001040152chr784906 4260 4198 3915 3884 3305 1379 540 2689 629 34944 1921 1216 --
NM_001040284chr16145787 5098 4816 4606 4570 4199 3871 3654 1788 1411 1025 903 776 705 25838 1490 139 --
NM_001040402chr452785 872 813 695 571 23216 1287 --23200 3050
NM_001040712chr983441 2940 2871 2515 2505 1104 399 208 23058 2569 ----
NM_001042355chr1695048 4838 4726 4337 4187 3659 1720 1200 98 ------
NM_001042412chr1695048 4838 4726 4337 4187 3659 1720 1200 98 ------
NM_001042533chr362921 2635 2538 932 861 409 22454 214 ----
NM_001042543chr451474 1136 578 194 107 21082 128 11208 --
NM_001042599chr296099 6080 5324 4974 2921 2876 1008 784 570 32069 1674 905 --1140
NM_001044385chr263977 3502 1284 933 223 28 43265 3047 801 210 ----
NM_001044722chr582307 2276 1686 933 274 260 243 79 ------
NM_001044723chr582307 2276 1686 933 274 260 243 79 ------
NM_001071775chr132746 82 21900 698 --11932
NM_001099678chr395763 5623 5250 4958 4709 4490 2367 1960 1911 35417 1932 215 1678 --
NM_001100108chr1147897 7606 6269 5675 5634 5605 3190 3023 2875 1873 1478 1373 1077 415 26494 6306 ----
NM_001106chr3179487 9059 8396 8064 6892 6859 6676 6620 6569 6203 6049 6029 3742 3505 3311 3194 1268 47724 3731 2418 1910 13574 18254
NM_001148chr441712 1620 659 244 1511 12228 11755
NM_001156chr10124 --165 1223
NM_001167chrX66009 5789 4703 4442 2194 1035 44926 4689 1331 591 --15565
NM_001173chr1463863 3135 1209 1146 724 337 ----14174
NM_001198chr611501 --1419 1354
NM_001201chr473950 3880 3737 3584 2416 1019 372 ----13664
NM_001204chr2126626 6531 5388 5323 5048 4921 2849 2573 2231 1432 1177 639 17802 ----
NM_001304chr1793803 3343 3170 3042 2823 1337 1330 910 366 23484 286 11368 13099
NM_001364chr11104350 4127 3551 1617 1493 1411 1273 1193 1064 976 23424 510 1871 --
NM_001390chr1853016 2791 2626 1245 206 --22527 689 2451 390
NM_001402chr651828 1612 1549 677 667 21776 114 --11263
NM_001491chr652713 2360 1783 1718 288 22502 1708 --1276
NM_001518chr751048 453 385 198 181 2264 252 --1734
NM_001527chr6104289 3716 3586 1935 1532 1241 1059 567 442 129 34624 3856 398 12954 --
NM_001650chr1853734 3686 2571 1588 1488 33216 1567 1125 --1421
NM_001690chr362142 1986 514 423 366 286 --22371 676 --
NM_001777chr384106 3792 3419 3239 3041 2759 511 297 1802 13377 --
NM_001830chrX103786 2587 2565 704 529 281 272 232 177 81 23344 64 ----
NM_001858chr685144 4311 4042 1802 1616 1225 678 657 --11645 15069
NM_001918chr1139137 8655 8224 6776 6038 2578 2348 1845 1492 1249 663 518 101 48305 8000 6492 2962 23056 263 16785
NM_001969chr1483144 3104 1505 569 328 193 163 96 33076 1553 576 ----
NM_002006chr455765 4148 2136 228 67 25025 1605 1248 14600
NM_002025chrX139031 8415 7802 7720 7512 5938 3624 2843 2724 2136 2065 2003 1693 59228 3157 1036 674 274 42417 2319 2076 1822 --
NM_002092chr495052 4206 3605 3229 1706 1071 831 439 115 33640 794 599 13833 --
NM_002130chr571642 1465 1054 662 312 234 147 ----1646
NM_002214chr754372 3632 1901 706 503 15505 11218 25113 4571
NM_002264chr3134950 4942 4673 4650 4499 3966 3538 1360 1337 1310 1194 634 492 14269 ----
NM_002285chr274209 3651 3587 3511 1572 562 462 1740 23630 135 --
NM_002310chr595138 4263 2581 2298 2161 2042 1766 911 188 31600 1593 552 1894 1843
NM_002336chr1294923 4416 3443 3392 1622 1466 907 492 296 ------
NM_002515chr1481940 1869 1567 1404 625 501 456 297 21886 1525 1393 --
NM_002545chr1185060 4906 4879 4297 3873 3260 1475 1207 1468 11729 11695
NM_002613chr1665309 5288 4922 4787 3728 1618 --11558 15048
NM_002655chr875330 5143 4859 3867 3504 1313 56 34900 4324 1364 14025 --
NM_002731chr163184 1180 1003 882 698 692 32068 890 751 1425 12642
NM_002837chr1294383 4100 3929 3040 1245 1125 1029 808 718 34162 3455 1696 14078 --
NM_002839chr983441 2940 2871 2515 2505 1104 399 208 23058 2569 ----
NM_002886chr364259 3976 3144 1523 1242 969 11631 --11619
NM_002955chr651816 493 473 307 279 --11951 --
NM_002959chr143914 2769 887 601 13570 44288 3375 1440 1005 12937
NM_003016chr1781812 1733 695 514 238 231 199 96 ------
NM_003034chr12138153 8075 6745 6298 5956 2905 2543 2324 2237 2021 1975 1780 129 --26412 5529 --
NM_003108chr296129 6027 5785 5511 4867 4613 4580 984 91 ------
NM_003155chr842637 2335 629 510 22729 2601 --1183
NM_003199chr18125642 5470 4783 4534 3633 1873 1631 1368 1198 1156 674 424 31906 574 560 ----
NM_003234chr352299 1704 539 320 291 12406 --21496 898
NM_003262chr363893 1634 1286 1267 1255 1103 1298 24345 4072 15178
NM_003342chr1773280 2710 2330 650 628 600 222 ------
NM_003392chr374155 4046 1487 1007 797 569 62 21227 558 ----
NM_003458chr323336 1366 --13920 23284 1386
NM_003463chr693320 3307 3050 2919 2767 2160 1025 586 95 33217 3025 1268 ----
NM_003583chr1253318 2547 2413 1365 236 33864 1290 511 11403 --
NM_003590chr263989 2590 1060 1043 823 674 53852 3769 3746 3309 426 ----
NM_003615chr33546 171 144 42817 2748 1258 576 22700 801 13843
NM_003617chr163595 1325 949 741 321 104 1987 24224 725 --
NM_003659chr221233 1171 ----21011 972
NM_003663chr362248 1336 1138 633 509 193 ----33499 1330 692
NM_003671chr983501 3277 3177 2653 1228 190 162 132 1224 11002 1997
NM_003759chr474081 3893 3632 3534 3362 2966 778 24132 2716 1103 --
NM_003800chr632333 1821 297 22069 517 21906 1706 1444
NM_003930chr752046 928 734 688 587 32200 603 78 --12084
NM_004028chr1853734 3686 2571 1588 1488 33216 1567 1125 --1421
NM_004034chr10124 --165 1223
NM_004117chr661830 769 467 227 51 31 21673 129 --1723
NM_004171chr1199407 8918 8104 6464 3265 3242 2445 1405 677 21845 164 13682 11270
NM_004253chr9------2266 260
NM_004274chr1482834 2803 2698 1273 1205 717 465 402 1890 12601 --
NM_004338chr18126940 5661 5502 5276 5032 4461 2768 2495 1780 1614 1495 1290 66601 6233 5099 4281 367 183 --12185
NM_004384chr582307 2276 1686 933 274 260 243 79 ------
NM_004586chrX154766 4154 4085 4062 4005 3678 3398 2014 1706 1274 1258 616 265 253 172 24172 2004 ----
NM_004598chr563151 2737 2626 2523 2328 2286 22961 2257 --22605 751
NM_004726chrX55411 3898 3620 1041 683 43877 3500 1537 22 --11323
NM_004734chr1383158 3103 2244 2122 1218 822 718 376 3581 283 224 ----
NM_004738chr202987 234 5959 620 349 248 103 --1278
NM_004745chr876150 5832 5815 5633 5315 4505 2009 24933 1004 11535 1659
NM_004748chr1553356 2630 2621 714 663 43372 3231 3197 2604 --11694
NM_004763chr23189 174 84 ----7938 802 746 690 410 354 298
NM_004815chr164680 4596 3582 1787 1701 573 ----13951
NM_004834chr263191 2798 2274 812 373 338 23437 3284 --12944
NM_004857chr1443269 3027 336 41 2260 232 11876 14413
NM_004863chr1465297 4881 4183 3951 3299 1739 23709 152 25055 572 15112
NM_004866chr564785 4323 4294 1300 491 262 44428 1370 691 254 ----
NM_004985chr1264414 3786 3176 1298 641 337 24035 156 14549 --
NM_005056chr12114924 4698 4310 4236 1893 1114 1075 355 221 203 114 25081 3992 ----
NM_005065chr1474699 4108 3916 3640 3429 1954 1563 --24689 1020 23347 31
NM_005095chr161951 609 236 208 130 77 1445 --1903
NM_005121chr1782713 2414 1282 755 355 290 206 87 ----13665
NM_005188chr11102002 1730 1573 1451 1311 1148 1041 887 102 38 27844 7540 ----
NM_005201chr341077 991 392 59 2433 44 31014 351 147 --
NM_005235chr296099 6080 5324 4974 2921 2876 1008 784 570 32069 1674 905 --1140
NM_005277chr431776 1337 484 --11475 1109
NM_005359chr1885992 5932 5763 5312 5147 1381 935 722 11405 21198 1179 --
NM_005465chr191864 1645 1451 1400 1365 1345 1292 363 54 ------
NM_005497chr1765690 4444 3943 1434 693 65 45656 5007 2353 1054 --14752
NM_005502chr973271 2055 2009 1094 481 283 160 --11074 --
NM_005504chr12116476 5442 5260 4811 4534 4235 2296 1211 748 740 23 45311 4906 1890 1364 25213 274 14100
NM_005578chr395046 4595 4485 1776 1525 1308 636 630 324 24237 687 14227 --
NM_005596chr975342 5187 4668 4615 3952 1067 311 55738 5412 2549 1551 295 15042 15911
NM_005665chr184628 4083 3946 3819 3722 1368 1115 391 14287 ----
NM_005756chrX61531 617 601 417 259 143 ----11183
NM_005759chr294558 4398 3537 3118 1913 1192 1056 740 234 1109 11472 --
NM_005822chr672405 2316 2041 2009 1946 810 571 ------
NM_005840chrX137323 6912 6788 6758 6307 6146 4992 4954 2705 1757 1669 789 143 36512 5321 2225 --37164 1636 1373
NM_005901chr1888433 8108 6032 5798 3393 2968 2949 242 ----18129
NM_005903chr595023 4583 4371 3792 1879 1860 1639 904 371 64338 4265 3321 758 589 574 ----
NM_005909chr564208 3215 3127 1243 1214 952 53633 1644 1584 1548 432 13313 --
NM_005935chr4115224 5063 5005 4993 1889 1625 1327 1039 570 537 514 24279 1840 24966 436 --
NM_005941chr883996 3728 3666 3370 2567 1210 1168 1092 ------
NM_005964chr1741072 963 523 505 --11476 11262
NM_006203chr5105048 4956 4565 4474 4239 3797 2169 1544 959 535 14700 24147 814 --
NM_006252chr186277 6081 2599 2466 2032 837 273 251 57414 6458 4636 2654 1459 --11985
NM_006300chr1972346 2294 1988 1714 789 570 60 21890 438 ----
NM_006306chrX95523 5400 5348 5240 4273 3808 1352 958 673 45159 4158 1634 452 ----
NM_006371chr364666 4311 4063 2089 1775 830 24298 1780 34632 4369 3657 1268
NM_006380chr1784273 3234 3176 3127 1280 1086 830 810 ----23497 895
NM_006420chr2073351 3330 2217 1193 857 744 119 --23300 2278 11099
NM_006482chr1253318 2547 2413 1365 236 33864 1290 511 11403 --
NM_006489chr1481940 1869 1567 1404 625 501 456 297 21886 1525 1393 --
NM_006529chr451465 1127 569 185 98 21073 119 11199 --
NM_006544chr14105067 4984 4946 4667 4265 4133 2081 946 619 445 24018 1124 1129 11951
NM_006547chr751774 1656 1370 587 354 1638 ----
NM_006599chr16117824 7795 6613 5960 5872 3312 2202 2142 1167 417 223 --12337 18071
NM_006620chr664776 3985 1791 1392 1242 37 44760 4327 1422 788 23812 3751 --
NM_006699chr172396 2277 2199 2064 1056 587 245 21731 267 ----
NM_006722chr383036 2914 2675 2632 2565 2068 1945 720 32908 2739 999 ----
NM_006731chr915234 84181 3617 1752 1633 1342 1054 931 507 --14935
NM_006750chr16168041 7462 7416 7255 7116 6957 5958 5574 2824 2757 2395 2365 2299 1760 1226 292 77127 6746 6138 5681 5224 2893 981 ----
NM_006852chr1752870 2707 2339 2291 52 11948 12372 12814
NM_006873chr272167 1146 1085 1062 865 482 91 23390 24 23357 3073 --
NM_006888chr1452945 2468 1146 485 281 1251 23141 2187 1585
NM_006924chr1794038 3609 3433 3416 3332 3209 3096 561 484 23340 1317 ----
NM_007011chr1596900 6283 5691 5684 5604 5376 5274 1705 369 32436 1788 238 191 11051
NM_007038chr2155814 4886 4771 4039 3958 23738 1327 35090 5064 2226 1108
NM_007050chr20167992 7956 7348 6188 5256 4926 4899 3225 3169 3104 2702 2452 2331 1460 1431 1286 47334 5294 1492 70 17793 12115
NM_007137chrX145551 4966 4899 4889 4656 4604 4134 3925 3846 1657 1296 1133 826 347 ------
NM_007203chr983765 2711 1352 1029 508 357 347 266 13454 1149 13512
NM_007218chr83330 291 22 ----1775
NM_007220chrX64885 4103 4032 3746 3548 1637 21621 284 11917 --
NM_007249chr13139166 8862 8444 8401 8161 7696 6776 5985 3351 1999 1379 1013 948 23718 2512 --22276 223
NM_012141chr1363893 3482 2982 2966 1079 765 24052 3504 22645 159 --
NM_012164chr9106753 6556 2553 2188 1865 955 837 740 701 323 27423 2649 12175 22263 1762
NM_012193chr11105073 5001 4604 4400 1340 1196 744 199 123 87 11124 1176 33983 3314 1669
NM_012214chr2126238 5926 5033 4814 3910 1908 1666 1481 1452 1247 1218 1090 21173 875 23935 665 --
NM_012252chr7104691 4597 3501 1801 1481 1383 1322 1289 334 179 34204 4002 1581 13633 --
NM_012262chr154629 3961 3422 3390 3283 25274 1912 25007 3469 --
NM_012287chr3114256 3915 3776 3740 3471 3376 3345 3053 634 319 115 23985 1606 ----
NM_012290chr241053 241 229 192 1507 --21602 513
NM_012294chr763995 3333 3221 2980 1330 999 3991 963 459 23673 346 --
NM_012382chr5103533 3021 2909 2817 1348 1033 950 905 769 687 2791 146 --1631
NM_012465chr1063398 2623 2240 1208 558 551 22566 1225 22469 1034 12156
NM_012479chr7102711 2638 2613 2199 2193 1990 1952 1676 334 102 12442 11697 --
NM_013231chr1463904 3353 1344 919 443 278 14361 11005 --
NM_013255chr7136470 6151 5725 5610 5513 3218 3006 2306 1598 869 811 286 93 58816 6688 2752 1764 706 --15408
NM_013261chr493483 3441 3411 2927 1345 1009 945 691 178 4599 426 222 24 ----
NM_013269chr1293768 3565 3544 3305 1308 1049 1021 709 616 23027 212 ----
NM_013306chr112670 144 ----1706
NM_013309chr1562419 2299 2038 1890 733 700 ----11778
NM_013381chr122484 94 21839 510 1598 22396 2262
NM_014112chr895281 5107 3892 3645 1651 507 495 446 197 ------
NM_014155chr11126395 5990 5858 4566 2961 1914 1767 1742 1672 938 668 233 35925 2932 1269 ----
NM_014333chr11112599 2045 2027 1754 1065 988 754 657 613 63 22 ------
NM_014423chr575163 3891 3426 3410 2142 1785 290 24250 635 42041 1191 1045 733 --
NM_014577chr223751 698 599 ----1367
NM_014670chr241193 1095 478 303 --1435 11033
NM_014702chr683122 2834 2769 2140 1197 889 823 542 1811 ----
NM_014721chr6116739 6689 6425 6376 5877 2887 2442 2217 1258 618 434 15989 24642 207 14528
NM_014730chr1265121 1767 1528 1138 583 93 13818 187 15314
NM_014730chr1265121 1767 1528 1138 583 93 13818 187 15314
NM_014733chr562063 865 846 343 334 143 11517 11891 --
NM_014739chr674144 4080 3925 3710 3684 3545 1127 13054 13702 --
NM_014755chr293784 3624 3540 2988 2748 1696 1346 1130 1089 64065 3660 3376 2995 1325 276 ----
NM_014787chr172296 1976 1025 615 596 362 229 31890 1844 1013 ----
NM_014810chr142476 1236 1181 920 ----13226
NM_014873chr1114415 3483 3470 3417 3030 2982 1931 1634 992 187 118 13328 ----
NM_014877chr1777719 7548 7215 6703 5216 2058 423 37493 7253 1534 --15852
NM_014906chr1783455 3409 3315 3281 2554 1552 1319 547 --23683 1618 13169
NM_014920chr643652 3581 1301 308 42820 2746 1382 1187 22868 981 --
NM_014982chr1485154 5113 4930 4868 3791 3449 1897 486 11493 ----
NM_015026chr1294314 3720 3514 3487 3458 1175 1131 711 322 14374 24225 1395 --
NM_015040chr2102916 2799 2702 2451 2322 2138 1294 1033 852 507 13239 ----
NM_015068chr793758 3112 3050 2767 2736 1349 1304 1147 231 --33796 773 68 11424
NM_015071chr586544 5958 4852 4688 3980 1998 1045 602 56242 5081 4522 4415 3952 ----
NM_015076chr694486 4340 3833 3758 3650 3140 1718 1232 1106 33840 3581 1734 --13447
NM_015090chr176182 5561 4977 4885 4514 4333 2309 1668 2862 182 26077 4061
NM_015115chr452785 872 813 695 571 23216 1287 --23200 3050
NM_015132chr771866 1386 492 439 358 263 206 ----1310
NM_015192chr2051968 818 800 659 297 22641 991 22141 1091 22388 2321
NM_015199chr372901 2595 2463 2373 2110 1822 114 42820 2400 1872 954 ----
NM_015200chr411714 22552 1736 --11726
NM_015206chr1553849 3820 3596 2744 75 --32952 999 931 --
NM_015247chr1695048 4838 4726 4337 4187 3659 1720 1200 98 ------
NM_015254chr883186 3137 3120 3101 3031 2141 995 115 --12122 163
NM_015271chr4114245 3909 3818 3739 1623 1368 1341 1095 1002 550 160 --12909 13682
NM_015277chr181377 2624 314 11310 1495
NM_015375chr1113446 3344 3323 3259 1389 914 546 530 178 165 152 23890 3874 14817 --
NM_015455chr553284 1388 785 515 107 13015 --13266
NM_015564chr572923 2239 697 673 662 639 86 12615 11399 --
NM_015571chr682564 2498 1691 552 319 184 96 44 11968 ----
NM_015640chr195361 4765 4604 4486 4189 3392 1643 1390 1330 13359 ----
NM_015879chr18148066 7808 7350 6836 5891 5598 5539 2679 2377 1789 1612 1323 958 28 ------
NM_015888chr1123377 3344 3210 3076 2860 2842 2783 2706 2620 944 842 588 12879 ----
NM_015906chr174367 4243 3563 3464 667 597 245 33815 2976 296 ----
NM_016009chr194856 4659 3669 3578 3177 3026 984 934 544 21447 998 ----
NM_016083chr6102740 2663 2643 2493 1483 523 251 225 202 112 11355 13309 --
NM_016206chr3128978 8800 8711 7739 5747 3425 3000 2713 2239 2123 1634 745 1764 1970 16312
NM_016260chr286193 5421 5281 5161 4765 2958 714 516 46322 5310 4897 4827 ----
NM_016373chr162543 161 1551 --1557
NM_016396chr1562703 1909 775 596 436 239 12909 22969 984 22270 842
NM_016513chr643652 3581 1301 308 42820 2746 1382 1187 22868 981 --
NM_016530chr1594148 3625 3592 2959 2680 2634 1094 661 208 13246 13976 --
NM_016531chr4103810 3652 3261 2734 2696 2672 1408 776 626 446 23668 1226 ----
NM_016544chr242470 514 475 177 --12643 23375 3290
NM_016599chr421519 1223 11489 --11378
NM_016929chr674523 3296 3254 3160 2932 1461 863 34433 3810 212 23774 730 --
NM_016953chr295679 5233 3845 2301 2272 1312 1069 236 31 1791 11604 --
NM_017420chr1473816 3075 2865 2835 2825 830 678 ------
NM_017633chr653613 2848 1548 873 543 2630 310 21193 119 --
NM_017637chr9118659 7034 7023 7009 6403 3734 3240 2994 2568 1946 1756 12380 16714 --
NM_017650chr786052 4945 4710 4250 2082 1961 1868 528 45925 5196 399 98 --15298
NM_017754chr674947 4434 3356 3145 1772 1743 1720 ----14176
NM_017813chr875220 4785 4629 4248 2252 1637 894 15033 11996 15779
NM_017847chr182238 2142 1937 1645 1638 686 458 281 42191 1884 871 452 ----
NM_017848chrX64341 4143 4062 3069 2838 803 33329 381 220 34317 3203 651 --
NM_017919chr985582 5036 3658 1623 1613 1152 799 552 13675 11190 15753
NM_017944chr11102936 2888 2779 2747 1983 1211 1111 926 877 160 ----1109
NM_018000chr252182 2033 1785 811 588 3579 570 118 ----
NM_018010chr351538 624 565 378 97 11202 --11217
NM_018027chr1083182 3150 2999 2691 2671 2228 2160 1090 ----1350
NM_018084chr262953 2788 2763 2684 979 639 23171 782 ----
NM_018155chr363095 3057 2716 2292 776 528 11055 11385 1427
NM_018227chr482718 2152 2127 2100 1160 1146 1111 1013 12055 ----
NM_018246chr8102860 2824 2667 2601 2557 2549 2535 1065 904 555 ------
NM_018299chr883244 2768 2519 2104 581 360 112 99 32269 1354 804 2406 322 --
NM_018362chr1143693 2618 2552 70 11321 21489 85 --
NM_018364chr174083 3973 3212 2598 2502 1582 438 2446 126 ----
NM_018373chr14116362 5057 4770 4582 1752 1506 1072 1027 391 110 31 12390 ----
NM_018429chr552804 2405 1936 480 131 31162 1014 562 1496 --
NM_018452chr6_random63628 1330 1244 673 631 272 43506 2520 1179 471 --13611
NM_018638chr1285551 5471 5356 4173 1515 1059 359 168 35073 4847 1164 ----
NM_018970chr783036 2618 2543 2066 1924 995 508 268 --22464 2200 11939
NM_018976chr1282870 2722 2224 2210 2161 658 651 579 1244 ----
NM_019072chr584302 4023 1278 1256 842 520 405 225 13852 1896 --
NM_019593chr2052899 2653 386 120 109 11178 11986 --
NM_020133chr6116196 6160 5990 5422 5154 4993 4985 4457 842 419 246 26228 2503 14661 35771 1243 886
NM_020226chr44779 680 615 594 2601 507 ----
NM_020341chr2051603 1290 738 613 130 11767 1585 --
NM_020353chr342064 1686 578 498 11958 --1453
NM_020390chr334574 4567 3026 --24430 1787 11612
NM_020474chr1841243 381 288 212 11604 --1635
NM_020673chr2087201 5020 2889 2521 1386 767 758 522 15173 12644 2598 170
NM_020699chr155134 4574 1966 366 254 31346 1083 480 --35343 4690 495
NM_020704chr782449 2412 2273 2141 960 776 759 163 1829 ----
NM_020739chr1553356 2630 2621 714 663 43372 3231 3197 2604 --11694
NM_020774chr18115404 4876 4449 4279 4186 1589 1200 955 886 602 388 34113 893 475 25938 2287 15297
NM_020796chr521898 668 11073 --22213 547
NM_020844chr8127056 5857 5160 2958 2740 1894 1757 1733 1682 1598 1154 884 25592 541 16177 --
NM_020859chr463015 1428 969 596 407 252 23689 1378 ----
NM_020870chr452161 1538 877 749 738 22174 399 --11660
NM_020871chrX62452 2235 1783 1742 657 600 42368 2271 2083 1721 ----
NM_020940chr1052778 2143 2022 1001 281 ----11869
NM_020977chr441712 1620 659 244 1511 12228 11755
NM_021255chr1463883 3677 3129 3105 2689 884 13916 --1982
NM_021629chr3105047 4891 4733 4689 4409 4272 4206 4091 1938 1355 1426 ----
NM_021647chr474512 4317 3404 3334 3004 246 156 34167 1307 1015 11390 --
NM_021813chr675736 5228 4829 4238 4154 1025 195 23979 237 13597 --
NM_021815chr273080 3022 2691 2560 2074 930 457 1561 12795 --
NM_021911chr574987 4805 4424 1734 1269 176 102 24403 3800 ----
NM_021912chr1564005 2965 2813 1576 1547 604 1720 23908 2850 2832 816
NM_021961chr1197487 6843 5258 2984 2181 1155 828 813 644 47410 6724 5419 5325 12062 15449
NM_021964chr376574 5778 5432 4044 1573 1434 1191 22350 529 16461 15707
NM_022048chr1555616 4070 1292 708 288 35491 4443 465 11778 13989
NM_022114chr184764 3819 3629 1739 523 422 411 151 1429 1234 --
NM_022334chr23189 174 84 ----7938 802 746 690 410 354 298
NM_022456chr12117531 6634 6324 5845 5491 2948 1876 1733 1408 443 49 47613 7251 6301 2573 --12579
NM_022459chr1385809 4673 4497 1226 1117 1035 562 149 15750 --11412
NM_022469chr1103318 3244 3186 3179 2808 2528 2354 2281 1135 819 23286 921 ----
NM_022893chr243048 2905 2500 876 22862 1191 21026 860 --
NM_023929chr852738 964 761 715 487 ----1374
NM_024345chr965548 4613 4575 4182 4125 2108 55588 4557 2282 1990 558 ----
NM_024665chr383533 3448 3405 3102 1514 1285 1265 55 33558 340 175 24613 4599 --
NM_024740chr112914 649 1834 156 22983 1010
NM_024761chr984978 4402 3691 1456 1436 1358 952 858 25311 90 35076 3599 132 --
NM_024770chr286644 6021 4307 2137 1187 1147 866 85 36100 5555 2149 36319 5017 654 --
NM_024896chr972361 1808 440 355 181 105 95 ------
NM_024930chr552419 812 745 579 285 1568 --11725
NM_024947chr3119377 8808 7272 6361 5910 5839 3483 2542 2256 2024 347 37014 6720 2773 --23616 460
NM_024989chr297878 7680 7126 5771 5559 3278 2608 1364 50 46789 6627 6322 1705 ----
NM_025073chr1124572 3629 3538 3342 3239 3003 1675 1668 1588 1424 1034 635 --13077 --
NM_025179chr1114253 3830 3807 3658 3175 1412 1332 614 552 349 219 --14772 --
NM_025191chr151247 656 583 574 490 22783 568 ----
NM_025195chr841881 1673 161 96 11445 1533 1364
NM_030621chr1473848 3841 3763 3199 897 585 274 21659 279 ----
NM_030627chr564097 3256 2512 539 141 131 32535 1567 860 12900 --
NM_030634chr182413 2043 1717 551 387 212 63 28 1137 2692 561 1821
NM_030647chr786157 5219 4851 4654 4352 3902 1808 738 --35970 5101 2478 --
NM_030648chr4135556 5426 4988 4006 3737 3552 3486 2128 2003 1798 508 304 72 14995 ----
NM_030650chr294230 3833 3639 3265 2731 780 617 606 196 11025 ----
NM_030664chr1041564 747 605 435 2937 105 1256 1541
NM_030670chr1232013 825 261 32287 2226 714 --2698 456
NM_030671chr1232013 825 261 32287 2226 714 --2698 456
NM_030806chr1119330 8410 6950 3199 2708 2589 1903 1627 1242 603 160 ------
NM_030816chr193583 3526 3430 2724 2713 543 245 143 92 13541 ----
NM_031268chr1665309 5288 4922 4787 3728 1618 --11558 15048
NM_031418chr1162771 2722 1084 780 453 50 12107 1187 --
NM_031427chr14104356 3786 2328 2152 1962 1746 1362 940 911 707 22374 1062 12228 --
NM_031442chrX63134 2841 2824 2161 2130 1093 32780 2274 532 1436 --
NM_031461chr84869 619 356 193 --21590 1431 --
NM_031468chr777816 7238 7232 5668 2982 1670 1024 26545 5085 47669 3295 3048 2524 16971
NM_031469chr673879 3563 3293 3227 282 159 21 23943 664 --13765
NM_032116chr1331305 1142 473 65490 5091 4816 2017 1281 450 14835 11894
NM_032208chr273049 2944 2850 1061 845 262 197 ----23637 820
NM_032373chr1095654 4829 4113 2223 1813 1767 1539 871 347 ------
NM_032521chr2062767 2219 2206 2068 824 504 33104 2487 2437 190 --
NM_032778chr362921 2635 2538 932 861 409 22454 214 ----
NM_032804chr1062546 2282 1970 1910 559 291 ----12557
NM_032828chr1941687 1601 1559 912 23596 599 --24562 4055
NM_032859chr1373581 2790 2729 2721 2555 1536 1239 33400 103 50 ----
NM_032873chr1194080 3970 3958 3679 3556 3077 3065 1588 794 21269 1102 ----
NM_032900chr1063297 2870 2756 1524 1006 789 1693 13204 23005 2733
NM_032975chr1853016 2791 2626 1245 206 --22527 689 2451 390
NM_032980chr1853016 2791 2626 1245 206 --22527 689 2451 390
NM_032999chr751048 453 385 198 181 2264 252 --1734
NM_033000chr751048 453 385 198 181 2264 252 --1734
NM_033001chr751048 453 385 198 181 2264 252 --1734
NM_033020chr174367 4243 3563 3464 667 597 245 33815 2976 296 ----
NM_033181chr6102740 2663 2643 2493 1483 523 251 225 202 112 11355 13309 --
NM_033211chr561750 1659 1391 719 597 427 11443 --22018 1946
NM_033224chr7118115 7934 5503 5297 3161 2431 2308 1517 1290 991 82 55394 5269 3103 2553 2112 27030 169 --
NM_033331chr983501 3277 3177 2653 1228 190 162 132 1224 11002 1997
NM_033360chr1264535 3907 3297 1419 762 458 24156 277 14670 --
NM_033364chr341965 1785 775 158 22028 1495 --11675
NM_033407chr12526 225 ----2655 447
NM_033430chr494192 4041 3769 3026 2683 1304 931 800 781 1875 13339 --
NM_033437chr494192 4041 3769 3026 2683 1304 931 800 781 1875 13339 --
NM_033505chr275592 5235 2454 2113 1712 805 531 55481 5272 1909 549 132 1477 --
NM_052879chr1263265 3183 2613 1415 1353 582 12746 --13021
NM_052907chr1294253 3981 3105 1619 1272 790 430 318 62 33815 1456 1111 22708 1152 --
NM_052927chr541896 1525 464 245 22176 1687 --137
NM_053016chr9187729 6079 5132 3213 2947 2913 2502 2457 2409 2171 1980 1790 1424 1319 974 906 711 297 15459 1939 17507
NM_054016chr131464 709 134 2389 151 192 1800
NM_054016chr131464 709 134 2389 151 192 1800
NM_054016chr131464 709 134 2389 151 192 1800
NM_080676chr2073125 2471 2009 1074 590 533 442 12353 12017 12097
NM_080867chr1494391 4190 3278 3257 1745 1710 1684 1339 655 53698 1731 1583 821 27 13618 --
NM_130391chr983441 2940 2871 2515 2505 1104 399 208 23058 2569 ----
NM_130392chr983441 2940 2871 2515 2505 1104 399 208 23058 2569 ----
NM_130393chr983441 2940 2871 2515 2505 1104 399 208 23058 2569 ----
NM_133170chr20167992 7956 7348 6188 5256 4926 4899 3225 3169 3104 2702 2452 2331 1460 1431 1286 47334 5294 1492 70 17793 12115
NM_133334chr4105985 5165 4610 4309 1759 1588 1381 899 456 134 21670 1029 --161
NM_138292chr1153492 3139 2832 1415 595 12685 12617 12178
NM_138444chr1354929 3527 3313 1493 953 64742 4519 4473 3430 3265 1776 1891 --
NM_138468chr2136181 6087 5405 5145 4825 4281 3942 2408 2038 1988 1580 1551 556 25850 5476 24949 1863 --
NM_138713chr16117824 7795 6613 5960 5872 3312 2202 2142 1167 417 223 --12337 18071
NM_138714chr16117824 7795 6613 5960 5872 3312 2202 2142 1167 417 223 --12337 18071
NM_138731chr1463612 3584 2742 1572 1117 225 --11547 34087 4046 3163
NM_138809chr532166 839 442 52789 1762 985 580 570 12746 --
NM_144571chr497029 6509 2796 1888 1651 1276 1122 418 355 45763 4627 1970 1037 15514 --
NM_144599chr1595040 4994 4279 3507 2063 2004 632 601 426 1818 13981 11536
NM_145259chr2116891 5000 4699 4564 4344 4317 1288 1217 1145 948 746 66778 6125 5099 2636 2341 712 26264 4495 --
NM_145307chr1053460 1436 1025 287 152 21695 1507 --1974
NM_145649chr652713 2360 1783 1718 288 22502 1708 --1276
NM_145655chr652713 2360 1783 1718 288 22502 1708 --1276
NM_145686chr263191 2798 2274 812 373 338 23437 3284 --12944
NM_145687chr263191 2798 2274 812 373 338 23437 3284 --12944
NM_145693chr242602 2250 1821 1668 42332 911 905 795 --12528
NM_147150chr983765 2711 1352 1029 508 357 347 266 13454 1149 13512
NM_147156chr1041546 1075 1030 106 1516 --1972
NM_147777chr112670 144 ----1706
NM_152289chr1931703 1664 84 ----21531 36
NM_152388chr263977 3502 1284 933 223 28 43265 3047 801 210 ----
NM_152424chrX64482 3974 3740 3024 649 496 64035 3579 1590 1417 1376 896 24254 4040 --
NM_152624chr596808 6719 5382 4862 4832 2644 1521 1487 360 --15121 --
NM_152756chr563565 3538 1618 794 473 379 22989 324 --12922
NM_152774chr782746 2691 2458 2334 1968 1708 1692 50 42716 1098 527 336 ----
NM_152787chrX83666 3561 3012 2715 2641 2464 875 128 23443 839 13308 --
NM_152835chr162907 2535 2048 584 226 53 32286 2272 2182 1535 --
NM_152924chr1596900 6283 5691 5684 5604 5376 5274 1705 369 32436 1788 238 191 11051
NM_152996chr151721 740 591 440 342 32027 1780 93 2401 110 1273
NM_153182chr362921 2635 2538 932 861 409 22454 214 ----
NM_153456chr1376325 5569 5025 4982 4447 2254 2119 26278 824 22136 2060 --
NM_153605chr31535 21596 1579 11219 11168
NM_153619chr1553144 2768 1068 680 271 32551 2481 1122 2883 659 13243
NM_153712chr273766 3541 2940 2728 2381 1465 65 43605 3342 2666 1482 13491 --
NM_170710chr472211 1956 1075 735 446 405 138 12087 22905 2636 --
NM_172037chr841501 1386 548 293 21257 314 1601 --
NM_172071chr197503 7388 6282 6260 5835 5072 4700 2468 363 27494 6833 ----
NM_173214chr16117824 7795 6613 5960 5872 3312 2202 2142 1167 417 223 --12337 18071
NM_173511chr263884 2999 2889 1023 860 420 --11457 22429 116
NM_173519chr871942 1841 1627 1419 801 794 212 12005 1139 --
NM_173576chr1061781 1547 891 521 89 27 11988 12113 --
NM_173582chr1155702 4733 2150 1458 201 44940 4753 2276 1710 12351 --
NM_173642chr1168876 7972 7561 6954 6135 3670 3604 3581 2907 2804 829 758 566 331 156 142 38838 6481 2283 26799 5736 16996
NM_173825chr382868 2468 2075 1954 794 686 580 266 22507 157 1588 1286
NM_173829chr5126230 5354 4699 3892 2337 2184 2158 2094 1025 816 360 318 11992 21958 394 --
NM_173851chr8103848 3757 3696 3619 3333 3153 2907 1236 1021 451 --21573 1181 --
NM_174911chr853759 3239 2748 2543 1194 23313 2471 12598 11522
NM_175607chr341681 1316 1266 661 41670 1637 1218 145 --11303
NM_175612chr341681 1316 1266 661 41670 1637 1218 145 --11303
NM_175623chr12117531 6634 6324 5845 5491 2948 1876 1733 1408 443 49 47613 7251 6301 2573 --12579
NM_175624chr12117626 6729 6419 5940 5586 3043 1971 1828 1503 538 144 47708 7346 6396 2668 --12674
NM_175625chr12117626 6729 6419 5940 5586 3043 1971 1828 1503 538 144 47708 7346 6396 2668 --12674
NM_177438chr1473848 3841 3763 3199 897 585 274 21659 279 ----
NM_177925chr1273122 2938 2755 2664 1985 835 691 11026 1983 --
NM_177990chr2051603 1290 738 613 130 11767 1585 --
NM_178011chr1032332 795 747 1759 --1929
NM_178151chrX97675 6881 6085 5959 1934 1603 692 563 283 21454 424 57346 6615 6511 5481 2160 --
NM_178152chrX97675 6881 6085 5959 1934 1603 692 563 283 21454 424 57346 6615 6511 5481 2160 --
NM_178153chrX97675 6881 6085 5959 1934 1603 692 563 283 21454 424 57346 6615 6511 5481 2160 --
NM_181265chr472211 1956 1075 735 446 405 138 12087 22905 2636 --
NM_181481chr18126940 5661 5502 5276 5032 4461 2768 2495 1780 1614 1495 1290 66601 6233 5099 4281 367 183 --12185
NM_181482chr18126940 5661 5502 5276 5032 4461 2768 2495 1780 1614 1495 1290 66601 6233 5099 4281 367 183 --12185
NM_181483chr18126940 5661 5502 5276 5032 4461 2768 2495 1780 1614 1495 1290 66601 6233 5099 4281 367 183 --12185
NM_181489chr396210 5993 5589 5260 5253 5073 4583 4266 2140 2782 125 ----
NM_181705chr5115692 5354 5002 4806 4278 4037 2063 1658 951 794 782 34296 3790 404 ----
NM_181712chr131831 1721 1610 ----21786 764
NM_182493chr16135246 4754 4431 4404 4006 3522 1338 1215 1032 728 483 66 24 24274 760 ----
NM_182501chr243101 2749 2121 1266 12302 --22507 1249
NM_182503chr6105403 5132 4403 3922 3905 3555 1907 879 38 28 35193 3645 2156 --15247
NM_182515chr1996478 5420 4767 2326 2093 1601 1100 1016 65 36070 5863 4452 ----
NM_182907chr611501 --1419 1354
NM_182948chr163184 1180 1003 882 698 692 32068 890 751 1425 12642
NM_183004chr1483144 3104 1505 569 328 193 163 96 33076 1553 576 ----
NM_194283chr5104155 3838 3097 1412 1284 1255 924 875 527 90 23995 1510 12673 1715
NM_194314chr194399 4307 3831 1943 1549 1523 1512 1202 887 ----15463
NM_194317chr282756 2622 2334 2228 1723 1102 1080 1053 12467 11012 --
NM_197941chr573098 2990 2731 2004 1064 670 560 ----1357
NM_198158chr383036 2914 2675 2632 2565 2068 1945 720 32908 2739 999 ----
NM_198159chr383036 2914 2675 2632 2565 2068 1945 720 32908 2739 999 ----
NM_198177chr383036 2914 2675 2632 2565 2068 1945 720 32908 2739 999 ----
NM_198178chr383036 2914 2675 2632 2565 2068 1945 720 32908 2739 999 ----
NM_198270chrX103249 3120 2606 1156 1145 1028 933 855 724 122 11212 1497 --
NM_198465chrX82971 2855 2576 2210 2028 1055 208 153 12082 12044 12292
NM_198581chr2127343 6646 2804 2491 2330 1828 1635 1335 1323 873 806 327 46893 6874 6755 1168 --16338
NM_198715chr1106143 5873 5332 2289 1801 1793 1477 1421 908 283 56218 4788 2220 2155 2019 ----
NM_198793chr384102 3788 3415 3235 3037 2755 507 293 1798 13373 --
NM_199188chr1263265 3183 2613 1415 1353 582 12746 --13021
NM_199190chr1263265 3183 2613 1415 1353 582 12746 --13021
NM_199421chr1494391 4190 3278 3257 1745 1710 1684 1339 655 53698 1731 1583 821 27 13618 --
NM_199454chr184764 3819 3629 1739 523 422 411 151 1429 1234 --
NM_199462chr1113446 3344 3323 3259 1389 914 546 530 178 165 152 23890 3874 14817 --
NM_201591chr431776 1337 484 --11475 1109
NM_201592chr431776 1337 484 --11475 1109
NM_203329chr1187067 6244 6221 5206 2090 1897 1272 678 31182 1147 1064 36359 5776 2206 1289
NM_203330chr1187067 6244 6221 5206 2090 1897 1272 678 31182 1147 1064 36359 5776 2206 1289
NM_203331chr1187067 6244 6221 5206 2090 1897 1272 678 31182 1147 1064 36359 5776 2206 1289
NM_203391chrX71660 1544 1481 1446 1328 640 48 31832 1629 1260 --184
NM_203394chr1252635 1753 1002 789 220 1676 --12265
NM_206853chr632889 1219 441 33934 3640 3310 1105 13477
NM_206854chr674150 3334 3323 1702 1204 945 237 35195 4901 4571 11366 14738
NM_206855chr675115 4299 4288 2169 1910 1202 48 36160 5866 5536 12331 15703
NM_207303chr10113989 3549 2670 2597 2541 1622 1168 995 875 366 283 13447 33469 444 142 11343
NM_207325chr1992041 1943 1881 1619 1359 1281 279 251 69 --11869 --
NM_207406chr4115703 5353 5015 4868 4354 1670 1385 943 808 572 240 21740 494 24012 1602 --
NM_212558chr994058 3581 1357 1120 1056 987 430 364 192 34034 3234 805 14155 11191