TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-624-3p
miRNA Sequence: CACAAGGUAUUGGUAUUACCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr521186 26 ------
NM_000038chr551816 1409 1326 429 118 --1163 11983
NM_000046chr562885 1919 1077 742 252 68 11994 ----
NM_000051chr11103388 2957 2757 2567 2321 2296 1237 1078 772 264 --13240 --
NM_000052chrX83080 2539 2348 1337 1253 1068 1031 571 12370 ----
NM_000074chrX1645 --1938 --
NM_000081chr131699 1546 677 ------
NM_000084chrX116080 5387 4405 2685 2667 2353 2000 1894 782 726 533 36291 2550 1050 35950 5843 5484 12446
NM_000088chr171128 ------
NM_000089chr71728 1264 ----
NM_000090chr22629 59 --170 1903
NM_000091chr222586 1033 11057 ----
NM_000109chrX31946 500 317 ------
NM_000111chr71126 ------
NM_000117chrX1211 --2288 249 --
NM_000125chr674226 4189 4080 3618 3274 3171 2593 32607 491 222 ----
NM_000138chr1572594 2519 2319 2191 1958 931 370 22415 140 22444 225 --
NM_000139chr113340 214 60 ------
NM_000158chr33590 449 52 --1606 --
NM_000161chr1482008 1867 1401 1363 720 481 119 71 --22002 1811 --
NM_000163chr552283 2093 1911 1568 905 ------
NM_000165chr621373 505 ------
NM_000167chrX21861 100 --21668 1429 1716
NM_000168chr753055 2609 2284 2233 2075 23375 2991 32890 2035 67 --
NM_000176chr543255 2981 2545 750 --13805 --
NM_000188chr103705 640 225 ----1737
NM_000189chr252245 915 839 354 76 ------
NM_000210chr241868 1723 951 134 ------
NM_000212chr1742110 2016 435 261 --12468 --
NM_000214chr2031760 1750 522 --11383 31417 1140 586
NM_000216chrX63113 1581 1340 947 695 466 11093 1583 14004
NM_000217chr1295180 4947 4635 4584 3890 3755 2094 2013 1141 34908 3253 95 ----
NM_000232chr452533 2309 1168 345 36 ------
NM_000237chr81145 --11671 --
NM_000245chr7----32261 1398 37 --
NM_000248chr362698 2454 2366 2309 678 517 11048 --12333
NM_000252chrX--11275 ----
NM_000259chr15106038 6011 4959 4941 1389 1316 1079 998 695 164 ------
NM_000262chr2271531 1455 1184 477 433 316 59 11253 ----
NM_000264chr983071 2991 2889 2730 2293 1004 671 603 --13081 --
NM_000266chrX1374 ------
NM_000267chr1753462 3322 3309 1323 166 --23334 2353 --
NM_000277chr121694 ------
NM_000280chr11--2990 183 ----
NM_000289chr122311 121 ------
NM_000291chrX1334 ------
NM_000297chr41112 ------
NM_000314chr1053301 3117 2339 2157 385 12683 22076 143 --
NM_000321chr1331440 381 344 --31401 1316 214 --
NM_000332chr665584 5114 2854 1525 1399 1157 15029 45227 5043 2530 128 --
NM_000337chr596089 4928 4819 4519 1940 1472 1351 697 604 1477 31454 1086 109 --
NM_000346chr1731384 694 253 11330 --1378
NM_000354chrX1248 ------
NM_000361chr2051493 494 429 398 327 ------
NM_000362chr2252751 2401 2317 1374 1251 23592 779 12505 --
NM_000369chr1451833 1811 1564 582 109 ------
NM_000378chr1111254 --2502 431 --
NM_000389chr631155 514 475 ------
NM_000390chrX93207 3196 3129 2703 2188 1278 350 341 32 --12079 --
NM_000393chr231505 1394 66 11351 11643 --
NM_000396chr12171 69 ------
NM_000399chr1041015 865 108 52 11043 ----
NM_000406chr453043 2677 2063 1976 1041 12618 12929 12243
NM_000408chr233279 3181 2719 11338 ----
NM_000428chr1482508 2343 2300 2266 955 265 123 61 ------
NM_000430chr1743570 2870 2645 2556 1714 ----
NM_000437chr162098 1421 721 232 185 156 ------
NM_000439chr53599 424 115 ------
NM_000441chr731988 1670 495 ------
NM_000447chr15524 452 415 400 186 ------
NM_000449chr121348 45 1573 21313 1152 --
NM_000461chr343299 3042 1067 88 ------
NM_000474chr7--1667 ----
NM_000480chr111465 --11428 --
NM_000486chr1293078 2866 2485 2458 1002 985 655 632 366 --13064 --
NM_000489chrX33149 2890 2408 ------
NM_000495chrX--1453 1844 --
NM_000503chr851805 1449 1292 637 149 1421 ----
NM_000508chr42870 298 1130 ----
NM_000522chr71869 ----21178 309
NM_000523chr21834 ----1185
NM_000525chr11--1632 ----
NM_000527chr1951636 713 467 107 58 ----12172
NM_000530chr12860 689 ------
NM_000533chrX21518 1340 --11787 --
NM_000555chrX85712 5503 5293 4971 4831 4822 2938 860 26966 1539 26192 5923 15412
NM_000575chr23980 924 864 2145 116 ----
NM_000583chr4125 ------
NM_000598chr731513 1116 240 11537 1345 --
NM_000599chr234598 3116 1007 13823 ----
NM_000602chr721375 162 1441 1972 --
NM_000610chr1142921 2889 2838 1923 --1634 --
NM_000611chr11137005 6838 5580 5353 2818 2752 1908 1460 1166 873 731 639 164 25941 1004 11768 --
NM_000615chr1183000 2948 2906 1924 1181 1104 750 218 --22248 713 22201 533
NM_000618chr12106357 4399 2645 1720 1495 1242 698 359 188 78 --35524 475 390 16050
NM_000618chr12106357 4399 2645 1720 1495 1242 698 359 188 78 --35524 475 390 16050
NM_000621chr1331324 1212 333 ------
NM_000633chr1885230 4503 3437 2010 1751 1687 1399 1359 --45186 4155 2089 1493 --
NM_000635chr193531 311 117 ------
NM_000663chr1632510 302 258 22476 1144 12994 --
NM_000683chr4--1525 ----
NM_000693chr1541542 1398 609 537 ------
NM_000701chr1168 ------
NM_000719chr1235030 4550 2257 34981 1689 889 11891 15297
NM_000721chr112287 12222 ----
NM_000724chr1051621 1404 1300 1229 375 2114 46 ----
NM_000726chr211159 ------
NM_000788chr421407 51 ------
NM_000793chr1485145 4935 4074 3509 1387 1263 1120 400 15130 --13221
NM_000801chr201711 ----1121
NM_000809chr4119077 8453 8372 6261 3464 3305 3066 2928 1995 1615 956 26840 3443 12064 12967
NM_000813chr572179 2031 2003 1849 1738 531 194 ----15367
NM_000814chr1563826 3768 3587 3402 3363 362 1408 13069 --
NM_000816chr51187 ------
NM_000818chr10----1122 --
NM_000826chr461658 1635 997 300 251 211 1417 --1744
NM_000829chr1141563 736 557 366 --12277 --
NM_000831chr186097 5388 3808 1959 1315 1108 1008 888 ------
NM_000838chr652769 2686 2246 1969 825 12722 ----
NM_000844chr331114 1002 406 ------
NM_000845chr7--3405 327 127 ----
NM_000859chr521661 94 11435 ----
NM_000861chr352430 2187 1995 520 202 1248 ----
NM_000864chr13764 109 23 ------
NM_000866chr331882 571 467 --11643 --
NM_000868chrX52530 2230 1798 1035 551 ----1140
NM_000875chr15106760 6682 6286 5949 5095 4830 2196 1678 1298 1117 11374 ----
NM_000876chr62486 396 --1233 --
NM_000891chr175827 809 787 595 289 --13226 --
NM_000899chr1273798 3276 3249 2833 2822 1452 703 ------
NM_000901chr482426 2318 2299 2117 1772 869 640 25 --11955 --
NM_000903chr1641291 1184 1148 572 ------
NM_000905chr71128 ------
NM_000909chr43371 129 68 ----11191
NM_000912chr843540 2610 2481 596 ----13493
NM_000917chr101780 --1162 --
NM_000919chr5----1433 --
NM_000926chr11139456 9065 8795 8015 7932 7823 7575 6417 5803 2244 2237 1532 402 57262 6679 6100 3125 2941 11448 --
NM_000933chr2021690 319 ------
NM_000935chr36968 946 812 439 253 126 ------
NM_000944chr421711 511 --22056 389 --
NM_000945chr241879 1654 1609 736 11370 --1789
NM_000965chr3----11068 1332
NM_000990chr1163706 3531 3142 1487 740 47 --11424 --
NM_001001323chr1272938 2919 2734 2357 2316 963 382 12848 1904 --
NM_001001330chr101355 ------
NM_001001331chr342483 2263 741 359 1620 11671 --
NM_001001344chrX62363 2307 2109 2060 1926 1733 ------
NM_001001389chr1142921 2889 2838 1923 --1634 --
NM_001001390chr1142921 2889 2838 1923 --1634 --
NM_001001391chr1142921 2889 2838 1923 --1634 --
NM_001001392chr1152967 2935 2884 1969 65 --1680 --
NM_001001394chr21569 ------
NM_001001395chr1242770 2564 802 619 2941 371 ----
NM_001001419chr5114751 4548 4284 3845 3689 1984 1775 1333 775 433 62 --25204 1969 --
NM_001001420chr5114751 4548 4284 3845 3689 1984 1775 1333 775 433 62 --25204 1969 --
NM_001001433chr2042859 2119 1266 1128 13085 ----
NM_001001481chr833088 1274 58 11056 21086 985 --
NM_001001483chr111375 ------
NM_001001484chr1022394 27 1383 ----
NM_001001521chr22296 257 ------
NM_001001549chr782531 923 752 736 627 412 350 279 12852 --12370
NM_001001550chr782531 923 752 736 627 412 350 279 12852 --12370
NM_001001555chr782531 923 752 736 627 412 350 279 12852 --12370
NM_001001664chr263090 2902 2652 1067 271 235 1623 14085 --
NM_001001702chr561737 1648 1540 1474 387 81 ------
NM_001001787chr13474 134 80 ----1484
NM_001001870chr17--1769 ----
NM_001001890chr2143208 3111 1467 776 14256 13654 --
NM_001001924chr831446 1318 382 1354 21850 284 --
NM_001001925chr831446 1318 382 1354 21850 284 --
NM_001001931chr831446 1318 382 1354 21850 284 --
NM_001001933chr13627 435 126 ------
NM_001001936chr104978 339 62 44 ------
NM_001001938chr983510 3112 2499 1379 960 655 398 359 23052 1555 1896 21431 595
NM_001001971chr101968 --21110 510 1883
NM_001001974chr1072248 2096 1954 1650 686 546 355 12213 1912 --
NM_001001994chrX2452 131 ------
NM_001001995chrX3498 255 232 --11208 --
NM_001001996chrX2452 131 ------
NM_001002009chr7165 1116 ----
NM_001002010chr7165 1116 ----
NM_001002243chr21276 ------
NM_001002257chr293445 3172 2936 2875 2605 1171 1023 672 524 11017 ----
NM_001002295chr103968 898 146 ------
NM_001002811chr131616 1528 981 --1445 --
NM_001002812chr131616 1528 981 --1445 --
NM_001002812chr131616 1528 981 --1445 --
NM_001002838chrX1648 11164 11881 --
NM_001002860chr1434355 3354 1817 24129 3453 13816 24477 1612
NM_001002909chr1731743 1580 630 ------
NM_001003406chr2233062 2811 2234 --22555 2006 --
NM_001003652chr18148368 8298 7994 7740 7625 7517 6934 6367 3471 3034 2870 2539 1504 871 26899 3434 58638 5537 2378 2341 145 28265 7556
NM_001003674chr18126182 6033 5128 4921 4721 4479 2737 2693 2175 555 343 135 --26486 5576 --
NM_001003675chr18126182 6033 5128 4921 4721 4479 2737 2693 2175 555 343 135 --26486 5576 --
NM_001003678chr11----1107 --
NM_001003679chr142225 1551 1516 786 --1584 --
NM_001003681chr2242008 858 687 176 --11977 --
NM_001003688chr441234 173 98 41 --1267 --
NM_001003698chr62552 379 ------
NM_001003699chr62552 379 ------
NM_001003712chr1212705 22751 322 23055 1010 --
NM_001003760chr642389 896 812 651 --12800 --
NM_001003792chr32454 37 --1778 --
NM_001003793chr32454 37 --1778 --
NM_001003845chr21425 1404 ----
NM_001003940chr1553325 2715 851 212 85 ------
NM_001003942chr1553325 2715 851 212 85 ------
NM_001003943chr1553329 2719 855 216 89 ------
NM_001003954chr8143 ------
NM_001004019chr3------198
NM_001004051chrX1133 --1122 --
NM_001004065chr953817 3610 3210 3068 945 13083 ----
NM_001004196chr331100 1015 938 ------
NM_001004304chr1262924 2422 936 596 381 318 --11275 --
NM_001004308chrX71584 1512 1488 1481 1375 1249 276 --2381 157 --
NM_001004317chr653376 3178 2933 1260 313 1854 13846 13617
NM_001004342chr1115760 5078 5024 4777 4194 4029 3984 1876 1391 449 369 --11235 --
NM_001004360chr231386 1264 774 1207 ----
NM_001004419chr123818 553 465 --14274 --
NM_001005158chr3----1384 --
NM_001005159chr3----1384 --
NM_001005266chr154569 274 260 242 ------
NM_001005267chr154569 274 260 242 ------
NM_001005268chr154569 274 260 242 ------
NM_001005269chr154569 274 260 242 ------
NM_001005291chr173475 174 44 ------
NM_001005335chr19------193
NM_001005366chr122950 903 1686 ----
NM_001005375chrY21742 1176 --11572 --
NM_001005386chr262431 1752 1726 668 245 155 ------
NM_001005404chr1794382 4031 2881 2872 1153 1119 344 298 110 1194 ----
NM_001005417chr12564 169 ------
NM_001005463chr1052635 2340 2291 1723 638 1825 2349 139 1609
NM_001005473chr545475 4942 4134 2013 22311 279 34715 2627 258 --
NM_001005474chr331011 1003 297 11546 --11572
NM_001005476chr23627 603 70 --143 --
NM_001005505chr321665 151 11801 --11775
NM_001005609chrX43695 3103 2469 187 11529 ----
NM_001005739chr21581 ------
NM_001005743chr1431162 372 203 --280 26 --
NM_001005744chr1431162 372 203 --280 26 --
NM_001005745chr1431162 372 203 --280 26 --
NM_001005746chr211159 ------
NM_001005747chr211159 ------
NM_001005753chr232305 1903 754 ----1907
NM_001005781chr21458 --1140 --
NM_001005782chr21907 ------
NM_001005861chr31265 176 ----
NM_001005862chr171221 1457 1587 --
NM_001006115chr382714 2049 1057 946 808 411 316 216 ------
NM_001006600chr562431 2153 1602 1590 720 342 11826 ----
NM_001006610chr162873 400 1906 ----
NM_001006612chrX2130 76 ------
NM_001006613chrX2130 76 ------
NM_001006614chrX2130 76 ------
NM_001006623chr272490 2457 2361 2328 687 243 138 ------
NM_001006636chr2--1369 ----
NM_001006657chr253202 2733 2390 1239 345 11064 32587 1015 260 --
NM_001006945chr11204 ----1473
NM_001007023chr1485145 4935 4074 3509 1387 1263 1120 400 15130 --13221
NM_001007024chr1784026 3725 3193 3154 1746 1619 1513 732 ----14294
NM_001007025chr1784026 3725 3193 3154 1746 1619 1513 732 ----14294
NM_001007075chr4--1949 ----
NM_001007102chr621194 529 1247 ----
NM_001007237chr121861 236 1338 1471 1618
NM_001007245chr71646 --1633 --
NM_001007246chr2121337 382 --11822 --
NM_001007257chr131231 355 311 ------
NM_001007271chr10148 ------
NM_001007277chr11----1419 --
NM_001007466chr644520 3952 3783 3668 --24604 4499 13715
NM_001007553chr131120 1059 301 11166 2887 336 --
NM_001007559chr1831651 1620 155 1323 32046 775 119 --
NM_001007793chr10138 ------
NM_001007794chr11491 --1632 1188
NM_001008220chr543456 1304 701 653 13913 --13971
NM_001008222chrX1874 ------
NM_001008239chr1843014 664 623 57 ----1356
NM_001008388chr42136 30 1857 --1315
NM_001008391chr11--1262 1452 --
NM_001008405chr741523 1459 1344 109 ------
NM_001008407chr731555 1175 138 ------
NM_001008408chr7136258 6226 5963 5930 5684 4698 4484 4002 2562 1885 607 302 225 1489 ----
NM_001008495chr852029 1853 1844 1602 722 --1619 --
NM_001008529chr1741343 1325 1178 483 --1301 --
NM_001008539chr884996 4782 4627 4017 3962 3577 1115 1093 11515 1455 --
NM_001008541chr1052332 1735 1684 824 461 ----11472
NM_001008541chr1052332 1735 1684 824 461 ----11472
NM_001008563chr931086 281 203 11103 ----
NM_001008564chr1352230 2120 546 403 177 11430 1439 --
NM_001008566chr224386 335 325 174 ------
NM_001008660chr1121267 1172 ----11548
NM_001008707chr1441387 774 730 589 ------
NM_001008738chr532881 1836 432 42630 2102 1161 1107 ----
NM_001008744chr1441232 1225 573 360 168 --11432
NM_001008800chr1190 ------
NM_001008801chr1942130 1464 1364 484 ----2414 386
NM_001008860chr152800 727 2753 156 ----
NM_001008883chr1190 ------
NM_001008892chr152800 727 2753 156 ----
NM_001008894chr152800 727 2753 156 ----
NM_001008895chr1351435 578 311 305 254 --21483 1257 --
NM_001008925chr443440 1415 1312 1042 ------
NM_001009552chr8--127 ----
NM_001009554chr444579 1743 733 559 153 13491 --
NM_001009554chr444579 1743 733 559 153 13491 --
NM_001009567chr101583 --1534 --
NM_001009881chr1------1483
NM_001009882chr1------1483
NM_001009899chr3136542 6439 6070 4717 4506 4257 2176 2039 1952 1832 1770 1125 623 14611 35174 2005 297 --
NM_001009909chr1143679 3328 2445 2413 ------
NM_001009958chr71427 ----1570
NM_001009993chr253982 3213 3154 2897 75 11143 --11440
NM_001009997chr101356 ------
NM_001010853chr632797 2625 1043 23064 1008 ----
NM_001010861chr152743 2167 1924 974 448 ----12657
NM_001010862chrX82783 2116 2038 738 622 587 472 268 ------
NM_001010888chrX33264 1830 660 34534 4239 3402 24013 4003 13961
NM_001010895chr951450 1362 1299 803 122 --11477 1708
NM_001010917chr1052249 664 656 637 49 11472 ----
NM_001010927chr61231 ------
NM_001010938chr31204 --1559 --
NM_001010942chr1221164 1064 11074 179 1342
NM_001010971chr15996 979 874 801 707 ----175
NM_001010980chr141333 1065 901 884 --2488 161 12316
NM_001010986chrX42537 2288 1663 561 12175 1275 --
NM_001010989chr161531 ------
NM_001010990chr161531 ------
NM_001011513chr472766 2759 1175 1061 817 561 349 ------
NM_001011515chr42367 287 21053 956 ----
NM_001011516chr42367 287 21053 956 ----
NM_001011537chr332163 2120 690 --1361 --
NM_001011546chr204744 655 555 110 1697 1342 --
NM_001011551chrX--134 ----
NM_001011658chrX72106 2093 1958 647 496 316 202 12099 ----
NM_001011663chr106738 675 437 320 271 96 11048 ----
NM_001011666chr745405 4477 2553 957 66301 5210 4703 4413 2101 950 1339 --
NM_001011708chr262166 1169 1163 1081 915 425 12748 ----
NM_001011713chr141158 ------
NM_001011885chr1531793 526 225 --1724 1465
NM_001012329chr142307 2290 842 257 12219 ----
NM_001012393chr1174735 4136 3937 3931 2068 1812 267 --14995 --
NM_001012398chr162829 246 --1925 --
NM_001012420chr1522220 1866 12853 --1506
NM_001012423chr1522220 1866 12853 --1506
NM_001012426chr611051 13376 ----
NM_001012427chr611051 13376 ----
NM_001012514chr221024 96 11085 ----
NM_001012516chr221024 96 11085 ----
NM_001012643chr191392 ------
NM_001012751chr1031867 1529 1299 --11249 --
NM_001012754chr132748 560 12006 21953 1856 --
NM_001012755chrX64874 3363 1558 1215 652 29 21729 1565 14755 --
NM_001012761chr552733 2569 1788 1079 875 12275 11767 --
NM_001012968chrX72626 2019 1077 929 198 178 144 --1340 --
NM_001012980chrX--1161 1228 --
NM_001012989chrX2582 165 ------
NM_001013031chr10133546 3270 3060 2979 2486 2222 1258 1176 1059 1018 969 646 586 --11411 --
NM_001013398chr731513 1116 240 11537 1345 --
NM_001013406chr721178 125 21185 409 ----
NM_001013438chr351007 757 748 369 328 ------
NM_001013439chr35853 603 594 215 174 ------
NM_001013620chr1258139 5999 2889 2857 2240 11530 47500 5434 957 910 12111
NM_001013635chr1241159 917 168 113 --11139 --
NM_001013659chr1975392 5346 4569 4272 3558 2162 288 --2273 70 11405
NM_001013690chr1231548 866 420 ------
NM_001013693chr142736 2143 917 904 --22957 2849 --
NM_001013693chr142736 2143 917 904 --22957 2849 --
NM_001013699chr12150 ------
NM_001013703chr152444 144 ------
NM_001014794chr111187 ------
NM_001014795chr111187 ------
NM_001014797chr1098180 7511 7454 7304 5870 3080 793 287 279 18186 --13186
NM_001014812chr15--1184 ----
NM_001014839chr11675 ------
NM_001014841chr11675 ------
NM_001015048chr1463203 2940 2534 2449 2425 964 12480 22950 614 1714
NM_001015049chr1463203 2940 2534 2449 2425 964 12480 22950 614 1714
NM_001015877chrX32630 497 149 11029 --11957
NM_001015882chr91690 ----1752
NM_001015887chr321834 1283 ----11728
NM_001017369chr421093 1057 --11066 --
NM_001017371chr2--11227 1855 1154
NM_001017395chr3102701 2549 2364 1290 1233 1024 966 597 397 210 ------
NM_001017396chr241855 828 439 265 1811 1431 --
NM_001017406chr1158 ------
NM_001017420chr8--1304 --1272
NM_001017423chr104779 316 238 81 ------
NM_001017424chr121282 598 ------
NM_001017425chr121282 598 ------
NM_001017440chr7127673 7378 6271 5955 3052 2821 2130 1550 1473 1083 1070 1046 21430 1031 ----
NM_001017523chr122716 389 1534 ----
NM_001017923chr1431664 1655 1345 1260 2325 250 --
NM_001017926chr841836 1429 1315 427 ------
NM_001017962chr101780 --1162 --
NM_001017963chr143597 386 357 --2330 278 --
NM_001017969chr92671 179 ------
NM_001017973chr5--3267 77 65 1322 --
NM_001017974chr5--3267 77 65 1322 --
NM_001017979chr42205 190 1277 ----
NM_001018004chr15------1228
NM_001018006chr15------1228
NM_001018007chr15------1228
NM_001018020chr15------1228
NM_001018025chrX137 ------
NM_001018037chr921325 474 ------
NM_001018050chr22113025 2902 2777 2574 2568 1264 1113 577 414 325 234 --11322 12835
NM_001018052chr22113025 2902 2777 2574 2568 1264 1113 577 414 325 234 --11322 12835
NM_001018053chr141633 608 556 111 --11854 --
NM_001018054chr12993 430 11450 ----
NM_001018056chr92393 181 ------
NM_001018064chr922144 426 --1489 --
NM_001018065chr9145603 5507 5473 5055 4783 3839 1963 1477 1385 1185 1104 896 536 120 1636 ----
NM_001018066chr9145603 5507 5473 5055 4783 3839 1963 1477 1385 1185 1104 896 536 120 1636 ----
NM_001018067chr155168 4500 1028 483 33 24874 3326 35183 5028 2075 24945 1122
NM_001018068chr155168 4500 1028 483 33 24874 3326 35183 5028 2075 24945 1122
NM_001018069chr155168 4500 1028 483 33 24874 3326 35183 5028 2075 24945 1122
NM_001018072chr122716 389 1534 ----
NM_001018074chr543255 2981 2545 750 --13805 --
NM_001018075chr543255 2981 2545 750 --13805 --
NM_001018076chr543255 2981 2545 750 --13805 --
NM_001018077chr543255 2981 2545 750 --13805 --
NM_001018089chr1583986 3177 2883 2601 1032 588 209 124 --33101 1017 432 --
NM_001018100chr152810 318 1260 ----
NM_001018108chr1542121 1920 1841 1551 1269 ----
NM_001020658chr151698 1644 1537 1489 1352 1172 --11392
NM_001020658chr151698 1644 1537 1489 1352 1172 --11392
NM_001023567chr1542389 2244 2197 1887 ----1509
NM_001023587chr31954 ------
NM_001024024chr1451062 921 417 188 170 --21056 865 --
NM_001024070chr1451058 917 413 184 166 --21052 861 --
NM_001024094chr543255 2981 2545 750 --13805 --
NM_001024218chr142247 124 ----1727
NM_001024226chr121040 823 ------
NM_001024227chr121040 823 ------
NM_001024228chr121040 823 ------
NM_001024463chr15--1262 ----
NM_001024593chr10180 ------
NM_001024649chr562874 2609 1100 329 311 285 --1514 --
NM_001024660chr311243 ----1655
NM_001024666chrX1485 --179 --
NM_001024680chr211592 ------
NM_001024808chr1241984 1753 425 70 11817 ----
NM_001024847chr33789 521 369 ------
NM_001024912chr1981378 726 679 616 521 383 356 47 --11366 --
NM_001024934chr6149 ------
NM_001024935chr6149 ------
NM_001024936chr6149 ------
NM_001024947chr53430 149 53 1754 ----
NM_001024948chr13857 744 534 13217 1148 12535
NM_001025068chr331263 253 145 11304 ----
NM_001025069chr331263 253 145 11304 ----
NM_001025072chr372779 2613 2429 2209 1096 875 494 --12357 --
NM_001025073chr372779 2613 2429 2209 1096 875 494 --12357 --
NM_001025076chr1086255 5673 5642 2154 1842 1256 1133 836 --21859 1570 --
NM_001025077chr10107613 7031 7000 4973 2614 2491 2194 1391 346 251 --22928 202 --
NM_001025079chr363403 3359 3146 2647 732 81 ----23941 558
NM_001025108chr283043 2558 1482 1450 1410 1273 1254 232 --21384 1320 --
NM_001025232chr122316 40 1304 ----
NM_001025252chr832274 1109 352 --164 --
NM_001025253chr832274 1109 352 --164 --
NM_001025266chr373686 3193 1645 1540 1368 312 55 14921 24242 1809 --
NM_001025366chr631800 1446 184 ------
NM_001025366chr631800 1446 184 ------
NM_001025367chr631800 1446 184 ------
NM_001025367chr631800 1446 184 ------
NM_001025368chr631800 1446 184 ------
NM_001025368chr631800 1446 184 ------
NM_001025369chr631816 1462 200 ------
NM_001025369chr631816 1462 200 ------
NM_001025370chr631800 1446 184 ------
NM_001025370chr631800 1446 184 ------
NM_001025389chr111465 --11428 --
NM_001025390chr111465 --11428 --
NM_001025579chr17--11072 ----
NM_001025580chrX83944 3743 3498 3095 3048 2754 2711 563 1941 13358 12644
NM_001025595chr4--11043 11432 --
NM_001025596chr112498 465 1379 1156 --
NM_001025603chr121348 45 1573 21313 1152 --
NM_001025616chr42718 673 1293 2537 507 --
NM_001029839chr341233 1030 563 243 ------
NM_001029840chr341233 1030 563 243 ------
NM_001029858chr642983 2105 1093 590 12552 ----
NM_001029863chr632634 787 70 --1634 1344
NM_001029875chr552871 1902 1104 1084 1008 12238 12120 --
NM_001029989chr15170 ------
NM_001030002chr17------1321
NM_001030006chr1721819 1076 12435 12682 --
NM_001030007chr16133657 3599 3339 3016 2861 2679 2482 1538 1411 1091 651 223 156 11221 1367 13297
NM_001030055chr1494739 4707 4622 4052 3968 3650 3641 3078 1058 1793 ----
NM_001031623chr661740 556 483 264 152 35 --11511 --
NM_001031679chr1252827 711 488 421 224 13467 ----
NM_001031689chr9------1124
NM_001031690chr762805 2787 2781 2635 1894 880 ------
NM_001031695chr2265179 4746 4485 4383 4341 3670 24626 1813 --21330 1187
NM_001031710chr731035 853 58 ------
NM_001031712chr61161 ------
NM_001031732chr473612 3256 3185 2991 485 342 143 22323 1142 --21096 47
NM_001031746chr1051350 1037 940 529 61 --1956 --
NM_001031804chr1664190 4027 2788 1319 1228 829 --1908 --
NM_001031812chr5155 --1876 11567
NM_001032221chr92423 165 --21628 401 1330
NM_001032279chr111269 ----1400
NM_001032280chr611340 ------
NM_001032282chr821276 34 --21323 814 --
NM_001032283chr1231021 906 185 --1207 --
NM_001032284chr1231021 906 185 --1207 --
NM_001032296chr1342757 1121 802 568 ----1940
NM_001032363chr142041 1714 248 165 ------
NM_001032363chr142041 1714 248 165 ------
NM_001032367chr15176 ------
NM_001032380chr1041859 559 153 87 --11642 --
NM_001032394chr632663 2567 2533 --12719 --
NM_001032395chr632530 2434 2400 --12586 --
NM_001032999chr20115247 5000 4844 4715 4082 4056 1968 1606 1427 1170 676 --1901 14214
NM_001033025chr131346 1164 508 ------
NM_001033044chr171727 1363 1270 1260 597 153 143 ------
NM_001033049chr2121978 95 1751 1354 --
NM_001033056chr171727 1363 1270 1260 597 153 143 ------
NM_001033057chr311429 11592 ----
NM_001033059chr621497 189 --11781 --
NM_001033087chr2032844 2298 280 22196 253 ----
NM_001033112chr52732 88 ------
NM_001033117chr3104602 4470 4374 3911 3645 3551 3400 894 98 62 ------
NM_001033518chr7181 --2624 60 --
NM_001033519chr7181 --2624 60 --
NM_001033520chr7181 --2624 60 --
NM_001033557chr2--11121 ----
NM_001033564chr651455 1258 697 359 246 --11694 1672
NM_001033578chr841929 1785 632 206 22286 386 1938 --
NM_001033756chr631734 1380 118 ------
NM_001033756chr631734 1380 118 ------
NM_001034025chr122964 78 ------
NM_001034837chr52124 75 ------
NM_001034838chr52124 75 ------
NM_001034841chr16135491 5220 4855 4843 4437 4405 4098 2154 1771 1427 1251 1169 776 13878 15519 --
NM_001034850chr521556 1458 ------
NM_001035chr121080 183 ------
NM_001035003chr431040 979 128 ------
NM_001035004chr431040 979 128 ------
NM_001035260chr1051403 1324 1076 549 345 --1311 --
NM_001037132chr732264 1953 466 --1373 --
NM_001037133chr732264 1953 466 --1373 --
NM_001037164chr772068 1644 1493 1485 1404 156 119 21976 391 ----
NM_001037172chr331370 1213 395 --1389 --
NM_001037174chr241985 1577 1438 359 --12048 --
NM_001037317chr152743 2167 1924 974 448 ----12657
NM_001037331chr181180 --1749 --
NM_001037334chr1852199 1865 1752 1578 659 22022 672 11780 --
NM_001037339chr131486 385 196 ------
NM_001037340chr131486 385 196 ------
NM_001037341chr131486 385 196 ------
NM_001037341chr131486 385 196 ------
NM_001037582chr441604 1550 1374 1082 21512 74 ----
NM_001037738chr51223 1285 ----
NM_001037872chr22666 480 ------
NM_001037954chr1152697 934 862 636 227 1895 11399 --
NM_001038493chr251427 1414 1399 486 203 11525 --11546
NM_001039091chrX61019 566 480 468 301 286 2943 125 ----
NM_001039348chr221060 1036 1423 ----
NM_001039349chr221060 1036 1423 ----
NM_001039465chr141452 1151 ----
NM_001039538chr252641 2588 2562 1403 338 12470 ----
NM_001039570chr2274521 4475 4104 4072 1732 1389 1154 --23412 1256 --
NM_001039571chr2274521 4475 4104 4072 1732 1389 1154 --23412 1256 --
NM_001039574chr16876 784 693 287 249 111 ------
NM_001039580chr455029 4988 3763 3361 144 24843 1681 --25077 4935
NM_001039590chrX63471 3228 2611 2583 626 339 ------
NM_001039591chrX63471 3228 2611 2583 626 339 ------
NM_001039618chr11105774 4457 2309 1944 1587 1346 1336 1290 564 333 11992 ----
NM_001039690chr1652331 1885 1599 822 699 ------
NM_001039709chr20115247 5000 4844 4715 4082 4056 1968 1606 1427 1170 676 --1901 14214
NM_001039711chr1122 1305 ----
NM_001039712chr1122 1305 ----
NM_001039802chr11476 21383 1335 ----
NM_001039840chrX95883 5630 5555 4410 4173 3851 2432 1832 506 32348 774 58 13937 --
NM_001039916chr124935 766 437 102 --1313 --
NM_001039917chr124935 766 437 102 --1313 --
NM_001039918chr124935 766 437 102 --1313 --
NM_001039919chr124935 766 437 102 --1313 --
NM_001039920chr124935 766 437 102 --1313 --
NM_001039937chr13123804 3123 2677 2548 1577 1083 1004 823 606 532 348 75 13683 13257 2771 374
NM_001040001chr631647 1552 794 ----21966 25
NM_001040020chr731607 1347 104 11425 ----
NM_001040057chr71104 11195 ----
NM_001040059chr173598 566 169 ------
NM_001040101chr451377 1302 1087 630 54 11061 ----
NM_001040110chr741755 1434 721 97 11572 ----
NM_001040142chr222242 623 --12067 --
NM_001040143chr222242 623 --12067 --
NM_001040144chr1652331 1885 1599 822 699 ------
NM_001040146chr1652331 1885 1599 822 699 ------
NM_001040151chr1154582 3506 3035 2971 519 --11304 1335
NM_001040152chr744592 4527 1815 1398 ------
NM_001040157chr452493 792 750 419 33 --21987 199 --
NM_001040159chr42980 459 ----21531 293
NM_001040181chr32940 422 ------
NM_001040182chr32940 422 ------
NM_001040183chr32940 422 ------
NM_001040199chr32940 422 ------
NM_001040200chr32940 422 ------
NM_001040214chr62435 249 ----1502
NM_001040284chr16135962 5869 5659 5542 4884 4666 4594 4150 3939 3688 1291 1048 721 --55677 4429 4136 3983 921 --
NM_001040409chr2--1119 1287 --
NM_001040429chr1352969 1250 1160 500 36 11376 13119 23494 2359
NM_001040440chr53676 532 158 ------
NM_001040441chr175043 4490 4037 1669 1565 1415 815 --1174 --
NM_001040446chr562569 2266 848 734 622 360 12186 12508 --
NM_001040450chr1562682 2520 2187 1972 892 589 1833 --1712
NM_001040453chr1562682 2520 2187 1972 892 589 1833 --1712
NM_001040456chr71116 1554 ----
NM_001040457chr71116 1554 ----
NM_001040633chr72842 215 ------
NM_001040653chr3112561 2230 2217 2102 1752 1666 1658 1060 995 313 154 12526 ----
NM_001040697chr112465 149 ------
NM_001040709chr162391 2169 2149 1933 440 230 ------
NM_001040712chr933000 2462 680 13019 ----
NM_001042355chr1685240 4831 4238 3268 1860 522 420 108 --15213 11410
NM_001042357chr1041271 1105 539 200 ----1380
NM_001042358chr1041271 1105 539 200 ----1380
NM_001042360chr1041271 1105 539 200 ----1380
NM_001042361chr1051302 1136 570 231 25 ----1411
NM_001042363chr1041271 1105 539 200 ----1380
NM_001042364chr1051302 1136 570 231 25 ----1411
NM_001042365chr1051302 1136 570 231 25 ----1411
NM_001042383chr352940 2630 280 227 24 ------
NM_001042387chr1051302 1136 570 231 25 ----1411
NM_001042388chr182849 205 ------
NM_001042389chr1041271 1105 539 200 ----1380
NM_001042390chr1041271 1105 539 200 ----1380
NM_001042392chr1041271 1105 539 200 ----1380
NM_001042393chr1051302 1136 570 231 25 ----1411
NM_001042395chr1041271 1105 539 200 ----1380
NM_001042396chr1051302 1136 570 231 25 ----1411
NM_001042397chr1051302 1136 570 231 25 ----1411
NM_001042403chr123792 386 88 ------
NM_001042404chr131849 1252 109 11593 1580 --
NM_001042412chr1685240 4831 4238 3268 1860 522 420 108 --15213 11410
NM_001042413chr983718 3470 3200 3183 3089 1185 611 37 13519 ----
NM_001042425chr611340 ------
NM_001042430chr142462 176 ------
NM_001042437chr2193 ------
NM_001042459chr31104 ------
NM_001042473chr1032108 2047 1625 22062 770 1533 --
NM_001042476chr1672171 1973 1836 843 428 45 23 11768 1856 --
NM_001042481chr1432367 780 152 ------
NM_001042492chr1753462 3322 3309 1323 166 --23334 2353 --
NM_001042506chrX31063 326 41 ------
NM_001042510chr861596 1370 809 707 306 226 11765 11401 --
NM_001042511chr861596 1370 809 707 306 226 11765 11401 --
NM_001042537chrX72396 2111 1736 929 540 470 437 ------
NM_001042555chr1264609 4154 2955 1544 1038 33 11383 24106 3721 13832
NM_001042599chr2127104 7066 6702 6622 6346 6286 5806 5096 4835 2656 1246 338 --25605 5414 --
NM_001042603chr1255370 4289 4023 1434 969 34162 1344 649 14111 --
NM_001042604chr374033 3720 3013 1645 1582 535 260 ------
NM_001042632chr2072548 2451 2307 2145 939 855 60 ------
NM_001042633chr2072548 2451 2307 2145 939 855 60 ------
NM_001042646chr321616 1231 --1202 1172
NM_001042669chr42718 673 1293 2537 507 --
NM_001042681chr142530 2405 2232 278 --12447 --
NM_001042682chr142530 2405 2232 278 --12447 --
NM_001042682chr142530 2405 2232 278 --12447 --
NM_001042683chr621708 590 --21495 444 --
NM_001042749chrX21765 1742 11923 1521 --
NM_001042750chrX21765 1742 11923 1521 --
NM_001042751chrX21765 1742 11923 1521 --
NM_001042762chr72795 252 1884 ----
NM_001043318chr14104085 3827 3797 2670 1661 1468 1328 1168 1118 870 ----12578
NM_001043351chr122056 1428 1909 ----
NM_001044305chr631650 1366 1053 1625 ----
NM_001044385chr253637 3539 3283 2566 847 13651 ----
NM_001044722chr5155 --1876 11567
NM_001044723chr5155 --1876 11567
NM_001045556chr821738 66 ------
NM_001045557chr821738 66 ------
NM_001046chr552982 2267 1978 399 327 13005 11899 --
NM_001048183chr153000 2624 1202 762 138 23739 1326 1200 --
NM_001049chr1431689 1512 998 --12219 --
NM_001079874chr111971 11622 32068 1989 1778 12126
NM_001083620chr461657 1634 996 299 250 210 1416 --1743
NM_001096chr173792 712 242 ------
NM_001099678chr376291 5183 4771 4259 4194 1002 637 36437 6120 5501 11712 --
NM_001100108chr1157545 6990 6800 6088 6023 5448 5106 3329 3082 3043 2889 2451 2000 500 76 15274 17978 --
NM_001106chr3199581 7802 7600 7211 6435 6223 6127 3793 3772 3434 2866 2757 2700 2646 1703 1255 871 345 125 49231 7673 1641 1518 1761 --
NM_001109977chr42769 32 ------
NM_001113490chrX93482 3190 2925 1269 1197 1024 985 802 73 --13646 --
NM_001117chr1812479 --1199 --
NM_001121chr10----1582 --
NM_001122679chr521186 26 ------
NM_001123chr101571 ----1290
NM_001126chr11169 ------
NM_001128chr16133657 3599 3339 3016 2861 2679 2482 1538 1411 1091 651 223 156 11221 1367 13297
NM_001144chr1651349 1173 1014 887 531 1171 ----
NM_001148chr421944 791 --22123 398 --
NM_001153chr2141 --1284 1945
NM_001160chr1252796 2382 2370 817 607 32762 2744 1051 2257 192 --
NM_001167chrX66357 5902 5573 2102 1249 1056 --25450 1114 11365
NM_001169chr162413 364 ------
NM_001173chr1494739 4707 4622 4052 3968 3650 3641 3078 1058 1793 ----
NM_001177chr1242063 1933 1734 232 ------
NM_001191chr2021215 406 ------
NM_001198chr652348 1727 1650 978 465 2479 436 --1721
NM_001201chr473920 3590 3507 2838 700 497 487 --13070 --
NM_001204chr277514 7400 7117 6920 4860 2178 494 26351 545 36939 1952 475 --
NM_001206chr922455 756 1763 ----
NM_001215chr11369 --189 --
NM_001219chr732096 1673 1505 11815 --1233
NM_001222chr1051980 1965 1410 662 370 ------
NM_001233chr7149 12038 --1208
NM_001241chr241885 1594 1526 1510 11819 21903 676 --
NM_001241chr241885 1594 1526 1510 11819 21903 676 --
NM_001248chr31958 ------
NM_001251chr173598 566 169 ------
NM_001254chr1721053 926 1776 ----
NM_001256chr1772811 2488 938 673 317 278 58 ------
NM_001257chr1631442 1187 336 ----1942
NM_001259chr765015 1906 1540 1097 1049 307 14643 44842 1403 1357 1118 14584
NM_001260chr13--1345 ----
NM_001262chr11223 --1308 --
NM_001270chr5----1445 --
NM_001271chr1542823 2041 246 204 23260 697 ----
NM_001282chr1721819 1076 12435 12682 --
NM_001283chr72541 533 ------
NM_001289chrX1601 ------
NM_001290chr41815 1873 ----
NM_001304chr1732461 1081 356 --22978 2724 --
NM_001310chr1262968 2946 2278 1950 690 170 ------
NM_001315chr66574 401 378 259 176 91 ----11752
NM_001316chr202368 155 ----1121
NM_001319chr191199 --160 --
NM_001326chr11182 ------
NM_001329chr1021538 1284 21006 97 ----
NM_001331chr1172477 2306 2203 2083 1864 1074 616 ------
NM_001332chr521321 398 --11099 11089
NM_001343chr561392 1359 552 480 288 102 ------
NM_001346chr392638 2600 2250 2117 2023 1777 964 296 166 --12578 --
NM_001351chr321715 1160 --1111 --
NM_001356chrX42498 2245 1610 424 11538 21643 77 --
NM_001363chrX3741 620 136 --2527 177 --
NM_001364chr1133734 1416 422 24230 4210 11136 --
NM_001378chr21468 --1175 --
NM_001380chr10------1971
NM_001386chr842135 1780 851 435 ------
NM_001387chr552778 1961 604 205 183 12704 11268 --
NM_001390chr1873373 3183 3091 2781 2760 2371 994 ----13228
NM_001392chr18148 ------
NM_001396chr2132227 1012 29 12596 ----
NM_001399chrX43695 3103 2469 187 11529 ----
NM_001400chr131282 1117 355 ------
NM_001401chr91205 --11541 11332
NM_001406chr1751597 1330 1234 1167 300 ------
NM_001407chr351368 1335 1289 1213 1170 1234 21185 1152 --
NM_001412chrX32902 2530 336 12450 23042 202 --
NM_001419chr1964434 3988 1540 1102 113 65 --14236 --
NM_001423chr1241540 1323 413 209 --11763 --
NM_001426chr21549 ----1300
NM_001427chr731952 1470 523 --21377 452 --
NM_001429chr2231052 311 242 ------
NM_001430chr221507 1297 ----1770
NM_001431chr62933 332 1919 2300 37 --
NM_001438chr122381 1414 13144 12359 --
NM_001439chr131346 1164 508 ------
NM_001443chr2----160 --
NM_001448chrX41444 1428 354 80 --1152 --
NM_001449chrX21023 51 21225 999 ----
NM_001451chr16----11035 --
NM_001452chr61637 ------
NM_001453chr641593 1476 281 225 ------
NM_001483chr73689 306 202 1411 ----
NM_001491chr642280 2172 1787 209 --22411 518 --
NM_001493chrX4713 589 583 215 ------
NM_001495chr82782 95 --1124 --
NM_001527chr6104889 4580 4569 4118 3145 1591 1341 535 381 101 --11350 --
NM_001530chr1421110 754 --21063 966 --
NM_001533chr19------193
NM_001542chr121861 236 1338 1471 1618
NM_001546chr621488 1439 --1362 --
NM_001550chr71646 --1633 --
NM_001560chrX3338 329 36 --12066 --
NM_001564chr41144 ------
NM_001584chr11----11148 --
NM_001604chr11--2990 183 ----
NM_001609chr10114386 4159 3728 3484 3438 3303 3170 507 347 82 65 --21572 685 --
NM_001614chr17------1189
NM_001614chr17------1189
NM_001616chr293465 3365 3237 2784 2628 2367 764 215 137 22734 2569 22804 1181 --
NM_001634chr621497 189 --11781 --
NM_001635chr72238 122 1260 ----
NM_001650chr1843336 940 888 509 ----24122 737
NM_001656chr53155 134 48 ----11680
NM_001658chr121040 823 ------
NM_001659chr1272390 2346 2199 2182 1876 320 139 1737 12290 --
NM_001660chr33554 267 79 ------
NM_001663chr1441766 881 855 279 1336 32657 1049 998 --
NM_001664chr32855 128 ------
NM_001668chr171949 1935 1824 1668 1484 639 347 ------
NM_001670chr222147 33 ------
NM_001677chr151112 772 718 318 232 ----11122
NM_001678chr1741603 1287 528 519 1603 11170 --
NM_001679chr33507 271 95 1518 1756 --
NM_001681chr12----1138 --
NM_001682chr1272652 2633 2448 2071 2030 677 96 12562 1618 --
NM_001683chr342483 2263 741 359 1620 11671 --
NM_001688chr12664 312 ------
NM_001690chr352488 685 653 295 183 --1415 --
NM_001693chr851114 989 303 86 31 ------
NM_001695chr893794 3679 3409 3366 3346 2679 2663 1389 34 11554 --13473
NM_001701chr931476 622 459 ------
NM_001703chr12188 65 --1279 --
NM_001709chr1162698 2611 2567 1796 886 432 22287 1131 ----
NM_001718chr641237 546 105 37 1964 ----
NM_001731chr121946 1751 1805 --
NM_001743chr2161 133 1517 --
NM_001744chr5----151 --
NM_001745chr551176 768 466 366 235 ------
NM_001746chr562874 2609 1100 329 311 285 --1514 --
NM_001748chr131118 924 888 ----180
NM_001753chr731701 1552 114 ------
NM_001754chr2143208 3111 1467 776 14256 13654 --
NM_001759chr12105337 4962 4717 4317 4292 3219 1598 975 876 78 2388 229 13477 --
NM_001777chr363403 3359 3146 2647 732 81 ----23941 558
NM_001781chr12----1103 --
NM_001790chr51372 1358 ----
NM_001791chr11476 21383 1335 ----
NM_001792chr181458 ----190
NM_001797chr161608 1550 1533 --
NM_001801chr52215 54 ----1430
NM_001806chr1952985 2404 2052 1807 932 1174 1524 22754 1184
NM_001826chr13446 102 91 ------
NM_001830chrX43913 3472 2679 1357 23011 1218 1493 --
NM_001839chr1266 36 1270 183 --
NM_001854chr12148 44 1577 ----
NM_001858chr645116 4082 1918 1786 1917 23159 310 14289
NM_001859chr9103596 2971 2882 2733 2445 1093 989 546 301 101 1886 11081 --
NM_001873chr41475 --1502 --
NM_001881chr10--1114 ----
NM_001882chr53408 175 118 ----1521
NM_001894chr2221182 210 ----11144
NM_001895chr2041153 1072 853 769 11061 11199 --
NM_001901chr61987 ------
NM_001904chr31146 --1983 --
NM_001924chr11170 160 ----
NM_001935chr21133 ------
NM_001939chrX53802 3439 1482 1474 323 --22660 2405 --
NM_001945chr521425 1104 11302 ----
NM_001946chr122983 84 2818 343 1735 --
NM_001949chr683087 2816 2804 2140 2017 991 880 793 12760 ----
NM_001955chr611074 ------
NM_001957chr442336 2099 1777 780 ----22262 1622
NM_001964chr51792 1402 --11107
NM_001968chr41157 1163 --1853
NM_001977chr42649 166 1298 ----
NM_001980chr1252231 1500 394 259 163 --1598 1123
NM_001982chr1251187 1073 1052 830 362 ------
NM_001987chr1274190 4110 3550 3380 3054 1586 757 --22724 1140 11410
NM_001993chr11187 ----1833
NM_001995chr421418 351 ------
NM_001998chr3------198
NM_001999chr53348 134 108 ------
NM_002009chr1542737 2152 1912 1869 1828 --1695
NM_002010chr13----1117 --
NM_002015chr1393376 3182 2577 2543 1342 1262 1074 958 544 1660 1834 --
NM_002017chr1141242 342 106 74 1123 1245 --
NM_002024chrX42097 1586 562 289 --170 11656
NM_002025chrX109148 8961 8170 3029 2973 2746 2069 1321 1160 630 27908 2957 28496 7207 --
NM_002029chr192131 54 ------
NM_002035chr1873793 3163 1436 737 527 386 233 13707 22761 396 24002 1444
NM_002036chr1147 ------
NM_002039chr44886 680 352 169 --1617 --
NM_002040chr21103109 2597 2419 2296 1946 1275 1011 909 171 149 ------
NM_002051chr103968 898 146 ------
NM_002054chr21422 ------
NM_002056chr22205 72 1816 2868 779 --
NM_002061chr141872 1263 610 160 21524 1218 --1603
NM_002062chr63599 557 297 ------
NM_002065chr171727 1363 1270 1260 597 153 143 ------
NM_002069chr711457 11619 11403 1387
NM_002071chr182686 569 ------
NM_002074chr141563 509 420 248 ------
NM_002077chr942054 1989 1582 870 ------
NM_002080chr161841 ------
NM_002086chr1752150 1904 669 258 140 ------
NM_002092chr474963 3978 1615 1156 938 647 269 14556 13554 --
NM_002114chr62460 112 ------
NM_002126chr1764172 3217 2935 2718 2665 456 --11122 --
NM_002128chr1352441 677 268 213 31 12196 12281 --
NM_002129chr41395 ------
NM_002130chr531710 1411 394 ------
NM_002137chr721994 1606 1297 12276 --
NM_002140chr931172 351 345 ----11015
NM_002146chr1741383 918 422 189 1401 ----
NM_002148chr23613 160 115 1600 ----
NM_002154chr51450 --159 --
NM_002156chr21437 ------
NM_002158chr21784 22918 1011 21408 481 --
NM_002165chr20--1323 ----
NM_002196chr202715 443 11005 ----
NM_002196chr202715 443 11005 ----
NM_002199chr45919 891 362 117 44 ------
NM_002207chr32482 225 155 ----
NM_002210chr233457 3375 29 --12896 --
NM_002211chr1031089 1006 219 --11067 --
NM_002214chr734317 1867 1195 24856 4562 ----
NM_002226chr14------1162
NM_002227chr12828 267 --11297 --
NM_002240chr21291 53 ------
NM_002241chr122807 1161 --1450 --
NM_002247chr1022346 1502 ------
NM_002253chr431200 520 446 ----11363
NM_002254chr262178 2102 1810 787 709 672 ------
NM_002264chr3145051 4997 4297 3322 3076 1970 1460 1062 964 678 405 319 135 60 24959 2026 13283 --
NM_002265chr172406 245 ------
NM_002267chr1371816 1550 982 951 381 151 112 11662 ----
NM_002268chr331811 1780 445 1388 21707 1239 11462
NM_002269chr6----1404 --
NM_002270chr5105127 4809 4365 3854 3743 2184 1642 1101 508 224 24847 3799 25222 1726 --
NM_002271chr1352307 1797 797 525 71 ------
NM_002285chr283043 2558 1482 1450 1410 1273 1254 232 --21384 1320 --
NM_002310chr586355 5120 2434 1935 1810 1279 643 232 35483 4613 1821 --11353
NM_002312chr132685 202 ------
NM_002314chr721083 1027 ------
NM_002317chr51360 ------
NM_002333chr19--140 ----
NM_002334chr1141790 1715 1376 61 ----1244
NM_002335chr11------1164
NM_002336chr12124944 4881 4869 4321 4124 3692 3609 1646 1594 736 540 525 34424 3596 1393 --15013
NM_002349chr221557 1310 --11257 11018
NM_002355chr122496 171 ------
NM_002356chr682577 2296 1136 898 830 350 318 263 12750 21877 1070 --
NM_002359chr1794173 3532 3061 1630 1535 1429 1241 959 890 1938 23803 3410 --
NM_002374chr252641 2588 2562 1403 338 12470 ----
NM_002382chr1421167 450 --1428 --
NM_002395chr651418 1058 978 576 191 --1456 --
NM_002397chr521826 1606 12238 11648 --
NM_002399chr1531367 1036 388 ------
NM_002401chr1742460 1850 1803 875 ------
NM_002402chr741185 334 242 210 ------
NM_002408chr14------2310 119
NM_002430chr2252136 955 475 355 323 ------
NM_002438chr101583 --1534 --
NM_002442chr1211429 ------
NM_002449chr5------1947
NM_002451chr953786 3461 2907 2593 2499 --2801 460 --
NM_002467chr82158 99 ------
NM_002473chr2211043 11004 1877 --
NM_002480chr1211238 ------
NM_002481chr1178009 7813 7585 7569 7543 6100 5847 4907 3129 2858 2677 2469 2276 1688 1620 832 422 11541 2990 322 --
NM_002486chr952491 2171 1688 766 438 32189 790 90 ----
NM_002499chr1522084 327 11831 21795 308 --
NM_002505chr631322 306 192 1466 1504 --
NM_002509chr202633 229 ------
NM_002515chr1431623 219 73 ------
NM_002518chr221197 992 1403 ----
NM_002524chr121064 229 ------
NM_002536chrX2369 229 ------
NM_002538chr5175 1230 ----
NM_002539chr21330 199 ----
NM_002543chr1231430 1395 68 11476 11211 --
NM_002545chr1174735 4136 3937 3931 2068 1812 267 --14995 --
NM_002547chrX73706 2647 458 419 123 78 23 1198 11324 --
NM_002563chr3--1753 2833 782 --
NM_002568chr81132 ------
NM_002572chr11192 ------
NM_002577chr383896 3694 2885 2735 1126 873 866 298 --24036 308 1541
NM_002581chr954839 4251 1544 1271 817 14112 ----
NM_002586chr611022 ------
NM_002591chr203533 489 145 ------
NM_002594chr201918 --11631 --
NM_002595chr1221615 518 ----21559 1334
NM_002599chr113450 301 274 11203 --1203
NM_002600chr131486 385 196 ------
NM_002605chr1531115 886 33 ------
NM_002607chr73881 247 124 ------
NM_002612chr771988 1956 839 833 696 367 83 ------
NM_002613chr1685209 3783 3623 1715 1312 877 498 126 15400 14365 13711
NM_002623chr20--1706 ----
NM_002628chr341086 933 357 220 --41228 1153 1119 262 --
NM_002629chr106750 618 315 300 107 52 ------
NM_002643chr2127 ------
NM_002645chr1153092 2833 1237 1043 289 11067 ----
NM_002646chr162079 1763 1637 792 409 83 12168 1266 --
NM_002655chr845253 4072 3755 1428 ------
NM_002656chr611121 1195 ----
NM_002657chr20103855 3563 3356 3002 2568 2442 1052 825 361 188 12430 --13751
NM_002663chr17------1525
NM_002667chr61120 ----1184
NM_002687chr1451187 1181 835 512 256 2159 76 2998 846 --
NM_002693chr151326 ------
NM_002699chr1--11466 ----
NM_002709chr263111 3102 2884 1004 828 511 11225 12336 --
NM_002714chr62992 869 ------
NM_002715chr51163 11163 1904 --
NM_002716chr1193151 2926 2828 2766 2286 1461 646 197 39 --22877 1402 --
NM_002718chr361961 1892 1857 626 96 54 --32686 2579 135 --
NM_002719chr1472380 1666 1599 1495 749 621 586 ------
NM_002721chr92500 96 160 ----
NM_002731chr173083 2902 2778 2576 2024 987 81 11952 --13021
NM_002734chr1742054 1812 243 223 1423 31732 1670 638 --
NM_002736chr731831 782 513 11614 1596 1231
NM_002737chr17106648 6145 5895 4711 4429 4055 2607 1754 1373 95 22129 706 26462 912 14350
NM_002738chr1611082 ------
NM_002740chr352821 2167 2030 628 502 1131 ----
NM_002745chr2284371 3525 3438 1767 1555 1353 533 111 34508 3585 3574 ----
NM_002748chr152312 129 127 ----
NM_002750chr102198 74 ------
NM_002755chr152216 151 ------
NM_002757chr151360 ------
NM_002765chrX61019 566 480 468 301 286 2943 125 ----
NM_002767chr17----1523 --
NM_002786chr112271 81 ------
NM_002823chr2------1433
NM_002825chr71589 184 1460 --
NM_002827chr2031306 489 208 --21723 714 --
NM_002830chr21123 ------
NM_002834chr1243549 3370 3173 1395 1760 11539 --
NM_002837chr1244387 3547 1687 1225 14371 ----
NM_002838chr141096 1014 488 351 1242 ----
NM_002839chr933000 2462 680 13019 ----
NM_002840chr11469 --11541 --
NM_002843chr1141340 895 829 108 ------
NM_002848chr1231280 871 861 1109 11224 --
NM_002849chr122414 171 --11074 --
NM_002855chr1183589 3575 2660 610 592 519 309 177 ------
NM_002858chr141216 1025 556 244 ------
NM_002860chr104779 316 238 81 ------
NM_002868chr1242140 1752 1652 602 1674 --1273
NM_002869chr1111956 ----11799
NM_002874chr942307 1605 825 435 --12179 11841
NM_002886chr364882 4248 3245 2054 655 101 ----11003
NM_002890chr541031 695 294 247 ----1180
NM_002892chr1441270 1116 1104 167 11641 11178 --
NM_002899chr31134 --121 --
NM_002902chr151681 ------
NM_002906chr1141854 1736 1603 93 --11562 11828
NM_002912chr61831 ----1274
NM_002923chr12628 86 ------
NM_002924chr1------153
NM_002938chr431948 1713 1383 ------
NM_002942chr31211 ----11445
NM_002945chr171865 ------
NM_002950chr3144 ------
NM_002955chr62552 379 ------
NM_002958chr31265 176 ----
NM_002959chr184121 3680 3477 1209 1135 818 639 618 --14461 14401
NM_002968chr164822 441 232 201 2859 760 1153 --
NM_002971chr32746 89 --168 --
NM_002973chr12--1125 --1538
NM_002993chr42694 133 ------
NM_002995chr11543 1119 --1258
NM_002996chr1662009 1935 1915 1822 1250 175 --21867 1752 --
NM_002998chr82424 82 --1378 1551
NM_003010chr1722365 1985 32234 1566 174 11488 --
NM_003011chr941699 476 177 103 ------
NM_003013chr41689 1833 --1229
NM_003016chr1731786 1714 790 ----11940
NM_003022chrX11259 ------
NM_003026chr91136 ------
NM_003028chr933920 1213 359 33842 3353 3055 ----
NM_003030chr361983 1786 1667 1364 1352 151 11806 1372 --
NM_003031chr162873 400 1906 ----
NM_003036chr1----1979 11169
NM_003042chr351771 1382 642 399 265 ------
NM_003045chr1374364 3769 3379 3204 1881 1717 347 11375 ----
NM_003046chr884996 4782 4627 4017 3962 3577 1115 1093 11515 1455 --
NM_003048chr232021 1099 731 12314 12820 --
NM_003051chr151659 1619 615 604 424 11812 11494 --
NM_003068chr8--1383 ----
NM_003069chrX2570 191 ------
NM_003071chr311835 1428 1246 --
NM_003074chr321733 358 11970 ----
NM_003079chr172409 101 1777 1211 --
NM_003081chr2021007 918 1351 1163 --
NM_003093chr6--1181 ----
NM_003105chr11186 ------
NM_003106chr31713 ----1318
NM_003107chr61467 32330 2199 1949 ----
NM_003108chr255038 5028 2848 1558 1150 26576 5319 ----
NM_003111chr2--11227 1855 1154
NM_003112chr733083 2732 1038 11961 1370 --
NM_003113chr23585 260 28 --1549 --
NM_003118chr5----1379 --
NM_003128chr242716 2444 2041 496 12071 ----
NM_003137chr642078 1803 1417 211 12235 21559 117 --
NM_003142chr2--1246 ----
NM_003144chr642140 1467 880 401 --12236 --
NM_003149chr321288 538 ------
NM_003150chr1751766 1659 630 463 295 --1106 --
NM_003152chr1731077 1039 138 --1814 11218
NM_003155chr852533 2474 1928 910 603 ------
NM_003156chr1131056 1023 349 11324 --11050
NM_003161chr1743352 3072 2845 832 ----13561
NM_003162chr211003 --1423 --
NM_003173chrX31192 1114 958 11384 --1496
NM_003184chr821090 61 ------
NM_003189chr173297 2846 2401 2348 752 387 138 23306 2771 12647 --
NM_003198chr11101 1277 ----
NM_003199chr1875295 3920 3826 3738 2213 1967 1640 25446 4091 25041 4373 --
NM_003202chr521431 1329 2480 451 ----
NM_003206chr61358 ------
NM_003217chr121705 --1124 --
NM_003220chr611340 ------
NM_003221chr653573 3511 3416 3043 828 ------
NM_003222chr2031258 459 204 --11111 --
NM_003223chr16--1835 1863 --
NM_003234chr342155 718 377 122 1257 --11848
NM_003242chr33789 521 369 ------
NM_003253chr2111494 21812 1654 1161 --
NM_003255chr1741638 458 439 297 22635 655 ----
NM_003257chr1531087 1080 249 11054 ----
NM_003262chr374625 4323 3910 3456 1302 1296 1207 22085 969 ----
NM_003286chr201797 ------
NM_003290chr192763 340 166 ----
NM_003292chr132105 1604 217 --1770 --
NM_003298chr3105587 3869 2397 1942 1905 1568 1303 1025 925 459 --16031 15731
NM_003305chr41350 ------
NM_003318chr61219 ----1290
NM_003319chr22778 349 --1620 --
NM_003320chr1144478 3793 1736 1255 --11156 --
NM_003321chr161176 ------
NM_003336chrX11097 ------
NM_003337chr541673 1408 1368 159 --1436 --
NM_003338chr1031480 546 399 ------
NM_003339chr531338 1313 604 --11188 --
NM_003340chr41433 ----11202
NM_003341chr31165 --1534 --
NM_003342chr172683 544 1344 --1324
NM_003344chr71162 11219 ----
NM_003345chr161500 ------
NM_003347chr2261841 1691 1479 612 273 220 ------
NM_003348chr1241450 687 165 62 --11517 --
NM_003352chr21907 ------
NM_003355chr112335 38 ------
NM_003359chr421150 984 --1332 --
NM_003369chr113407 134 75 1307 ----
NM_003374chr51585 ----1304
NM_003375chr101158 ------
NM_003376chr631800 1446 184 ------
NM_003376chr631800 1446 184 ------
NM_003383chr92393 181 ------
NM_003385chr23878 321 147 ------
NM_003387chr241145 1124 820 89 12941 22625 898 --
NM_003390chr111698 ------
NM_003392chr333279 1727 1623 --24123 1644 24346 3169
NM_003403chr141205 181 ----
NM_003404chr2051861 1301 656 629 61 ------
NM_003406chr831820 1503 211 ------
NM_003410chrX52018 741 316 307 39 ----12920
NM_003411chrY3688 70 36 1679 ----
NM_003412chr362478 2363 2286 1943 352 305 1361 --1594
NM_003413chrX21650 797 --1121 --
NM_003418chr31224 ------
NM_003436chr193905 600 256 1755 ----
NM_003439chr783579 3539 3208 2613 2278 1418 1192 415 --12776 --
NM_003445chr191113 ------
NM_003458chr373800 3366 3127 2779 2603 478 312 --23943 994 --
NM_003462chr13653 491 280 21404 92 ----
NM_003463chr633267 875 805 1908 1619 12312
NM_003466chr242396 1680 1562 176 ------
NM_003468chr274325 3508 2740 1443 1256 843 650 --1277 --
NM_003470chr1691813 1668 1605 1553 1365 1293 715 394 66 ------
NM_003478chr1132717 326 97 ------
NM_003482chr122835 575 ----12237
NM_003483chr1232957 2848 2812 31881 885 201 --1558
NM_003487chr17124 ------
NM_003489chr2123103 1087 1872 22479 636 --
NM_003506chr821298 486 21351 385 11314 --
NM_003507chr231988 1661 443 1621 11797 --
NM_003557chr131316 1237 1105 ----11591
NM_003562chr171295 ------
NM_003565chr1261701 1581 1484 1164 696 463 --11505 --
NM_003566chr1242874 1235 458 277 1868 13310 --
NM_003569chr6----1121 --
NM_003571chr32224 201 ------
NM_003574chr18105739 5606 4215 4181 4161 4045 3734 1929 519 286 21679 325 15375 --
NM_003576chr1342757 1121 802 568 ----1940
NM_003583chr1243054 2664 2524 1120 ------
NM_003589chr1351435 578 311 305 254 --21483 1257 --
NM_003590chr2103692 3590 3017 1593 1204 1189 1047 597 455 394 --1930 --
NM_003592chr71345 ------
NM_003595chr224386 335 325 174 ------
NM_003597chr242260 2191 888 840 11509 22071 1974 --
NM_003603chr442035 1804 1430 1402 11387 ----
NM_003607chr164374 4000 3727 3671 3210 656 1590 13862 --
NM_003615chr343789 2499 834 823 1758 1344 --
NM_003618chr2--1224 --2504 114
NM_003624chr1931016 408 39 ------
NM_003626chr1111079 --1101 --
NM_003628chr23627 603 70 --143 --
NM_003629chr163374 3322 3212 2876 2186 1394 1946 ----
NM_003630chr61516 ----1731
NM_003631chr101282 --1947 --
NM_003632chr171709 ------
NM_003633chr532279 2238 260 1266 1581 1150
NM_003637chr1--11297 ----
NM_003644chr17155947 5560 5366 5220 5204 4124 2311 1951 1896 1702 1497 1140 1058 371 213 11090 1286 --
NM_003659chr221240 829 ------
NM_003660chr19------1273
NM_003663chr342609 1091 757 341 13047 ----
NM_003671chr923513 168 --33559 2376 403 --
NM_003673chr17--196 ----
NM_003677chr1241980 1889 1666 1640 ------
NM_003690chr23630 565 96 ----2217 189
NM_003692chr91175 ------
NM_003705chr24597 321 233 36 1308 ----
NM_003710chr15176 ------
NM_003718chr7----1515 --
NM_003722chr342373 2201 2133 107 ----11776
NM_003743chr221463 211 2906 202 ----
NM_003744chr1431162 372 203 --280 26 --
NM_003749chr1342302 922 683 193 22141 1840 ----
NM_003758chr153581 453 180 ------
NM_003758chr153581 453 180 ------
NM_003759chr444067 3037 559 541 11662 13920 --
NM_003762chr131337 1228 927 ------
NM_003763chr2042859 2119 1266 1128 13085 ----
NM_003769chr122264 53 ------
NM_003772chr1141229 880 385 74 ------
NM_003780chr12564 169 ------
NM_003787chr1841302 1192 538 431 11458 ----
NM_003796chr191115 1465 ----
NM_003797chr11167 1162 ----
NM_003800chr632273 2012 310 --1245 --
NM_003831chr1811376 1133 ----
NM_003846chr14707 672 631 236 1600 1262 --
NM_003850chr13------1542
NM_003858chr142683 29 1509 --197
NM_003861chr1482904 2830 2543 1853 1097 921 320 297 ------
NM_003864chr4176 ------
NM_003870chr15--12100 11578 --
NM_003872chr262616 2490 2090 2059 838 775 22721 694 ----
NM_003873chr1032136 1625 320 ------
NM_003884chr331558 1226 746 11583 ----
NM_003885chr1761077 1044 885 653 239 184 12318 ----
NM_003887chr222306 2200 ------
NM_003888chr1521067 325 ------
NM_003895chr2122050 1618 --1738 --
NM_003896chr2193 ------
NM_003899chr1362428 1874 726 305 291 116 1344 --12281
NM_003901chr1062575 1047 381 229 151 80 --11702 --
NM_003902chr12280 55 ------
NM_003913chr61613 --1649 --
NM_003916chrX41518 1172 100 28 --1479 --
NM_003924chr411243 11411 1609 --
NM_003930chr742132 1851 1749 97 ------
NM_003931chr6149 ------
NM_003934chr9--1480 11320 11042
NM_003939chr1054020 3301 2822 1365 639 ------
NM_003941chr711979 --1930 --
NM_003947chr3--11269 ----
NM_003948chr452209 1885 1706 976 290 12240 21755 415 --
NM_003949chr1731927 1657 81 --1677 --
NM_003955chr1721564 1414 ------
NM_003958chr6133743 3076 2994 2875 2712 2486 2463 2433 1491 1474 1271 431 115 13622 22987 717 13359
NM_003966chr5177219 7101 7079 6679 6069 4955 4751 4745 2659 2602 1650 1296 912 624 551 340 201 37144 1998 27 15848 12022
NM_003968chr3----2503 47 1142
NM_003971chr17----2569 546 --
NM_003972chr101140 ----1322
NM_003983chr1653618 1647 1189 1169 893 --13171 --
NM_003994chr1273798 3276 3249 2833 2822 1452 703 ------
NM_004006chrX31946 500 317 ------
NM_004007chrX31946 500 317 ------
NM_004009chrX31946 500 317 ------
NM_004010chrX31946 500 317 ------
NM_004011chrX31946 500 317 ------
NM_004012chrX31946 500 317 ------
NM_004013chrX31946 500 317 ------
NM_004014chrX31946 500 317 ------
NM_004015chrX31946 500 317 ------
NM_004016chrX31860 414 231 ------
NM_004017chrX31946 500 317 ------
NM_004018chrX31860 414 231 ------
NM_004020chrX31946 500 317 ------
NM_004021chrX31860 414 231 ------
NM_004022chrX31860 414 231 ------
NM_004023chrX31860 414 231 ------
NM_004028chr1843336 940 888 509 ----24122 737
NM_004035chr17114968 4949 4370 4132 3878 3411 3272 1743 1290 1048 797 --21544 1187 --
NM_004040chr231258 1021 426 ------
NM_004056chr81875 1837 ----
NM_004061chr51245 ------
NM_004067chr741007 617 564 212 --1508 11533
NM_004071chr2--188 ----
NM_004075chr123588 519 427 ------
NM_004077chr122934 358 ------
NM_004079chr152705 2417 876 763 589 1818 1949 --
NM_004081chrY21742 1176 --11572 --
NM_004087chr321303 396 ------
NM_004090chr1772617 2501 1314 785 706 640 411 ------
NM_004093chr1373143 2721 2689 2647 2070 832 185 22407 172 ----
NM_004094chr14102927 2758 2597 2543 2028 1863 1049 748 442 201 ------
NM_004096chr1021608 558 1828 11967 --
NM_004099chr961978 1964 1726 1327 472 263 ------
NM_004100chr632118 744 695 ------
NM_004105chr221060 1036 1423 ----
NM_004114chrX2841 277 ------
NM_004124chr1463438 2780 2647 1164 1057 254 --12517 1187
NM_004128chr131115 1154 ----
NM_004136chr1543004 2516 2378 2365 --13121 12165
NM_004145chr19--1298 ----
NM_004156chr8--127 ----
NM_004157chr31198 --1874 --
NM_004161chr22252 217 1464 11638 --
NM_004162chr321115 400 ------
NM_004170chr931726 1325 1287 1755 --11411
NM_004171chr11139476 8648 8012 7497 7359 6250 6015 1696 1373 1260 893 431 149 49296 8345 8302 6141 48066 6761 1563 1316 --
NM_004172chr51570 ----12026
NM_004176chr173475 174 44 ------
NM_004180chr21534 2508 248 ----
NM_004181chr43300 274 21 1242 ----
NM_004186chr33933 684 42 ------
NM_004193chr10----1358 --
NM_004199chr5--3267 77 65 1322 --
NM_004225chr821144 964 1997 ----
NM_004229chrX31534 1370 737 --11477 --
NM_004232chr1853036 1518 549 30 23 13209 ----
NM_004235chr91554 --1140 --
NM_004241chr10153 2767 122 ----
NM_004270chr52277 113 ------
NM_004274chr1452890 1299 1191 747 189 ----12100
NM_004279chr742373 891 705 174 11900 --21473 681
NM_004282chr62220 82 1226 ----
NM_004293chr943375 2495 2396 58 --63872 3518 3509 3087 557 97 --
NM_004306chr8143 ------
NM_004313chr171419 ------
NM_004316chr123801 84 40 ------
NM_004329chr101398 1442 11192 --
NM_004331chr81958 ----12638
NM_004337chr851704 758 699 393 330 ------
NM_004338chr18126182 6033 5128 4921 4721 4479 2737 2693 2175 555 343 135 --26486 5576 --
NM_004342chr722108 1934 ------
NM_004346chr411397 11154 ----
NM_004354chr42869 257 ------
NM_004358chr2061124 894 826 339 294 286 ------
NM_004370chr611960 --21587 1506 --
NM_004374chr81137 ------
NM_004380chr1642238 2046 1615 641 --1469 --
NM_004384chr5155 --1876 11567
NM_004386chr1961977 1902 1817 1706 325 298 1143 ----
NM_004392chr132317 43 1389 ----
NM_004393chr32891 194 ------
NM_004397chr1194298 3430 3385 3290 3240 1418 1160 844 79 12636 --23700 995
NM_004411chr7138 175 --1277
NM_004414chr2131509 544 162 ------
NM_004423chr352158 2056 2035 1737 344 --184 --
NM_004429chrX51452 1210 1155 468 201 1103 ----
NM_004430chr872782 2610 2237 1109 1036 286 268 --12291 --
NM_004432chr95731 612 424 356 328 32410 844 90 --11624
NM_004433chr121553 689 ----11193
NM_004434chr1441387 774 730 589 ------
NM_004438chr233137 2240 840 12828 22697 741 --
NM_004439chr4------147
NM_004440chr631602 1502 264 21974 1571 1451 --
NM_004441chr321208 814 ------
NM_004444chr74693 594 305 104 --1605 --
NM_004447chr123214 70 56 ------
NM_004448chr171221 1457 1587 --
NM_004449chr2131272 1018 937 --11475 1244
NM_004450chr14----2153 104 --
NM_004456chr71240 ------
NM_004457chr211244 31597 1096 524 21393 581 --
NM_004458chrX62644 2634 696 484 374 75 ------
NM_004459chr1721461 693 --3766 257 210 --
NM_004464chr413303 23247 189 --1271
NM_004480chr141266 ------
NM_004481chr142190 954 896 759 11704 12597 1669
NM_004482chr21798 ----1900
NM_004491chr1973063 2992 1721 1237 828 591 64 14091 --14379
NM_004499chr5142 ------
NM_004500chr1441471 1283 313 129 --1726 --
NM_004501chr163382 3320 3152 2709 1069 134 2902 317 24145 3626 13177
NM_004502chr171389 ------
NM_004504chr253031 936 706 408 78 --11165 --
NM_004505chr1711327 154 --11820
NM_004506chr6197 ----1479
NM_004514chr1752988 2263 838 736 599 --1849 --
NM_004516chr1921159 381 ------
NM_004517chr111187 ------
NM_004519chr8--129 --147
NM_004520chr53557 538 262 1761 ----
NM_004523chr1031401 146 76 1574 --1475
NM_004525chr221491 1167 ------
NM_004538chrX166 2807 740 1594 --
NM_004566chr1072185 2037 1930 1595 490 290 129 12307 ----
NM_004569chr141715 1199 ----
NM_004571chr2153282 2934 2501 579 283 11290 12164 --
NM_004575chr441509 1216 635 400 ------
NM_004580chr1521826 586 1175 ----
NM_004586chrX94476 4370 3946 3850 3589 823 518 434 359 ------
NM_004588chr1163865 3352 1537 1165 1026 436 ------
NM_004591chr22174 57 ------
NM_004593chr34860 767 191 74 ------
NM_004598chr563033 3026 2855 2457 687 425 1842 13350 --
NM_004602chr201966 ----11453
NM_004612chr984734 3519 3449 3133 1418 1325 517 456 11280 13632 --
NM_004614chr1672222 2007 1637 1515 262 153 99 1940 ----
NM_004621chr1121254 272 ------
NM_004622chr252107 1567 916 299 25 ------
NM_004631chr12993 430 11450 ----
NM_004637chr321097 420 ------
NM_004642chr12185 1690 ----
NM_004654chrY51138 1038 988 464 440 ------
NM_004655chr1731211 877 47 11269 ----
NM_004660chrY31554 422 338 11484 ----
NM_004663chr1521114 79 ----11528
NM_004685chr1372978 2805 2436 1965 1112 570 152 1409 ----
NM_004686chr821639 312 ----1664
NM_004687chr1761952 1738 811 398 203 119 ------
NM_004698chr12143 39 ------
NM_004703chr1752485 1034 710 549 33 ----1948
NM_004708chr19----175 --
NM_004709chrX41800 1340 1142 169 ------
NM_004719chr1272573 1834 807 734 723 705 657 ----11081
NM_004721chr3------1307
NM_004725chr1031388 1259 276 --11368 --
NM_004726chrX105732 5434 5281 4908 4485 2077 1936 1341 1309 777 --25254 36 --
NM_004730chr552159 1520 1350 236 181 2742 300 ----
NM_004734chr1332558 901 466 1254 1587 --
NM_004737chr222815 158 ------
NM_004738chr2041851 1778 629 314 ------
NM_004741chr1031439 446 377 ------
NM_004742chr31658 ------
NM_004744chr453881 3840 3750 2819 224 23327 330 1400 --
NM_004745chr855787 4400 1991 1562 576 --24643 1550 --
NM_004747chr1051402 1028 643 497 457 21286 149 --11599
NM_004748chr15103799 3721 3238 2847 2719 1670 1664 734 235 171 23331 47 ----
NM_004756chr1931411 1069 529 ------
NM_004760chr72851 433 --22384 132 --
NM_004764chr122207 45 ------
NM_004768chr141175 472 199 54 ------
NM_004774chr1733077 506 218 --1461 --
NM_004775chr1831853 1601 499 ------
NM_004776chr20113277 3059 2702 2403 2393 2325 2097 1225 1128 776 388 --32952 2894 2569 --
NM_004781chr151645 1547 1425 321 149 11281 11259 --
NM_004781chr151645 1547 1425 321 149 11281 11259 --
NM_004788chr1132709 2111 1851 --21096 608 --
NM_004789chr92441 339 ------
NM_004796chr1422184 1924 11901 ----
NM_004798chr2073620 3525 3423 3380 848 380 282 32481 1265 502 ----
NM_004801chr221393 170 ------
NM_004805chr24903 500 204 193 ------
NM_004808chr1052941 2513 2329 751 633 1249 13227 --
NM_004815chr174304 3852 3470 3426 3057 1587 443 14369 ----
NM_004817chr9--1606 ----
NM_004822chr1753053 2617 1348 1322 66 14027 ----
NM_004824chr621337 207 ------
NM_004831chr1921043 35 --11072 --
NM_004834chr252755 2681 1177 348 327 169 1823 --
NM_004836chr22223 216 ------
NM_004845chrX82996 2943 1640 1572 1543 1121 585 255 --22545 1137 --
NM_004857chr1453419 1921 1544 1185 670 24646 3112 ----
NM_004859chr1722516 2057 1101 1746 --
NM_004863chr1494912 4693 3622 3441 1551 482 347 230 60 ------
NM_004866chr564133 4054 3664 1950 869 155 --14478 --
NM_004869chr1851517 1245 1171 642 492 11437 ----
NM_004871chr1784026 3725 3193 3154 1746 1619 1513 732 ----14294
NM_004873chr1463203 2940 2534 2449 2425 964 12480 22950 614 1714
NM_004879chr11----1297 --
NM_004887chr52238 61 ------
NM_004891chr2123 ------
NM_004896chr1051318 1239 991 464 260 --1226 --
NM_004897chr101903 1842 ----
NM_004898chr432737 2028 760 --11990 --
NM_004902chr203215 131 57 2837 567 ----
NM_004904chr745405 4477 2553 957 66301 5210 4703 4413 2101 950 1339 --
NM_004905chr11934 --1263 --
NM_004906chr62227 139 ------
NM_004912chr721178 125 21185 409 ----
NM_004926chr1431788 1466 708 1378 1390 --
NM_004932chr531588 1340 1308 1717 11543 --
NM_004947chr32677 338 11609 ----
NM_004956chr774274 2874 2791 1560 737 430 77 --13891 --
NM_004958chr1----1100 --
NM_004961chrX21135 1084 1402 ----
NM_004964chr12218 190 1561 ----
NM_004965chr211484 147 1512 --
NM_004972chr92400 263 1748 1409 --
NM_004973chr631586 1396 706 11261 11487 --
NM_004976chr1175014 4477 4449 3816 3464 3244 2035 ----15109
NM_004985chr1244169 3389 3286 1819 --13620 --
NM_004992chrX108377 7450 5769 5374 3196 3139 2207 1688 1426 1373 ------
NM_004992chrX108377 7450 5769 5374 3196 3139 2207 1688 1426 1373 ------
NM_004993chr1431009 541 75 1376 ----
NM_004995chr1441497 569 273 41 --1506 --
NM_004998chr151779 ----1307
NM_004999chr623866 1066 21014 997 1874 --
NM_005006chr22249 168 185 1390 --
NM_005010chr732264 1953 466 --1373 --
NM_005011chr741755 1434 721 97 11572 ----
NM_005016chr121366 ------
NM_005017chr31254 ------
NM_005028chr1041564 707 118 98 --1211 --
NM_005032chrX11006 ------
NM_005054chr261701 1599 1341 1334 674 463 --1550 --
NM_005056chr1255614 4533 4267 1678 1213 34406 1588 893 14355 --
NM_005065chr14144703 4600 4375 4301 4286 4009 2114 1832 936 800 659 495 80 21 25106 1769 21368 720 --
NM_005068chr621434 534 ------
NM_005069chr2131561 297 270 11620 11719 --
NM_005077chr93316 137 121 1375 1422 --
NM_005079chr832274 1109 352 --164 --
NM_005087chr35853 603 594 215 174 ------
NM_005093chr20115247 5000 4844 4715 4082 4056 1968 1606 1427 1170 676 --1901 14214
NM_005095chr131443 392 373 --11711 --
NM_005096chrX51214 1095 1026 929 377 ------
NM_005104chr61556 ------
NM_005109chr362283 1910 722 562 513 407 1486 --12545
NM_005112chr43989 710 271 ------
NM_005113chr141419 ----1438
NM_005116chr2054337 1371 985 470 408 13064 12801 --
NM_005119chr141216 1082 1004 499 ------
NM_005121chr1742597 2587 2473 1531 1395 ----
NM_005124chr63961 764 325 1311 173 --
NM_005126chr31371 12183 11698 --
NM_005128chr212615 170 1480 ----
NM_005133chr111269 ----1400
NM_005134chr182849 205 ------
NM_005151chr1852199 1865 1752 1578 659 22022 672 11780 --
NM_005156chr984384 4308 3800 1750 1611 1448 1105 811 25109 471 ----
NM_005168chr241787 632 578 373 --11484 --
NM_005180chr1031491 425 377 ------
NM_005188chr11157608 7461 7269 7007 6811 6723 6182 5810 5500 5463 5221 2866 1328 962 402 --12777 --
NM_005189chr1762387 1812 1723 1584 438 205 --1221 --
NM_005191chr331262 206 106 --11449 --
NM_005194chr201103 ------
NM_005197chr14105839 5199 5071 4983 4921 4267 3957 1681 173 107 24811 1336 ----
NM_005204chr101293 ------
NM_005206chr1721221 402 ------
NM_005207chr2263548 3219 3058 2290 413 30 --52651 2455 1173 1120 1039 --
NM_005215chr183584 286 43 ------
NM_005222chr71298 ----1946
NM_005233chr341788 1595 681 355 12301 ----
NM_005235chr2127104 7066 6702 6622 6346 6286 5806 5096 4835 2656 1246 338 --25605 5414 --
NM_005238chr1142968 2826 2663 2633 ------
NM_005239chr2151832 1611 1305 776 178 ----1798
NM_005240chr1----2632 240 --
NM_005241chr3--11328 ----
NM_005244chr203668 494 219 --1625 --
NM_005254chr15155 2468 153 ----
NM_005256chr111737 1895 ----
NM_005259chr211006 ------
NM_005261chr84857 367 211 135 1870 ----
NM_005264chr101162 2621 72 ----
NM_005271chr101282 ----21208 995
NM_005275chr6--1108 ----
NM_005277chr441275 621 479 149 31838 1512 1468 11955 --
NM_005278chrX2452 131 ------
NM_005296chrX2853 289 ------
NM_005308chr101400 ------
NM_005310chr17------1321
NM_005311chr782531 923 752 736 627 412 350 279 12852 --12370
NM_005313chr1521349 1200 ----21252 25
NM_005316chr1111052 11122 ----
NM_005318chr22--11266 ----
NM_005324chr1741458 684 592 50 ------
NM_005328chr81232 ------
NM_005339chr494053 4010 3842 3639 3089 1528 743 628 574 11170 13603 --
NM_005342chrX52785 2145 567 283 25 ------
NM_005348chr143597 386 357 --2330 278 --
NM_005359chr18146463 6079 5356 5325 5316 5128 4776 4183 2326 1795 1719 1436 1118 139 --14017 11204
NM_005370chr192341 188 ------
NM_005378chr23866 170 35 --1286 --
NM_005382chr8----1118 --
NM_005385chr31878 1446 --12734
NM_005387chr113451 231 82 1589 ----
NM_005388chr931695 491 75 2678 102 --1168
NM_005392chr951684 1490 1355 714 106 21837 1365 11409 --
NM_005400chr282316 2275 1937 1883 660 642 204 23 --12776 --
NM_005402chr731729 397 28 ------
NM_005407chr1431339 1125 30 31401 1268 217 ----
NM_005410chr5--1584 ----
NM_005414chr3--1206 ----
NM_005415chr22721 660 ------
NM_005417chr2052004 1829 1484 1251 557 ------
NM_005433chr18------22474 745
NM_005435chr72203 173 ------
NM_005436chr1084025 3451 3131 3096 1563 1241 1159 973 23000 2605 --13288
NM_005437chr1081352 1135 1012 991 548 346 273 82 11260 ----
NM_005442chr32538 110 ------
NM_005443chr4181 1421 1395 --
NM_005455chr151685 1663 1318 463 376 --1705 --
NM_005458chr932136 799 385 --1961 --
NM_005461chr205741 698 363 189 107 ------
NM_005475chr1253320 2984 2929 2827 231 ----13182
NM_005476chr951445 434 347 117 60 ------
NM_005483chr19----192 --
NM_005487chr2242008 858 687 176 --11977 --
NM_005493chr61312 1772 1619 --
NM_005494chr72604 242 ------
NM_005497chr17106133 5504 5162 4260 3768 2461 1554 1014 985 281 11208 21388 439 --
NM_005499chr192668 74 ------
NM_005501chr1731161 436 411 11173 ----
NM_005502chr953056 2898 2870 2805 2726 31103 209 195 ----
NM_005506chr412476 1255 1389 --
NM_005509chr521395 106 ------
NM_005522chr721008 388 --1525 --
NM_005524chr3--1232 1120 --
NM_005542chr741548 1450 1403 331 ------
NM_005563chr12636 237 ------
NM_005566chr112558 420 --1207 --
NM_005570chr1821129 1093 ------
NM_005573chr5----1191 --
NM_005574chr11185 ------
NM_005575chr51263 ------
NM_005576chr151242 ------
NM_005578chr364371 3745 3377 214 202 120 --13197 --
NM_005587chr1531015 1001 953 1208 ----
NM_005591chr1141125 902 777 195 --1161 --
NM_005593chr121136 1512 1554 --
NM_005595chr11917 2831 207 ----
NM_005596chr974492 4108 2093 1490 1345 473 356 35429 5083 1363 --26077 3967
NM_005599chr121222 328 ------
NM_005603chr181542 --172 --
NM_005604chr642283 726 693 75 --12478 --
NM_005626chr11429 ------
NM_005630chr321707 42 --11256 --
NM_005634chrX280 28 2249 114 1674 --
NM_005637chr1831651 1620 155 1323 32046 775 119 --
NM_005638chrX41482 1360 603 163 --1138 1359
NM_005644chr1------1377
NM_005647chrX83203 3133 3127 2879 1296 1077 905 548 --23412 3105 1512
NM_005650chr2211390 --21242 377 --
NM_005655chr821276 34 --21323 814 --
NM_005665chr153697 3646 1671 370 279 13528 2799 478 --
NM_005668chr5104392 4346 3303 3013 2839 1757 1395 904 400 380 --12824 --
NM_005688chr321196 92 --11316 --
NM_005704chr11140 11115 ----
NM_005711chr511029 ------
NM_005715chr632256 2036 53 --1249 --
NM_005717chr1----11061 --
NM_005721chr21399 ------
NM_005722chr262431 1752 1726 668 245 155 ------
NM_005734chr111133 ------
NM_005737chr242625 2291 725 490 11161 ----
NM_005738chr772068 1644 1493 1485 1404 156 119 21976 391 ----
NM_005746chr742569 2518 2148 693 1609 ----
NM_005748chr1263432 3338 2710 2648 2429 890 ------
NM_005754chr531107 279 79 --1913 --
NM_005756chrX31283 1251 392 21495 488 ----
NM_005759chr284700 4315 3640 3081 1894 1394 969 907 --24303 3258 11810
NM_005761chr121114 ------
NM_005768chr123676 479 201 ------
NM_005779chr552745 2636 2351 703 426 --142 --
NM_005781chr31204 --1559 --
NM_005786chr182120 95 2967 893 ----
NM_005789chr1752179 1651 547 540 57 ------
NM_005795chr222151 471 12412 2749 647 --
NM_005813chr222555 831 22195 74 ----
NM_005822chr64666 411 270 122 1827 ----
NM_005826chr11626 1453 ----
NM_005828chr1784983 4731 4574 4460 3888 3797 687 546 --21804 1641 25076 480
NM_005832chr321151 936 1499 ----
NM_005833chr92164 116 ------
NM_005834chrX1239 ------
NM_005839chr12865 797 1836 ----
NM_005840chrX86839 5343 2612 2587 2041 1625 736 171 15612 13015 21518 1000
NM_005871chr101858 1850 ----
NM_005880chr161381 --1601 --
NM_005885chr52395 243 --21257 660 --
NM_005896chr22545 183 ------
NM_005898chr1162698 2621 2380 1148 231 224 --13085 --
NM_005900chr441234 173 98 41 --1267 --
NM_005901chr18148368 8298 7994 7740 7625 7517 6934 6367 3471 3034 2870 2539 1504 871 26899 3434 58638 5537 2378 2341 145 28265 7556
NM_005902chr15103676 3083 2851 1797 837 718 545 537 395 226 24602 3698 --14471
NM_005903chr5114751 4548 4284 3845 3689 1984 1775 1333 775 433 62 --25204 1969 --
NM_005904chr1831373 413 56 ------
NM_005906chr661355 653 622 575 543 391 --11501 11470
NM_005907chr621410 90 --11310 --
NM_005909chr554096 3292 3053 1669 1296 --138 --
NM_005910chr17103788 3675 3425 3076 3016 2606 2578 1484 978 839 11016 1495 --
NM_005911chr251256 561 531 368 297 --1962 --
NM_005920chr163486 3291 1235 633 293 109 --12598 --
NM_005924chr71885 41170 1131 901 748 ----
NM_005933chr1152850 2789 2610 2355 1086 12520 22268 2000 --
NM_005935chr4135084 4838 4820 4565 4389 3802 3750 3205 1870 1536 1427 227 28 25107 3678 14691 --
NM_005937chr17104030 3849 3740 3384 2785 1473 936 693 222 105 14110 13798 14102
NM_005941chr852814 1379 534 233 223 --13301 --
NM_005943chr641600 1195 1069 599 ------
NM_005944chr331100 1015 938 ------
NM_005955chr164931 3723 1911 1684 1577 377 ----13503
NM_005962chr1052332 1735 1684 824 461 ----11472
NM_005962chr1052332 1735 1684 824 461 ----11472
NM_005966chr211719 --21728 412 --
NM_005968chr192236 56 --1216 --
NM_005984chr22160 ------
NM_005986chr1362561 2248 2229 1800 1084 116 1644 ----
NM_005996chr1241042 593 550 521 --157 --
NM_005998chr1190 ------
NM_006007chr943949 3618 3225 3080 --131 --
NM_006009chr121151 ------
NM_006011chr15113727 3690 3328 3274 3173 1684 1590 1201 716 323 113 14185 ----
NM_006012chr191185 ------
NM_006016chr652092 1590 1516 870 318 ------
NM_006020chr1441233 910 175 143 --1551 --
NM_006022chr132928 890 --1845 --
NM_006023chr101168 ------
NM_006030chr321665 151 11801 --11775
NM_006033chr1842040 1740 471 112 11609 ----
NM_006035chr14--21257 975 --1110
NM_006036chr242531 1028 892 853 11582 12015 --
NM_006037chr284778 4305 4146 3823 3574 3140 1201 28 --44895 4372 3493 3373 1474
NM_006038chr2041458 1403 658 195 ------
NM_006040chr16----1469 --
NM_006043chr163695 276 133 --1638 --
NM_006047chr2083493 3162 1274 1022 680 578 452 434 22991 2586 22442 2213 --
NM_006054chr1121632 1507 ------
NM_006064chrX1139 ----1321
NM_006077chr10177 ------
NM_006080chr7----12458 --
NM_006089chrX51610 1561 1485 1290 1213 --21601 157 --
NM_006090chr11491 --1632 1188
NM_006091chr1521763 579 ----11365
NM_006094chr84693 624 323 196 ------
NM_006095chr494374 4207 4012 3764 3565 1657 1046 729 260 23784 230 ----
NM_006106chr11103259 2971 2684 2671 2657 2372 2099 591 424 157 11033 ----
NM_006107chr172352 345 ------
NM_006108chr1162339 2057 1985 1624 304 135 11665 --1246
NM_006113chr111971 11622 32068 1989 1778 12126
NM_006134chr2161531 1491 1399 1347 363 316 --21547 292 --
NM_006135chr1--1189 --1380
NM_006141chr1662757 2153 2034 830 268 199 ------
NM_006145chr1921014 745 --1709 --
NM_006147chr11184 1462 ----
NM_006154chr1562934 2041 866 573 114 57 22393 337 --12012
NM_006158chr831423 1404 693 11527 ----
NM_006159chr123622 567 112 ------
NM_006166chr1242307 2097 2070 469 1103 ----
NM_006178chr1751562 1540 1487 1380 1333 ------
NM_006180chr922144 426 --1489 --
NM_006186chr231071 965 912 11164 ----
NM_006194chr143534 143 112 --11078 --
NM_006195chr92985 36 --1116 1972
NM_006197chr822241 190 12222 ----
NM_006200chr9123 ------
NM_006202chr1931937 98 90 --11982 --
NM_006203chr575235 5128 1685 1336 1276 888 132 ----14140
NM_006206chr412292 12243 3595 285 185 --
NM_006212chr121267 71 11357 ----
NM_006216chr22520 41 ------
NM_006218chr31268 ------
NM_006224chr1752419 1840 1638 1601 405 --12482 12461
NM_006241chr352401 1842 568 192 70 --12279 --
NM_006243chr11195 1936 ----
NM_006246chr142218 111 ------
NM_006247chr19------1119
NM_006251chr532413 2095 502 --22736 526 --
NM_006252chr1147044 6750 6659 6401 5639 5363 4897 2990 2729 2679 1467 1246 1011 654 --32906 2720 1768 13010
NM_006253chr1221260 921 ----11287
NM_006256chr132736 2362 888 ----12210
NM_006264chr4------1574
NM_006267chr251792 1780 1756 1656 170 1754 1266 1563
NM_006275chr2062448 2369 2035 1911 1642 217 1200 1820 --
NM_006281chr851131 1015 427 291 227 ------
NM_006281chr851131 1015 427 291 227 ------
NM_006282chr20104406 3570 3321 2893 1786 1337 1312 608 175 117 21135 591 13266 --
NM_006283chr833629 66 50 11501 --13279
NM_006287chr242604 2503 2249 1900 --1172 --
NM_006306chrX95909 4878 4809 4519 3739 2332 873 764 703 --11571 --
NM_006313chr1241547 1335 1134 578 2599 216 ----
NM_006315chr483854 3435 3181 3060 2755 1621 1464 252 ----14358
NM_006321chr332178 1376 900 ------
NM_006323chr4--1713 ----
NM_006328chr111205 --1180 --
NM_006330chr811540 ----11049
NM_006350chr51382 ------
NM_006352chr151951 1762 1375 832 89 ------
NM_006353chr63404 296 136 ----11077
NM_006357chr21444 1481 --1182
NM_006359chrX72396 2111 1736 929 540 470 437 ------
NM_006362chr111254 ----1214
NM_006364chr1421257 823 ------
NM_006366chr61203 1825 ----
NM_006370chr14136 --143 --
NM_006371chr3125248 4856 3978 3815 3783 3518 3324 1546 1491 928 458 55 ------
NM_006372chr61455 ----2386 370
NM_006375chrX21763 319 ----11349
NM_006379chr71618 1164 ----
NM_006380chr1763472 3297 3055 2921 530 150 12998 11640 --
NM_006386chr2211628 --12456 --
NM_006389chr1111358 ------
NM_006393chr10104449 3683 3472 2973 2914 1379 902 575 363 212 14204 --13123
NM_006401chr9--1362 ----
NM_006403chr62525 428 21815 1693 ----
NM_006420chr2043279 2863 2264 105 1412 ----
NM_006424chr42721 645 31790 1758 1494 --11665
NM_006430chr23410 78 67 ------
NM_006451chr521077 826 ------
NM_006457chr472766 2759 1175 1061 817 561 349 ------
NM_006460chr1731439 633 215 ----11652
NM_006464chr261521 1389 985 574 509 236 --195 --
NM_006467chr531614 1481 148 ------
NM_006469chr121119 219 ------
NM_006471chr18243 33 ------
NM_006472chr15989 509 471 395 388 --11201 --
NM_006475chr132271 246 ------
NM_006478chr22150 ------
NM_006482chr1243054 2664 2524 1120 ------
NM_006486chr221222 --1678 --
NM_006489chr1431623 219 73 ------
NM_006494chr192886 96 ------
NM_006496chr141688 1278 508 477 --1726 --
NM_006504chr1072942 2847 2478 2385 2307 1815 653 42888 2026 1030 107 ----
NM_006516chr111085 11366 ----
NM_006517chrX31512 1483 483 2933 641 1713 --
NM_006519chr6196 ------
NM_006521chrX21427 418 ------
NM_006526chr201685 21946 1563 ----
NM_006534chr2053352 2640 478 328 95 12585 11304 --
NM_006536chr13682 377 193 ------
NM_006538chr253444 1218 985 846 112 ----12721
NM_006540chr831405 398 357 --11453 --
NM_006544chr1455226 5081 4466 4029 1565 42399 2258 1730 345 ----
NM_006546chr17106455 6234 6056 6035 5673 5180 4057 1994 1376 1102 25476 2662 ----
NM_006547chr722120 280 ------
NM_006548chr331531 1341 1334 ------
NM_006549chr1262515 1989 1868 1191 783 146 ------
NM_006558chr8----1141 --
NM_006559chr11258 157 --11096
NM_006560chr112498 465 1379 1156 --
NM_006561chr1086255 5673 5642 2154 1842 1256 1133 836 --21859 1570 --
NM_006565chr161973 ----1803
NM_006572chr1733469 2662 1302 ------
NM_006574chr31297 289 71 ----
NM_006593chr22687 218 1323 ----
NM_006595chr1141304 334 276 265 1191 12021 --
NM_006599chr1677145 5981 5616 5494 3105 1706 1521 26945 6837 27843 55 12513
NM_006601chr1211063 ------
NM_006603chrX21765 1742 11923 1521 --
NM_006609chr252369 2218 2053 1061 681 --12031 --
NM_006614chr343466 2789 1278 409 11095 12533 11069
NM_006618chr131156 479 434 ------
NM_006622chr52487 183 ------
NM_006624chr1051822 1606 1460 741 414 --1440 1645
NM_006625chr141021 465 423 416 ----1202
NM_006625chr141021 465 423 416 ----1202
NM_006625chr141021 465 423 416 ----1202
NM_006626chr972633 2337 2250 1832 1826 1081 101 22305 946 11947 --
NM_006628chr1554558 3499 1331 1181 969 21729 344 12971 --
NM_006631chr192623 175 ----1101
NM_006636chr2--1119 1287 --
NM_006646chr1332946 2035 1973 --12490 --
NM_006650chr543456 1304 701 653 13913 --13971
NM_006654chr1264609 4154 2955 1544 1038 33 11383 24106 3721 13832
NM_006667chrX21129 480 ------
NM_006670chr62144 111 ------
NM_006675chr1253136 3103 1240 780 65 --1336 --
NM_006690chr2051903 1754 1655 1606 1507 12347 ----
NM_006695chr172281 74 --147 --
NM_006699chr141005 830 351 163 --12642 --
NM_006704chr131125 ------
NM_006706chr54581 238 178 155 1757 1789 --
NM_006713chr5----1203 --
NM_006716chr761329 1019 382 268 204 100 11127 ----
NM_006717chr973147 2443 2063 1212 861 603 498 12361 ----
NM_006718chr611121 1195 ----
NM_006721chr101571 ----1290
NM_006722chr362698 2454 2366 2309 678 517 11048 --12333
NM_006726chr411068 11054 ----
NM_006729chrX95585 4833 4195 4140 3443 1962 1922 1065 466 --24732 3602 --
NM_006734chr621538 258 1327 1495 --
NM_006745chr421093 1057 --11066 --
NM_006748chr821738 66 ------
NM_006750chr16157865 7585 7218 7177 5770 2682 2348 2195 1507 1154 667 409 400 180 27 28092 6519 17476 --
NM_006751chr22933 84 --1796 --
NM_006754chr761201 1000 436 129 102 63 1818 ----
NM_006759chr22296 257 ------
NM_006763chr121782 765 --21925 1867 --
NM_006766chr882361 2301 2121 968 951 894 698 212 32633 2580 2525 12531 --
NM_006769chr11263 193 ----
NM_006773chr251342 468 335 245 23 --134 --
NM_006775chr632932 2518 2173 --33103 2795 2079 --
NM_006777chrX42937 2589 2444 653 2912 430 12827 --
NM_006783chr131239 ----1510
NM_006788chr1842125 1358 767 261 ----11800
NM_006800chrX3665 215 117 --1598 --
NM_006805chr53304 275 183 11086 1400 --
NM_006807chr1731092 995 243 --11315 --
NM_006811chr202667 304 --1733 --
NM_006815chr1261234 1022 546 461 206 54 --2992 538 --
NM_006818chr12691 29 --2920 89 --
NM_006827chr1463270 3108 2913 2253 447 312 13006 --131
NM_006828chr63477 458 90 1517 ----
NM_006838chr1251667 1598 751 672 45 21754 654 11377 11780
NM_006851chr1252911 2809 2795 2607 2106 ------
NM_006852chr1772781 2540 2376 2108 1068 1039 184 1207 ----
NM_006854chr751872 1755 1564 363 184 11983 11338 --
NM_006861chr1221564 684 ------
NM_006870chr204744 655 555 110 1697 1342 --
NM_006884chr361983 1786 1667 1364 1352 151 11806 1372 --
NM_006885chr1694049 2982 1602 1369 1303 1074 1047 987 192 21349 331 44168 2588 524 415 --
NM_006888chr1423424 1037 42339 913 552 353 ----
NM_006908chr73587 371 295 21005 46 ----
NM_006912chr122321 1700 22150 832 22461 900 --
NM_006915chrX21743 810 --1842 1551
NM_006920chr23678 199 160 --1687 --
NM_006922chr232396 2202 24 --11792 --
NM_006924chr1773885 3529 3381 3048 2839 641 342 22888 129 --14243
NM_006925chr141452 1151 ----
NM_006940chr1211633 1505 ----
NM_006943chr2043343 2822 2766 1119 ------
NM_006947chr461203 1181 1119 683 244 126 1201 11718 --
NM_006951chr102772 720 ----1810
NM_006981chr942875 2428 2396 641 22977 377 ----
NM_006991chr32995 177 ------
NM_006997chr101482 1301 ----
NM_006999chr522092 1288 ----11378
NM_007005chr9147 ------
NM_007007chr1294202 3955 3545 721 585 487 390 347 84 --24722 1558 14822
NM_007008chr22318 88 --1294 --
NM_007010chr1731450 1256 536 1745 1568 --
NM_007011chr1596233 5883 5418 4271 2550 2482 2350 1479 1249 ------
NM_007013chr81741 --2793 366 --
NM_007014chr1611778 --1672 --
NM_007017chr53894 355 158 ------
NM_007034chr1------1719
NM_007035chr122688 556 1613 ----
NM_007038chr21145867 5846 5712 5577 5487 5474 5007 4302 3847 1892 1849 837 305 196 25937 5566 --15394
NM_007039chr1431494 529 232 1901 1439 1484
NM_007040chr191732 ------
NM_007042chr332202 920 334 ------
NM_007050chr20157650 6416 5810 5803 5318 2886 1848 1777 1263 1216 1184 1126 757 632 278 38038 6052 764 27049 2249 --
NM_007054chr533046 1203 944 --12872 --
NM_007064chr311243 ----1655
NM_007067chr1761363 1245 519 507 153 86 ------
NM_007068chr222699 81 ------
NM_007078chr1062562 2488 2472 1889 849 565 ------
NM_007084chr1321331 586 ------
NM_007106chr1321905 37 1204 12573 --
NM_007107chr332322 2174 29 ------
NM_007124chr631770 1433 429 ------
NM_007125chrY11300 ------
NM_007144chr174929 491 282 105 11306 11239 --
NM_007146chr1722028 864 --11920 11138
NM_007150chrX32020 708 289 1215 ----
NM_007157chrX22649 156 11099 ----
NM_007158chr131120 1059 301 11166 2887 336 --
NM_007166chr1121267 1172 ----11548
NM_007173chr1141886 507 426 316 ----1692
NM_007174chr1272384 1745 927 683 595 410 32 --22401 246 --
NM_007175chr8123412 3320 3249 3138 2797 2768 2317 2235 1231 828 611 517 13553 12579 --
NM_007190chr102763 30 1917 2957 931 --
NM_007191chr122206 49 ------
NM_007197chr121244 --1928 --
NM_007202chr171719 ------
NM_007203chr953817 3610 3210 3068 945 13083 ----
NM_007207chr12934 671 --1860 --
NM_007210chr1242306 750 563 357 ------
NM_007212chr151899 1811 876 241 93 1430 ----
NM_007214chr64530 364 255 164 --21352 1302 --
NM_007218chr82611 350 ------
NM_007222chr841836 1429 1315 427 ------
NM_007229chr22----2329 289 --
NM_007236chr1541901 1539 838 741 ----1819
NM_007246chr441068 840 791 303 1355 ----
NM_007249chr1379464 9426 7709 7677 6379 3696 1208 29058 6970 18386 --
NM_007260chr12764 69 --1681 --
NM_007269chr1--1197 ----
NM_007271chr631806 1558 1398 21708 42 --11697
NM_007276chr721009 183 ----11055
NM_007285chr16------147
NM_007292chr17114968 4949 4370 4132 3878 3411 3272 1743 1290 1048 797 --21544 1187 --
NM_007308chr41219 ------
NM_007322chr192408 39 ------
NM_007345chr1832215 1588 564 1332 ----
NM_007346chr201350 1255 ----
NM_007347chr1542630 2259 1052 137 ------
NM_007349chr74426 379 331 94 ------
NM_007363chrX2903 301 --2795 336 --
NM_007368chr1331386 1330 246 11309 ----
NM_007372chr172839 267 --1855 --
NM_007375chr142377 2034 1093 380 11840 21950 787 --
NM_012069chrX42526 2460 1722 816 ------
NM_012081chr563770 3482 2989 2299 154 94 --22973 1496 --
NM_012083chr102942 111 ------
NM_012090chr121303 36 ------
NM_012095chr1073481 3033 2663 1419 1319 1047 666 13465 12542 --
NM_012096chr322982 2620 13502 ----
NM_012097chr241985 1577 1438 359 --12048 --
NM_012102chr142530 2405 2232 278 --12447 --
NM_012104chr1153352 382 298 139 59 ------
NM_012104chr1153352 382 298 139 59 ------
NM_012117chr12--133 ----
NM_012124chr111825 1295 ----
NM_012137chr161171 1130 912 518 512 116 22719 2097 ----
NM_012141chr13123804 3123 2677 2548 1577 1083 1004 823 606 532 348 75 13683 13257 2771 374
NM_012153chr1162385 2151 2001 1696 911 317 1849 ----
NM_012156chr2043121 2865 2635 629 23416 2842 ----
NM_012158chr1331863 1683 1281 1665 11788 --
NM_012161chr451090 932 926 81 21 --1793 --
NM_012164chr9127133 6124 6115 5773 5678 4724 2454 2271 2166 809 608 31 24921 1671 15384 --
NM_012175chr115822 632 598 275 179 ------
NM_012180chr41551 ------
NM_012183chr1------1612
NM_012193chr11105230 4442 3991 3887 2026 1591 1563 993 601 192 45093 4254 1629 1289 21749 554 --
NM_012197chr921477 1223 --1519 --
NM_012207chr101190 ------
NM_012214chr2126090 5612 5282 4340 4328 4195 3959 2568 2359 1295 902 99 14865 24592 4046 13941
NM_012215chr1071778 1363 1328 766 700 239 156 1668 149 1604
NM_012218chr1972840 2824 2764 2595 2326 2203 1093 --1234 --
NM_012219chr332876 2838 1261 13231 ----
NM_012223chr211117 141 ----
NM_012224chr421112 324 --1473 --
NM_012229chr1031454 1312 1026 ------
NM_012234chr363628 3345 3285 2995 1129 1059 12547 23401 2319 --
NM_012238chr10--1435 ----
NM_012242chr103326 291 158 ------
NM_012249chr273402 2893 2876 2440 1367 866 798 1409 ----
NM_012250chr111453 11374 2947 75 --
NM_012255chr20----1108 --
NM_012257chr71831 11056 ----
NM_012259chr621066 976 ----11408
NM_012262chr194526 4001 1650 1503 1374 1292 1249 329 58 24690 1068 1461 --
NM_012264chr2221615 472 11972 22042 1927 --
NM_012264chr2221615 472 11972 22042 1927 --
NM_012266chr911084 ------
NM_012281chr71717 1963 1230 --
NM_012287chr374292 3793 3317 3108 3059 774 354 13504 ----
NM_012288chr6145085 4526 4328 4129 3708 3576 2173 1771 1394 1303 1119 1009 590 373 13743 14872 --
NM_012290chr221280 573 ------
NM_012294chr7103691 2957 2880 2530 1632 1365 904 616 396 39 ----14046
NM_012296chr1143726 1518 883 640 ------
NM_012297chr442474 2014 407 60 22102 1693 ----
NM_012300chr522154 377 12400 11002 --
NM_012301chr721661 218 11557 12189 --
NM_012302chr131189 926 145 ----1185
NM_012307chr183820 685 140 ------
NM_012308chr1152439 2125 1873 798 433 --12040 --
NM_012309chr11124854 4736 4648 4515 4457 4221 4203 4076 3617 1764 981 35 23390 347 ----
NM_012316chr195199 4962 4649 3722 2149 2039 1684 1509 437 21658 588 14036 1537
NM_012318chr431296 469 73 ------
NM_012325chr2051296 1127 1058 502 142 ----1195
NM_012326chr21104 ------
NM_012329chr1731259 1242 452 --11616 --
NM_012330chr1051590 1397 1256 542 468 21145 1117 ----
NM_012333chr161390 1322 1172 601 515 474 ------
NM_012343chr531113 1106 1050 ------
NM_012383chr9----160 --
NM_012384chr2062459 2243 1813 1788 1540 287 12427 ----
NM_012388chr1573017 2954 2935 2023 1235 675 240 --1430 --
NM_012395chr772902 2385 1189 1129 920 799 196 23418 3048 1216 1840
NM_012399chr2231968 1660 112 ----1655
NM_012402chr1141165 493 410 88 ------
NM_012405chr153005 2361 952 703 24 13476 ----
NM_012413chr2--1455 ----
NM_012416chr92988 197 ------
NM_012417chr17192 ------
NM_012419chr61140 ------
NM_012420chr102462 87 --1172 --
NM_012421chr11403 ------
NM_012428chr152816 252 1760 ----
NM_012448chr1762171 1992 1623 680 377 56 --1310 --
NM_012454chr61231 ------
NM_012461chr143760 616 525 ------
NM_012464chr462162 1933 994 905 614 381 1142 --1439
NM_012471chrX81952 1874 1648 633 468 349 339 167 ------
NM_012486chr15524 452 415 400 186 ------
NM_013229chr1252796 2382 2370 817 607 32762 2744 1051 2257 192 --
NM_013231chr14113802 3793 3781 3545 3213 1453 1391 1380 1191 1138 341 --34391 4353 1081 --
NM_013236chr2231195 220 183 ------
NM_013246chr111666 1941 151 --
NM_013255chr798186 8078 7335 7248 6289 5939 743 580 447 11983 38782 1107 918 17103
NM_013257chr841929 1785 632 206 22286 386 1938 --
NM_013261chr443328 2536 1459 938 1629 11394 12303
NM_013262chr611047 ------
NM_013269chr123745 480 392 --14201 --
NM_013272chr151257 --1148 --
NM_013277chr122912 697 --2777 203 --
NM_013279chr1121900 783 12370 21615 687 --
NM_013281chr2021321 415 21312 387 1296 --
NM_013282chr19----11309 --
NM_013286chr383221 3019 3010 2359 1475 953 498 85 1743 11161 --
NM_013292chr16185 ------
NM_013293chr72222 115 1260 ----
NM_013302chr1663814 3600 3123 1729 1579 660 11330 13863 --
NM_013309chr1522545 184 12625 ----
NM_013313chr2243079 2784 395 301 12198 ----
NM_013323chr172906 407 --1446 --
NM_013341chr262166 1169 1163 1081 915 425 12748 ----
NM_013357chr81819 --1621 --
NM_013367chr4180 ------
NM_013368chr192415 119 ------
NM_013372chr1563268 2898 2144 943 833 532 --22584 327 --
NM_013377chr121575 --1469 --
NM_013386chr121615 388 ----11708
NM_013396chr211288 ------
NM_013409chr5137 ------
NM_013423chrX--11012 11292 --
NM_013427chrX--11012 11292 --
NM_013433chr1962060 1910 1376 1308 725 662 --12038 --
NM_013437chr831423 1334 1299 ----1404
NM_013438chr91412 ------
NM_013444chrX41142 929 243 220 ------
NM_013446chr731276 1027 545 ------
NM_013447chr1943330 2318 887 248 --189 --
NM_013450chr231061 873 504 ----1393
NM_013951chr242396 1680 1562 176 ------
NM_013952chr242473 1757 1639 253 ------
NM_013953chr242473 1757 1639 253 ------
NM_013989chr1485145 4935 4074 3509 1387 1263 1120 400 15130 --13221
NM_013992chr242473 1757 1639 253 ------
NM_013995chrX62451 1949 1038 893 493 176 12411 1820 12123
NM_013999chr17--11339 --11520
NM_014001chr1731631 648 29 --11526 --
NM_014021chr123260 2346 1968 ----
NM_014023chr1062833 2251 1117 970 939 805 2199 119 12151 --
NM_014028chr653267 2425 2114 1257 397 1597 12348 13163
NM_014034chr621384 1066 ------
NM_014038chr72360 130 ------
NM_014048chr1664539 4346 4324 3590 1426 517 15109 ----
NM_014066chr8--1311 1369 --
NM_014089chr1352230 2120 546 403 177 11430 1439 --
NM_014109chr83464 432 206 ------
NM_014112chr875186 4899 4307 3678 1914 817 257 22044 1195 11038 --
NM_014117chr1641954 1821 830 98 1177 1649 --
NM_014141chr765300 4339 4236 4211 4086 1293 --14393 --
NM_014149chr72805 771 ------
NM_014154chr331059 424 262 11440 ----
NM_014155chr1187275 6203 6158 5504 1920 813 54 40 46929 6147 5978 328 ----
NM_014157chr1693989 3613 2934 2843 1355 1046 870 837 690 ------
NM_014176chr1166 ----1123
NM_014191chr1221032 160 ------
NM_014212chr121275 ------
NM_014217chr121282 598 ------
NM_014233chr1761872 1733 1674 1667 1390 68 ------
NM_014240chr353710 2999 2678 1604 739 1570 ----
NM_014241chr10----185 --
NM_014243chr441861 1498 1413 588 --11849 --
NM_014246chr222430 48 --1537 --
NM_014250chr2242008 858 687 176 --11977 --
NM_014251chr74913 860 226 105 1628 ----
NM_014263chr101128 --11327 --
NM_014265chr83805 779 145 ------
NM_014267chr11--288 23 ----
NM_014271chrX1593 2164 138 1220 --
NM_014279chr92821 102 ----1961
NM_014283chr13555 334 165 11010 1442 --
NM_014284chr11675 ------
NM_014285chr93308 105 35 1823 ----
NM_014289chrX11047 ------
NM_014293chr22123988 3747 3535 2692 2656 2553 1456 974 724 589 391 42 --13478 --
NM_014299chr1951934 817 444 415 389 12151 ----
NM_014300chr151466 ------
NM_014309chr2265169 4736 4475 4373 4331 3660 24616 1803 --21320 1177
NM_014316chr1672171 1973 1836 843 428 45 23 11768 1856 --
NM_014317chr101241 --172 --
NM_014319chr122613 366 2574 349 11519 11696
NM_014323chr22--1790 21035 828 --
NM_014325chr1231484 463 439 1450 ----
NM_014331chr4107713 6794 6394 5882 5486 1382 1207 564 96 21 16573 35611 5583 5362 27112 2820
NM_014333chr1151880 1852 1105 342 300 ----12522
NM_014335chr1521057 972 1574 1261 11204
NM_014342chr1141388 1095 963 113 1325 2505 290 --
NM_014345chr61797 --1282 1828
NM_014350chr511033 ------
NM_014360chr143588 578 37 ------
NM_014363chr13131 1425 ----
NM_014372chr131832 1723 212 --1250 11581
NM_014382chr31185 21769 496 ----
NM_014392chr451377 1302 1087 630 54 11061 ----
NM_014393chr832016 867 746 ------
NM_014399chr72996 733 --141 1299
NM_014415chr321355 1187 139 11714 --
NM_014418chr1481919 1653 1355 812 701 678 415 243 ------
NM_014421chr4--12061 11582 12092
NM_014423chr5115318 5205 5181 4132 3654 3644 3490 2223 2099 1794 428 25600 2239 ----
NM_014445chr362296 2162 1510 639 403 195 11825 ----
NM_014447chr4--11042 11431 --
NM_014452chr651141 1047 982 934 859 --1434 --
NM_014454chr62784 400 --1983 11027
NM_014456chr1031705 1468 468 ------
NM_014458chr121041 57 267 22 21308 306 --
NM_014488chr112536 512 ------
NM_014491chr72786 773 ------
NM_014494chr1662308 1501 748 737 699 504 --21878 127 --
NM_014498chr31353 ------
NM_014503chr121423 ------
NM_014515chr121660 11055 1866 11021
NM_014517chr331360 696 639 --11934 --
NM_014521chr21450 11780 ----
NM_014554chr12102300 2097 1718 527 365 346 201 71 50 25 --1279 12029
NM_014563chrX72106 2093 1958 647 496 316 202 12099 ----
NM_014572chr1331197 694 317 11248 ----
NM_014577chr224807 789 718 27 ------
NM_014585chr231115 388 121 11252 ----
NM_014587chr1631139 365 47 11353 --11319
NM_014592chr52124 75 ------
NM_014600chr241403 1348 596 119 ----11530
NM_014606chr431391 623 377 1218 ----
NM_014607chr241878 787 781 337 --1747 1477
NM_014612chr941297 1092 960 122 ------
NM_014614chr231297 473 464 11062 11111 --
NM_014615chr1673388 2531 1358 960 377 168 61 21377 782 ----
NM_014616chr33428 258 242 1110 12248 --
NM_014630chr1583900 3269 2832 2742 2430 732 522 257 23076 921 ----
NM_014634chr22113477 2754 2599 2533 2228 1450 1265 1204 1081 742 42 --11300 --
NM_014635chr251679 1309 638 427 160 --1512 --
NM_014636chr974373 4365 4188 3794 3451 2863 712 14283 22836 1270 --
NM_014646chr1863075 2577 2204 995 899 246 --12147 --
NM_014647chr1632162 662 589 --12223 --
NM_014655chr192286 1997 1973 1583 1525 1488 922 440 150 --11647 --
NM_014659chr15--1262 ----
NM_014660chr721049 335 ------
NM_014667chr332126 1526 364 11624 ----
NM_014670chr221533 521 --11288 11603
NM_014674chr373980 3157 3004 1295 528 335 26 ------
NM_014676chr151698 1644 1537 1489 1352 1172 --11392
NM_014679chr1131397 1016 554 --1466 1271
NM_014682chr821669 488 ----12122
NM_014683chr1772158 2016 1992 1716 1693 1366 522 22023 221 ----
NM_014685chr161531 ------
NM_014690chr762805 2787 2781 2635 1894 880 ------
NM_014701chr1543355 3123 1050 990 1749 ----
NM_014702chr672120 1284 1137 648 415 382 261 22777 697 ----
NM_014705chr712033 11722 ----
NM_014707chr722226 1424 ------
NM_014711chr1632033 1533 1367 ------
NM_014713chr21520 ------
NM_014717chr193859 593 40 ------
NM_014720chr1041504 1285 1143 220 --21519 1433 1240
NM_014721chr6107025 5961 5568 5403 5306 1756 1441 1412 889 565 27275 2272 --11188
NM_014723chr2093207 3198 3190 3000 2341 2091 1040 588 438 ------
NM_014729chr832168 1884 646 167 ----
NM_014730chr12145288 4557 4530 4371 3792 3559 2117 1956 1435 1394 1193 997 612 216 25031 989 1912 --
NM_014730chr12145288 4557 4530 4371 3792 3559 2117 1956 1435 1394 1193 997 612 216 25031 989 1912 --
NM_014732chr1685858 5175 4344 3977 3655 2291 1392 569 22329 1062 35729 5665 2045 --
NM_014735chrX32052 1804 518 11470 ----
NM_014736chr15295 36 ------
NM_014739chr663772 3290 2735 2688 282 154 ------
NM_014743chr442370 1939 786 416 --11145 --
NM_014746chr273662 3437 2943 1494 1262 1115 627 11704 11409 14101
NM_014747chr195156 4850 4652 3523 460 448 284 277 100 --14391 --
NM_014751chr841968 1869 1731 184 1298 ----
NM_014752chr1151454 1358 1327 430 37 ------
NM_014755chr243742 3612 3404 1670 13159 ----
NM_014757chr562366 2104 2021 1796 576 79 ------
NM_014761chr161914 175 1477 --
NM_014764chr121347 ------
NM_014766chr773188 2873 2750 826 458 332 155 --1144 --
NM_014774chr162593 2309 2065 2045 716 116 12609 33148 3112 2151 12619
NM_014776chr1282964 2749 2556 2136 1222 658 651 511 ------
NM_014779chr3150 --1773 1890
NM_014787chr11233 11909 ----
NM_014791chr9--1304 ----
NM_014795chr2--11360 21284 1238 --
NM_014802chr1221103 167 1269 1712 --
NM_014803chr1052763 2415 728 459 231 --11951 --
NM_014810chr163459 3401 3029 2599 1093 603 13307 --21073 107
NM_014812chr131849 1252 109 11593 1580 --
NM_014813chr13556 416 390 ------
NM_014815chr171430 ------
NM_014819chr552314 2125 1819 1771 315 1909 ----
NM_014822chr41492 1621 ----
NM_014826chr164374 4000 3727 3671 3210 656 1590 13862 --
NM_014829chr542189 660 429 107 --22343 2285 --
NM_014830chr1273698 2863 1321 1112 904 820 102 --11090 --
NM_014836chr1041859 559 153 87 --11642 --
NM_014839chr142322 574 532 332 ------
NM_014840chr1282758 2120 1299 851 751 733 387 147 1423 ----
NM_014841chr621395 942 11340 ----
NM_014850chr3104602 4470 4374 3911 3645 3551 3400 894 98 62 ------
NM_014859chr171361 --1248 --
NM_014860chr2102432 2409 2087 1652 1049 849 785 748 677 335 ----2347 312
NM_014862chr1594225 3929 3576 2863 1604 1462 1263 1044 626 --33023 2987 1011 --
NM_014864chr1134052 2684 1578 1503 1399 1241 912 741 486 412 400 358 128 1701 11117 --
NM_014872chr961998 1835 1822 1749 825 570 12133 ----
NM_014873chr164670 4409 3896 3716 2962 821 ------
NM_014876chr2272219 1878 1854 1373 817 604 239 ------
NM_014877chr17197654 7609 6948 6883 6598 6391 5735 5380 5259 4977 2950 2644 2364 2176 1294 1131 1044 206 100 22958 1690 --27554 1338
NM_014885chr42138 38 ------
NM_014888chr731607 1347 104 11425 ----
NM_014890chr31104 ------
NM_014891chr741558 1273 1186 146 ------
NM_014893chrY32296 1843 943 ----1600
NM_014897chr1742527 2490 529 171 1370 12693 --
NM_014899chr522683 959 12798 ----
NM_014900chr211085 1287 ----
NM_014903chr1252465 2002 434 319 31 22320 2077 ----
NM_014904chr1043333 3148 1618 699 23388 3076 --1499
NM_014906chr1753923 3915 3842 3398 2933 12879 ----
NM_014909chr1463723 3271 2857 1013 491 185 --13867 --
NM_014910chr192681 137 ------
NM_014912chr1031158 244 230 23411 3141 11359 --
NM_014918chr152644 223 11137 ----
NM_014920chr612658 --1624 1304
NM_014926chr32901 294 11008 ----
NM_014932chr321691 136 ----11684
NM_014935chr193889 3360 3093 3063 3028 2417 1202 1120 319 ------
NM_014936chr642798 2728 149 95 12676 2228 140 --
NM_014937chr1041268 869 269 234 --11330 --
NM_014939chr1851055 962 484 358 125 ----1544
NM_014945chr541351 1305 648 84 11761 ----
NM_014946chr252916 2735 1918 641 208 ------
NM_014949chr11984 1999 ----
NM_014950chr142633 180 --1192 --
NM_014951chr1052324 1933 1684 1008 293 12444 ----
NM_014961chr441865 603 242 123 ------
NM_014962chr2072568 2437 1102 1081 1038 332 227 1463 12875 --
NM_014969chr11908 1989 ----
NM_014974chr103661 562 218 1675 ----
NM_014978chr1051580 732 496 332 290 --1478 --
NM_014982chr1484512 4007 3581 1832 1449 835 414 98 --13285 --
NM_014988chr431928 695 645 --12321 --
NM_014991chr422078 965 42836 2629 2254 768 11083 --
NM_014994chr1552268 1618 776 261 254 --12305 --
NM_014996chr321008 391 1703 ----
NM_014999chr1221693 1399 --1465 --
NM_015000chr1252606 1216 1101 972 784 12630 12201 --
NM_015001chr11916 ----2798 190
NM_015002chr1221425 516 1327 1761 --
NM_015005chr1441709 1657 1618 416 ------
NM_015008chr3102701 2549 2364 1290 1233 1024 966 597 397 210 ------
NM_015009chr32640 198 1773 ----
NM_015017chr121252 255 ------
NM_015020chr1622546 2370 13679 ----
NM_015025chr231772 875 48 --11724 12671
NM_015026chr1294707 4700 4621 4500 3122 3115 1286 1024 472 14072 --13803
NM_015032chr1342603 522 206 138 12026 ----
NM_015035chr20136430 6276 6183 6078 5960 5302 4887 4582 1216 633 545 534 386 --15725 --
NM_015039chr193229 2798 1625 1618 1363 1356 976 503 44 14050 13117 --
NM_015040chr273380 3329 2389 2281 2089 1106 180 12602 12232 --
NM_015042chr1563474 3307 3175 3112 979 687 43767 3533 2851 1384 ----
NM_015045chr102292 268 11381 ----
NM_015046chr952691 2470 1833 822 599 12456 ----
NM_015049chr263288 3274 2904 2264 2200 265 --13259 --
NM_015059chr1553514 3253 2794 1484 319 1600 23831 1495 1620
NM_015061chr92629 329 1555 ----
NM_015064chr1233335 3078 1350 1939 ----
NM_015068chr763444 3379 1503 1450 667 250 ------
NM_015074chr1104956 4732 4667 1993 1657 422 349 193 128 69 34876 4601 92 44626 3568 1388 759 --
NM_015076chr674557 4284 3423 3126 2801 1486 190 1813 ----
NM_015080chr111939 ------
NM_015090chr1115095 4321 4177 4047 2439 1626 1396 1184 626 375 31 25403 1330 36069 6005 4665 --
NM_015092chr1634472 3725 1549 --24634 3774 --
NM_015093chr641804 1717 518 511 11846 ----
NM_015094chr2284166 1784 1646 1222 1018 888 310 35 ------
NM_015097chr33797 660 434 11714 1287 --
NM_015100chr131980 1764 1668 ------
NM_015110chr922515 1545 --22131 1736 --
NM_015116chr1351519 1220 564 458 81 21689 1202 21552 1272 21654 173
NM_015124chr2232529 1808 829 --22465 375 --
NM_015125chr191423 1141 ----
NM_015129chrX31733 685 397 ------
NM_015130chr431127 305 202 ------
NM_015134chr172659 83 ------
NM_015137chr862108 2023 2015 1919 1640 515 1644 ----
NM_015138chr1592568 2526 2500 2313 1935 829 403 345 170 1656 1437 --
NM_015141chr382507 2147 2035 2012 1861 823 522 503 12230 11805 --
NM_015143chr431433 1377 1025 21225 589 ----
NM_015144chr1653284 3246 3146 1525 1396 12645 33952 3722 441 --
NM_015149chr13601 473 24 ------
NM_015153chr61590 --1663 158
NM_015156chr1443690 3365 2563 263 --32810 1577 400 --
NM_015158chr91793 1756 ----
NM_015161chr164617 587 305 103 --21543 1302 --
NM_015170chr831899 899 316 12241 ----
NM_015172chr121479 1252 ----11108
NM_015176chr151687 1131 466 421 199 ------
NM_015180chr14----1292 --
NM_015185chrX52886 2229 1943 402 359 ------
NM_015191chr1142743 913 508 354 1954 12398 --
NM_015192chr2072775 2493 2485 2363 2203 2008 429 ------
NM_015199chr362874 2094 1069 239 193 69 ----12722
NM_015200chr462479 2374 1983 924 509 129 22396 2136 --12536
NM_015206chr1553027 1369 913 907 66 12840 ----
NM_015208chr1813839 23526 1258 --23484 552
NM_015215chr15914 879 732 642 242 --1776 --
NM_015216chr53627 340 115 11452 ----
NM_015221chr1031324 175 27 --2606 149 --
NM_015225chr942903 2224 538 100 --1291 --
NM_015226chr1673247 3202 3048 2844 650 189 24 23457 2129 ----
NM_015227chr21103290 3106 2977 1365 921 901 354 225 136 57 12944 ----
NM_015230chr41394 ----2406 212
NM_015245chr662638 2544 2247 1942 860 186 ------
NM_015247chr1685240 4831 4238 3268 1860 522 420 108 --15213 11410
NM_015265chr262618 2000 1751 469 231 171 12470 21725 936 --
NM_015267chr1211432 --32165 2086 851 --
NM_015268chr31742 ------
NM_015269chr1------1483
NM_015270chr1232136 1598 1589 12394 11779 --
NM_015271chr474006 2792 1627 1045 728 521 479 13923 --1678
NM_015275chr1211531 1309 ----
NM_015278chr663147 2939 1321 1289 391 143 12138 ----
NM_015282chr262769 2323 2142 1965 1953 428 1260 22665 400 12750
NM_015285chr1832208 296 137 22367 648 11797 --
NM_015288chr543486 3229 1331 405 23619 3599 13413 --
NM_015291chr193158 2560 2286 1413 782 692 290 284 148 11007 1869 --
NM_015293chr6293 87 --1507 1460
NM_015294chr172925 37 1216 ----
NM_015296chr131159 1960 ----
NM_015299chr1463251 2641 749 560 228 138 ------
NM_015308chr11--1839 --1862
NM_015310chr8197635 7514 6741 6538 6481 3278 2886 2866 2789 2207 1844 1500 1431 1416 1298 1184 1024 450 291 36566 5661 1787 11174 18183
NM_015313chr11114713 4680 4494 4366 3998 3659 3115 1472 552 432 393 13817 ----
NM_015314chr721926 950 12447 12498 --
NM_015315chr521389 127 13439 ----
NM_015317chr252859 2178 1090 1051 162 42793 2559 2349 1795 11065 1319
NM_015321chr1974371 4297 3519 3468 1685 1232 1163 24918 4901 ----
NM_015326chr152924 2134 871 352 150 1565 2626 397 --
NM_015328chr762830 2071 2021 781 483 321 22392 1915 ----
NM_015335chr1242572 1866 1831 1782 --12630 --
NM_015336chr1212096 ----12216
NM_015338chr2071949 1567 1246 778 642 565 428 --1716 11588
NM_015339chr205819 716 653 406 93 21015 698 --1645
NM_015347chr1262744 2212 2176 2089 731 691 --12444 12275
NM_015349chr631116 1102 166 12910 ----
NM_015353chr1751889 1813 1021 980 605 --12603 --
NM_015355chr1731839 522 514 ----1359
NM_015358chr2121100 336 ------
NM_015365chrX83944 3743 3498 3095 3048 2754 2711 563 1941 13358 12644
NM_015378chr123008 2208 12466 22836 2501 --
NM_015382chr142522 58 1721 ----
NM_015387chr231620 400 102 ------
NM_015393chr473661 3507 3463 3257 3157 299 239 11232 12931 --
NM_015396chr34203 160 100 42 --21073 307 --
NM_015397chr9296 55 --3591 469 445 --
NM_015409chr1282560 2383 2337 1881 1827 1061 329 75 ----12697
NM_015412chr372779 2613 2429 2209 1096 875 494 --12357 --
NM_015429chr31730 1928 ----
NM_015435chr81571 ------
NM_015436chr443259 1234 1131 861 ------
NM_015443chr1751468 1429 194 155 138 --11041 11361
NM_015446chr131323 1302 436 1537 ----
NM_015449chr11514 ------
NM_015455chr553501 3386 2789 1484 26 ----13173
NM_015458chr8105216 5166 3941 3377 1639 887 568 213 94 62 11524 ----
NM_015463chr21339 ----1792
NM_015464chr71925 1898 ----
NM_015475chr211080 ------
NM_015477chr152866 368 ------
NM_015483chr7142 ------
NM_015493chr1951541 1480 745 598 49 1247 ----
NM_015507chrX--2459 145 --129
NM_015508chr31991 ------
NM_015509chr1261385 617 429 389 377 51 11558 ----
NM_015520chr332127 1777 320 12290 ----
NM_015523chr11--1194 ----
NM_015528chr171199 ------
NM_015535chr254132 3348 1586 911 221 ------
NM_015550chr773418 3068 2220 1426 1151 1094 213 --23006 2509 21037 930
NM_015554chr1592801 2692 2677 2453 2442 2018 1819 822 247 12784 ----
NM_015555chr661740 556 483 264 152 35 --11511 --
NM_015565chr2121645 1435 32232 267 186 ----
NM_015568chr2084225 4098 3895 2943 2747 1084 673 260 13607 ----
NM_015569chr194629 4569 4470 3791 1904 1774 1026 871 260 14224 24662 948 --
NM_015570chr731833 1340 1263 1125 21395 1213 1463
NM_015571chr642430 2308 2231 542 11828 12517 --
NM_015575chr253160 2469 556 355 150 ------
NM_015577chr531204 45 32 11803 21721 1339 --
NM_015578chr19------1652
NM_015584chr1741243 947 938 535 --11351 --
NM_015601chr103656 366 61 ------
NM_015602chr131483 1341 651 --11420 --
NM_015605chr1051302 1136 570 231 25 ----1411
NM_015610chr7181 --2624 60 --
NM_015630chr2--21069 444 1399 2380 184
NM_015635chr961750 1569 1490 1451 607 220 12014 ----
NM_015640chr155168 4500 1028 483 33 24874 3326 35183 5028 2075 24945 1122
NM_015646chr1221164 1064 11074 179 1342
NM_015670chr171476 ------
NM_015675chr192475 448 1638 ----
NM_015678chr1331609 1548 1371 21360 1216 2328 164 31428 484 431
NM_015686chrX82512 2139 1850 1676 970 964 510 355 ------
NM_015691chrX42885 2222 2039 196 ------
NM_015695chr641791 1767 806 561 ------
NM_015711chr191618 1830 ----
NM_015726chr13458 339 100 11149 21414 1250 --
NM_015833chr2121978 95 1751 1354 --
NM_015850chr862306 2295 2125 1779 1704 414 12269 ----
NM_015855chr112841 344 ------
NM_015866chr131231 355 311 ------
NM_015878chr872222 1891 1868 1840 1507 1428 588 2534 371 ----
NM_015879chr18128591 8349 7987 7237 6728 6077 3229 2770 2764 1092 668 625 15503 36225 3121 1419 16540
NM_015886chr895039 3585 3501 1888 1739 1288 1249 1177 1034 21722 133 25424 110 --
NM_015888chr143273 2563 998 592 1293 1540 --
NM_015891chr631942 724 122 ------
NM_015902chr81330 2693 358 1916 --
NM_015904chr23820 804 533 ----1760
NM_015906chr164807 4751 4325 4034 3419 184 --1968 --
NM_015912chr82779 205 22476 2217 ----
NM_015916chr10--125 ----
NM_015934chr2--1219 ----
NM_015939chr202639 271 ------
NM_015954chr12----1235 --
NM_015960chr101114 ------
NM_015967chr1--11044 1418 --
NM_015990chr4--1949 ----
NM_015994chr142481 234 ------
NM_015995chr1585430 4992 3967 2153 1729 1629 1280 629 24865 4335 --15453
NM_015999chr12686 269 ------
NM_016003chr7181 --2624 60 --
NM_016009chr154492 3630 3392 3227 949 ----140
NM_016019chr71300 ----1396
NM_016021chr63636 593 214 1129 --1627
NM_016025chr1632030 509 204 21580 159 1808 --
NM_016026chr1461247 556 356 199 124 58 ------
NM_016032chrX1874 ------
NM_016037chr14462 295 248 21 --1984 --
NM_016041chr17172 ------
NM_016045chr2021604 341 11581 21186 671 --
NM_016048chr52748 321 ------
NM_016061chr241362 557 518 249 ----11146
NM_016072chr1231736 1506 610 11883 ----
NM_016075chr1352597 2590 2155 907 569 32822 2181 1982 ----
NM_016076chr183174 3099 2885 2419 1198 943 705 307 1376 --2288 191
NM_016078chr173730 106 24 --1990 --
NM_016079chr232305 1903 754 ----1907
NM_016083chr633057 2610 1412 23587 333 11228 13766
NM_016096chr861596 1370 809 707 306 226 11765 11401 --
NM_016097chr1831092 99 59 --1976 --
NM_016101chr1661262 978 531 255 209 50 ------
NM_016107chr51874 --1429 --
NM_016123chr1211100 ----1478
NM_016124chr151277 1083 390 314 244 --11430 --
NM_016129chr4----1379 1291
NM_016132chr1543358 3135 2681 261 13105 ----
NM_016133chr211374 ----21604 1411
NM_016147chr11----21163 1141 --
NM_016152chr3----11068 1332
NM_016162chr12--1326 --1826
NM_016166chr15----169 --
NM_016200chr7--138 ----
NM_016201chr352097 1856 843 660 262 ------
NM_016203chr72842 215 ------
NM_016206chr3138948 8595 8587 8533 8134 7632 7171 5891 2341 2072 1976 1837 257 37820 5883 2181 28382 322 26813 6334
NM_016217chr673538 3521 3384 2932 2845 2633 2512 --1119 --
NM_016226chr121388 1337 ----
NM_016227chr13555 334 165 11010 1442 --
NM_016231chr1731529 1328 465 ----21692 180
NM_016248chr13103879 3722 3530 3349 3163 3116 2958 1453 742 145 --22721 2435 13810
NM_016250chr143642 154 129 ------
NM_016257chr163541 3295 2861 2754 2246 1150 --1568 --
NM_016260chr2117337 5628 5472 4996 4939 4902 2102 1456 1320 1277 398 11308 17477 27468 7142
NM_016269chr42962 355 21186 774 ----
NM_016271chr1852024 1969 1638 1470 169 128 ----
NM_016275chr372797 2611 2587 2116 2000 1926 676 --21778 1753 --
NM_016279chr52460 161 1378 ----
NM_016281chr122959 289 ------
NM_016282chr911119 --11716 --
NM_016284chr162290 270 1964 --1332
NM_016289chr251955 1838 735 356 215 ------
NM_016303chrX2130 76 ------
NM_016306chr3----123 --
NM_016308chr142001 1532 788 559 11335 ----
NM_016316chr22666 480 ------
NM_016322chr963252 2486 2276 979 338 247 ------
NM_016329chr3----1384 --
NM_016338chr5--11173 11036 --
NM_016339chr1761726 1645 1465 592 212 59 11400 ----
NM_016357chr122125 61 11160 ----
NM_016374chr121299 25 41405 1152 1045 359 ----
NM_016374chr121299 25 41405 1152 1045 359 ----
NM_016376chr1743583 2958 1515 1184 ------
NM_016396chr1562888 2412 2208 1189 834 612 13045 ----
NM_016410chr92573 475 ----127
NM_016418chr2292862 2645 2506 1172 1118 1105 318 292 232 13505 ----
NM_016422chr1162710 2577 2239 981 779 512 ------
NM_016424chr1761857 1850 1404 532 497 57 --2469 398 --
NM_016436chr2042738 2517 2184 1845 ------
NM_016441chr232258 868 478 12278 ----
NM_016447chr7------1219
NM_016448chr131872 1172 343 11202 ----
NM_016467chr231158 1095 497 11368 ----
NM_016470chr201492 --285 74 --
NM_016472chr1421380 379 ----1429
NM_016480chr52732 88 ------
NM_016485chr621674 380 1315 --12077
NM_016488chr1251924 1431 1272 765 735 --11572 --
NM_016489chr7165 1116 ----
NM_016505chr1257 50 ----1659
NM_016507chr1742602 2082 663 610 --13131 --
NM_016513chr612658 --1624 1304
NM_016516chr21581 ------
NM_016519chr4151 --1184 --
NM_016520chr92551 109 1318 1570 --
NM_016522chr1151481 1431 452 206 165 ------
NM_016530chr1583730 3429 2998 2891 2857 478 292 248 --24029 557 --
NM_016531chr422973 590 24074 846 1540 --
NM_016536chr192260 74 ------
NM_016538chr17133 ------
NM_016544chr241547 1268 1180 1052 23915 2557 22669 919 --
NM_016545chr12832 255 ------
NM_016548chr941554 634 477 196 --2328 147 --
NM_016561chr161777 1125 ----
NM_016569chr1241042 593 550 521 --157 --
NM_016575chr1295333 5130 4143 3986 3372 3354 1498 957 875 11996 ----
NM_016577chr374191 3329 1192 1178 1066 721 590 --23771 750 --
NM_016578chr113658 553 173 ------
NM_016587chr721009 183 ----11055
NM_016592chr202327 28 ------
NM_016603chr522136 321 ------
NM_016604chr52857 343 --1887 --
NM_016605chr522165 522 --12657 --
NM_016607chrX11336 --162 --
NM_016617chr1312135 ------
NM_016621chr1184483 4470 4014 3438 1183 1173 1124 918 23209 1231 11579 --
NM_016628chr10192 1203 ----
NM_016631chr212841 100 --1222 --
NM_016644chr52550 372 ------
NM_016654chr15155 2468 153 ----
NM_016656chrX1139 ----1321
NM_016824chr10----1582 --
NM_016830chr123460 366 233 ------
NM_016834chr17103788 3675 3425 3076 3016 2606 2578 1484 978 839 11016 1495 --
NM_016835chr17103788 3675 3425 3076 3016 2606 2578 1484 978 839 11016 1495 --
NM_016841chr17103788 3675 3425 3076 3016 2606 2578 1484 978 839 11016 1495 --
NM_016929chr663998 3481 3279 3245 123 91 ----13569
NM_016931chr11159 ------
NM_016936chr1631939 1611 221 1617 --12191
NM_016946chr1123171 2798 2763 2565 2338 1371 1262 1164 1029 618 405 379 11236 12617 13450
NM_016950chr42980 459 ----21531 293
NM_016952chr1193909 3764 3681 3337 3234 1569 1290 752 502 33353 1400 609 1233 1856
NM_016954chrX4599 495 222 120 1577 ----
NM_017409chr12160 ------
NM_017412chr841075 1009 963 944 1324 128 1452
NM_017413chrX3638 418 252 --11598 --
NM_017415chr5134265 4253 3517 2910 1592 1566 1541 1420 1314 1219 1205 259 71 --43584 1749 1174 591 14466
NM_017420chr1423116 928 23406 3208 --13441
NM_017423chr4--12054 11904 2688 218
NM_017437chr1432022 1942 270 --1622 --
NM_017440chr123591 488 107 ----1657
NM_017443chr921569 26 11553 ----
NM_017447chr21104168 3724 2976 2964 2672 964 578 444 142 61 1644 14031 --
NM_017452chr201966 ----11453
NM_017453chr201966 ----11453
NM_017454chr201966 ----11453
NM_017455chr152816 252 1760 ----
NM_017488chr241488 1401 1362 639 ------
NM_017489chr821315 1176 ------
NM_017491chr43989 710 271 ------
NM_017516chr1131108 762 725 --1247 --
NM_017522chr12993 430 11450 ----
NM_017544chrX2719 671 --1106 1905
NM_017545chr201452 ------
NM_017548chr332039 747 424 ------
NM_017551chr1062082 2018 1034 751 614 414 21776 134 --1241
NM_017554chr371980 1945 1710 1598 875 183 124 ------
NM_017563chr3116226 6202 4912 4810 4126 2390 1845 404 388 365 174 14643 15451 --
NM_017580chr1031563 549 399 --1937 --
NM_017590chr2252717 2691 2611 1976 1819 ------
NM_017593chr41461 ------
NM_017594chr942197 1032 1012 573 13007 ----
NM_017599chr1261830 1427 1381 773 575 259 1760 ----
NM_017610chr1562122 2115 1901 1582 1536 370 21493 255 ----
NM_017612chr121567 --139 --
NM_017628chr4125115 4213 3834 3628 3283 1786 1593 1433 1407 1124 1062 85 1220 42028 1922 1731 1555 --
NM_017629chr131384 496 146 --11470 --
NM_017633chr663783 3685 3202 2867 2823 2646 --1548 --
NM_017635chr1121285 538 ------
NM_017637chr9199321 9229 8993 8724 8475 8324 7569 7340 6865 6855 6491 6146 3779 3313 2771 2510 999 712 539 39453 9432 2435 --12811
NM_017640chr61823 ------
NM_017643chr1752452 2237 2062 1911 543 11926 13087 --
NM_017645chr942207 1220 752 495 21102 194 22654 1132 1278
NM_017649chr1021107 905 --1134 --
NM_017650chr785875 5169 3674 2211 2160 1919 802 702 25727 1589 1280 22287 1602
NM_017655chr131373 1294 314 41168 599 572 351 ----
NM_017657chr21276 ------
NM_017658chr1451865 1747 1347 1173 236 13953 --11254
NM_017666chrX82236 2148 1769 1708 1366 879 590 398 ------
NM_017672chr15--1260 1286 --
NM_017686chr131144 1067 368 ------
NM_017693chr1331345 1324 528 --1111 1132
NM_017694chr221993 1939 --22027 1769 --
NM_017699chr341722 1293 305 40 ------
NM_017709chr1113943 3624 3339 3331 2949 2918 1262 1234 991 506 143 33425 3393 460 13850 13583
NM_017714chr202856 93 ------
NM_017719chr372369 2084 1890 1834 645 348 164 12291 1485 --
NM_017724chr32315 182 1126 --1717
NM_017730chr31156 1648 ----
NM_017737chr13521 511 505 11926 1555 --
NM_017739chr12529 208 --1112 --
NM_017741chr452747 2454 1803 259 207 22827 1791 ----
NM_017742chr1821893 90 1141 ----
NM_017745chrX2648 47 ------
NM_017746chr9183 ------
NM_017752chrX41772 504 171 152 --32035 1556 93 --
NM_017753chr91239 --1877 --
NM_017754chr665020 4976 4153 3195 1849 1455 --24182 1919 --
NM_017762chr1522409 785 21823 230 12466 --
NM_017768chr12701 25 ----1115
NM_017769chr1432716 846 87 ----12624
NM_017770chr642884 2859 751 562 12969 ----
NM_017778chr83552 90 63 11090 ----
NM_017779chr132687 406 40 12737 ----
NM_017780chr83853 810 167 1668 1758 1833
NM_017784chr31359 ----31215 855 100
NM_017787chr1032776 708 443 ------
NM_017794chr91264 ------
NM_017798chr202125 40 11069 ----
NM_017799chr1451733 1496 1427 1395 1290 ------
NM_017810chr16191 1480 ----
NM_017811chr9----32020 696 604 11987
NM_017813chr8115815 5628 5061 4095 3775 3645 1438 1240 1234 719 189 23822 1343 22258 964 1796
NM_017819chr31204 --1218 --
NM_017822chr122331 25 1269 1104 --
NM_017824chr1062694 2670 2661 1750 1065 1055 ------
NM_017845chr42779 540 --185 --
NM_017848chrX83881 3772 3351 3282 1797 1786 1694 1322 1658 ----
NM_017857chr11--1680 ----
NM_017873chr942264 2166 740 360 ------
NM_017890chr81551 11689 1600 --
NM_017896chr2062734 2689 2604 2480 2446 2374 43431 1142 161 114 12513 --
NM_017899chr12134 1143 1135 --
NM_017902chr10115606 4843 4831 4794 4690 3971 2222 2151 2128 700 210 13784 14993 --
NM_017918chr41101 1116 ----
NM_017919chr985524 4802 4118 4075 1838 1730 829 434 35627 4810 748 1724 --
NM_017922chr142502 114 ----1596
NM_017925chr951917 1475 455 257 162 11328 ----
NM_017938chrX22028 874 ----11445
NM_017943chr1431019 958 183 ----1794
NM_017944chr1122092 920 1966 ----
NM_017945chr3180 ------
NM_017946chr731227 259 99 1985 11298 --
NM_017953chr11768 1117 ----
NM_017957chr1731571 1053 485 ------
NM_017964chr22120 70 ------
NM_017969chr2------1175
NM_017982chr121109 536 ----153
NM_017987chr1032026 888 661 1450 --1271
NM_017988chr122330 282 ------
NM_017994chr792796 2222 1984 794 781 749 381 240 99 ------
NM_017998chr921025 997 11363 ----
NM_018009chr121121 ------
NM_018011chr131484 ----147
NM_018017chr1062804 2008 1897 1085 1033 311 --2819 78 --
NM_018040chr11470 ------
NM_018045chr142736 885 386 202 22995 2842 12517 --
NM_018046chr521576 344 --1260 11878
NM_018056chr1--1121 ----
NM_018061chr171670 1378 545 533 515 444 431 1154 21413 1257 --
NM_018078chr42835 76 ------
NM_018079chr22503 395 ------
NM_018084chr222924 2296 ----22312 261
NM_018085chr1128125 7849 6725 6136 5245 2201 1205 595 546 461 107 71 17487 ----
NM_018086chr231345 775 612 11655 11498 --
NM_018092chr1631548 1300 113 11248 ----
NM_018098chr32751 230 ----11212
NM_018105chr821100 907 ------
NM_018107chr1441015 982 909 29 1734 --1959
NM_018112chr93877 690 140 ------
NM_018117chr102509 250 1692 ----
NM_018120chr831408 487 205 31003 456 388 ----
NM_018121chr1082635 2508 2315 2232 1943 970 777 305 12070 43163 2388 2151 870 --
NM_018128chr1731421 1172 141 ------
NM_018131chr101810 ------
NM_018133chr362086 1716 687 485 312 267 --12009 --
NM_018144chr103262 107 46 ------
NM_018150chr1--2910 80 ----
NM_018151chr23786 745 525 ------
NM_018155chr343376 2729 811 398 13222 --22682 550
NM_018156chr123008 2208 12466 22836 2501 --
NM_018171chr123217 138 130 1979 ----
NM_018178chr12423 163 ------
NM_018179chr122232 53 --295 65 --
NM_018181chr1871786 1720 1649 1531 1486 583 233 ----11276
NM_018182chr174679 621 553 266 1668 ----
NM_018193chr153104 74 29 ------
NM_018195chr11101825 1627 1488 844 467 180 142 112 79 58 ------
NM_018199chr1421067 362 ------
NM_018200chr1572580 2418 1926 1832 1029 822 685 ------
NM_018211chr131576 1434 666 11660 ----
NM_018214chr63518 271 88 ------
NM_018227chr423159 228 12203 32916 1283 1058 13141
NM_018237chr10----1251 --
NM_018243chr483804 3379 2659 2608 1575 1212 1190 1019 --23746 3416 --
NM_018244chr201929 ----11231
NM_018247chr642965 871 516 137 12421 23167 598 --
NM_018263chr252516 2380 2052 985 311 --2931 213 1184
NM_018266chr33851 689 66 1940 11087 --
NM_018287chr101183 11225 ----
NM_018293chr363002 2884 2860 2559 2406 441 31901 1834 815 ----
NM_018299chr833088 1274 58 11056 21086 985 --
NM_018302chr451933 1705 967 642 413 ----12432
NM_018312chr1142208 710 371 269 --1878 1427
NM_018314chr114617 301 151 28 ------
NM_018317chr4193 ------
NM_018318chr122680 602 1948 ----
NM_018319chr1441232 1225 573 360 168 --11432
NM_018323chr41545 --21260 608 --
NM_018340chr1694910 4696 4008 3839 3785 3386 1566 852 503 15082 ----
NM_018348chr1621130 340 ------
NM_018351chr1264604 4280 4050 3840 3520 1154 21875 377 --14657
NM_018361chr873449 2715 1136 856 774 421 110 --13689 --
NM_018362chr1163898 2702 2696 530 125 56 --13562 --
NM_018364chr153599 917 343 308 99 24069 3119 11488 --
NM_018368chr61226 ------
NM_018372chr11204 ----1473
NM_018373chr1496398 5879 5617 2446 1987 1315 982 761 131 15710 26479 581 --
NM_018374chr743437 1231 1122 692 25219 157 ----
NM_018375chr1461490 1344 1327 744 99 90 --11933 --
NM_018383chr242014 1712 766 55 --21424 548 --
NM_018386chr132149 49 1130 ----
NM_018387chr91372 ----1515
NM_018388chrX2467 291 ------
NM_018400chr1154582 3506 3035 2971 519 --11304 1335
NM_018403chr363664 2691 2612 1092 862 204 13162 ----
NM_018409chr442466 1297 841 706 12198 ----
NM_018416chr1242542 2330 2106 570 ------
NM_018424chr971578 1544 1318 1168 707 674 301 ------
NM_018429chr542876 2820 2355 258 --12140 --
NM_018433chr2171 ------
NM_018439chr1862032 803 475 459 370 320 2700 386 ----
NM_018440chr8188697 8474 7999 7524 7339 6774 6652 6173 5580 3101 3052 2853 2191 2178 2116 1818 1785 666 17876 47892 6987 2785 1933 13008
NM_018448chr121397 1428 ----
NM_018462chr33808 300 117 ------
NM_018464chr102309 152 ------
NM_018469chr1721196 1133 ----1417
NM_018471chr21171 --1146 --
NM_018477chr1431080 169 24 --1160 --
NM_018482chr842235 1667 1641 513 --12215 --
NM_018489chr131788 787 152 12293 --11908
NM_018490chr1131841 1551 411 11588 ----
NM_018509chr1721196 34 1147 11440 --
NM_018557chr231622 1525 461 21444 291 --1680
NM_018566chr174962 4341 4310 1168 1145 849 151 13788 --13752
NM_018569chr41326 --2255 21 --
NM_018584chr151200 1128 942 463 86 ------
NM_018602chr1531642 1467 89 --1293 --
NM_018638chr1275377 2179 1754 1221 699 448 112 25218 4972 1587 21964 1141
NM_018639chr1231394 1215 419 128 ----
NM_018640chr1242770 2564 802 619 2941 371 ----
NM_018650chr152094 1901 740 680 579 ------
NM_018682chr71636 1103 ----
NM_018683chr2041184 442 421 312 21653 1635 1219 --
NM_018685chr731126 1017 834 ------
NM_018686chr12------1235
NM_018689chr1582491 2211 1908 1877 1739 582 452 343 12638 ----
NM_018695chr562431 2153 1602 1590 720 342 11826 ----
NM_018698chrX31994 1491 254 11649 ----
NM_018700chr531371 239 155 11608 11680 --
NM_018704chr131963 1318 539 1674 ----
NM_018710chr82540 128 ------
NM_018712chr113524 232 52 11304 11298 --
NM_018713chr13949 341 42 ------
NM_018715chr161991 1601 1390 915 810 275 ------
NM_018717chr442820 991 889 82 ----12448
NM_018718chr762317 2259 2003 1969 931 263 11747 --11630
NM_018719chr711212 1117 1236 --
NM_018834chr52893 48 ----1238
NM_018841chr1103663 3486 3385 1398 1238 992 981 689 474 389 --22630 1193 --
NM_018844chr741765 1701 1586 351 ------
NM_018846chr72853 58 ------
NM_018890chr73587 371 295 21005 46 ----
NM_018945chr6103561 3471 3123 2811 2423 2268 1275 641 565 315 --33649 3436 3114 --
NM_018951chr72917 180 --21143 892 --
NM_018975chr16----1777 1816
NM_018976chr1232637 2255 2193 --22781 2185 11963
NM_018977chrX--11047 ----
NM_018979chr1282590 2513 2411 2121 1783 910 656 298 42612 2576 1711 805 ----
NM_018992chr1611525 11370 --1660
NM_018993chr2021388 52 21366 1285 --11373
NM_018999chr10104545 4355 4057 3692 3266 1821 1717 1503 1237 491 --24713 1402 --
NM_019000chr521556 1458 ------
NM_019001chr374033 3720 3013 1645 1582 535 260 ------
NM_019004chr742288 2015 465 77 21676 192 12095 --
NM_019008chr2251390 1296 918 417 343 --12539 13535
NM_019018chr5----1231 1622
NM_019022chr1853213 3124 2206 646 237 22178 2078 ----
NM_019028chr111375 ------
NM_019041chr642330 2047 509 465 ------
NM_019045chrX--1843 ----
NM_019050chr42915 39 ----12188
NM_019059chr71330 ------
NM_019060chr11123 ------
NM_019071chr74517 509 234 144 ------
NM_019072chr563584 3575 2897 2719 855 140 13792 1707 --
NM_019083chr151480 1241 1218 214 135 --11165 --
NM_019084chr1042099 2061 766 38 ------
NM_019087chr531309 368 36 ----11302
NM_019096chr61990 ------
NM_019106chr221294 22509 248 2737 126 --
NM_019114chr961948 992 958 841 761 67 --12158 --
NM_019116chr16113739 3623 3393 3380 3015 2833 2747 2327 2287 1498 351 --199 --
NM_019117chrX53268 3046 2245 1364 1186 --1678 --
NM_019555chr351175 1166 591 351 146 21679 418 ----
NM_019556chrX51414 1378 973 436 312 --1585 11387
NM_019558chr2178 ----1238
NM_019592chr94695 607 254 198 --2884 756 --
NM_019593chr20112746 2482 2303 2249 2229 2197 2169 944 547 473 300 13082 12346 1484
NM_019594chr921490 459 --11176 --
NM_019600chr151787 ------
NM_019605chr12519 22 ------
NM_019610chr142120 2061 1376 158 1245 ----
NM_019613chr172822 116 ------
NM_019843chr22194 ------
NM_019845chr22258 47 ------
NM_019895chr32940 422 ------
NM_019903chr10----1582 --
NM_020116chr431706 544 470 21395 1174 ----
NM_020122chr2145899 5726 5228 4737 2379 2301 1632 895 738 649 544 238 111 70 25527 952 26055 411 --
NM_020123chr1021062 25 --1117 --
NM_020127chr131719 1563 595 11838 ----
NM_020135chr61177 ------
NM_020139chr441867 1831 765 285 1180 11679 --
NM_020141chr122051 614 --22202 1817 --
NM_020150chr1051986 1934 861 636 577 --21942 598 12133
NM_020152chr212938 899 ------
NM_020157chr2021012 834 --1182 --
NM_020159chr42671 417 21523 1214 ----
NM_020177chr542504 2080 1218 1209 ------
NM_020178chr1731200 1111 476 21118 412 ----
NM_020182chr2073320 2966 759 668 376 285 231 --12424 1557
NM_020184chr232272 808 382 11772 ----
NM_020193chr1141071 935 536 91 165 ----
NM_020194chr2169 ------
NM_020205chr133324 2293 882 ----12683
NM_020234chr15165 ------
NM_020243chr224831 666 306 96 ------
NM_020245chr654426 3858 3689 3574 2035 --24510 4405 13621
NM_020248chr142307 2290 842 257 12219 ----
NM_020336chr2073820 3464 3049 1093 699 505 167 --12637 --
NM_020337chr452717 2360 2313 2060 498 52969 1210 464 377 219 33043 2115 774 --
NM_020338chr1031091 900 486 13484 11466 13380
NM_020340chr662072 1892 1853 1492 872 801 ------
NM_020341chr203600 484 164 ------
NM_020342chr22485 386 2700 65 ----
NM_020346chr1121643 578 ------
NM_020357chr31644 --21400 1143 --
NM_020362chr12321 121 ------
NM_020381chr631943 1800 564 ------
NM_020382chr1231037 640 465 11573 ----
NM_020384chrX3532 234 130 ------
NM_020390chr374517 4240 3472 1728 1708 798 550 --14872 1745
NM_020403chr1331753 1722 648 --1124 11615
NM_020405chr1764297 3730 1459 997 718 30 1264 ----
NM_020420chrY21742 1176 --11572 --
NM_020428chr19--1807 ----
NM_020429chr772932 2907 2395 2203 1944 674 428 ------
NM_020431chr1472746 2725 2680 1786 1095 761 108 ------
NM_020432chr741714 1502 389 135 ------
NM_020433chr2061665 1347 1331 1170 523 428 --11483 --
NM_020436chr20160 ------
NM_020440chr132903 2743 729 --23269 1241 --
NM_020443chr1145932 5767 5640 5268 5145 4639 1832 1687 1493 1265 1192 401 293 254 ------
NM_020444chr561185 1175 595 481 140 62 --11413 --
NM_020449chrX1617 2673 597 ----
NM_020455chr632663 2567 2533 --12719 --
NM_020456chr1321695 571 --11663 --
NM_020457chr16----1222 --
NM_020466chr684305 3772 3257 3199 3148 1985 1310 862 --15000 --
NM_020474chr1822041 1566 ------
NM_020482chr61822 ------
NM_020532chr22318 88 --1294 --
NM_020546chr553160 1260 1193 660 81 11210 ----
NM_020630chr101116 ------
NM_020638chr1241436 505 400 312 11913 ----
NM_020647chr821635 206 --12213 --
NM_020651chr221716 1562 ----1608
NM_020653chr17----138 --
NM_020673chr2077519 7410 5697 3079 1298 1165 245 17376 46359 5804 641 380 25824 5577
NM_020686chr1632510 302 258 22476 1144 12994 --
NM_020689chr2011075 21518 1459 ----
NM_020696chr32218 30 ------
NM_020697chr83905 834 49 ------
NM_020699chr164862 4828 3861 3815 843 387 23306 936 --35400 4320 927
NM_020703chr12583 472 ------
NM_020715chr1452102 1865 1699 565 111 --12266 --
NM_020717chrX114719 4310 4023 3936 1764 1101 706 689 454 393 66 1312 24956 3266 --
NM_020718chr1675473 4404 2441 1802 1440 1179 948 26104 539 12630 11027
NM_020728chr772641 2458 2222 886 470 313 248 12918 --1810
NM_020734chr1253079 3053 2304 2080 518 133 13193 --
NM_020739chr15103799 3721 3238 2847 2719 1670 1664 734 235 171 23331 47 ----
NM_020742chrX22032 703 ----1614
NM_020748chr1741863 1427 742 204 21591 298 ----
NM_020749chr831446 1318 382 1354 21850 284 --
NM_020750chr631270 558 37 158 ----
NM_020752chr1092658 2540 2134 862 770 582 440 306 195 12696 ----
NM_020754chr321240 278 1502 ----
NM_020760chr221542 335 ------
NM_020761chr1711971 ------
NM_020766chrX124185 3921 3760 3474 3146 1576 1567 799 536 232 164 63 --24005 3862 --
NM_020769chrX3714 670 343 --196 --
NM_020771chr631504 1229 339 ------
NM_020772chr17197251 7004 6937 6757 6597 6449 6184 5967 5610 2812 2796 2637 2251 1963 1898 1615 1557 960 550 27895 3427 27796 422 --
NM_020774chr1885373 5149 4763 3929 2166 619 607 348 11300 12393 --
NM_020775chr1135 --1210 --
NM_020778chr1584459 4448 4214 3862 1867 942 608 295 1679 ----
NM_020779chr253202 2733 2390 1239 345 11064 32587 1015 260 --
NM_020782chr1294709 4273 4084 3885 3745 3625 3279 1942 1112 21661 973 43955 1667 930 192 11707
NM_020791chr17----11012 --
NM_020792chr372673 2632 2556 1978 424 306 239 ------
NM_020796chr552606 2309 2136 1166 891 ------
NM_020806chr142247 124 ----1727
NM_020808chr1144 2888 862 ----
NM_020809chr1122164 931 179 ----
NM_020810chr1433164 3150 3132 1106 1997 1330
NM_020815chr41365 ------
NM_020818chr14--1376 ----
NM_020825chr1663156 3054 2547 1021 726 362 12799 13095 --
NM_020826chr1173721 3707 3586 3405 2645 1239 146 --23185 1188 13101
NM_020830chr242227 988 903 400 13181 23174 2709 --
NM_020834chr1431542 1195 117 1453 194 --
NM_020839chr331480 1120 291 1610 --11066
NM_020841chr1212705 22751 322 23055 1010 --
NM_020854chr1831261 246 234 161 ----
NM_020856chr1931181 545 398 11462 1235 --
NM_020858chr1532388 408 138 12136 --12351
NM_020859chr482804 2748 1614 1559 1292 1213 1024 464 1576 --1233
NM_020860chr441043 895 373 275 ------
NM_020861chr62165 109 ------
NM_020868chr231386 1264 774 1207 ----
NM_020870chr412263 1224 ----
NM_020872chr331163 660 592 --11729 --
NM_020873chr31100 ------
NM_020888chr131857 1353 257 11500 ----
NM_020896chr1141061 1015 988 281 ------
NM_020899chr1762346 755 457 400 153 107 1569 11854 --
NM_020909chr2104047 3559 3516 3473 3165 3140 3056 2791 2649 1577 12890 --13302
NM_020919chr2----1111 --
NM_020921chr1453177 3039 2952 1070 794 23569 609 12469 --
NM_020922chrX1648 11164 11881 --
NM_020925chr161146 973 580 447 114 101 ------
NM_020927chr1642323 1945 886 285 ------
NM_020935chr274609 4430 4313 3898 3041 1104 185 --1758 --
NM_020946chr941769 1166 704 651 --11746 --
NM_020947chr1631891 1492 764 --41944 1787 292 261 --
NM_020948chr143572 2951 2723 1416 21381 671 ----
NM_020951chr1932390 1661 183 --11860 12446
NM_020962chr1532282 2005 182 12224 1798 --
NM_020973chr42639 233 ------
NM_020977chr421944 791 --22123 398 --
NM_020981chr21762 ------
NM_020983chr1242393 2136 1598 1589 --11779 --
NM_020988chr1621074 893 31255 252 93 ----
NM_020993chr1241984 1753 425 70 11817 ----
NM_021003chr142693 678 1299 162 --
NM_021005chr1511131 1919 ----
NM_021007chr222242 623 --12067 --
NM_021033chr1353449 3280 3173 3106 2692 --12574 --
NM_021038chr343360 2634 2280 341 ----2466 211
NM_021069chr442035 1804 1430 1402 11387 ----
NM_021083chrX73667 2768 2281 1236 1189 844 118 13448 1624 --
NM_021088chr241855 828 439 265 1811 1431 --
NM_021090chr2274211 3493 3423 1890 1347 1219 90 11341 ----
NM_021096chr2233062 2811 2234 --22555 2006 --
NM_021097chr252553 2509 2256 1911 399 ------
NM_021109chrX------183
NM_021109chrX------183
NM_021110chr81488 --153 1737
NM_021116chr7118469 8453 7019 6644 6274 5844 3077 2745 2353 2038 1258 13531 37951 7370 2126 --
NM_021132chr1011242 ------
NM_021137chr1752197 1901 1646 885 178 --12061 1595
NM_021140chrX--1400 ----
NM_021144chr92449 89 ------
NM_021145chr71721 11026 ----
NM_021148chr732523 866 324 22244 1833 1394 --
NM_021155chr19103022 2586 2349 2292 960 634 602 510 128 80 --12677 --
NM_021159chr411545 21287 227 1191 --
NM_021167chr742420 2283 660 594 ------
NM_021168chr1631526 1495 228 11621 ----
NM_021174chr82295 265 ----1722
NM_021183chrX92526 2323 2058 1962 1954 1773 1708 515 108 --1524 --
NM_021192chr21417 ------
NM_021202chr2072960 2513 2334 2298 1127 898 592 11141 ----
NM_021205chr172686 2612 2330 1966 1795 1140 169 --12723 --
NM_021213chr1741145 1094 852 841 ------
NM_021219chr212210 75 ----1246
NM_021222chr121349 340 ------
NM_021229chr1241232 989 456 437 1508 ----
NM_021238chr124819 651 142 110 11577 --12016
NM_021239chr1441159 453 74 61 21133 300 21150 279 --
NM_021240chr91673 --182 --
NM_021244chr61177 ------
NM_021253chr661429 1415 1400 1394 128 115 --11368 --
NM_021255chr1493637 3571 3527 3020 3010 955 745 318 282 21411 241 ----
NM_021619chr931063 446 163 11284 --11192
NM_021622chr1072248 2096 1954 1650 686 546 355 12213 1912 --
NM_021629chr353819 3225 767 280 242 ----24495 356
NM_021637chrX41233 415 227 96 ------
NM_021638chr455027 3804 3151 455 211 --33918 506 225 14934
NM_021643chr241872 1816 1299 391 11168 ----
NM_021644chr101190 ------
NM_021647chr444579 1743 733 559 153 13491 --
NM_021648chr652769 2570 1943 774 373 11792 ----
NM_021705chr631322 306 192 1466 1504 --
NM_021784chr202531 82 ------
NM_021785chrX188 ------
NM_021803chr4--167 ----
NM_021813chr662308 2241 1842 1592 1014 851 --11960 --
NM_021872chr2061124 894 826 339 294 286 ------
NM_021873chr2061124 894 826 339 294 286 ------
NM_021911chr572179 2031 2003 1849 1738 531 194 ----15367
NM_021912chr1563826 3768 3587 3402 3363 362 1408 13069 --
NM_021914chr1452195 2132 867 453 345 12081 11530 --
NM_021939chr172783 701 ------
NM_021940chr631650 1366 1053 1625 ----
NM_021943chr62658 490 12069 --22182 85
NM_021949chrX72658 2602 2404 2355 2221 2028 1772 ------
NM_021954chr1333434 1392 1188 22890 955 ----
NM_021960chr142675 780 560 311 11900 2834 241 --
NM_021961chr11116874 6435 6130 5671 5372 2712 2617 2533 2476 890 430 37262 7114 512 32831 1809 153 27469 5693
NM_021963chrX2152 67 2552 87 ----
NM_021964chr386350 5652 2589 2532 1850 1662 1497 1175 24966 741 24153 2482 --
NM_021965chr921248 98 ------
NM_021977chr6103532 3467 3171 3147 2748 2412 941 557 272 67 12481 ----
NM_021984chrX21135 1084 1402 ----
NM_021987chrX21135 1084 1402 ----
NM_021990chrX21135 1084 1402 ----
NM_021998chrX21292 1105 1124 ----
NM_022037chr231025 763 245 --1685 1936
NM_022041chr1642620 2094 990 163 11058 ----
NM_022044chr221101 ------
NM_022048chr1586334 6288 4727 2374 2084 1042 566 407 24953 1838 1745 --
NM_022049chr131679 402 231 ------
NM_022051chr1------1177
NM_022073chr1431329 140 26 11521 ----
NM_022079chr103656 366 61 ------
NM_022085chr641271 1161 420 137 21551 1517 ----
NM_022093chr12912 705 ------
NM_022114chr143706 1875 1833 1040 11718 14125 --
NM_022116chr72795 252 1884 ----
NM_022118chr13------1162
NM_022121chr63869 359 79 ------
NM_022123chr14187 ------
NM_022130chr531484 968 279 ------
NM_022138chr63522 502 227 11322 --2128 104
NM_022166chr16104797 4604 2431 2387 1872 1854 1476 912 623 271 15716 25001 4514 --
NM_022173chr231025 763 245 --1685 1936
NM_022351chr853509 2773 1092 694 557 11334 ----
NM_022361chr61527 1190 ----
NM_022367chr11685 ------
NM_022373chr73788 713 362 ------
NM_022444chr7126 11801 11592 --
NM_022459chr13106038 5725 3914 2483 2080 1802 1729 1659 129 76 --12417 25294 1564
NM_022465chr1242715 2649 1869 564 22848 95 ----
NM_022469chr152791 1292 1035 492 152 ------
NM_022474chr1432352 2039 544 12766 32531 650 561 12120
NM_022476chr162829 246 --1925 --
NM_022482chr20--11806 12594 --
NM_022484chr73919 896 101 --1128 --
NM_022491chr12103579 3561 3516 2488 2354 1191 935 801 556 116 11282 2987 180 --
NM_022644chr172488 202 137 ----
NM_022648chr2104616 3551 2937 1840 1804 1401 1069 884 662 98 ------
NM_022650chr541031 695 294 247 ----1180
NM_022652chr122983 84 2818 343 1735 --
NM_022658chr121893 ----11343
NM_022659chr8--1368 ----
NM_022716chr153137 2438 1984 1104 558 ----12016
NM_022719chr22113845 3683 3463 3224 2677 2455 2363 1353 308 284 199 ------
NM_022726chr671709 1666 1121 640 438 258 221 ------
NM_022733chr111134 ------
NM_022735chr141892 1172 698 181 21299 708 ----
NM_022739chr1741190 798 437 249 1463 ----
NM_022744chr1641114 968 953 55 ------
NM_022750chr74586 274 266 41 ------
NM_022753chr132831 721 631 22787 853 1744 --
NM_022756chr141496 458 447 134 21389 504 11469 --
NM_022757chr31775 ----1984
NM_022758chr663091 2107 1179 742 245 51 1807 12328 --
NM_022763chr332845 2782 756 1801 12884 --
NM_022771chr122310 82 --2327 36 --
NM_022776chr331559 1429 355 2441 366 ----
NM_022778chr151458 1207 534 363 82 ------
NM_022781chr952726 2610 2447 2401 611 --11081 --
NM_022784chr151242 ------
NM_022787chr162749 2673 2099 1807 712 165 11704 --11686
NM_022802chr1021538 1284 21006 97 ----
NM_022818chr1621265 264 ------
NM_022824chr521195 136 ------
NM_022831chr141521 1447 1436 583 ------
NM_022841chr1531829 918 668 22584 1917 --12268
NM_022843chr13145 ------
NM_022893chr283098 3021 2093 960 731 662 319 305 ----11208
NM_022894chr23489 159 132 21204 444 --11682
NM_022897chr51249 ------
NM_022898chr1483415 2988 1825 1604 1215 764 475 336 14434 24245 666 --
NM_022912chr263076 2742 2721 1959 495 476 --11036 --
NM_022918chr11142 21532 1397 12087 --
NM_022977chrX62644 2634 696 484 374 75 ------
NM_023000chr1441270 1116 1104 167 11641 11178 --
NM_023001chr1441270 1116 1104 167 11641 11178 --
NM_023008chr191135 ------
NM_023033chr123560 478 414 ------
NM_023035chr191330 --1791 --
NM_023037chr134800 722 421 115 --1930 --
NM_023067chr351332 1198 1150 234 183 ------
NM_023068chr2031038 587 335 --11471 --
NM_023071chr122732 145 ------
NM_023072chr193936 777 266 11001 ----
NM_023074chr1961188 1027 886 861 326 186 1302 ----
NM_023105chr862306 2295 2125 1779 1704 414 12269 ----
NM_023106chr862306 2295 2125 1779 1704 414 12269 ----
NM_023110chr862306 2295 2125 1779 1704 414 12269 ----
NM_023111chr862306 2295 2125 1779 1704 414 12269 ----
NM_023923chr153000 2624 1202 762 138 23739 1326 1200 --
NM_023927chr531393 199 180 ------
NM_023929chr831898 875 862 22808 524 ----
NM_023943chr3187 ------
NM_024019chr421106 1083 1768 ----
NM_024052chr1752864 2402 419 367 54 ------
NM_024054chr73337 270 134 ------
NM_024055chr52660 637 --1163 --
NM_024061chr71427 ----1570
NM_024085chr22811 689 ------
NM_024086chr1763238 3172 1400 1241 1141 475 ------
NM_024091chr5191 ------
NM_024092chr114874 807 437 363 1781 11253 --
NM_024095chr122443 67 11037 ----
NM_024107chr171585 ------
NM_024294chr663091 2107 1179 742 245 51 1807 12328 --
NM_024312chr1231446 1333 77 1648 ----
NM_024315chr72306 174 --1434 --
NM_024324chr22--1198 ----
NM_024325chr203417 341 221 ----11069
NM_024332chrX51693 681 472 445 410 ------
NM_024336chr162375 278 ------
NM_024345chr983823 2344 1578 1296 1200 1136 349 286 46093 5645 2292 694 25442 2124 --
NM_024408chr173050 1276 802 626 568 533 250 --13160 --
NM_024411chr201551 1357 ----
NM_024424chr1111254 --2502 431 --
NM_024425chr1111254 --2502 431 --
NM_024426chr1111254 --2502 431 --
NM_024429chr72842 215 ------
NM_024490chr151625 1557 ----
NM_024491chr32608 166 ------
NM_024501chr21624 1196 ----
NM_024513chr393487 3337 2477 1475 1434 1273 1253 567 330 --1153 13369
NM_024524chr343140 3051 861 384 ------
NM_024525chr12609 463 ------
NM_024529chr131121 1114 117 --11133 --
NM_024539chrX1879 11196 ----
NM_024546chr133953 932 213 --1184 --
NM_024557chr111441 ----21067 177
NM_024561chr133973 446 326 ----21239 1198
NM_024563chr541808 1489 1462 635 21875 62 11541 --
NM_024581chr6--1241 ----
NM_024582chr41717 1424 1920 --
NM_024595chr131009 410 98 1944 ----
NM_024596chr865034 4303 3912 3427 533 491 14422 ----
NM_024611chr1583986 3177 2883 2601 1032 588 209 124 --33101 1017 432 --
NM_024612chr1751054 991 940 411 61 21086 1004 ----
NM_024613chr83465 240 53 --11862 --
NM_024624chr221507 21 11333 11140 --
NM_024626chr141590 1501 581 367 --11535 --
NM_024627chr22114886 4748 3718 3597 3137 1947 970 683 565 535 332 ----11925
NM_024628chr34964 938 220 124 ----11116
NM_024631chr112598 471 ------
NM_024639chr641109 702 655 84 12342 22164 2050 12028
NM_024643chr142434 148 ------
NM_024646chr153781 2770 1583 1001 172 --1502 12684
NM_024652chr151773 --1833 --
NM_024659chr2--1369 ----
NM_024663chr20147 ------
NM_024665chr374643 4304 3829 1019 697 533 346 --11476 --
NM_024674chr182996 2985 2467 2332 2044 973 635 261 --1693 1460
NM_024676chr131240 1019 68 ------
NM_024699chr81313 ------
NM_024713chr1511660 --11078 11057
NM_024715chr541172 746 520 225 ------
NM_024721chr81953 1708 ----
NM_024740chr1153889 3820 3605 3584 3526 14121 23341 36 13161
NM_024745chr1621075 721 ------
NM_024749chr12786 666 ------
NM_024757chr921131 239 1910 ----
NM_024761chr9124920 4900 4312 4089 3937 2023 1721 1615 1609 1535 786 391 --1161 --
NM_024763chr111169 2474 27 11210 --
NM_024766chr21376 ------
NM_024770chr2114557 2510 2379 1950 1747 1315 1125 1005 679 490 142 25339 971 21655 917 --
NM_024771chr1162254 2133 1680 1627 984 825 11952 ----
NM_024779chr1231153 406 283 1292 ----
NM_024785chr261377 1164 1146 585 324 80 ------
NM_024798chr1562728 2643 2235 2053 493 288 1677 ----
NM_024811chr113510 301 58 ------
NM_024814chr73352 152 128 ------
NM_024817chr1575910 5516 5003 3704 2303 969 449 --15045 --
NM_024818chr341390 1153 1047 339 ------
NM_024828chr911293 11589 1241 --
NM_024834chr1051994 1878 1689 1308 684 ------
NM_024841chr1141529 948 776 254 1200 ----
NM_024844chr17--127 ----
NM_024884chr1453581 987 955 870 367 23062 1609 21236 590 14272
NM_024885chrX4589 274 231 31 --1858 --
NM_024887chr142130 1379 428 25 ------
NM_024896chr952502 2343 937 921 574 ----11677
NM_024899chr183726 700 550 --1260 --
NM_024909chr621356 999 ------
NM_024913chr751143 686 661 496 204 ------
NM_024915chr832688 2410 1813 1575 ----
NM_024920chr461412 1405 1373 977 318 132 11192 1535 --
NM_024930chr552676 1106 905 753 444 ----1781
NM_024939chr161261 21044 468 ----
NM_024947chr3189477 8705 8163 8115 7911 7548 6669 6124 3833 3261 3115 2987 2905 2858 1843 1831 1814 1739 ------
NM_024949chr464903 4065 1781 694 379 175 --13878 --
NM_024953chr1232040 1919 128 --21754 1103 --
NM_024979chr1351548 1137 1052 601 470 ------
NM_024989chr2127888 6862 6781 6743 6311 6262 5813 5109 2101 1909 1398 1093 --1548 27931 5051
NM_025004chr114619 518 265 204 ------
NM_025054chr82758 557 23895 270 1124 196
NM_025074chr443139 2729 2700 559 ------
NM_025083chr1551786 1553 759 405 273 11438 186 --
NM_025133chr21358 1794 ----
NM_025134chr1642392 1696 954 769 12378 12013 --
NM_025137chr151128 129 ----
NM_025146chr371908 1706 625 450 433 117 111 1536 1391 --
NM_025147chr21479 ------
NM_025152chr1431856 716 168 --11280 --
NM_025154chr75999 562 358 256 162 --11450 --
NM_025160chr163316 1079 921 531 335 163 11553 13925 --
NM_025164chr1132053 1551 92 22088 794 11705 --
NM_025179chr194563 4542 4148 3671 3032 1638 1591 1103 711 ------
NM_025180chr352940 2630 280 227 24 ------
NM_025181chr21183 1637 ----
NM_025195chr831711 1692 656 ----11542
NM_025208chr1141537 463 150 144 --11575 1487
NM_025221chr431040 979 128 ------
NM_025222chr352289 578 543 452 172 ------
NM_025235chr1052147 1678 1584 866 96 2702 450 ----
NM_025238chr1531590 323 22 --1521 1262
NM_025263chr641908 1486 619 321 1640 ----
NM_030579chr1673671 3273 2386 943 482 339 37 --32949 2446 2297 12369
NM_030594chr152551 152 ------
NM_030621chr1463517 3459 3291 3261 2974 249 ------
NM_030625chr101266 --22492 742 --
NM_030627chr573446 2766 1603 1573 1139 240 171 ------
NM_030629chr1641532 517 330 311 ----1242
NM_030637chr14--1676 ----
NM_030640chr123570 280 45 1876 ----
NM_030647chr7115901 5868 5751 5671 5366 5129 4396 2007 1737 255 235 --14793 --
NM_030648chr4105349 5100 4972 3870 3695 1579 1362 1088 496 196 --1793 --
NM_030650chr2133930 3880 3776 3554 3547 3342 3087 2748 1103 891 808 348 297 --23942 2716 --
NM_030660chr1431009 541 75 1376 ----
NM_030664chr1022394 27 1383 ----
NM_030667chr1231280 871 861 1109 11224 --
NM_030668chr1231280 871 861 1109 11224 --
NM_030669chr1231280 871 861 1109 11224 --
NM_030670chr1252312 1903 1893 493 217 --22256 363 --
NM_030671chr1252312 1903 1893 493 217 --22256 363 --
NM_030674chr12115772 5618 5436 5283 2137 1381 1207 1168 707 431 318 24206 2333 --15722
NM_030756chr10277 29 1260 ----
NM_030759chr102728 532 ------
NM_030766chr1231028 684 411 1219 ----
NM_030780chr841759 1646 526 378 1419 ----
NM_030790chr161241 ------
NM_030797chr22246 115 ------
NM_030806chr1178901 8869 8532 7950 7940 6227 3413 2011 1972 1480 1367 1053 777 530 474 261 219 13251 1979 --
NM_030808chr17--1986 ----
NM_030810chr641271 1161 420 137 21551 1517 ----
NM_030816chr13785 474 316 --13237 --
NM_030820chr641004 950 910 648 1234 ----
NM_030881chr2211628 --12456 --
NM_030885chr352292 2139 306 229 192 --12231 --
NM_030906chr113412 55 45 --1428 --
NM_030911chr133609 289 66 --1547 --
NM_030912chr103774 676 163 ----1860
NM_030915chr221884 836 --12013 12072
NM_030917chr41179 1185 157 --
NM_030918chr185384 4003 3648 3532 2072 1905 1089 101 11128 --15303
NM_030920chr172082 1947 1891 1476 1451 799 62 12028 ----
NM_030922chr152800 727 2753 156 ----
NM_030926chr221024 96 11085 ----
NM_030938chr173749 387 147 --1211 --
NM_030939chr62444 58 ------
NM_030940chr931487 227 111 1219 1978 --
NM_030962chr1141608 1184 987 216 11463 --21489 1285
NM_030964chr563471 3424 3245 3130 199 107 13617 2529 229 --
NM_030979chr131140 ------
NM_031203chr192236 56 --1216 --
NM_031216chr1831550 1410 25 21525 548 ----
NM_031243chr721994 1606 1297 12276 --
NM_031244chr61941 ------
NM_031262chr931115 294 288 ----1958
NM_031263chr931172 351 345 ----11015
NM_031266chr5142 ------
NM_031267chr7----1515 --
NM_031268chr1685209 3783 3623 1715 1312 877 498 126 15400 14365 13711
NM_031272chr171301 --1125 --
NM_031302chr121150 156 ----
NM_031305chr42718 673 1293 2537 507 --
NM_031314chr1441471 1283 313 129 --1726 --
NM_031362chr222512 959 1983 ----
NM_031365chr222648 1095 11119 ----
NM_031366chr222648 1095 11119 ----
NM_031371chr121299 25 41405 1152 1045 359 ----
NM_031371chr121299 25 41405 1152 1045 359 ----
NM_031372chr451254 1080 681 169 49 --2639 180 --
NM_031417chr1942499 621 548 313 1780 --22449 768
NM_031418chr1182594 1976 1771 939 925 473 415 60 ------
NM_031419chr331011 1003 297 11546 --11572
NM_031426chr962695 2036 1090 420 195 54 1141 ----
NM_031427chr1465861 4534 4168 3848 2217 1559 1294 --13991
NM_031435chr1253206 3064 2984 2843 1406 13396 --1971
NM_031439chr841907 757 54 48 ------
NM_031442chrX12145 ----1932
NM_031445chr262970 2789 2454 1125 293 174 23368 2147 ----
NM_031453chr1082450 1903 1820 1775 624 577 500 162 12536 ----
NM_031461chr821971 138 32281 1942 313 --1875
NM_031468chr7127673 7378 6271 5955 3052 2821 2130 1550 1473 1083 1070 1046 21430 1031 ----
NM_031469chr664085 2885 1504 1344 1273 116 23394 525 14065 --
NM_031483chr2043450 1389 250 210 12619 13371 178
NM_031844chr163382 3320 3152 2709 1069 134 2902 317 24145 3626 13177
NM_031845chr252641 2588 2562 1403 338 12470 ----
NM_031847chr252641 2588 2562 1403 338 12470 ----
NM_031889chr431587 1365 1316 --1445 --
NM_031935chr13986 186 97 ------
NM_031942chr231159 189 92 2883 49 ----
NM_031946chr7------1415
NM_031953chr41411 ------
NM_031964chr172382 108 1286 ----
NM_031989chr121366 ------
NM_032015chr111632 ------
NM_032021chr11----11104 11231
NM_032025chr342097 1367 726 187 ------
NM_032047chr31504 22388 978 11932 --
NM_032050chr22--1790 21035 828 --
NM_032052chr22--11175 21420 1213 --
NM_032102chr1152343 2052 2003 767 696 12997 ----
NM_032120chr72482 156 1118 1384 --
NM_032121chrX1460 12400 1298 --
NM_032144chr211812 ----11655
NM_032145chr611868 154 ----
NM_032147chr123792 386 88 ------
NM_032153chr342078 850 410 246 ----12685
NM_032154chr106738 675 437 320 271 96 11048 ----
NM_032160chr1874065 3501 3483 1021 469 376 213 13284 23643 53 --
NM_032169chr31690 ----1757
NM_032174chr131478 241 91 --1525 --
NM_032182chr103533 386 128 --1547 --
NM_032192chr172675 590 1754 ----
NM_032195chr212206 102 1477 ----
NM_032199chr1073457 3388 2789 2728 2652 1326 269 1870 ----
NM_032208chr273419 3171 2980 2955 495 483 417 ------
NM_032221chr2022063 2007 11729 ----
NM_032228chr1173541 3501 2814 2681 2376 2168 1042 --33049 2917 801 --
NM_032229chr131902 1867 --161
NM_032231chr15--160 ----
NM_032239chr431170 926 131 --2319 155 --
NM_032246chr151461 ------
NM_032268chr1672704 2524 2311 2136 1996 589 513 ------
NM_032272chr81462 ------
NM_032288chr332163 2120 690 --1361 --
NM_032293chr92260 183 1217 ----
NM_032294chr1731695 487 463 ------
NM_032295chr75601 544 378 203 136 ------
NM_032312chr22614 354 --1893 --
NM_032320chr111525 1253 ----
NM_032329chr243776 3462 3236 185 14326 189 --
NM_032343chr31192 ------
NM_032352chr1421127 365 --1534 --
NM_032354chr1731051 978 836 1181 ----
NM_032364chr1211012 --1761 --
NM_032373chr10145922 4246 4194 3927 3754 3626 2099 2016 1703 1394 1272 494 438 397 14305 11736 --
NM_032408chr751140 463 268 148 96 ----2791 444
NM_032410chr83777 396 162 31027 311 274 --11215
NM_032424chr1121562 98 21479 244 11392 --
NM_032429chr102529 234 1622 ----
NM_032434chr251355 1199 1063 235 223 1629 ----
NM_032435chr182364 1816 1707 1657 584 421 409 316 1435 11742 --
NM_032436chr131653 155 --2962 192
NM_032438chr621194 529 1247 ----
NM_032439chr1031389 473 439 ------
NM_032440chr1042150 1899 715 541 1896 ----
NM_032445chr1542425 1762 963 776 ----12608
NM_032446chr563267 2754 2641 2542 1420 570 11212 ----
NM_032452chr1441420 1366 564 140 --11093 --
NM_032457chr443859 1289 403 200 13358 13573 --
NM_032458chrX32960 827 479 11359 --12287
NM_032466chr821633 1101 --2463 81 --
NM_032468chr821633 1101 --2463 81 --
NM_032491chr125948 460 447 312 306 --1852 --
NM_032497chr193532 515 188 ------
NM_032499chr1521718 563 2535 305 11342 --
NM_032505chr342557 1931 837 165 --32437 1967 1751 --
NM_032510chr1872041 1826 1735 951 658 524 122 --1312 --
NM_032521chr203937 410 173 --13110 12691
NM_032539chrX2332 120 --1533 1738
NM_032547chr421071 89 --1398 --
NM_032550chr104978 339 62 44 ------
NM_032558chr91525 ----11307
NM_032560chr14196 1422 ----
NM_032569chr1641908 634 504 128 ------
NM_032574chr2----1241 --
NM_032582chr1731346 697 565 154 --11832
NM_032590chr1221122 1075 1858 ----
NM_032622chr411072 --174 --
NM_032632chr1431964 1771 1648 11988 ----
NM_032682chr393464 3041 2874 2277 1198 1174 1158 539 329 --1702 --
NM_032701chr191178 --1661 --
NM_032711chr1794173 3532 3061 1630 1535 1429 1241 959 890 1938 23803 3410 --
NM_032777chr811581 11405 ----
NM_032780chr1131163 852 458 ----1376
NM_032787chr32278 267 ------
NM_032788chr231384 1223 1090 --21319 115 --
NM_032801chr1152187 2069 2004 726 621 --11967 --
NM_032811chr1121865 196 ----21468 221
NM_032818chr922143 214 1465 1818 --
NM_032832chr63660 393 21 --11519 --
NM_032833chr172408 2308 1994 685 416 403 72 32452 792 571 1518 --
NM_032837chr1731404 1357 612 1656 --22125 820
NM_032842chr711308 1362 ----
NM_032859chr1363048 1512 1407 797 280 113 ------
NM_032869chr821772 1354 127 --22006 111
NM_032870chr6--1443 ----
NM_032873chr1133469 3320 3286 14439 12862 --
NM_032876chr1421688 385 12195 12156 11516
NM_032895chr17--1769 ----
NM_032900chr1083775 2603 2531 1549 1207 756 535 474 13911 ----
NM_032905chr102458 382 ------
NM_032918chr124902 350 298 90 11063 ----
NM_032932chr17166030 5920 5710 5404 5398 4924 4684 4594 4521 4167 3984 2567 2421 1628 1200 576 12241 25734 226 15625
NM_032947chr541248 1174 945 280 ------
NM_032961chr42949 85 ------
NM_032968chrX12671 21387 236 11489 11413
NM_032969chrX12671 21387 236 11489 11413
NM_032973chrY12666 1236 11489 11413
NM_032975chr1873373 3183 3091 2781 2760 2371 994 ----13228
NM_032980chr1873373 3183 3091 2781 2760 2371 994 ----13228
NM_032982chr772500 1821 1038 723 651 532 217 --32336 2171 2070 --
NM_032991chr411397 11154 ----
NM_032998chr1122 1305 ----
NM_033020chr164807 4751 4325 4034 3419 184 --1968 --
NM_033023chr73857 223 100 ------
NM_033025chr191986 ------
NM_033027chr321130 997 152 --11161
NM_033030chr22337 41 ------
NM_033036chr1131278 180 129 ------
NM_033044chr121303 36 ------
NM_033055chr12792 443 --11045 1998
NM_033071chr6293 87 --1507 1460
NM_033083chr352440 2288 2278 1330 62 --13320 --
NM_033116chr142235 92 ------
NM_033121chr1221625 96 21235 412 ----
NM_033125chr6--156 ----
NM_033129chr2022067 241 ------
NM_033132chr1342349 1535 935 503 --1758 --
NM_033133chr1793377 3088 2905 1327 1139 943 516 503 71 ------
NM_033135chr1141537 463 150 144 --11575 1487
NM_033138chr722108 1934 ------
NM_033139chr722108 1934 ------
NM_033140chr722108 1934 ------
NM_033143chr423634 348 23578 520 --1602
NM_033157chr722108 1934 ------
NM_033181chr633057 2610 1412 23587 333 11228 13766
NM_033196chr1921462 61 ------
NM_033201chr162854 50 1879 ----
NM_033222chr941018 400 350 138 ------
NM_033224chr7107657 7335 6542 6065 5527 3081 2529 1637 1588 1403 26402 2377 ----
NM_033225chr842713 2399 1212 418 --1123 --
NM_033260chr65714 223 186 83 76 ------
NM_033261chr102482 237 --1156 --
NM_033274chr563602 3526 2988 2864 2776 759 ----12954
NM_033281chr52721 169 ----1755
NM_033285chr874374 4071 3651 3521 3066 183 144 34429 3410 1072 --11260
NM_033296chr43732 362 335 ------
NM_033300chr12993 430 11450 ----
NM_033305chr921325 474 ------
NM_033315chr1761753 1703 1460 518 494 330 ------
NM_033326chr1142317 2169 1023 554 12047 ----
NM_033331chr923513 168 --33559 2376 403 --
NM_033340chr1031055 973 24 1359 21359 374 --
NM_033343chr11357 ------
NM_033360chr1234290 3510 3407 --13741 --
NM_033380chrX--1453 1844 --
NM_033381chrX--1453 1844 --
NM_033389chr1794868 4571 4321 3998 3773 3284 1214 799 417 21689 899 34006 3689 3654 --
NM_033394chr221587 1219 ----11487
NM_033396chr11------1162
NM_033402chr8191 ------
NM_033406chr111120 ----134
NM_033407chr11614 ------
NM_033425chr1152697 934 862 636 227 1895 11399 --
NM_033429chr1552994 2829 1231 770 312 12901 ----
NM_033484chr51577 ------
NM_033495chrX1159 ------
NM_033496chr103705 640 225 ----1737
NM_033497chr103705 640 225 ----1737
NM_033498chr103705 640 225 ----1737
NM_033500chr103705 640 225 ----1737
NM_033503chr1553325 2715 851 212 85 ------
NM_033505chr2116638 6617 5354 5046 2274 2244 1800 1744 1203 606 311 11445 11737 41940 1846 837 397
NM_033512chr822561 2204 12240 1279 --
NM_033535chr451090 932 926 81 21 --1793 --
NM_033542chr2051809 1705 1560 212 50 ------
NM_033551chr521389 127 13439 ----
NM_033624chr1221425 516 1327 1761 --
NM_033631chr163658 2510 1405 833 244 108 --13375 --
NM_033637chr1054020 3301 2822 1365 639 ------
NM_033642chrX2841 277 ------
NM_033644chr522154 377 12400 11002 --
NM_033645chr522154 377 12400 11002 --
NM_033656chr2175952 4538 3651 2364 1862 1050 832 1179 15758 --
NM_044472chr11485 --1500 --
NM_052832chr852608 2117 846 771 28 12991 ----
NM_052834chr1832208 296 137 22367 648 11797 --
NM_052857chr172439 157 ------
NM_052874chr162665 556 ------
NM_052879chr1233339 2826 768 24061 488 --12605
NM_052880chr2231214 531 203 --183 --
NM_052898chr821682 1445 ------
NM_052900chr841617 1519 1371 487 11509 11685 11778
NM_052904chr641221 1120 583 89 1279 11100 --
NM_052905chr23556 170 88 ----1434
NM_052906chr2294925 4408 4372 4060 3548 3321 1990 1962 632 ------
NM_052910chr131489 ------
NM_052911chr181856 ------
NM_052913chr621037 965 1460 11050 --
NM_052917chr253132 2626 809 764 79 --13304 --
NM_052918chr10153745 3469 3259 3178 2685 2421 1457 1375 1258 1217 1168 845 785 111 57 --191 --
NM_052925chr191823 ------
NM_052927chr531751 1516 637 --1405 --
NM_052937chr842082 1843 1076 205 1440 ----
NM_052948chr19271 52 ----1120
NM_052950chr1362198 1965 1530 1364 815 338 ------
NM_052953chr31312 ----1104
NM_052954chr212572 41 ------
NM_052971chr5------1111
NM_053001chr82414 305 --1335 --
NM_053002chr31447 --11145 --
NM_053016chr9167904 7143 6618 6266 6224 6190 5654 5436 3021 2673 1058 919 821 435 233 111 15810 21831 448 17887
NM_053023chr11103263 3247 2801 2719 2235 2093 1231 968 893 810 12955 --142
NM_053024chr341408 1255 542 215 1131 41550 1475 1441 584 --
NM_053025chr311625 ------
NM_053026chr311625 ------
NM_053027chr311625 ------
NM_053028chr311625 ------
NM_053031chr311625 ------
NM_053032chr311625 ------
NM_053043chr7136258 6226 5963 5930 5684 4698 4484 4002 2562 1885 607 302 225 1489 ----
NM_053046chr191105 ------
NM_053281chrX2397 107 ------
NM_054016chr12524 467 11691 --11894
NM_054016chr12524 467 11691 --11894
NM_054016chr12524 467 11691 --11894
NM_057089chr73339 331 172 ------
NM_057159chr91205 --11541 11332
NM_057169chr1282964 2749 2556 2136 1222 658 651 511 ------
NM_057170chr1282964 2749 2556 2136 1222 658 651 511 ------
NM_057175chr472569 2313 2256 1816 946 361 32 1654 ----
NM_057180chr121388 1337 ----
NM_057749chr82399 318 ------
NM_058170chr151661 1239 1232 1175 221 ------
NM_058237chr14189 --1698 --
NM_058241chr231785 1494 1426 11719 21803 576 --
NM_058241chr231785 1494 1426 11719 21803 576 --
NM_078467chr631155 514 475 ------
NM_078471chr171772 ------
NM_078626chr1----1308 --
NM_078629chrX3665 215 117 --1598 --
NM_078630chrX3665 215 117 --1598 --
NM_080422chr18------1279
NM_080423chr18------1279
NM_080491chr1143726 1518 883 640 ------
NM_080629chr12148 44 1577 ----
NM_080630chr12148 44 1