TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-624-5p
miRNA Sequence: UAGUACCAGUACCUUGUGUUCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51468 ------
NM_000038chr511812 --2757 400 --
NM_000084chrX32585 2578 1293 12391 56468 2261 940 683 494 --
NM_000108chr71129 ------
NM_000109chrX12503 ----1203
NM_000138chr1531912 1879 410 --1677 1423
NM_000165chr62578 56 --31286 222 103 --
NM_000170chr9----1205 --
NM_000176chr542885 2390 1205 842 --32748 1564 684 13857
NM_000267chr1761372 1328 1271 1006 581 229 ------
NM_000297chr411770 ----11980
NM_000330chrX11901 --12096 --
NM_000332chr655424 2166 1943 1925 167 --17062 --
NM_000368chr924765 3320 --24404 1723 1761
NM_000439chr542307 666 650 204 --12541 --
NM_000461chr32655 171 ------
NM_000618chr1266589 5041 4186 2096 1330 1012 14956 --1908
NM_000618chr1266589 5041 4186 2096 1330 1012 14956 --1908
NM_000640chrX----129 --
NM_000693chr1511670 --1312 --
NM_000793chr1453930 1902 993 583 394 --35095 3503 1063 --
NM_000806chr511615 ------
NM_000813chr513594 --11975 --
NM_000814chr15----1487 14149
NM_000817chr2----1811 --
NM_000826chr421781 567 --11673 --
NM_000829chr1122329 1520 ----1893
NM_000868chrX22317 958 --32541 636 602 --
NM_000902chr312792 --22428 711 --
NM_000908chr5------1750
NM_000926chr1178614 7501 7317 7308 736 441 40 29225 1915 --21709 1310
NM_000950chrX33643 1187 632 --13584 --
NM_000958chr51465 --1869 --
NM_000964chr17--1496 ----
NM_001001395chr12----11076 --
NM_001001549chr722815 914 12724 ----
NM_001001550chr722815 914 12724 ----
NM_001001555chr722815 914 12724 ----
NM_001001852chr221921 ------
NM_001003652chr1898336 8202 7187 5781 5586 1897 1722 1669 1059 12092 26599 1587 --
NM_001003674chr1856630 4990 4315 313 98 16531 14944 --
NM_001003675chr1856630 4990 4315 313 98 16531 14944 --
NM_001003681chr2221439 626 --11983 11991
NM_001003698chr611225 --11383 1589
NM_001003699chr611225 --11383 1589
NM_001003712chr121136 ------
NM_001003800chr963463 2828 2639 2359 1336 978 178 13260 --
NM_001003927chr171464 --163 --
NM_001004051chrX1224 ------
NM_001004317chr622990 1785 1543 --14173
NM_001004346chr41249 --1105 --
NM_001004356chr41437 --11295 --
NM_001004358chr41437 --11295 --
NM_001006600chr5----2871 525 1418
NM_001007023chr1453930 1902 993 583 394 --35095 3503 1063 --
NM_001007246chr212540 349 --11436 --
NM_001007466chr614699 11275 14737 --
NM_001008239chr1853782 2767 2634 1511 1000 22614 762 ----
NM_001008564chr131866 ------
NM_001008925chr443355 3029 814 244 ------
NM_001009554chr433907 1335 563 --13060 14699
NM_001009554chr433907 1335 563 --13060 14699
NM_001009909chr1123716 756 ----1510
NM_001011537chr342291 2248 2061 1867 1620 11612 --
NM_001012398chr16------21081 1073
NM_001015877chrX----13088 12271
NM_001017371chr21208 --1341 --
NM_001017922chr1----11749 --
NM_001018067chr155010 2028 1986 994 955 ----11705
NM_001018068chr155010 2028 1986 994 955 ----11705
NM_001018069chr155010 2028 1986 994 955 ----11705
NM_001018074chr542885 2390 1205 842 --32748 1564 684 13857
NM_001018075chr542885 2390 1205 842 --32748 1564 684 13857
NM_001018076chr542885 2390 1205 842 --32748 1564 684 13857
NM_001018077chr542885 2390 1205 842 --32748 1564 684 13857
NM_001018088chr15----1174 --
NM_001018090chr151788 --12130 1216
NM_001018091chr151898 --12240 1326
NM_001018102chr151788 --12130 1216
NM_001020825chr51360 --1223 11332
NM_001023567chr1522412 1999 ------
NM_001023587chr3----11140 1398
NM_001024094chr542885 2390 1205 842 --32748 1564 684 13857
NM_001024463chr152165 51 1769 ----
NM_001024649chr512685 --1438 --
NM_001024666chrX----1627 --
NM_001024809chr17--1496 ----
NM_001024855chr311878 31486 1396 253 --11673
NM_001024916chr9----1118 --
NM_001025079chr333911 3161 675 ------
NM_001025105chr511549 --21158 979 --
NM_001025201chr2----1669 --
NM_001025266chr374167 3456 3304 3278 1561 1363 141 ------
NM_001025580chrX53809 3057 3020 2742 525 ------
NM_001025780chr911430 ----11048
NM_001029863chr633177 2313 518 --23186 481 --
NM_001030001chr14--1138 ----
NM_001030006chr17----1318 --
NM_001030055chr1484667 3672 3593 2899 1872 1501 1190 1064 --24235 142 --
NM_001032280chr6----11240 --
NM_001032289chrX1139 ------
NM_001032296chr1332558 2124 733 ----1770
NM_001033925chr1021457 1361 ----11739
NM_001035260chr10----1410 --
NM_001037132chr722203 218 ----12109
NM_001037133chr722203 218 ----12109
NM_001037172chr34872 228 194 178 ----11302
NM_001037872chr2159 ------
NM_001039457chr1----1277 --
NM_001039618chr1125647 3954 ----25496 1191
NM_001040152chr774303 4204 3363 1900 1058 986 310 1547 24551 140 --
NM_001040440chr51191 1140 ----
NM_001040450chr15--1584 ----
NM_001040453chr15--1584 ----
NM_001040633chr72302 121 ------
NM_001040665chr723249 890 11770 13616 --
NM_001042413chr913774 --33608 3249 940 11421
NM_001042425chr6----11240 --
NM_001042492chr1761372 1328 1271 1006 581 229 ------
NM_001042493chr6--11424 ----
NM_001042543chr421396 98 ------
NM_001042555chr1274665 3643 3564 3412 1913 611 169 --11871 13364
NM_001042599chr246619 5352 4867 1442 --16646 --
NM_001042603chr1244233 3964 548 212 21580 402 21533 478 --
NM_001042604chr324190 3539 --1589 11365
NM_001071775chr13----11957 --
NM_001079874chr11408 --32116 1828 177 --
NM_001083620chr421779 566 --11672 --
NM_001106chr377343 6882 2999 2895 1215 650 258 12227 48483 7557 6268 2388 --
NM_001146chr822273 1539 11887 ----
NM_001172chr141266 1206 ----
NM_001173chr1484667 3672 3593 2899 1872 1501 1190 1064 --24235 142 --
NM_001256chr1732359 2139 1847 --32570 2004 706 --
NM_001257chr1621555 392 ------
NM_001282chr17----1318 --
NM_001356chrX1641 ------
NM_001357chr1----1268 --
NM_001396chr211998 --11717 --
NM_001402chr611583 --12016 --
NM_001408chr11162 ----11597
NM_001430chr252014 1260 765 347 84 --11806 --
NM_001530chr141854 --1225 --
NM_001678chr17193 ------
NM_001695chr832804 738 299 ----13764
NM_001746chr512685 --1438 --
NM_001755chr1611932 1152 --1839
NM_001777chr333911 3161 675 ------
NM_001797chr16176 ------
NM_001806chr1912481 --11003 12688
NM_001822chr2----1669 --
NM_001858chr644681 1673 1633 842 --33203 1806 875 11905
NM_001892chr511549 --21158 979 --
NM_001918chr158975 8583 6955 3541 1023 25753 3120 2970 243 --
NM_001924chr12546 353 ------
NM_001962chr5--1519 ----
NM_001967chr3----1464 --
NM_001978chr81964 ------
NM_001981chr142410 952 473 244 --32058 1718 1483 --
NM_001993chr11993 --1865 1207
NM_002009chr151666 --11840 --
NM_002107chr11166 ------
NM_002145chr17--1119 ----
NM_002147chr17----2906 601 --
NM_002149chr2--1768 1629 --
NM_002210chr273607 3544 3143 2437 1232 431 219 ------
NM_002266chr17----146 --
NM_002270chr534195 3932 1714 --1957 25000 4972
NM_002293chr122427 538 ------
NM_002336chr1224885 3141 24643 3316 54894 4788 3946 3740 1577 --
NM_002399chr15----11293 --
NM_002469chr121380 --1485 --
NM_002577chr323532 345 ----11263
NM_002581chr925117 2013 1748 159 --
NM_002590chr13----2154 144 --
NM_002655chr824376 204 --13778 14478
NM_002731chr142894 2875 1032 783 1803 ----
NM_002834chr1212880 12782 ----
NM_002851chr7----1252 --
NM_002866chr191537 ------
NM_002886chr321725 1290 --13938 --
NM_002893chrX1246 ------
NM_002906chr11----1604 11642
NM_002941chr3----1618 11358
NM_002955chr611225 --11383 1589
NM_002971chr3----140 1235
NM_002990chr1622282 2266 ----11748
NM_003016chr171548 ------
NM_003034chr1276695 6274 6206 5290 2337 1210 36 12669 37919 3207 1787 --
NM_003051chr1----187 1797
NM_003054chr101276 ------
NM_003071chr3--1136 ----
NM_003081chr20------172
NM_003095chr12------1385
NM_003111chr21208 --1341 --
NM_003182chr7------1403
NM_003182chr7------1403
NM_003199chr1814690 --25418 471 --
NM_003220chr6----11240 --
NM_003257chr15----1219 --
NM_003290chr191270 ------
NM_003340chr4----1513 --
NM_003341chr31104 ------
NM_003344chr711155 ------
NM_003380chr101238 ------
NM_003400chr2166 ------
NM_003404chr20----1166 --
NM_003412chr332804 316 229 --12785 1639
NM_003439chr713144 ------
NM_003453chr13--1134 ----
NM_003478chr1122493 2398 --1993 1608
NM_003489chr213901 353 98 12582 12187 --
NM_003567chr1----1298 --
NM_003574chr1874546 3767 1827 1554 1411 450 433 15729 2792 571 --
NM_003576chr1332558 2124 733 ----1770
NM_003626chr11----11182 --
NM_003663chr321002 196 --23302 3036 12166
NM_003670chr32420 203 ----11192
NM_003671chr953477 2505 633 303 277 --1455 --
NM_003672chr1----1257 --
NM_003718chr7----1429 --
NM_003722chr31671 22623 936 12670 --
NM_003749chr131859 --21831 422 --
NM_003750chr102320 297 ------
NM_003796chr19----1148 --
NM_003822chr122682 197 ------
NM_003983chr1664011 3811 3567 3507 3167 3120 --53202 1396 1279 638 353 11100
NM_004006chrX12503 ----1203
NM_004007chrX12503 ----1203
NM_004009chrX12503 ----1203
NM_004010chrX12503 ----1203
NM_004011chrX12503 ----1203
NM_004012chrX12503 ----1203
NM_004013chrX12503 ----1203
NM_004014chrX12503 ----1203
NM_004015chrX12503 ----1203
NM_004016chrX12417 ----1117
NM_004017chrX12503 ----1203
NM_004018chrX12417 ----1117
NM_004020chrX12503 ----1203
NM_004021chrX12417 ----1117
NM_004022chrX12417 ----1117
NM_004023chrX12417 ----1117
NM_004047chr1----1277 --
NM_004061chr5----1447 --
NM_004075chr12----1478 --
NM_004086chr141625 ------
NM_004096chr1031813 1318 565 ----1681
NM_004098chr101418 ------
NM_004171chr1157904 1659 879 358 175 17419 27329 1077 --
NM_004215chr8----1518 --
NM_004229chrX11833 --12036 --
NM_004293chr9--1710 12476 --
NM_004330chr151850 ------
NM_004338chr1856630 4990 4315 313 98 16531 14944 --
NM_004342chr7--1548 1610 --
NM_004346chr451490 1036 223 112 56 --166 --
NM_004356chr11--1104 ----
NM_004379chr2----1546 --
NM_004392chr131752 1841 ----
NM_004419chr101799 ----1960
NM_004432chr911527 --12299 --
NM_004440chr621699 588 ------
NM_004457chr21438 ------
NM_004501chr132870 1303 583 ------
NM_004575chr421381 1188 --1218 --
NM_004586chrX44901 723 113 26 --24120 3855 14344
NM_004593chr32805 319 --2715 187 --
NM_004612chr91793 13971 33997 1070 806 --
NM_004690chr61306 --2727 256 --
NM_004725chr101218 ------
NM_004726chrX14327 35764 4565 263 ----
NM_004756chr19--1947 ----
NM_004772chr5258 42 --1645 1561
NM_004774chr171875 ------
NM_004866chr564910 4851 3933 3860 3409 873 1952 1303 --
NM_004872chr1----1165 --
NM_004890chr172279 224 ------
NM_004891chr21220 ------
NM_004896chr10----1325 --
NM_004921chr142486 1795 953 785 --1146 --
NM_004922chr101282 --1875 --
NM_004947chr312493 --12311 --
NM_005010chr722203 218 ----12109
NM_005032chrX--11037 ----
NM_005056chr1244477 4208 792 456 21824 646 21777 722 --
NM_005065chr1445086 5036 1823 375 1869 23587 3554 --
NM_005121chr17----21293 854 --
NM_005159chr15--22208 46 ----
NM_005160chr2235997 2391 231 --25470 4902 --
NM_005180chr1021267 1160 1616 ----
NM_005188chr1136066 2476 966 --26439 732 1507
NM_005233chr32423 203 22276 2031 1982 --
NM_005235chr246619 5352 4867 1442 --16646 --
NM_005249chr14182 ------
NM_005277chr41659 11529 --11809
NM_005302chr7----1399 --
NM_005311chr722815 914 12724 ----
NM_005313chr151268 ------
NM_005339chr444217 2756 2744 2719 --14006 --
NM_005347chr931410 1073 452 ----11099
NM_005349chr4--1450 ----
NM_005358chr131342 ------
NM_005376chr11903 ------
NM_005387chr11----1635 --
NM_005392chr911230 ------
NM_005399chr144128 3983 2890 826 --14255 14152
NM_005415chr2151 --1490 --
NM_005433chr18----12342 12096
NM_005487chr2221439 626 --11983 11991
NM_005497chr1745274 4958 4186 748 15755 35087 3922 315 --
NM_005519chr101180 ------
NM_005570chr18--11147 ----
NM_005596chr946269 1979 1310 543 --24401 1328 --
NM_005626chr1----1536 --
NM_005668chr533512 2967 1126 14595 ----
NM_005746chr722599 935 --22245 253 11789
NM_005751chr71470 ------
NM_005776chr141776 1797 --1214
NM_005802chr91314 ------
NM_005841chr41245 --21074 952 --
NM_005850chr11158 ------
NM_005862chr3----1796 --
NM_005868chr721984 1627 ------
NM_005872chr1----1196 --
NM_005898chr1131109 901 894 ----1818
NM_005901chr1898336 8202 7187 5781 5586 1897 1722 1669 1059 12092 26599 1587 --
NM_005906chr61125 --11332 --
NM_005909chr511692 11074 --24139 3808
NM_005924chr71423 ------
NM_005935chr433993 3293 975 ----14844
NM_005941chr821383 1250 ------
NM_005994chr17------1653
NM_006054chr11------11665
NM_006055chr22944 548 21127 395 11242 --
NM_006095chr44822 409 256 215 ------
NM_006106chr1133398 3161 2757 ------
NM_006113chr11408 --32116 1828 177 --
NM_006141chr1642528 1913 1784 747 ------
NM_006153chr3--1501 ----
NM_006167chr81628 --1278 --
NM_006206chr41527 --12264 1534
NM_006216chr21167 ------
NM_006223chrX1207 155 --1473
NM_006257chr101976 ------
NM_006275chr201705 ------
NM_006279chr11590 ------
NM_006313chr12147 --11577 --
NM_006330chr8--11420 --1510
NM_006375chrX----21247 324 --
NM_006380chr1753897 3018 1342 665 418 12783 ----
NM_006413chr101300 ------
NM_006469chr121401 1116 --11424 --
NM_006471chr18149 ------
NM_006486chr221109 ------
NM_006504chr1022626 467 --11015 --
NM_006529chr421387 89 ------
NM_006534chr2042644 2495 919 132 12971 12320 --
NM_006539chr16------198
NM_006544chr1424429 861 ----13929
NM_006547chr721907 573 1540 --12019
NM_006558chr8----1442 --
NM_006570chr9--1364 ----
NM_006575chr1421190 1013 --1308 --
NM_006599chr1645931 1985 1515 1055 16696 37341 5667 839 --
NM_006629chr181767 ----12397
NM_006646chr1311070 --177 22990 2376
NM_006654chr1274665 3643 3564 3412 1913 611 169 --11871 13364
NM_006660chr151305 ------
NM_006729chrX55499 4003 1871 1334 737 25042 1617 25164 3431 --
NM_006750chr1667615 7589 5883 3138 1395 1369 38064 7251 438 ----
NM_006751chr21275 ------
NM_006777chrX12738 --12345 --
NM_006805chr5----11374 --
NM_006826chr2----1289 --
NM_006915chrX1623 ----130
NM_006939chr14----138 --
NM_006947chr441785 1441 1306 248 ----11582
NM_007006chr1621200 642 1694 --13448
NM_007007chr1234347 1054 732 --24813 4227 --
NM_007013chr81755 ------
NM_007038chr2155817 4755 1004 408 338 14913 14947 --
NM_007052chrX----1129 --
NM_007054chr513185 --13953 13510
NM_007078chr101443 ------
NM_007112chr1--1191 ----
NM_007129chr13------1907
NM_007145chr1921206 1106 --1406 --
NM_007212chr132105 1931 1919 --1535 --
NM_007287chr312792 --22428 711 --
NM_007288chr312792 --22428 711 --
NM_007289chr312792 --22428 711 --
NM_007331chr422286 30 --22303 99 22731 2401
NM_007373chr102606 92 ------
NM_012081chr543376 2957 1154 248 ------
NM_012158chr13------1588
NM_012183chr1----1575 --
NM_012214chr256266 5379 2081 1020 347 --25823 4827 25676 261
NM_012223chr231199 1009 405 ----11167
NM_012234chr322651 2310 --32826 927 540 --
NM_012238chr10--1227 1419 1642
NM_012252chr734063 1947 946 --13606 152
NM_012262chr163706 3381 3224 2032 909 849 11409 ----
NM_012300chr5--12489 ----
NM_012302chr11248 ------
NM_012327chr1831322 1098 517 11359 1127 --
NM_012416chr9----1459 --
NM_012419chr6----1498 --
NM_012443chr101809 ------
NM_012453chr731026 988 215 ------
NM_012464chr412676 ----21100 215
NM_013255chr731064 686 223 --27643 2444 --
NM_013261chr412562 11425 13187 --
NM_013262chr611393 ------
NM_013279chr11----22233 835 --
NM_013281chr20----1536 1421
NM_013374chr322991 2366 12161 --1542
NM_013438chr931672 1345 390 --11745 --
NM_013441chr12441 428 ------
NM_013448chr14--1509 ----
NM_013989chr1453930 1902 993 583 394 --35095 3503 1063 --
NM_013995chrX42577 1881 772 119 1665 --1555
NM_013996chr7------1403
NM_013996chr7------1403
NM_013997chr7------1403
NM_013997chr7------1403
NM_013998chr7------1403
NM_013998chr7------1403
NM_014011chr22585 169 1676 1269 --
NM_014035chr521389 1219 --1169 --
NM_014089chr131866 ------
NM_014112chr864237 1755 1526 1286 1086 807 ------
NM_014117chr1631866 760 157 1584 22418 2016 --
NM_014141chr721228 377 22101 281 ----
NM_014155chr1186108 6016 5934 5453 5120 2775 1860 1452 12036 1852 15684
NM_014181chr221889 414 ------
NM_014210chr171464 --163 --
NM_014250chr2221439 626 --11983 11991
NM_014283chr111277 ------
NM_014317chr10----1259 --
NM_014319chr1211918 ------
NM_014372chr1----1196 --
NM_014423chr565315 5154 5067 4416 1600 675 --15451 --
NM_014521chr22408 296 ------
NM_014607chr221428 370 11571 11641 --
NM_014615chr1623603 771 --13087 --
NM_014659chr152165 51 1769 ----
NM_014707chr711470 ------
NM_014711chr16----11434 --
NM_014717chr19----1864 --
NM_014721chr657401 6253 5219 5044 584 12935 57308 6964 6147 2252 1628 --
NM_014735chrX3791 444 250 ------
NM_014741chr1111372 ------
NM_014765chr142619 1946 925 606 --22170 2007 --
NM_014795chr21176 ------
NM_014810chr133354 2537 155 ----1166
NM_014827chr11507 ------
NM_014840chr1243263 3063 2916 2473 13232 21252 277 --
NM_014877chr1767140 6607 6554 5512 975 917 12716 1807 --
NM_014892chr61457 ------
NM_014893chrY1566 ------
NM_014904chr1053862 3500 3209 2519 263 --1269 --
NM_014912chr1021165 255 --33115 2569 217 1710
NM_014950chr1411654 ----1698
NM_014990chr1421111 869 --11323 11212
NM_014996chr3138 ------
NM_015002chr12----12069 --
NM_015011chr13------1466
NM_015035chr2095690 5414 5071 4406 2646 2622 2422 1328 1197 14914 16696 16282
NM_015037chr10----1233 --
NM_015051chr9----32304 531 394 11141
NM_015062chr101190 ------
NM_015087chr1322633 2559 --11071 --
NM_015092chr16--13498 ----
NM_015100chr121534 95 --1295 --
NM_015132chr761470 1443 710 653 213 49 ----11425
NM_015176chr1----2717 504 --
NM_015187chr4----155 --
NM_015192chr201776 1998 ----
NM_015200chr4----12308 --
NM_015206chr1563692 3573 3554 3399 855 700 1498 23756 1314 --
NM_015208chr1821312 268 --124 --
NM_015250chr921765 661 --11562 --
NM_015252chr2----1278 --
NM_015265chr222285 2251 ------
NM_015271chr423648 331 1472 23041 1534 --
NM_015272chr16----11925 --
NM_015310chr877824 5578 5352 5276 3267 2203 1655 27933 1563 ----
NM_015328chr7----22050 686 --
NM_015344chr83123 114 93 ----11796
NM_015361chr2----168 --
NM_015365chrX53809 3057 3020 2742 525 ------
NM_015423chr1131587 1272 1230 ------
NM_015429chr31995 --1256 --
NM_015435chr8----11408 11275
NM_015436chr443174 2848 633 63 ------
NM_015458chr834856 4272 3579 1233 25229 3508 --
NM_015520chr311749 --12157 --
NM_015532chr151788 --12130 1216
NM_015548chr6------1906
NM_015550chr713482 12687 22668 513 --
NM_015554chr1532874 2354 180 12413 11869 --
NM_015560chr321978 251 --22622 2489 --
NM_015564chr512634 --1467 --
NM_015571chr611720 ----12392
NM_015640chr155010 2028 1986 994 955 ----11705
NM_015680chr21600 ------
NM_015874chr4--1450 ----
NM_015886chr845638 5453 4611 1227 --25400 3901 24021 4007
NM_015888chr11123 --22088 1016 --
NM_015906chr144601 3902 342 328 --13029 --
NM_016073chr151468 11169 ----
NM_016078chr17--1980 1899 --
NM_016083chr61172 11322 12518 13078
NM_016203chr72302 121 ------
NM_016221chr512321 --11841 --
NM_016227chr111277 ------
NM_016260chr286981 6727 6436 5152 2106 1803 1504 416 --11044 --
NM_016281chr12--1826 ----
NM_016289chr221439 678 ------
NM_016312chr122177 104 ------
NM_016315chr211439 184 11712 --
NM_016316chr2159 ------
NM_016410chr91540 ----1426
NM_016424chr173719 706 406 ----1386
NM_016485chr61778 --32205 763 685 --
NM_016507chr1722535 1249 ------
NM_016519chr41465 ----1452
NM_016617chr13----150 --
NM_016953chr265572 4787 1117 879 663 487 ------
NM_017412chr81527 ------
NM_017563chr385996 5686 5253 4908 4891 4262 1836 1233 --25117 4584 --
NM_017607chr191507 ------
NM_017632chr4----137 --
NM_017641chr1221094 453 --1150 --
NM_017644chr354708 3984 3495 3158 127 13211 11082 --
NM_017650chr734028 3733 557 1697 25053 1915 --
NM_017658chr1443299 1501 403 145 --23777 514 1929
NM_017672chr151320 --1971 11165
NM_017686chr1----1127 --
NM_017704chr111348 --2292 283 --
NM_017737chr1--171 ----
NM_017742chr1841695 1421 261 78 ------
NM_017769chr14--13181 1906 12279
NM_017778chr8----11008 --
NM_017779chr152483 1716 938 790 103 ------
NM_017780chr81287 ----1298
NM_017786chr8----1115 --
NM_017812chr71667 --1286 --
NM_017813chr844421 2293 1806 1154 ------
NM_017826chr13--1710 ----
NM_017831chr1844655 4281 4176 3283 ------
NM_017919chr955585 4476 4343 4243 26 14444 35821 3809 2202 11238
NM_017994chr722144 436 ------
NM_018011chr13--1445 ----
NM_018023chr3----12037 --
NM_018064chr6----1293 --
NM_018080chr15----1174 --
NM_018131chr101827 ------
NM_018133chr31352 --12159 --
NM_018159chrX----21569 1485 1425
NM_018195chr111399 11452 51493 1335 803 472 199 --
NM_018211chr121641 648 ----11440
NM_018214chr62894 476 ------
NM_018238chr721290 438 11308 1950 --
NM_018247chr612978 ----12747
NM_018270chr20----1640 --
NM_018362chr1122848 1537 ------
NM_018364chr122638 479 --23026 2794 --
NM_018374chr733780 786 70 14707 --14969
NM_018409chr432766 2472 114 ------
NM_018427chr16----1508 --
NM_018439chr1812515 ----12592
NM_018440chr828518 8496 18339 45560 3106 1285 826 15792
NM_018444chr822263 139 12028 12137 --
NM_018482chr811829 --1518 --
NM_018488chr172698 94 ------
NM_018557chr2----21165 191 --
NM_018640chr12----11076 --
NM_018641chr71167 ------
NM_018695chr5----2871 525 1418
NM_018898chr532406 1854 478 --12370 12362
NM_018899chr532406 1854 478 --12370 12362
NM_018900chr532406 1854 478 --12370 12362
NM_018901chr532406 1854 478 --12370 12362
NM_018902chr532406 1854 478 --12370 12362
NM_018903chr532406 1854 478 --12370 12362
NM_018904chr532406 1854 478 --12370 12362
NM_018905chr532406 1854 478 --12370 12362
NM_018906chr532406 1854 478 --12370 12362
NM_018907chr532406 1854 478 --12370 12362
NM_018908chr532406 1854 478 --12370 12362
NM_018909chr532406 1854 478 --12370 12362
NM_018910chr532406 1854 478 --12370 12362
NM_018911chr532406 1854 478 --12370 12362
NM_018970chr72767 698 22956 283 22098 1242 --
NM_018976chr1212641 --1555 --
NM_019001chr324190 3539 --1589 11365
NM_019041chr612131 ----22218 700
NM_019042chr71240 --21100 1000 --
NM_019106chr2222084 218 --1111 --
NM_019555chr31248 ----1460
NM_019593chr202494 52 --12620 1817
NM_020066chr1------1244
NM_020135chr61415 ------
NM_020198chr1711211 ------
NM_020205chr1----13046 --
NM_020245chr614605 11181 14643 --
NM_020319chr71694 --1890 --
NM_020340chr641481 751 637 612 ------
NM_020390chr333159 1504 976 14767 24360 364 --
NM_020425chr6--11424 ----
NM_020665chrX----1254 --
NM_020727chr2123537 1470 11220 1543 13008
NM_020752chr10------1588
NM_020760chr221502 623 ------
NM_020766chrX--14208 ----
NM_020772chr1768473 3003 1535 913 722 256 15403 16573 --
NM_020824chr101233 ------
NM_020841chr121136 ------
NM_020856chr1911025 ------
NM_020918chr1053559 2338 1027 410 380 13497 ----
NM_020925chr1--11366 ----
NM_020948chr132539 2307 202 ------
NM_020962chr1512121 12272 ----
NM_021132chr10----11229 --
NM_021174chr8----2643 270 --
NM_021239chr1421032 230 ------
NM_021252chr1012023 --2608 374 --
NM_021629chr344487 4403 3763 1266 --24737 3907 --
NM_021647chr433907 1335 563 --13060 14699
NM_021825chr111342 ------
NM_021911chr513594 --11975 --
NM_021912chr15----1487 14149
NM_021923chr41437 --11295 --
NM_021961chr1167140 2806 2781 1286 213 115 1715 22406 2251 --
NM_021964chr346052 4753 4584 1380 --36499 2075 943 --
NM_022080chr2042739 2419 2082 987 --21793 280 1507
NM_022170chr71346 --21747 520 --
NM_022374chr21374 ------
NM_022459chr1335791 5178 4885 --35619 5061 4454 14924
NM_022476chr16------21081 1073
NM_022658chr12----1383 --
NM_022739chr171818 ------
NM_022742chr7----137 --
NM_022753chr142758 2187 364 237 1622 32509 2450 2383 --
NM_022763chr322246 150 --12517 --
NM_022771chr12----187 --
NM_022778chr111414 ------
NM_022845chr1611886 1106 --1793
NM_022901chr921813 329 --11682 --
NM_022918chr1132141 609 463 --11652 11475
NM_023012chr12----1705 --
NM_023016chr222755 1822 1502 2924 581 12797
NM_023929chr822246 94 1582 1838 --
NM_023943chr31218 ------
NM_024007chr522521 1033 ------
NM_024408chr132527 1336 630 --1471 13035
NM_024429chr72302 121 ------
NM_024490chr15--1564 ----
NM_024511chr443274 3085 3048 2597 --21036 209 --
NM_024529chr121013 846 --1988 1400
NM_024558chr1411028 --31003 815 286 11020
NM_024573chr61128 --2667 383 --
NM_024617chr91282 ------
NM_024639chr632544 2264 660 ----12708
NM_024665chr344046 3256 649 613 1737 23678 1340 --
NM_024692chr211247 --11465 --
NM_024721chr841647 1034 870 168 --12639 --
NM_024761chr965345 4057 3882 3772 978 49 15051 --13752
NM_024828chr91636 --1302 --
NM_024911chr12601 230 ------
NM_024930chr522122 355 1963 12826 --
NM_024945chr92818 213 ------
NM_024989chr227990 1737 18144 38166 6910 776 --
NM_025047chr31388 ------
NM_025054chr823988 1022 --21127 878 --
NM_025147chr2----11130 --
NM_025191chr153384 2858 2698 936 28 --11305 --
NM_030594chr152347 339 ------
NM_030647chr755998 4768 2340 1363 1286 13867 25780 5533 --
NM_030650chr234155 593 530 21633 170 1981 --
NM_030661chr7--11336 ----
NM_030755chr1432936 2323 332 --33052 950 623 --
NM_030768chr2----134 --
NM_030786chr121425 562 ------
NM_030806chr178884 8437 7126 6574 3771 2618 2349 19118 37903 7026 1146 --
NM_030816chr163668 3385 3308 3299 2920 2381 13019 --1698
NM_030912chr101897 ------
NM_030948chr6----171 --
NM_031216chr1811614 --1651 --
NM_031267chr7----1429 --
NM_031411chr532406 1854 478 --12370 12362
NM_031435chr1232837 2489 1280 --22989 795 13034
NM_031445chr222185 317 --1301 --
NM_031483chr2033323 3053 2948 --11139 --
NM_031844chr132870 1303 583 ------
NM_031849chr532406 1854 478 --12370 12362
NM_031857chr532406 1854 478 --12370 12362
NM_031860chr532406 1854 478 --12370 12362
NM_031892chrX1833 --1627 1307
NM_031911chr421722 1072 --1851 12822
NM_031992chr71346 --21747 520 --
NM_032120chr7----196 --
NM_032121chrX1194 ------
NM_032124chr181153 ------
NM_032131chr6--1176 ----
NM_032288chr342291 2248 2061 1867 1620 11612 --
NM_032327chr101464 ------
NM_032352chr1431113 968 236 --1943 --
NM_032445chr1522036 86 12527 ----
NM_032452chr14------11237
NM_032456chr4------1655
NM_032457chr423694 2580 --13315 11056
NM_032458chrX176 --13418 12601
NM_032505chr311002 22387 331 --1723
NM_032682chr322394 1204 --32616 1455 252 --
NM_032859chr1343998 3368 1594 360 --1457 --
NM_032905chr1011025 --1997 11291
NM_032932chr1776043 5900 4775 3993 1868 330 254 25984 4276 24289 1229 --
NM_032949chr13----2154 144 --
NM_032968chrX12759 12610 --23488 3004
NM_032969chrX12759 12610 --23488 3004
NM_032973chrY12754 12609 --23484 2999
NM_032991chr451490 1036 223 112 56 --166 --
NM_033020chr144601 3902 342 328 --13029 --
NM_033029chr3----1364 --
NM_033138chr7--1548 1610 --
NM_033139chr7--1548 1610 --
NM_033140chr7--1548 1610 --
NM_033143chr4191 14063 ----
NM_033157chr7--1548 1610 --
NM_033181chr61172 11322 12518 13078
NM_033224chr755222 1964 1631 1557 955 ----11775
NM_033331chr953477 2505 633 303 277 --1455 --
NM_033389chr1744685 4185 3388 125 --14352 11109
NM_033495chrX1307 ------
NM_033512chr842810 1970 1062 911 ----1475
NM_033624chr12----12069 --
NM_033644chr5--12489 ----
NM_033645chr5--12489 ----
NM_033656chr2165554 5369 5167 4365 2045 1459 --12190 22346 1571
NM_052875chr1121366 811 12038 ----
NM_052885chr1241882 1593 1395 300 ------
NM_052923chr6129 ------
NM_052927chr5--1183 12041 --
NM_052932chr11----22485 1926 --
NM_053055chr111303 ------
NM_058191chr213900 571 152 ------
NM_080546chr92918 638 11487 ----
NM_080618chr201275 ------
NM_080745chr15146 ------
NM_080759chr131752 1841 ----
NM_080760chr131752 1841 ----
NM_080764chr2211135 2268 179 1609 22512 1144
NM_080927chr332477 1068 379 1436 ----
NM_130395chr61415 ------
NM_130435chr1022626 467 --11015 --
NM_130436chr211998 --11717 --
NM_130438chr21----12294 --
NM_130811chr20------172
NM_130831chr321978 251 --22622 2489 --
NM_130832chr321978 251 --22622 2489 --
NM_130833chr321978 251 --22622 2489 --
NM_130834chr321978 251 --22622 2489 --
NM_130835chr321978 251 --22622 2489 --
NM_130836chr321978 251 --22622 2489 --
NM_130837chr321978 251 --22622 2489 --
NM_133334chr466404 6014 5304 1549 1372 1177 --15012 25708 117
NM_133631chr3----1618 11358
NM_134421chr2--1768 1629 --
NM_134442chr2----1546 --
NM_134447chr19----1148 --
NM_138288chr1432189 1533 849 ------
NM_138391chr11911 ----2639 259
NM_138437chrX1224 ------
NM_138444chr1313101 1929 1313 --
NM_138459chr632912 2627 2482 --4705 664 656 634 --
NM_138468chr211758 --1578 1206
NM_138492chr531079 463 383 ----11106
NM_138713chr1645931 1985 1515 1055 16696 37341 5667 839 --
NM_138714chr1645931 1985 1515 1055 16696 37341 5667 839 --
NM_139131chr11----1635 --
NM_139245chr3----11421 --
NM_139323chr20----1166 --
NM_144571chr486865 5681 5250 5085 2704 2595 797 163 ------
NM_144578chr1413724 --14843 --
NM_144633chr31604 1219 ----
NM_144778chr131195 1751 ----
NM_144949chr22585 169 1676 1269 --
NM_144963chr8----22729 441 --
NM_144979chr41116 ------
NM_145029chr6--1272 ----
NM_145037chr3----11016 --
NM_145055chr1853782 2767 2634 1511 1000 22614 762 ----
NM_145174chr2221511 1394 ----1191
NM_145203chr131655 ------
NM_145284chrX11881 --12067 1920
NM_145307chr1034058 3847 3253 --1940 24021 739
NM_145320chr713482 12687 22668 513 --
NM_145321chr713482 12687 22668 513 --
NM_145322chr713482 12687 22668 513 --
NM_145330chr21146 ------
NM_145802chrX----1205 --
NM_147166chr7----1605 --
NM_147171chr71470 ------
NM_147175chrX31926 1667 1386 --11872 --
NM_147185chr71470 ------
NM_147223chr211606 ------
NM_152261chr1252415 2123 1807 880 256 --11897 --
NM_152265chr14611 564 278 220 --11086 --
NM_152267chr22----1385 --
NM_152282chr34872 228 194 178 ----11302
NM_152387chr221036 380 ------
NM_152407chr553121 2973 2721 404 92 --33139 1184 259 --
NM_152522chr21998 ------
NM_152549chr51191 1140 ----
NM_152556chr732330 1962 1011 ----12012
NM_152594chr1521814 103 --1913 --
NM_152624chr586927 5015 4982 2624 2123 1925 1874 1329 --16942 11543
NM_152629chr913774 --33608 3249 940 11421
NM_152666chr11577 --1763 --
NM_152671chr21100 ------
NM_152682chr421648 642 --2502 83 --
NM_152707chr10--2963 760 1123 --
NM_152716chr1111644 --11320 --
NM_152739chr71209 ------
NM_152756chr533659 1202 137 13256 --1497
NM_152758chr843020 2992 2493 898 12511 22581 1910 --
NM_152774chr722547 1825 2827 796 1589 --
NM_152835chr132415 2220 1950 ----12626
NM_152896chr91664 ------
NM_152910chr131519 1202 --151
NM_152999chr723249 890 11770 13616 --
NM_153040chr15----1139 --
NM_153042chr62685 560 --21710 1464 --
NM_153188chr534195 3932 1714 --1957 25000 4972
NM_153365chr412236 ------
NM_153631chr7--11336 ----
NM_153632chr7--11336 ----
NM_153702chr41290 ------
NM_153810chr1044675 3952 904 668 --14915 11842
NM_170674chr15----11293 --
NM_170675chr151433 --1969 --
NM_170676chr151433 --1969 --
NM_170677chr15----11293 --
NM_171998chrX----1349 --
NM_172071chr136512 6249 2863 25175 2499 1504 1390
NM_172242chr101816 ------
NM_172315chr15----11293 --
NM_172316chr15----11293 --
NM_173039chr111182 ------
NM_173083chr1----11222 --
NM_173214chr1645931 1985 1515 1055 16696 37341 5667 839 --
NM_173469chr1511006 --11305 --
NM_173470chrX----1205 --
NM_173564chr71803 ------
NM_173576chr10------11838
NM_173582chr1145964 2296 814 602 1496 25823 449 --
NM_173589chr111183 ------
NM_173595chr1255271 4732 4021 1207 216 --1475 15007
NM_173814chr151170 ------
NM_173829chr545404 5132 4780 1372 --1262 15709
NM_173834chrX1107 ------
NM_174921chr421067 411 --1124 --
NM_174963chr11590 ------
NM_174964chr11590 ------
NM_174965chr11609 ------
NM_174966chr11590 ------
NM_174967chr11609 ------
NM_174968chr11590 ------
NM_174969chr11590 ------
NM_174970chr11609 ------
NM_174971chr11590 ------
NM_175607chr311712 ------
NM_175610chr15----1219 --
NM_175612chr311712 ------
NM_175619chr41136 ------
NM_175921chr554078 2921 2896 1675 321 14188 ----
NM_176787chr1831322 1098 517 11359 1127 --
NM_178009chr131482 1165 ----
NM_178498chr1154024 2622 1061 649 130 11562 ----
NM_178527chr1--131 ----
NM_178812chr8----21607 1377 --
NM_181054chr1411000 --1371 --
NM_181481chr1856630 4990 4315 313 98 16531 14944 --
NM_181482chr1856630 4990 4315 313 98 16531 14944 --
NM_181483chr1856630 4990 4315 313 98 16531 14944 --
NM_181504chr543488 2549 1665 1484 --1337 13643
NM_181523chr543488 2549 1665 1484 --1337 13643
NM_181524chr543488 2549 1665 1484 --1337 13643
NM_181659chr2042644 2495 919 132 12971 12320 --
NM_181659chr2042644 2495 919 132 12971 12320 --
NM_181670chr1221160 278 ------
NM_181836chr5168 --1293 --
NM_181869chr1232885 2303 2056 --2424 58 --
NM_181886chr4----1513 --
NM_181887chr4----1513 --
NM_181888chr4----1513 --
NM_181889chr4----1513 --
NM_181890chr4----1513 --
NM_181891chr4----1513 --
NM_181892chr4----1560 --
NM_181893chr4----1513 --
NM_182314chrX----21247 324 --
NM_182485chr41801 ------
NM_182501chr223267 1313 --1535 13336
NM_182646chr41801 ------
NM_182648chr14--1509 ----
NM_182666chr31104 ------
NM_182697chr711155 ------
NM_182944chr141378 1341 ----
NM_182948chr142894 2875 1032 783 1803 ----
NM_183380chr6------1906
NM_183419chr8----11408 11275
NM_194291chr832827 2631 908 --32234 1932 1213 --
NM_194301chr141939 --11151 11040
NM_194314chr152135 2059 1841 1810 1587 --25174 3586 --
NM_194434chr1874546 3767 1827 1554 1411 450 433 15729 2792 571 --
NM_197941chr532898 2657 842 1212 --12084
NM_197968chr13--1134 ----
NM_198043chr101464 ------
NM_198044chr101464 ------
NM_198045chr101464 ------
NM_198046chr101464 ------
NM_198120chr8----1518 --
NM_198181chr1532777 2728 1973 ------
NM_198261chr12----1705 --
NM_198262chr12----1705 --
NM_198270chrX22895 2539 --1395 13217
NM_198334chr111911 ------
NM_198391chr20----1536 1421
NM_198404chr131312 --1623 --
NM_198443chr16199 ------
NM_198467chr71568 --1587 --
NM_198503chr11348 --32043 1634 176 --
NM_198507chr52437 102 ------
NM_198597chr101282 --1875 --
NM_198793chr333907 3157 671 ------
NM_198794chr1421190 1013 --1308 --
NM_198859chr344323 1408 1370 917 23445 1856 23110 972 --
NM_199168chr1011501 --11182 --
NM_199205chr8----2643 270 --
NM_199245chr12--12293 ----
NM_199327chr41245 --21074 952 --
NM_199461chr102707 609 --1794 --
NM_201428chr11------11665
NM_201429chr11------11665
NM_201430chr11------11591
NM_201453chr9----1118 --
NM_201591chr41659 11529 --11809
NM_201592chr41659 11529 --11809
NM_203283chr4--1450 ----
NM_203284chr4--1450 ----
NM_203372chr21438 ------
NM_203390chr821572 1182 --11365 --
NM_203458chr1----1720 --
NM_205846chr531079 463 383 ----11106
NM_205860chr122682 197 ------
NM_206808chr13137 ------
NM_206853chr633868 2968 1534 --21212 1186 --
NM_206854chr625129 4229 --23378 142 11182
NM_206855chr636094 5194 610 --34343 3909 1107 12147
NM_206909chr877824 5578 5352 5276 3267 2203 1655 27933 1563 ----
NM_207171chr121534 95 --1295 --
NM_207304chr13182 1638 ----
NM_212558chr943452 2621 138 112 --21508 483 --
NM_213589chr273954 1441 1371 1045 1010 382 96 14486 14510 --