TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-618
miRNA Sequence: AAACUCUACUUGUCCUUCUGAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000809chr497330 6809 3053 2990 1410 1286 1230 879 526 1149 --19072
NM_001001928chr2297850 6410 5905 5626 2014 1432 1384 798 35 28317 2206 --11882
NM_001014797chr10128195 7989 7047 6884 6472 6054 5404 5194 5078 3161 2244 880 16131 --13239
NM_001018065chr985535 4738 4632 3868 2281 1463 649 82 11268 54862 3911 2147 658 300 --
NM_001167chrX116509 6275 6087 5669 5556 2176 1910 1900 1876 1648 1605 14679 16397 22514 393
NM_001204chr267633 7245 6151 1409 840 22 35485 2271 260 16577 --
NM_004852chr181213846 11953 9824 5539 4988 4598 3353 2460 1876 412 390 201 310647 8633 2771 112816 --
NM_005160chr2245554 4265 1448 1277 11491 1729 25216 5188
NM_005668chr564445 3806 3747 3119 1473 705 13897 12974 14238
NM_006371chr3135154 5135 4915 4681 4243 3268 1929 1752 1740 1527 900 259 234 11771 --11819
NM_013386chr121756 54 --1506 31506 643 321
NM_014877chr1767526 5951 5727 5654 5630 4736 --47588 6756 3073 1577 1622
NM_015271chr433912 3555 1136 --2580 88 23208 193
NM_015310chr878229 6199 5677 5528 2545 2232 695 --46972 6025 1769 47 1423
NM_018440chr866818 6656 6211 2461 651 587 13448 28577 8392 18071
NM_018999chr1074864 4310 3858 3753 3680 1191 289 --21835 1555 13803
NM_021083chrX1859 1839 2941 447 23095 2717
NM_033224chr796637 6612 6503 5868 4878 2639 1280 749 543 14913 28049 7378 --
NM_207406chr4116494 6216 5839 5450 4716 4573 4441 1405 1353 1204 44 --3651 387 156 16267