TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-622
miRNA Sequence: ACAGUCUGCUGAGGUUGGAGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX96975 6643 5438 4766 4625 2776 989 503 248 1655 ----
NM_000087chr41418 ------
NM_000115chr1341865 1645 1039 593 --2689 495 --
NM_000127chr8----197 --
NM_000163chr551665 1546 727 560 401 --1238 --
NM_000176chr543500 3392 2763 387 --13794 --
NM_000208chr1933166 796 781 13677 --1527
NM_000248chr341184 932 258 171 ------
NM_000259chr1586154 5712 2348 1819 1583 1543 1260 760 11223 24852 2391 --
NM_000266chrX4713 672 239 70 --1337 --
NM_000280chr111307 ------
NM_000314chr1022585 102 ----1319
NM_000321chr131682 1205 1249 --
NM_000332chr6106604 5617 5311 4670 2526 1778 1060 573 163 54 11611 14605 16765
NM_000358chr5271 58 ------
NM_000362chr2252933 2634 2520 839 497 22245 802 1556 --
NM_000368chr994527 4287 4016 4004 3419 3276 1643 1237 1215 --54640 3924 3628 1711 777 --
NM_000393chr21477 ------
NM_000408chr243385 3065 3037 1044 ------
NM_000430chr1742823 2458 2297 800 23412 128 23728 3624 --
NM_000461chr363730 3362 3262 2837 1202 932 --13918 --
NM_000484chr211946 ------
NM_000489chrX63277 2510 2487 2420 1177 288 ------
NM_000492chr741495 996 576 270 ------
NM_000503chr82546 491 1382 --11786
NM_000533chrX21489 1257 --11711 --
NM_000538chr132470 182 21616 592 ----
NM_000599chr264548 4170 3969 3349 3127 1807 33284 1485 927 13080 --
NM_000618chr1295015 4622 4584 4524 2248 1461 1358 1110 216 --15336 --
NM_000793chr1484788 4396 4320 4228 3870 3772 3200 2061 24222 1935 ----
NM_000794chr52689 53 --1415 --
NM_000814chr1523211 3161 33155 1246 1139 ----
NM_000829chr1162265 2240 2009 856 316 197 12147 ----
NM_000840chr72143 36 1176 --1448
NM_000845chr7196 ----1422
NM_000868chrX12166 12015 12496 --
NM_000877chr243074 2414 2335 140 3731 409 274 ----
NM_000901chr442556 2546 2200 490 --12146 --
NM_000935chr31450 ----1207
NM_000945chr21487 1554 --11676
NM_000950chrX73259 2853 2600 2249 1089 1017 770 23469 998 11238 --
NM_000966chr121295 ----154
NM_001001323chr1262906 2258 2020 1973 1230 1149 ----22000 467
NM_001001664chr233589 1582 1176 1189 ----
NM_001001928chr22157906 7896 7511 6192 5900 5083 3065 2650 2157 1939 1665 1421 1036 822 227 48301 8226 5235 2962 16179 32805 2120 1181
NM_001002243chr23799 784 636 --1374 --
NM_001002265chr102765 101 ------
NM_001002269chr9194 --1169 --
NM_001002860chr1463966 1529 1067 1051 699 369 13699 24038 255 --
NM_001003652chr18107983 7105 6956 6488 5559 5506 3056 2337 523 81 17264 11125 18162
NM_001003681chr223241 164 73 ------
NM_001003712chr1293523 3241 3235 2994 2985 1465 1417 1181 917 ----1456
NM_001004051chrX----1217 --
NM_001004360chr2164 ----11532
NM_001005404chr1763387 2827 1187 1164 1011 786 24017 1513 33994 3785 2927 --
NM_001005463chr1042555 1741 899 47 12504 1509 --
NM_001005473chr596594 6164 4784 2532 2429 1769 1211 1149 1095 26263 2159 ----
NM_001006600chr552076 966 552 280 191 ------
NM_001006617chr9----1506 --
NM_001006636chr22271 217 ------
NM_001007024chr1764260 3773 2698 754 502 381 32888 1422 126 2674 404 --
NM_001007226chr172140 123 --1957 --
NM_001007257chr14566 412 283 158 --1594 --
NM_001007559chr1841278 504 365 292 --21828 1662 1303
NM_001008220chr573589 1515 1387 1251 1180 1051 536 --31289 748 517 1493
NM_001008239chr1833091 2548 392 --23303 2784 12938
NM_001008493chr111385 ------
NM_001008707chr1481570 1551 1517 1180 601 563 512 49 ------
NM_001008738chr552827 2787 2734 615 98 1747 22012 1847 --
NM_001009881chr13545 405 191 --1204 --
NM_001009899chr336030 574 329 15138 42185 2016 1911 1372 --
NM_001010861chr182652 2275 2217 2084 2053 1761 624 162 ------
NM_001010862chrX82907 2818 1111 1091 970 889 856 809 32736 1024 613 ----
NM_001010867chr186574 6434 5892 5730 5588 4598 606 38 14545 55360 5182 2025 1041 427 127
NM_001010984chr1102349 2211 1913 1706 1689 851 688 329 146 98 ------
NM_001011666chr776514 6497 5136 1319 1197 1096 117 15782 11550 11375
NM_001011885chr1551277 480 382 117 54 ----11248
NM_001012418chr673561 2817 2676 1429 1313 519 440 1378 ----
NM_001012755chrX54735 3413 1589 509 269 --21392 1226 --
NM_001012761chr532308 2185 778 --1144 11903
NM_001013415chr431481 357 157 ----1142
NM_001013690chr1272508 2220 2195 1895 863 595 232 --22381 2005 --
NM_001014797chr10118240 7124 6442 6423 5171 5099 2021 1991 1312 1198 481 27675 5258 32983 2268 1870 --
NM_001015045chr442568 2450 839 228 --11782 --
NM_001015885chr201248 --1356 --
NM_001017395chr353635 3469 1154 429 327 ------
NM_001017424chr121826 1658 11401 21303 261 --
NM_001018067chr144616 1833 1193 105 1135 14010 13569
NM_001024463chr152773 350 --21007 426 --
NM_001024680chr2--21736 1441 --21398 502
NM_001025068chr331439 1121 556 1107 11847 11501
NM_001025076chr1065751 5736 5059 5018 455 361 24818 275 ----
NM_001025266chr324758 3106 11066 33757 2992 1624 1323
NM_001025580chrX44080 3125 1462 734 --11675 --
NM_001029858chr6103358 3204 2560 2383 2195 886 753 458 179 114 --11236 12655
NM_001029875chr572755 2680 2251 1882 1022 894 200 --1214 --
NM_001030007chr1683562 3044 2895 2629 987 419 337 201 13575 ----
NM_001030055chr1474734 4569 4362 3425 1421 1072 491 --21551 25 --
NM_001031740chr131718 1313 567 11592 1656 1211
NM_001032394chr642694 2438 2092 658 12303 11964 --
NM_001033047chr422109 701 ------
NM_001033057chr31411 ------
NM_001033925chr1022180 137 --11467 1572
NM_001034025chr121905 ----2989 381
NM_001034850chr51621 31415 588 181 ----
NM_001035chr121235 810 1197 1433 --
NM_001037132chr732101 1755 525 ------
NM_001037738chr5------1102
NM_001039538chr2--23324 3013 11126 --
NM_001039577chr1104056 3978 2828 1811 1784 826 672 99 89 74 ------
NM_001039590chrX74001 3926 2548 1548 965 523 33 13017 --13990
NM_001039693chr243619 395 101 93 23159 826 2480 149 --
NM_001040284chr16105486 4916 4265 4066 2008 1045 596 427 228 21 2528 162 ----
NM_001040429chr1353413 2195 1039 716 473 --1370 --
NM_001040624chr852546 2422 1836 838 220 --21980 547 12247
NM_001040633chr72200 185 ----11048
NM_001040665chr744709 4549 1580 486 --34152 3179 1975 14298
NM_001040665chr744709 4549 1580 486 --34152 3179 1975 14298
NM_001042403chr121378 158 --1226
NM_001042510chr8----11967 1472
NM_001042537chrX52297 925 645 606 210 --1162 --
NM_001042555chr1234794 1395 789 1103 13639 --
NM_001042599chr236413 3120 1212 1182 24863 2104 --
NM_001043318chr1463959 1309 1214 908 360 217 24027 375 43648 2823 2649 475 --
NM_001043351chr152333 2184 809 112 47 1204 11605 11836
NM_001068chr33252 232 70 ------
NM_001092chr1782325 2261 2077 2065 627 111 77 67 12087 21995 943 1965
NM_001106chr3159107 8389 8118 7413 5999 5983 5960 3895 3593 3411 3260 812 626 439 28 17486 46951 6144 3273 2877 16474
NM_001121chr1021288 163 --198 --
NM_001151chr4280 27 ------
NM_001204chr2107691 7450 6928 6477 5841 4824 4743 2528 2381 1156 14898 ----
NM_001222chr1061841 1608 1576 1437 1224 243 1634 ----
NM_001233chr752386 2325 1785 751 27 11454 1658 --
NM_001241chr211826 11576 1854 --
NM_001254chr173997 945 828 --2893 402 --
NM_001256chr1721061 196 ------
NM_001259chr745365 4889 2535 134 --31520 1384 1175 --
NM_001310chr1232714 1085 296 1971 ----
NM_001351chr32550 133 1230 ----
NM_001356chrX52143 1759 1656 875 68 12377 1533 --
NM_001364chr1174540 4361 3926 3672 1740 1657 1354 13837 14426 --
NM_001390chr1882993 2685 2591 1293 1210 1097 964 237 ----1360
NM_001396chr2142651 2549 971 157 --22531 1712 --
NM_001412chrX32708 761 41 ----1120
NM_001419chr1964506 3997 3431 1569 1461 321 13242 31819 1371 357 --
NM_001438chr132457 2333 156 --23175 113 --
NM_001448chrX51273 692 686 596 185 --1617 --
NM_001455chr673558 3394 3241 1903 1601 1583 166 13796 ----
NM_001482chr152869 385 ----1984
NM_001543chr5104451 4079 3949 3934 1557 1413 1161 851 507 464 1748 33668 438 403 124
NM_001616chr242825 1253 408 326 12679 ----
NM_001635chr72895 308 --11000 1106
NM_001650chr1862809 2538 723 503 79 52 13965 13587 --
NM_001655chr1151695 1338 222 83 39 --3562 397 243 --
NM_001659chr1222642 2050 11783 1644 --
NM_001663chr1442685 935 891 457 11999 12240 --
NM_001755chr1642118 862 802 585 11519 22251 736 --
NM_001810chr20135 --1612 --
NM_001901chr6134 --1831 1869
NM_001938chr121414 711 ------
NM_001957chr452185 1852 1424 271 155 --11867 --
NM_001967chr32205 131 ------
NM_001991chr1771844 1545 1515 764 616 450 240 11982 2318 274 1522
NM_002015chr1333170 236 159 --2355 40 --
NM_002024chrX52227 2037 382 247 180 --11708 --
NM_002025chrX168895 8492 7633 7063 6873 6708 6293 3175 3100 2466 1801 1748 852 481 347 243 16545 ----
NM_002074chr1131 --11404 --
NM_002076chr1242310 2243 2026 640 1322 11254 22810 441
NM_002114chr61492 ------
NM_002137chr722182 533 11537 ----
NM_002145chr172314 91 ------
NM_002196chr201831 ------
NM_002199chr42987 740 --1648 --
NM_002202chr51673 ------
NM_002203chr523796 356 23740 1664 11423 --
NM_002214chr713509 32261 1776 139 23841 1458 11207
NM_002228chr171160 1003 889 387 380 137 60 1471 ----
NM_002253chr431160 1109 57 1923 1137 --
NM_002264chr3104510 4419 3724 3187 1583 1381 960 552 529 40 12017 24537 3226 --
NM_002268chr361897 1891 1677 705 551 409 ------
NM_002375chr341680 1568 1559 473 ----2112 98
NM_002401chr1772233 1753 1579 823 771 191 96 1357 2973 515 --
NM_002465chr12141 --1279 --
NM_002505chr6----1225 11375
NM_002508chr121959 248 11391 --174
NM_002515chr1421820 1786 --124 --
NM_002519chr1131509 1114 177 ------
NM_002577chr333441 817 773 1223 43498 2697 2530 368 --
NM_002578chrX1161 146 ----
NM_002581chr954733 3960 2115 1700 1243 --11333 --
NM_002595chr1221733 1487 2585 282 1156 --
NM_002655chr855204 5181 4834 1803 992 --24241 1765 --
NM_002687chr1411074 --1136 --
NM_002715chr52841 288 --11142 --
NM_002734chr1732268 725 395 ------
NM_002745chr2234027 1597 29 --24471 1183 --
NM_002748chr1541000 820 337 146 ------
NM_002822chr1231341 1286 398 --1487 1716
NM_002844chr621372 1228 1178 --1252
NM_002855chr1132717 1354 953 11189 11400 --
NM_002869chr1121551 764 ------
NM_002892chr1421599 1479 --1130 11293
NM_002895chr201872 --139 --
NM_002901chr111389 1968 2123 28 1996
NM_002959chr183600 2793 2727 1106 1078 1070 835 478 --44453 4155 3137 469 1882
NM_002971chr31485 --1162 --
NM_002998chr851948 1421 783 623 572 22240 1487 --1353
NM_003016chr171332 11396 11315 --
NM_003070chr9------1233
NM_003107chr652365 1887 1671 957 388 1617 12591 --
NM_003108chr297036 6221 6016 5116 2349 2112 1666 1492 1278 11727 1726 11750
NM_003110chr1711038 --1230 --
NM_003112chr712086 --1332 1188
NM_003113chr22634 97 ------
NM_003118chr54794 671 554 375 --2802 700 11404
NM_003161chr1712854 ------
NM_003173chrX31345 1277 538 21365 367 --126
NM_003185chr2041129 941 452 41 1269 ----
NM_003205chr1552219 1837 1701 289 78 ------
NM_003215chr451571 1183 529 156 28 --11469 --
NM_003246chr152647 186 127 11789 --
NM_003255chr1741959 1003 800 407 11028 22613 1664 --
NM_003272chr12644 487 1162 1565 --
NM_003298chr3155584 5541 5249 5058 4612 4032 2489 2354 2346 1801 1594 1251 1118 774 223 14041 42361 2175 1711 1357 --
NM_003320chr1164369 4344 3637 3226 1627 762 24225 1372 ----
NM_003338chr104577 439 388 180 1568 ----
NM_003348chr12----11603 --
NM_003392chr323569 2875 --1777 13128
NM_003404chr2011327 --1186 --
NM_003409chr1811174 143 11151 --
NM_003411chrY1477 ----1332
NM_003412chr333059 2599 1936 144 ----
NM_003463chr643192 2905 1291 150 ------
NM_003488chr172957 859 --1290 --
NM_003583chr1243876 3738 1506 1001 --2874 320 13075
NM_003590chr263778 1534 441 186 52 34 12516 ----
NM_003620chr1711021 --1436 --
NM_003629chr162804 2574 1297 454 88 59 --11160 --
NM_003677chr1262268 1785 779 354 314 274 12231 1643 --
NM_003692chr94873 643 374 160 --1659 --
NM_003701chr132735 188 --1250 --
NM_003758chr1531253 649 501 ------
NM_003769chr12------178
NM_003772chr112365 92 1428 --1325
NM_003791chr16------1528
NM_003794chr31212 1375 1258 --
NM_003861chr1481128 1094 1076 1058 1041 930 801 694 --11870 --
NM_003870chr1532064 1631 205 1774 12076 --
NM_003873chr1072368 2230 2077 1637 512 187 121 --190 --
NM_003884chr321563 504 --11681 --
NM_003902chr12759 522 ------
NM_003913chr6114196 3420 3305 3056 2738 1236 1204 801 332 225 205 23167 45 ----
NM_003921chr141697 1564 1533 1190 31506 1484 274 11810 --
NM_003941chr731771 1665 725 1297 1653 --
NM_003958chr693900 3428 2415 1522 1463 992 599 243 31 --22966 1108 --
NM_003980chr61514 --1160 --
NM_004052chr10------1215
NM_004093chr1372771 1123 1045 995 690 434 220 --32871 1231 244 --
NM_004094chr1433034 1196 67 1683 1300 --
NM_004100chr652412 1925 1735 1707 949 --2449 151 --
NM_004124chr1432896 2204 330 13063 ----
NM_004161chr241052 1011 135 106 --1273 --
NM_004171chr11119188 8463 7939 7759 7545 6634 3603 3162 3106 1583 1325 39555 7512 7041 11980 --
NM_004232chr1832868 2516 972 151 13703 --
NM_004302chr1252832 2453 2233 825 509 --21085 875 --
NM_004329chr103395 104 32 --1131 --
NM_004349chr81369 ------
NM_004370chr611996 --12147 --
NM_004395chr5----1286 --
NM_004397chr1163873 3685 2957 1479 1184 869 1167 13955 --
NM_004437chr173476 3106 2514 2350 246 98 91 --23090 2944 --
NM_004440chr641981 405 296 146 --2792 36 --
NM_004496chr1421313 168 ------
NM_004504chr262531 2378 2132 2054 1974 832 12624 1949 --
NM_004538chrX3317 200 54 ------
NM_004586chrX64113 3818 1800 1294 1177 733 11663 1623 --
NM_004588chr1142609 878 825 685 23333 1295 2702 491 14016
NM_004642chr121608 1158 ----
NM_004687chr1751922 1886 1867 561 411 ------
NM_004734chr1363032 2269 1135 873 680 81 --12681 --
NM_004735chr241062 391 195 149 21025 321 ----
NM_004737chr221860 --11340 11178
NM_004747chr1041617 1453 1304 54 11527 21569 582 --
NM_004748chr1523547 2930 22776 669 31681 1498 825 --
NM_004781chr131378 372 216 --1437 --
NM_004788chr1152200 2095 702 550 484 12555 11882 --
NM_004798chr2043675 2842 939 915 12987 12617 --
NM_004824chr641171 511 272 129 ------
NM_004830chr6----1123 --
NM_004834chr262818 2178 1189 459 244 219 11138 13328 22767 1064
NM_004849chr611618 1485 --11702
NM_004850chr22249 223 31688 115 64 11159 --
NM_004852chr181613968 12908 12243 10967 5208 4845 4629 4548 3780 3769 3486 2974 2350 1960 1862 1534 313176 5642 1645 214275 3673 212728 9059
NM_004866chr584001 3980 3708 3611 1418 1360 984 897 14280 --11113
NM_004869chr18----11606 --
NM_004929chr831480 537 75 11524 ----
NM_004973chr63697 411 204 11510 ----
NM_004975chr202847 792 ----1942
NM_004985chr1223425 1052 --2863 120 --
NM_005056chr1264064 3458 1165 1044 933 44 13445 --33722 3664 3606
NM_005116chr2031425 931 534 --21699 129 13624
NM_005121chr1762973 2764 2452 1426 1299 1200 ------
NM_005124chr64950 772 246 202 ------
NM_005156chr9104800 4627 3878 3834 2036 1859 1704 927 564 390 24684 66 12055 11801
NM_005171chr121937 --11156 --
NM_005188chr1187707 6424 6200 6179 5248 5059 2695 2509 --17219 --
NM_005201chr341176 1137 316 305 1833 ----
NM_005233chr342008 1814 1754 779 --12629 --
NM_005254chr1531390 490 252 1400 11174 --
NM_005316chr111301 2170 35 ----
NM_005333chrX------173
NM_005339chr453891 3054 1392 1182 991 23672 140 1584 11377
NM_005359chr1866328 6126 4216 2021 1572 1129 --34956 2288 598 --
NM_005387chr11----1212 --
NM_005389chr6----1650 --
NM_005460chr52450 227 ------
NM_005461chr2051824 1743 231 71 43 1476 11955 1295
NM_005491chrX52099 1758 1741 297 283 ------
NM_005499chr191429 --161 --
NM_005502chr943164 870 448 47 ----12330
NM_005563chr13731 118 54 --1143 --
NM_005574chr111758 --1654 1778
NM_005596chr9135940 5328 5285 4841 4623 4536 4199 4118 2312 2293 1915 645 184 25595 5479 16208 --
NM_005602chr321005 99 1935 21334 434 --
NM_005604chr611819 ------
NM_005610chr15735 315 196 85 30 ------
NM_005668chr543470 2912 1710 792 11352 34331 701 322 --
NM_005724chr152731 523 2572 329 ----
NM_005736chr1081404 1116 555 523 476 470 372 256 --21508 1017 --
NM_005739chr15----12376 --
NM_005754chr521059 235 1261 1292 --
NM_005776chr142803 172 ------
NM_005779chr583657 3407 3019 2483 2368 1423 744 259 33431 862 591 1356 11082
NM_005819chr163375 2889 2413 1337 1031 320 --22855 906 23024 2241
NM_005822chr622383 1744 21517 762 1531 11452
NM_005862chr32928 759 1210 ----
NM_005909chr563676 3302 3039 777 735 705 43088 1525 1208 798 ----
NM_005937chr1773891 3572 3451 3347 3105 2770 1464 43391 1360 169 163 23990 2550 --
NM_005941chr833179 630 98 --24036 3213 --
NM_005955chr1125313 5140 4383 4061 3900 3813 3451 1527 1388 1022 952 728 23459 446 34029 2052 649 --
NM_005957chr174920 4166 3126 1886 1874 162 143 34530 1103 1084 24407 3233 --
NM_005964chr172161 69 --1224 --
NM_005966chr281805 921 912 727 500 133 110 41 --12017 --
NM_005967chr122148 38 --1697 --
NM_005977chr1331054 343 106 ------
NM_005986chr1342428 1816 702 212 1227 ----
NM_006011chr1574252 4227 3766 3488 952 659 98 --11178 1260
NM_006022chr131689 1125 --1717
NM_006037chr274912 4180 3712 3678 3571 3323 1760 --21367 1265 --
NM_006047chr2063423 3113 2353 503 426 299 11072 162 --
NM_006106chr1152306 2278 532 357 92 23046 526 ----
NM_006134chr2131357 181 93 1505 ----
NM_006141chr1662688 2682 2481 2311 727 408 --22822 900 --
NM_006195chr921210 564 ------
NM_006206chr462661 2418 2177 1083 390 379 12119 12128 --
NM_006238chr641680 669 468 28 1580 --22065 645
NM_006241chr332072 879 730 5588 451 435 163 154 ----
NM_006252chr1137491 7332 6927 5512 5132 5078 4861 2343 1968 1759 1530 1474 580 15041 35588 5565 5012 15247
NM_006298chr672992 2621 2540 2461 2366 1327 336 ------
NM_006320chr41742 1808 164 --
NM_006329chr141253 ------
NM_006352chr151875 1670 1429 1404 1365 21968 1341 --11357
NM_006366chr63882 855 317 ------
NM_006378chr921067 580 --4908 447 420 393 --
NM_006390chr1221289 302 1268 --11863
NM_006421chr821084 495 1340 1911 --
NM_006449chr252109 1651 1455 879 426 --11859 --
NM_006469chr1131 --1589 11552
NM_006527chr44740 699 584 56 ------
NM_006540chr821426 1150 ----1315
NM_006547chr731800 1615 383 --153 --
NM_006570chr9----1326 --
NM_006624chr1011918 ------
NM_006699chr12317 137 --1594 --
NM_006717chr932993 2909 2867 --12591 1159
NM_006729chrX105510 5484 5246 4970 4323 4038 3869 3661 2203 955 --45212 4157 3989 3857 --
NM_006852chr172807 327 --22850 386 --
NM_006885chr1653024 1234 1011 864 75 ------
NM_006902chr152067 972 872 783 439 1106 --22547 2253
NM_006902chr152067 972 872 783 439 1106 --22547 2253
NM_006915chrX21583 886 --11920 --
NM_006920chr221837 1584 --21352 269 --
NM_006941chr222469 182 3121 112 103 1212 1941
NM_006947chr431163 704 207 2417 218 124 --
NM_006948chr212102 62 --12424 1178
NM_007005chr931568 1552 1370 1459 21111 22 --
NM_007008chr21962 1791 --1756
NM_007011chr15106485 5725 4826 4575 2496 2384 1336 1017 487 178 65561 5110 2755 2117 1817 659 21945 1589 16530
NM_007038chr2175701 5574 5404 5165 4704 3892 1207 45597 2360 1917 1844 ----
NM_007050chr20147108 6819 5988 5721 5353 5185 2622 2469 2245 1855 1743 212 127 38 37708 5844 438 17213 17129
NM_007106chr1332377 2155 373 22087 1097 ----
NM_007114chr312295 --22767 2112 13277
NM_007129chr133991 800 361 ------
NM_007146chr1732889 2182 1124 --12680 1432
NM_007150chrX51944 1799 1387 396 255 --1308 122
NM_007174chr1242316 2057 1866 862 --11686 --
NM_007204chr11629 --2223 157 --
NM_007212chr12186 127 127 11425 --
NM_007350chr1264162 4150 3871 3314 3283 1220 --1947 14356
NM_007353chr742465 727 441 58 12832 12816 --
NM_007358chr141350 734 553 478 ------
NM_007373chr1031578 102 40 ------
NM_012082chr8----1993 --
NM_012084chrX----1485 --
NM_012096chr353464 2698 2413 2291 356 31149 664 149 33265 2961 251 1981
NM_012104chr1173562 2585 1347 526 494 180 158 1557 23773 1479 --
NM_012207chr10265 53 --1146 --
NM_012234chr342660 2511 2419 748 ------
NM_012238chr1031683 1618 138 ------
NM_012249chr283601 3588 2643 2573 2171 1132 813 795 ------
NM_012309chr1184968 4494 4445 4218 3592 3328 1485 590 --128 --
NM_012316chr1115342 5239 5167 3764 3757 3696 3474 3417 668 597 126 45114 4971 4791 3972 14326 24432 3841
NM_012325chr2031563 1476 1340 2346 246 11073 --
NM_012388chr1583064 2747 2668 2383 2268 2133 2100 639 52710 2392 1161 1058 68 ----
NM_012463chr1271770 1246 1188 537 75 58 32 --21295 704 --
NM_013396chr2131485 515 146 --1158 --
NM_013411chr1102740 2642 2516 2157 2016 1944 1088 771 310 23 32211 2041 595 ----
NM_013436chr23807 631 60 ------
NM_013438chr931658 504 274 ------
NM_013444chrX------1906
NM_013446chr7----1295 --
NM_014011chr252218 1048 633 602 474 11775 ----
NM_014112chr865160 1431 1124 550 392 303 25084 1335 --11076
NM_014117chr1662713 2612 2525 2401 790 519 ------
NM_014141chr754863 4641 4498 1985 1399 24360 160 13862 25344 3347
NM_014181chr242502 2480 2022 1800 --1510 --
NM_014191chr124304 210 202 54 ------
NM_014299chr1972199 1868 1590 1357 240 199 45 --1774 --
NM_014331chr486424 2683 2392 2304 2240 1614 1577 1097 42038 1524 1391 344 15899 --
NM_014421chr42743 387 11717 2352 33 --
NM_014423chr554053 3696 2183 1063 996 21919 262 21895 333 --
NM_014517chr331898 1846 704 21313 65 1580 --
NM_014521chr231872 184 112 11334 1348 11551
NM_014554chr1242228 2024 1965 249 1324 ----
NM_014585chr221149 335 ------
NM_014666chr52310 138 ----124
NM_014700chr1641625 1453 1173 597 11354 ----
NM_014702chr643406 2574 2154 797 ------
NM_014729chr821684 242 --1830 --
NM_014730chr1274365 4244 2097 2006 1883 1250 649 23978 1368 ----
NM_014746chr284182 3678 3321 2785 1028 992 384 298 12985 1132 --
NM_014761chr162418 164 2215 59 ----
NM_014802chr123889 322 79 ------
NM_014810chr192737 2730 2443 2306 1324 700 580 573 312 ------
NM_014819chr542086 1755 1602 378 ------
NM_014824chr117735 719 611 556 493 149 44 ----1523
NM_014892chr62445 245 ------
NM_014903chr1231785 1678 836 --1287 --
NM_014906chr1763911 1639 1305 1097 646 586 11052 21625 1169 13807
NM_014912chr1063029 2491 825 737 328 301 ------
NM_014935chr133333 2587 1270 1587 52974 2881 902 853 150 --
NM_014946chr232591 806 159 ------
NM_014962chr2021131 661 --12096 --
NM_014989chr611627 ----11884
NM_015000chr1272603 2576 2493 2309 1927 875 56 22387 2051 ----
NM_015001chr14891 793 161 104 --1398 --
NM_015002chr1231995 604 457 ------
NM_015020chr1663482 3342 1376 1124 745 33 33604 1280 684 42722 1047 317 150 11336
NM_015027chr167606 593 567 478 471 413 24 --1732 --
NM_015042chr1563755 3061 3030 1559 478 177 11540 148 --
NM_015045chr1041931 1735 1582 468 12036 21455 230 --
NM_015054chr12----1368 --
NM_015057chr131455 ------
NM_015074chr174622 4074 4058 3434 3257 1653 1546 14021 14859 --
NM_015092chr16104663 4283 4152 3459 3179 1784 1747 1445 465 259 31694 1142 565 ----
NM_015138chr1522034 690 --32061 868 398 --
NM_015141chr332745 1706 316 ------
NM_015144chr16114034 3106 2509 1610 1452 1299 1102 1065 404 189 129 13178 ----
NM_015191chr1162726 2470 2227 1792 1692 822 32009 1888 228 --12081
NM_015192chr2052562 2426 279 172 53 1950 12086 --
NM_015199chr321925 890 --22301 790 --
NM_015245chr682304 2241 2096 1980 1715 607 499 226 22679 2514 11081 12768
NM_015267chr1231964 1952 1739 32155 1475 519 11671 --
NM_015310chr867977 7441 7178 5839 3339 846 2727 716 35716 2438 161 11930
NM_015313chr1133851 1726 596 ----1945
NM_015317chr222326 483 --1229 --
NM_015347chr1232625 2383 92 --22789 2338 --
NM_015349chr631948 785 391 ----12807
NM_015397chr93709 677 388 --21760 1214 1315
NM_015455chr532512 600 414 1810 13619 --
NM_015554chr1572798 2644 1840 814 627 410 54 --1471 --
NM_015564chr553312 2750 1348 1104 528 ----12171
NM_015565chr2141727 1614 327 179 11879 ----
NM_015569chr143009 2962 982 510 1824 13439 --
NM_015635chr93591 557 91 2817 85 21548 32 --
NM_015691chrX42813 1954 296 63 1406 22567 2050 12217
NM_015878chr851999 759 641 579 209 ------
NM_015879chr18186568 6064 5767 5710 5554 5407 5312 2782 2659 2555 2439 2085 1943 1563 929 411 205 167 28436 1990 --28339 7589
NM_015962chr1431475 1437 154 31384 171 104 1687 --
NM_016009chr174731 4549 3588 3051 1796 943 829 33535 3400 107 ----
NM_016075chr1342606 2253 1273 995 ------
NM_016133chr21390 --183 21448 1402
NM_016173chr374479 4393 3893 3094 1495 986 841 13927 34288 3744 969 --
NM_016289chr242057 1730 328 238 ------
NM_016322chr962596 2380 1136 1078 926 232 --32441 2024 1040 --
NM_016334chr11419 1399 121 --
NM_016396chr1552865 1898 876 850 751 ------
NM_016441chr22942 424 12041 ----
NM_016486chr1----1347 --
NM_016531chr443114 1468 558 494 24002 3529 1384 --
NM_016605chr572291 1958 962 817 610 173 77 --22526 809 136
NM_016620chr131252 499 307 ------
NM_017423chr452111 2021 730 394 198 157 ----
NM_017544chrX3378 234 42 1821 ----
NM_017548chr382122 2059 2022 1558 587 572 342 38 ------
NM_017580chr1022116 754 --2968 878 --
NM_017599chr12266 33 ------
NM_017610chr1562045 1717 832 816 694 92 11937 11388 --
NM_017628chr484352 4290 4018 1937 1727 1508 1446 1195 25082 820 24264 4204 --
NM_017629chr141884 644 588 472 2261 234 ----
NM_017633chr653817 2611 2392 896 774 11094 23897 2748 --
NM_017635chr1111261 --1572 --
NM_017637chr9108115 7323 7249 6974 6794 6356 5987 2919 2722 517 26768 2555 11813 --
NM_017640chr61711 --2892 339 --
NM_017644chr344846 4651 4026 1612 13374 43709 1332 908 497 --
NM_017658chr1433812 1854 1647 1271 ----
NM_017672chr151356 --11019 --
NM_017712chr1996192 5135 4489 2291 1467 1132 986 643 396 44758 4452 4312 933 34831 1974 1808 14632
NM_017742chr1821273 208 --21946 1472 --
NM_017770chr632948 572 368 21949 66 22002 43 1257
NM_017798chr2011163 ----1240
NM_017848chrX94465 4107 3290 2988 1608 1508 833 698 176 ------
NM_017919chr975154 4714 1791 1745 1094 256 242 1192 ----
NM_017944chr1132069 1969 127 22394 1942 1661 11134
NM_017952chr293932 3624 3406 3167 1469 1190 904 534 111 13287 11800 14157
NM_017994chr742970 2539 2063 649 32428 2007 33 12662 --
NM_018025chr19------1219
NM_018027chr1032863 2841 2067 12659 --12319
NM_018028chr192356 248 --31178 1106 257 --
NM_018061chr151314 1096 631 114 75 --1217 --
NM_018184chr352083 1787 1485 1405 342 ------
NM_018247chr632730 2707 858 --1920 --
NM_018362chr1143650 1230 800 259 11252 23207 2713 --
NM_018364chr163907 1263 1053 877 303 163 ------
NM_018374chr794903 4808 4644 4469 4395 4071 4022 856 791 13258 13502 --
NM_018375chr1421439 450 --11951 --
NM_018440chr878572 7623 7169 834 460 187 181 26320 6182 15745 --
NM_018448chr122927 133 ------
NM_018464chr10----1355 --
NM_018471chr22466 417 ------
NM_018482chr841944 768 46 23 ------
NM_018638chr1264718 3648 3444 2283 2062 1675 21048 163 ----
NM_018698chrX21940 478 1780 ----
NM_018898chr52560 469 1380 --1364
NM_018947chr7144783 4041 4017 3835 3553 3113 1854 1805 1531 1028 1006 317 253 152 34309 3500 1328 23923 1965 11083
NM_018948chr12953 94 1404 ----
NM_018999chr1084395 4372 3982 3816 3689 1573 539 280 11683 11947 11352
NM_019004chr71760 --11514 --
NM_019012chr121322 --1563 --
NM_019074chr15----2209 147 --
NM_019084chr1031838 1029 298 21593 138 22503 32 --
NM_019094chr1262945 2533 990 851 504 339 1984 33703 1444 1279 --
NM_019114chr911003 ------
NM_019116chr1663290 2903 1439 1382 529 424 33511 3261 31 13523 --
NM_019593chr2083124 2325 1184 1104 877 845 779 553 --32319 2258 1136 --
NM_019605chr11279 --1148 --
NM_019885chr21519 1984 11809 12511
NM_020122chr2135956 5892 5628 5264 4928 4074 3956 1833 1684 1483 1352 1233 1007 45670 5413 4876 3670 ----
NM_020148chr1832870 1145 123 ----1153
NM_020159chr411632 11416 --11463
NM_020205chr153232 2598 2238 919 708 32174 2148 1236 1162 --
NM_020363chrY31651 645 221 1325 ----
NM_020390chr374392 4368 4205 3033 1680 1130 409 1939 2962 128 --
NM_020429chr762715 2599 2513 487 480 363 --13091 --
NM_020432chr7--11990 1129 --
NM_020440chr11553 33021 2190 1123 12975 --
NM_020474chr183469 217 146 1242 ----
NM_020640chr341715 1616 1404 657 22248 86 --21915 117
NM_020699chr1105347 5092 4918 4258 3744 1794 1435 1190 1100 1034 14279 21490 511 --
NM_020748chr1742018 1967 1322 321 --11389 --
NM_020752chr102354 192 12742 22526 559 12448
NM_020771chr651266 1113 461 286 254 1563 ----
NM_020772chr1798607 6141 2768 2281 1518 1368 920 326 198 13098 ----
NM_020781chr732896 711 582 ----11130
NM_020796chr532863 901 535 12205 21847 434 --
NM_020805chr1841772 494 316 218 --1234 --
NM_020809chr1112076 22123 327 ----
NM_020818chr141290 ------
NM_020850chr1663048 2905 2003 1202 528 89 --23083 1005 12212
NM_020858chr1521978 348 --12256 --
NM_020899chr1782481 2453 2228 2149 1658 948 859 782 11969 1147 --
NM_020918chr1043274 2414 600 248 2553 295 2996 938 --
NM_020926chrX2258 84 ------
NM_021005chr154333 173 145 53 ------
NM_021020chr893277 3082 3000 2970 2759 2474 2316 1242 899 --23376 2361 --
NM_021021chr82695 150 11030 ----
NM_021038chr341288 675 546 353 ----12561
NM_021132chr1031114 310 191 ------
NM_021202chr2043058 2983 2940 652 22827 1108 --1814
NM_021255chr1433007 1385 1315 --13921 --
NM_021620chr61135 --1768 --
NM_021635chr631947 1285 1248 11895 1557 --
NM_021643chr211586 ----1507
NM_021785chrX----1226 --
NM_021813chr6125666 5541 4938 4346 4250 3842 1605 1401 1152 704 420 280 ----24589 1522
NM_021814chr641211 621 225 167 ------
NM_021943chr651850 864 583 513 504 --1104 --
NM_021964chr3116205 5903 2354 2296 1978 1727 1318 1112 1100 91 45 ----12607
NM_021999chr133830 785 653 ------
NM_022048chr1564478 2225 1545 1510 431 317 --24293 1110 --
NM_022063chr1041789 1476 402 32 11160 1580 --
NM_022336chr241912 1496 864 83 --1926 --
NM_022374chr22476 110 ----1489
NM_022458chr792920 2570 2510 2187 2060 939 596 223 50 12145 13104 --
NM_022459chr1396212 5525 4895 4397 2216 1738 1307 1170 451 36183 4951 4760 12248 25718 5669
NM_022462chr1993743 3218 3056 2918 2752 2651 2560 2423 1352 --43641 2827 927 763 --
NM_022475chr42614 73 ------
NM_022497chr383731 2955 2699 2608 1233 1177 963 53 43335 2571 1399 1008 ----
NM_022781chr952986 2542 2481 1213 58 --13069 --
NM_022831chr131560 1538 342 --1653 --
NM_022832chr452219 1995 259 138 72 --1217 --
NM_022841chr1572662 2419 2054 1896 366 194 155 ------
NM_022894chr2----1588 --
NM_022898chr141797 24316 1490 14063 --
NM_023037chr1331153 349 209 --1102 --
NM_024337chr5----2297 92 --
NM_024345chr986076 6051 5290 5033 1773 1268 909 191 21720 1187 14945 --
NM_024529chr1------187
NM_024545chr2122 ------
NM_024567chr82615 57 ------
NM_024674chr162927 1198 1094 1044 385 117 33084 2610 2476 22294 2133 --
NM_024700chr1----1151 --
NM_024713chr1541535 1395 413 245 1477 11122 --
NM_024742chr1661819 1755 1691 1395 448 69 11772 199 1685
NM_024761chr944799 3349 2005 710 23252 355 15030 --
NM_024769chr112982 138 ------
NM_024854chr1221033 338 --11493 --
NM_024949chr484929 4717 3655 3449 1721 1017 397 146 162 23933 3139 --
NM_024969chr23616 353 340 1916 2212 128 --
NM_025010chr382635 2243 2073 1120 508 405 276 182 11736 ----
NM_025047chr3----1367 --
NM_025054chr864087 3332 1438 1122 604 372 24063 627 1188 --
NM_025074chr452879 1031 468 332 257 22346 679 --12993
NM_025133chr221073 103 ----1468
NM_025135chr18----1431 1365
NM_025138chr1331392 1044 387 ------
NM_025205chr42269 248 ------
NM_025224chr2032230 1668 1451 ----11955
NM_030621chr1473312 3104 2709 1335 1045 991 577 13496 ----
NM_030627chr533737 2942 2862 2640 603 13011 --
NM_030647chr745858 3846 1047 345 25417 2289 ----
NM_030648chr4105574 4570 4486 3399 1840 1706 1400 960 178 87 33795 1158 312 11632 --
NM_030665chr1751355 1300 299 267 172 ------
NM_030786chr12641 590 ------
NM_030797chr2------175
NM_030918chr144778 4738 4174 128 24507 576 32038 1868 1578 1671
NM_030934chr111530 ------
NM_030938chr171427 --1261 --
NM_031216chr1822222 470 1447 12145 --
NM_031417chr1992736 2007 1926 1858 699 674 657 409 183 --1751 --
NM_031442chrX31174 956 674 --12880 --
NM_031469chr683212 3077 2911 2658 1602 1517 736 560 23237 1544 33796 3325 2878 --
NM_032102chr1142845 2659 530 96 12195 1319 --
NM_032144chr241408 1118 616 390 --11164 --
NM_032160chr1831491 912 144 1904 43820 3654 1278 1048 14308
NM_032208chr243616 2547 1036 217 ------
NM_032236chr121102 195 --1176 1842
NM_032239chr41913 ------
NM_032299chr111262 1197 ----
NM_032373chr1063751 3643 2344 1794 316 104 25045 1623 163 24769 667
NM_032410chr8----11153 --
NM_032439chr1021506 308 ------
NM_032440chr1052703 2679 1967 955 116 12584 12576 --
NM_032446chr521480 567 1151 2859 160 --
NM_032449chr122352 948 32658 2362 268 21832 494 12323
NM_032457chr443656 1535 1219 558 11427 ----
NM_032574chr2----1228 --
NM_032632chr1421762 1403 11744 11915 --
NM_032682chr352908 2811 2218 326 35 11145 --11379
NM_032804chr1052262 797 777 763 200 ------
NM_032842chr761403 1305 1201 473 119 32 --2590 424 --
NM_032900chr1073640 3249 2737 2385 1050 568 314 --12661 --
NM_032932chr17136423 6354 6280 5612 5101 5013 4800 4041 2086 2054 1952 1037 154 24864 4742 36410 5369 2584 --
NM_032983chr74940 578 529 260 1432 32963 2453 197 --
NM_033132chr1332247 1677 103 --11902 --
NM_033133chr1782407 2320 1451 1441 1320 835 655 254 11224 33541 2988 2481 --
NM_033211chr521876 1578 ----1547
NM_033224chr7118034 7849 7255 6033 5597 5398 3035 2962 2952 2020 1976 37278 5254 5133 57919 6804 6633 6343 872 --
NM_033225chr842727 826 308 269 124 ----
NM_033226chr161492 1510 ----
NM_033280chr18------130
NM_033285chr874155 3979 3401 985 578 221 155 14140 13103 14358
NM_033389chr1794856 3378 3184 1943 1812 1765 1710 750 367 31564 1476 189 11867 14878
NM_033505chr295380 5351 5245 5229 4587 4509 2631 2397 1926 25192 79 36609 4675 1320 --
NM_033512chr832765 2569 967 --1214 1896
NM_033656chr21124904 4657 4518 4446 4301 4270 4058 3853 2208 2104 429 40 25109 1834 21565 1455 11804
NM_052898chr811775 ----11648
NM_052906chr2274511 4100 2017 1531 960 470 89 1409 33802 3659 1329 --
NM_052954chr2132289 2130 566 11602 ----
NM_054111chr64900 712 656 143 ------
NM_080626chr12------1365
NM_080723chr621351 497 11358 ----
NM_080738chr142014 1701 1556 351 21645 787 ----
NM_080872chr883057 2499 1415 1400 1135 1003 403 250 21309 332 13067 --
NM_101395chr2153319 3217 2208 825 513 12158 23199 2380 --
NM_133334chr476333 6201 5654 4762 2211 1183 873 25931 2312 24084 3911 15750
NM_133477chr473237 2545 2275 2227 1251 1171 1057 --1743 --
NM_138340chr181195 1544 ----
NM_138426chr751857 892 855 291 261 12148 ----
NM_138459chr643189 1442 1328 778 ------
NM_138473chr1244438 3963 1481 405 24705 1529 --1851
NM_138731chr1442723 1314 674 214 11228 151 --
NM_139201chr121174 --141 --
NM_144571chr476922 6555 6500 5536 4920 1974 1705 ------
NM_144578chr1465169 4924 4421 4084 3789 1404 13546 11756 --
NM_144579chr272809 2629 1148 949 906 429 66 1155 32480 870 464 --
NM_144582chr292554 2439 1713 1701 777 611 547 449 191 ------
NM_144726chr52983 321 21218 341 ----
NM_144778chr1332305 2177 821 2843 691 ----
NM_145053chr11------137
NM_145203chr132613 355 ------
NM_145206chr1062542 2413 2357 2202 1224 216 12818 22741 1057 --
NM_145296chr19----1801 --
NM_147156chr101404 ------
NM_147202chr982292 1912 1831 1706 996 874 825 313 ----1680
NM_152271chr8----160 --
NM_152275chr22900 460 --12189 12329
NM_152345chr1731029 790 103 1897 --11144
NM_152450chr153835 447 331 ------
NM_152520chr231118 383 184 1165 ----
NM_152522chr21197 190 ----
NM_152527chr222086 1713 11888 ----
NM_152545chr44547 526 200 194 1212 ----
NM_152588chr124709 306 232 99 ------
NM_152641chr1242718 2058 1856 721 ------
NM_152688chr61352 ----1211
NM_152758chr842042 795 441 47 1293 --12030
NM_152774chr711014 --1231 1675
NM_152787chrX43581 2512 2436 405 13712 ----
NM_153029chr1674071 3670 3473 3170 3052 777 205 22852 1330 11260 12970
NM_153207chr1231276 1104 182 1251 13334 --
NM_153332chr822933 158 1793 ----
NM_153453chr64426 394 257 114 1204 ----
NM_153456chr1356236 5655 4699 2379 1221 15161 25314 2495 35895 5747 1497
NM_153487chr674372 3259 1769 1533 1432 652 484 31200 750 72 33707 3405 3030 --
NM_153810chr10134669 4514 3705 3682 3423 3309 1800 1682 1558 1316 249 198 60 ------
NM_172375chr142450 241 ------
NM_173083chr12835 141 ------
NM_173468chr456000 4520 4265 1124 394 25061 4799 13677 --
NM_173478chr172333 226 ------
NM_173491chr541416 1153 293 134 --11169 --
NM_173552chr3----1407 --
NM_173808chr164072 3602 3236 755 483 378 --1329 --
NM_173822chr241811 1473 548 109 2324 295 ----
NM_174916chr1551885 1805 1577 899 776 21877 52 ----
NM_175733chr1142138 688 526 255 --31847 568 155 --
NM_175736chr12147740 7497 7095 5524 5174 4768 2984 2927 2173 1538 1426 851 532 133 16625 11305 --
NM_175767chr541762 1613 1483 1470 --21655 336 --
NM_176812chr201645 --134 --
NM_176815chr3102888 2762 2588 2158 1081 1039 996 513 495 288 1523 ----
NM_177999chr983502 3441 3096 2857 1082 763 576 282 22965 2311 22342 235 1513
NM_178812chr831486 1441 367 --1302 --
NM_178815chr1072684 2128 2012 1078 632 429 22 ------
NM_178835chr44853 700 582 31 --1781 1835
NM_180989chr1332333 2058 858 1158 ----
NM_181784chr242335 739 264 173 1716 ----
NM_182487chr974320 4201 3174 3081 1562 289 117 13534 42802 1242 1108 340 --
NM_182503chr694412 4339 3998 2027 1803 1557 420 402 366 25358 60 22086 1236 --
NM_182528chr23556 524 432 ------
NM_182734chr2062809 2673 526 419 300 67 11197 12333 --
NM_182765chr1021770 698 --1358 --
NM_182920chr31205 --1510 --
NM_194285chr1143198 3162 2271 705 12885 22958 142 21213 67
NM_194314chr183959 3845 2006 1910 1328 1065 998 24 1640 ----
NM_197941chr542629 2585 1014 741 --1230 --
NM_198081chr621842 93 --32967 747 610 --
NM_198404chr133796 605 200 1253 1301 1859
NM_198465chrX72941 2073 1011 926 492 302 64 2850 761 ----
NM_198511chrX31616 498 335 ----31443 1132 151
NM_198513chr83583 193 168 21707 406 ----
NM_198560chr3103593 3408 2852 2525 1015 887 673 287 139 105 ------
NM_198581chr2107143 6711 6342 6004 4956 4710 4649 2775 1219 197 12398 46469 5510 4883 958 36621 5183 5049
NM_198844chr172899 890 ------
NM_198859chr375079 1793 1431 1392 1286 241 225 ------
NM_199320chr482104 1817 905 718 702 441 216 130 11144 ----
NM_203390chr811674 --1525 --
NM_203451chr1321505 247 --12350 --
NM_205848chr172433 2367 2293 1939 1018 539 35 11965 ----
NM_207306chr164290 3904 1690 1500 549 381 13879 32956 2790 1625 --
NM_207577chr1142190 1031 1022 749 12583 12765 1185
NM_212559chrX2884 558 ------