TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-625-3p
miRNA Sequence: GACUAUAGAACUUUCCCCCUCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1163511 3354 3181 1070 638 341 13306 --12390
NM_000084chrX116573 6185 5457 5105 4902 4375 1740 712 664 369 193 12584 32609 1430 255 26280 2577
NM_000125chr6103979 2771 1514 1273 740 591 553 500 479 299 ------
NM_000176chr5123718 3283 3277 2969 2742 2636 2477 1538 503 417 153 79 12821 13749 11364
NM_000255chr61143 ------
NM_000337chr556485 6311 6277 633 565 --36513 5084 1464 --
NM_000343chr221137 ------
NM_000378chr111392 ------
NM_000408chr253417 3150 2792 782 453 ------
NM_000461chr3104615 4000 3754 3640 3430 1552 941 609 519 231 ------
NM_000484chr21173 ------
NM_000555chrX147432 6968 6855 6827 6801 6583 5872 4783 2978 2066 1853 1088 931 348 2829 55 16808 --
NM_000572chr12121 24 ----1278
NM_000578chr211269 ------
NM_000618chr1286302 5215 4538 4209 4027 2525 917 247 15040 --14902
NM_000618chr1286302 5215 4538 4209 4027 2525 917 247 15040 --14902
NM_000726chr211280 ------
NM_000809chr4138888 8619 8131 7971 7405 6794 6417 6126 6052 5989 2018 1651 1499 39063 6180 1007 38384 7042 6383 17860
NM_000813chr575339 4905 4367 4343 3885 1669 925 14013 15199 --
NM_000902chr372543 2445 2289 2116 2001 792 281 --1413 --
NM_001001419chr5105049 4898 4848 4542 4013 1393 1122 1051 972 749 2488 346 ----
NM_001001420chr5105049 4898 4848 4542 4013 1393 1122 1051 972 749 2488 346 ----
NM_001001481chr893052 2924 2316 2169 1301 1231 718 448 105 --1690 --
NM_001001668chr1963609 3007 1327 1300 274 153 53115 3063 2952 1346 446 2720 585 --
NM_001002860chr1474693 4086 3984 3962 3323 1249 482 14530 21874 993 --
NM_001003652chr1887792 7683 6263 2828 2422 1621 532 77 11726 11407 --
NM_001003679chr162202 2074 1530 510 141 58 21637 366 11524 --
NM_001003712chr1243942 2939 2854 855 13964 --22910 332
NM_001004023chr11223 ------
NM_001004419chr1274450 3988 3372 2910 2841 1513 1278 --13494 --
NM_001005746chr211280 ------
NM_001005747chr211280 ------
NM_001006605chr11797 ------
NM_001006605chr11797 ------
NM_001006641chr911118 ------
NM_001006642chr911118 ------
NM_001006643chr911118 ------
NM_001008564chr1312192 ------
NM_001008738chr532606 2318 1117 12532 12291 --
NM_001009899chr356155 6128 5301 5208 1162 16518 15912 --
NM_001009909chr1173860 3706 3460 3092 963 674 326 --13255 --
NM_001010861chr142438 1082 995 957 1987 --1552
NM_001010888chrX62928 1074 1033 913 520 174 24273 75 --14335
NM_001010891chr575880 5355 4534 1947 1309 1026 979 26655 748 12317 --
NM_001010908chr101284 ------
NM_001010922chr1104169 4009 3743 3683 2643 1632 1513 1367 1215 1126 13497 ----
NM_001011513chr443767 3694 3415 3014 34103 3446 3371 11296 13574
NM_001011663chr101141 ------
NM_001011666chr795740 5730 4944 4114 2162 1596 1161 133 38 --14160 11974
NM_001011885chr1521579 64 11290 --21629 1534
NM_001012423chr1562466 2137 858 727 136 103 --12631 --
NM_001012659chr333506 3245 2697 21382 1351 --13651
NM_001013620chr1277938 7368 7332 7172 6548 2962 1285 13240 12599 --
NM_001015882chr92708 697 ------
NM_001018074chr5123718 3283 3277 2969 2742 2636 2477 1538 503 417 153 79 12821 13749 11364
NM_001018075chr5123718 3283 3277 2969 2742 2636 2477 1538 503 417 153 79 12821 13749 11364
NM_001018076chr5123718 3283 3277 2969 2742 2636 2477 1538 503 417 153 79 12821 13749 11364
NM_001018077chr5123718 3283 3277 2969 2742 2636 2477 1538 503 417 153 79 12821 13749 11364
NM_001018136chr171106 ------
NM_001018137chr171106 ------
NM_001018138chr171106 ------
NM_001018139chr171106 ------
NM_001018676chr81490 ------
NM_001018677chr81490 ------
NM_001024094chr5123718 3283 3277 2969 2742 2636 2477 1538 503 417 153 79 12821 13749 11364
NM_001024647chr12147554 7525 7141 7044 6625 6384 1909 1467 1403 1094 789 651 233 65 12047 17537 --
NM_001025079chr322680 1543 --33025 1114 882 12605
NM_001025252chr842931 2900 1091 597 22576 248 ----
NM_001025253chr842931 2900 1091 597 22576 248 ----
NM_001025616chr421613 404 ----11594
NM_001030055chr1484327 4142 3521 3200 1765 858 715 325 41871 1709 1402 1328 ----
NM_001031710chr71795 ------
NM_001031712chr61168 ------
NM_001031804chr1684036 3838 3786 1715 1578 1543 1065 694 11005 ----
NM_001033057chr372071 1868 635 592 429 421 289 --22011 442 11394
NM_001037172chr331128 965 271 --1914 11018
NM_001037317chr142438 1082 995 957 1987 --1552
NM_001037324chr31759 ------
NM_001039538chr253680 3630 3054 1414 771 ----1129
NM_001039547chr3127758 7400 6731 5577 5487 5083 3224 3110 3008 2301 1387 1337 26740 1544 ----
NM_001039590chrX53849 3524 2985 1423 193 1248 1636 --
NM_001039591chrX53849 3524 2985 1423 193 1248 1636 --
NM_001040135chr72738 570 ------
NM_001040157chr442164 1976 1911 823 --3628 599 346 --
NM_001040202chr472443 2412 2288 1982 855 729 546 ----1163
NM_001040610chr15133 ------
NM_001040665chr753428 3244 1700 1640 1439 ----1889
NM_001042473chr1052095 2087 2031 1514 723 1498 --12145
NM_001042506chrX31425 1411 542 ------
NM_001042555chr12104590 3624 3607 3247 2963 986 928 785 389 98 13361 ----
NM_001042573chr1712037 ------
NM_001042599chr2107753 7220 6339 6256 5771 5733 2706 2690 1079 776 12414 15308 12931
NM_001042603chr1234316 3877 1777 21347 1082 11530 23978 3638
NM_001042604chr384871 4226 3991 3571 3383 2976 1232 907 23677 1671 24086 1573 --
NM_001042669chr421613 404 ----11594
NM_001042683chr631431 1314 57 ------
NM_001068chr31229 ------
NM_001099678chr386316 5446 2318 2306 1768 1686 1186 686 11724 25800 4894 --
NM_001146chr851637 1506 822 336 222 --1773 2644 317
NM_001167chrX96655 6385 4784 4682 2300 2273 1321 816 680 --26170 5335 --
NM_001173chr1484327 4142 3521 3200 1765 858 715 325 41871 1709 1402 1328 ----
NM_001174chrX21951 1505 ------
NM_001204chr297594 6042 5791 5175 1649 1111 1032 971 523 17254 14981 11127
NM_001396chr2122602 41 12749 ----
NM_001412chrX33660 3595 1480 ------
NM_001438chr163457 3451 3406 3254 3146 2548 --12486 --
NM_001498chr611078 ------
NM_001527chr664809 3775 3615 905 545 410 23787 496 --1727
NM_001546chr621405 952 ------
NM_001560chrX12639 ------
NM_001584chr111485 ------
NM_001609chr1074491 3678 3571 1250 945 740 650 --13665 --
NM_001663chr1472743 2737 2682 2536 2492 1739 430 22216 610 --12130
NM_001688chr14569 282 142 103 ------
NM_001717chr151129 ------
NM_001730chr1331573 1367 575 11325 ----
NM_001730chr1331573 1367 575 11325 ----
NM_001777chr322680 1543 --33025 1114 882 12605
NM_001781chr124632 154 120 33 ------
NM_001800chr191132 ------
NM_001830chrX32506 1105 192 ------
NM_001842chr91581 ------
NM_001850chr3143 ------
NM_001859chr931517 1214 888 --22567 1577 23957 3399
NM_001918chr1119311 8476 7861 7485 6339 2455 1516 942 896 240 214 19151 42516 2013 1951 1781 17944
NM_001942chr1851889 1417 1281 743 392 21516 1439 1263 11918
NM_001955chr61951 ------
NM_002010chr131603 ------
NM_002025chrX77889 5625 3097 2578 2304 1106 997 28550 2462 16719 --
NM_002027chr81490 ------
NM_002035chr1852457 1595 1314 1269 82 ----12829
NM_002061chr121629 577 --11604 --
NM_002163chr161432 ------
NM_002193chr211520 ------
NM_002196chr2011080 ------
NM_002196chr2011080 ------
NM_002203chr564036 3748 3406 3184 2582 977 ------
NM_002214chr775270 3988 3812 3469 1932 601 579 15122 15619 --
NM_002222chr31285 ------
NM_002270chr553991 2232 2207 552 398 14152 11085 15628
NM_002310chr576463 6253 5897 950 548 185 166 --14412 --
NM_002374chr253680 3630 3054 1414 771 ----1129
NM_002376chr141529 ------
NM_002448chr41755 ------
NM_002467chr82357 310 1344 ----
NM_002506chr11107 ------
NM_002512chr171106 ------
NM_002577chr383466 3427 3420 1463 1308 1214 770 530 12911 ----
NM_002591chr201647 ------
NM_002645chr1142753 2368 526 381 23009 106 ----
NM_002655chr885324 3671 3563 3408 3212 1481 1064 649 ------
NM_002703chr461396 1377 1308 467 56 24 --21673 437 --
NM_002711chr71619 ------
NM_002717chr81144 ------
NM_002733chr121178 ------
NM_002822chr1241700 1640 490 161 ------
NM_002851chr71292 ------
NM_002868chr121279 ------
NM_002941chr32445 373 ------
NM_003034chr12117361 7165 7145 5947 5554 5437 5076 3106 1447 589 208 12923 ----
NM_003081chr2021215 1126 ------
NM_003108chr267057 6211 5070 1617 803 68 ----21299 1195
NM_003176chr1149 ------
NM_003176chr1149 ------
NM_003199chr1865330 4559 3777 1649 1554 616 11869 24524 833 23958 681
NM_003204chr1711219 ------
NM_003211chr121325 ------
NM_003253chr2151276 1235 631 577 297 11412 ----
NM_003291chr13144 ------
NM_003304chr331548 440 136 ------
NM_003340chr42523 34 ------
NM_003392chr333694 2760 50 ------
NM_003468chr284394 3941 3296 1373 1269 752 656 548 13758 33960 1387 683 --
NM_003473chr102725 99 ------
NM_003558chr92515 445 --1695 --
NM_003574chr1895436 5257 4866 4274 4053 2306 2188 1453 664 14257 11937 --
NM_003582chr11223 ------
NM_003615chr353503 2591 1375 551 497 ----12616
NM_003682chr111836 ------
NM_003760chr11238 ------
NM_003884chr341742 1657 501 249 ------
NM_003913chr694056 2932 1522 1506 826 798 439 254 202 34281 3685 977 ----
NM_003930chr751721 513 320 311 249 --12389 --
NM_003993chr1135 ------
NM_004035chr1743175 1344 636 91 --34652 1872 995 --
NM_004170chr931680 1481 1386 ------
NM_004171chr11189383 9179 9069 7187 6994 6944 6649 6519 5923 3103 2400 2364 2266 1631 1569 1241 1137 757 21916 855 29013 3469 153
NM_004267chr31115 ------
NM_004337chr842040 1995 841 439 11891 --1124
NM_004362chr43678 548 519 ------
NM_004419chr1011086 ------
NM_004440chr661751 1342 799 470 293 143 --11626 --
NM_004496chr141995 ------
NM_004521chr101331 ------
NM_004575chr411239 ----11541
NM_004586chrX94851 3734 3595 3319 1225 1165 368 327 239 1755 ----
NM_004612chr974491 4413 4405 3661 1682 1148 235 44237 3221 990 542 2716 474 --
NM_004663chr1581606 1461 996 988 538 396 200 36 --11436 --
NM_004719chr1242880 2614 432 270 21958 1914 ----
NM_004725chr1031249 920 408 ------
NM_004742chr31175 ------
NM_004744chr461078 953 899 888 608 57 1519 12479 1644
NM_004748chr1573207 2908 2785 1353 1279 1066 261 13117 23516 3469 --
NM_004760chr71548 ------
NM_004805chr21395 ------
NM_004857chr1464756 4724 4036 3925 3503 3062 34636 4224 316 ----
NM_004867chrX1244 ------
NM_004869chr1821529 521 ------
NM_004883chr51202 ------
NM_004904chr795740 5730 4944 4114 2162 1596 1161 133 38 --14160 11974
NM_004926chr141244 ------
NM_004951chr13124 ------
NM_004956chr754583 4500 4354 2946 1688 --23134 155 21012 381
NM_004969chr101179 ------
NM_004985chr1264452 4283 3559 964 846 748 13807 1498 --
NM_005056chr1234560 4121 2021 21591 1326 11774 24222 3882
NM_005077chr9259 27 ------
NM_005079chr842931 2900 1091 597 22576 248 ----
NM_005105chr131632 1572 665 ------
NM_005126chr352213 1956 1874 1420 833 11491 --11809
NM_005188chr1186880 5631 3309 3287 839 785 674 299 --37811 2188 1466 --
NM_005235chr2107753 7220 6339 6256 5771 5733 2706 2690 1079 776 12414 15308 12931
NM_005284chr61350 ------
NM_005339chr464113 4044 3795 1637 985 24 23144 2650 11733 --
NM_005359chr1866261 5695 4865 2251 1655 1531 15016 14252 --
NM_005378chr21859 ------
NM_005465chr131936 647 259 ------
NM_005479chr1021480 1391 ------
NM_005504chr1296260 6130 5409 5174 1839 1531 765 681 113 54842 4833 2061 713 121 ----
NM_005578chr384972 4609 3951 3730 3513 3402 1903 1832 --1627 23992 3608
NM_005596chr995974 4803 4723 3992 1900 1715 1191 778 623 ------
NM_005629chrX2859 520 ------
NM_005649chr51391 ------
NM_005665chr1104729 3391 3270 1660 1574 1451 1319 335 227 24 --24074 4012 --
NM_005739chr1551936 1596 650 39 28 22087 1719 ----
NM_005786chr182836 792 ------
NM_005795chr232273 953 71 --12689 --
NM_005802chr91740 ------
NM_005840chrX96314 6289 5869 5105 2535 1936 1038 938 238 12003 ----
NM_005853chr161128 ------
NM_005862chr311072 ------
NM_005872chr11203 ------
NM_005901chr1887792 7683 6263 2828 2422 1621 532 77 11726 11407 --
NM_005902chr1594493 4155 3228 3035 1571 1544 1329 945 766 ------
NM_005903chr5105049 4898 4848 4542 4013 1393 1122 1051 972 749 2488 346 ----
NM_005996chr1241500 1421 615 477 ------
NM_006037chr221505 1227 ------
NM_006047chr2053073 2978 742 439 22 22591 908 --13414
NM_006054chr1141548 565 382 280 ------
NM_006203chr565352 4643 4314 1896 784 758 11254 ----
NM_006251chr563049 2982 997 403 242 152 1823 1815 --
NM_006256chr162153 2104 1755 906 642 323 ------
NM_006264chr41371 ------
NM_006291chr1422052 1423 ------
NM_006325chr12141 ------
NM_006380chr1764414 4302 4214 3787 1070 164 23001 1135 21393 430 11371
NM_006457chr443767 3694 3415 3014 34103 3446 3371 11296 13574
NM_006537chr151240 ------
NM_006544chr1485510 5058 3822 2290 1237 1097 1041 850 25741 3745 ----
NM_006577chr211247 ------
NM_006599chr1686505 6418 6193 5853 5027 3288 2612 930 27939 6164 13011 --
NM_006601chr121389 ------
NM_006628chr1584610 3707 1763 1635 884 843 636 337 1264 ----
NM_006654chr12104590 3624 3607 3247 2963 986 928 785 389 98 13361 ----
NM_006761chr171351 ------
NM_006813chr61222 ------
NM_006826chr261224 1029 356 207 124 83 11123 1941 --
NM_006914chr91292 ------
NM_006956chr762338 2286 1772 1564 204 42 32252 2067 633 ----
NM_006981chr941053 367 250 122 1926 ----
NM_006996chr131789 335 28 ------
NM_007006chr1683420 3193 3022 2418 2327 1198 1112 294 ----13004
NM_007007chr1241513 968 407 242 24214 335 44545 4176 3819 1194 --
NM_007013chr81302 ------
NM_007073chr674212 4124 4049 4005 3741 2845 619 13821 13993 --
NM_007114chr373094 2955 2770 2749 957 112 87 1153 ----
NM_007145chr1911350 ------
NM_007195chr1863571 3485 3369 2906 997 654 22959 339 13049 --
NM_007197chr121780 ------
NM_007212chr13746 439 39 12128 --1460
NM_007249chr1359070 8000 3596 3405 1712 17206 29004 770 --
NM_007287chr372543 2445 2289 2116 2001 792 281 --1413 --
NM_007288chr372543 2445 2289 2116 2001 792 281 --1413 --
NM_007289chr372543 2445 2289 2116 2001 792 281 --1413 --
NM_007292chr1743175 1344 636 91 --34652 1872 995 --
NM_007347chr1582893 2611 1096 972 595 447 440 317 23037 2958 ----
NM_012081chr553471 3145 3070 2804 865 --11014 --
NM_012120chr662643 2301 1190 707 344 134 1641 1415 --
NM_012214chr295258 5220 4980 4705 763 625 390 376 113 11102 --14525
NM_012238chr1021565 121 ------
NM_012262chr142027 1432 1412 889 1622 33639 1754 534 --
NM_012300chr512142 ------
NM_012334chr543909 3608 3400 1058 13641 44232 3206 1778 715 14466
NM_012412chr73670 544 123 ------
NM_012428chr151827 --1854 --
NM_012431chr753259 1443 957 727 251 --13555 --
NM_013231chr1453612 3107 3056 1771 1660 --13985 --
NM_013249chr112195 117 ------
NM_013255chr758066 7107 5397 2321 521 38732 7085 718 16696 1933
NM_013269chr1274377 3915 3299 2837 2768 1440 1205 --13421 --
NM_013320chr121155 ------
NM_013357chr82811 641 ----1600
NM_013423chrX2913 467 ------
NM_013427chrX2913 467 ------
NM_013438chr931283 1205 259 11211 --1325
NM_013447chr1953477 3386 2913 2707 282 ------
NM_013943chr163239 2245 1169 1162 925 78 1148 11189 --
NM_013981chr51202 ------
NM_013982chr51202 ------
NM_013983chr51202 ------
NM_014011chr262308 995 736 547 430 66 11800 22301 1682 --
NM_014021chr152685 2536 393 352 287 2940 561 ----
NM_014023chr1062861 2600 978 741 636 502 --1748 --
NM_014089chr1312192 ------
NM_014155chr1177306 6759 6706 4744 2069 1385 1300 54961 2390 882 773 748 47264 1812 1647 1450 --
NM_014182chr121610 ------
NM_014212chr121689 --1696 --
NM_014243chr44733 705 603 96 ------
NM_014253chrX1468 ------
NM_014263chr1011402 ------
NM_014267chr11172 ------
NM_014279chr91768 ------
NM_014294chr841386 1160 1000 547 ------
NM_014331chr477521 7061 5323 2333 1752 393 187 36533 5270 2909 --16268
NM_014372chr131875 1551 802 21563 1311 --11605
NM_014393chr852048 1523 679 551 422 --22129 1691 --
NM_014421chr442035 1616 1508 60 ------
NM_014423chr554143 3850 1865 1452 738 25428 3725 24323 3762 --
NM_014445chr372227 2003 1783 1707 1625 594 463 1663 ----
NM_014470chr121740 ------
NM_014487chr41158 ------
NM_014521chr21371 ------
NM_014572chr1321684 305 ------
NM_014608chr151542 ------
NM_014613chr513113 ------
NM_014693chr31759 ------
NM_014700chr1611349 ------
NM_014709chr21133 ------
NM_014733chr572182 1604 1398 712 629 263 207 11784 --11422
NM_014739chr663899 2870 963 408 296 124 ----1518
NM_014741chr112828 781 ------
NM_014757chr512183 ------
NM_014810chr163212 3101 1321 992 552 428 --22399 1106 --
NM_014832chr1341948 1601 1491 381 ------
NM_014892chr61415 ------
NM_014899chr573006 2829 2427 2350 1974 1142 712 ----12743
NM_014901chr521790 1531 ------
NM_014904chr1054059 3307 2993 2600 660 12983 ----
NM_014906chr17114047 3956 3704 3224 3215 2639 1485 1406 866 716 603 --1687 --
NM_014923chr1362265 2052 1819 1574 272 114 ------
NM_014950chr141438 21701 1174 1496 1583
NM_014953chr13104201 3463 3339 3292 2882 1610 1508 1427 1037 761 13456 11303 21539 1322
NM_014982chr1485337 5058 3730 3576 1688 1516 1180 460 ------
NM_014999chr1241517 1170 371 107 ------
NM_015051chr943249 2416 1144 881 32695 1241 176 --12310
NM_015054chr12130 ------
NM_015057chr131287 ------
NM_015076chr6104345 4328 3774 3215 3009 1669 1281 688 407 327 14216 1340 --
NM_015137chr822400 1819 1778 ----
NM_015138chr1562722 2305 2172 2031 778 678 --12432 --
NM_015153chr61208 ------
NM_015185chrX32480 935 55 ------
NM_015271chr464041 3956 2709 1075 402 250 1916 --13376
NM_015310chr896912 6723 6133 5525 3202 2555 2270 1367 1128 --35778 1544 399 --
NM_015317chr23843 441 421 11029 ----
NM_015326chr15977 926 430 415 39 ------
NM_015344chr832159 1420 518 ----1232
NM_015354chr91415 ------
NM_015361chr24266 124 91 31 ------
NM_015375chr144983 3140 603 89 --14275 --
NM_015387chr241986 1490 497 93 ----1430
NM_015393chr443111 1183 801 123 ----13081
NM_015458chr885312 5258 4800 3901 3409 1439 1150 631 14271 34063 1950 1628 --
NM_015459chr111222 ------
NM_015460chr311928 ------
NM_015520chr352769 2566 1127 1119 987 --12709 12092
NM_015541chr321367 397 ------
NM_015571chr652146 2079 1071 805 308 12436 --1401
NM_015602chr141764 1617 616 470 1293 11381 11324
NM_015626chr171167 ------
NM_015879chr1835565 2667 2047 11673 68509 6200 5735 2216 1605 326 --
NM_015886chr894924 4259 4017 1851 1651 1635 1492 1413 884 15659 --15132
NM_015902chr81155 ------
NM_015912chr832196 376 221 ----1787
NM_015999chr11495 ------
NM_016009chr174748 3895 3218 1624 1410 676 441 11874 --11221
NM_016021chr622766 2668 ------
NM_016083chr653822 3009 2441 1384 781 1407 13172 --
NM_016087chr721164 423 ------
NM_016195chr102695 35 ------
NM_016260chr297217 7169 6752 5798 5655 800 781 727 570 15923 16277 16791
NM_016300chr33471 434 211 ------
NM_016351chr7153 ------
NM_016519chr41492 ------
NM_016569chr1241500 1421 615 477 ------
NM_016578chr111645 ------
NM_016953chr276060 4300 3919 1017 924 770 621 --22237 806 1662
NM_017420chr1453596 3363 3143 1496 972 13071 11444 --
NM_017447chr2163732 3099 2951 2938 1074 100 --14195 13768
NM_017455chr151827 --1854 --
NM_017544chrX1750 ------
NM_017637chr9118449 7708 6578 3706 2731 2692 2285 2123 735 460 217 23230 2393 15719 --
NM_017658chr14104657 4422 3667 3614 3450 3289 1724 1388 936 29 11826 33875 1520 731 13697
NM_017740chr161151 ------
NM_017745chrX134 ------
NM_017813chr875755 3997 2338 1267 1034 532 279 24263 1829 23853 832 11097
NM_017831chr1874483 4352 3620 1456 1147 963 141 ------
NM_017915chr1221025 828 1283 ----
NM_017946chr721009 329 --11349 11099
NM_018004chr31311 ------
NM_018015chrX1922 --1995 --
NM_018067chr11151 ------
NM_018078chr42987 252 1395 ----
NM_018084chr232662 664 108 ----1471
NM_018098chr331119 993 26 1360 ----
NM_018120chr81530 ------
NM_018178chr131910 1548 337 ------
NM_018184chr352115 1812 1482 1440 389 ----11335
NM_018221chr2173 ------
NM_018237chr101256 ------
NM_018299chr893052 2924 2316 2169 1301 1231 718 448 105 --1690 --
NM_018353chr141917 ------
NM_018373chr1486277 4988 4955 4844 1878 1813 1741 553 2658 535 21090 925 16382
NM_018374chr775221 4651 4367 1167 675 514 382 35059 4415 468 14720 21906 280
NM_018440chr8118597 7575 7192 6635 3119 2957 2755 2401 2288 1724 1368 17329 46299 2830 2274 1518 --
NM_018584chr121029 358 ------
NM_018602chr1521109 176 ------
NM_018693chr21230 ------
NM_018846chr71795 ------
NM_019001chr384871 4226 3991 3571 3383 2976 1232 907 23677 1671 24086 1573 --
NM_019035chr431858 634 540 2793 763 ----
NM_019067chrX74410 3743 3452 3413 3348 3080 1721 34745 4481 3331 23513 3065 14711
NM_019091chr23177 108 71 --1758 --
NM_019102chr71161 ------
NM_019102chr71161 ------
NM_020156chr71120 ------
NM_020177chr552806 2638 2210 692 655 12091 ----
NM_020226chr41741 ------
NM_020351chr3143 ------
NM_020445chr72738 570 ------
NM_020673chr2097724 7568 7195 5382 4909 4830 2334 889 506 1447 ----
NM_020718chr1644675 4581 2194 1318 16567 26249 2240 1865
NM_020739chr1573207 2908 2785 1353 1279 1066 261 13117 23516 3469 --
NM_020742chrX12495 --11940 --
NM_020772chr17108481 7983 5778 3041 2684 2670 1499 1110 908 165 16490 28196 6689 11598
NM_020774chr18146259 6216 5982 5386 5227 4556 4096 2104 1682 1615 1489 1438 1234 1046 25549 1078 15495 --
NM_020775chr11152 ------
NM_020830chr283207 3125 2905 2593 2270 2064 747 267 12868 ----
NM_020841chr1243942 2939 2854 855 13964 --22910 332
NM_020853chr1292792 2688 2019 1791 1050 925 727 589 84 ----12312
NM_020873chr31854 ------
NM_020937chr143575 147 140 ------
NM_020943chr2178 ------
NM_021005chr151999 ------
NM_021033chr1383477 3360 3230 2657 1131 1052 1007 664 --11001 --
NM_021038chr3113282 3030 2993 2648 2463 2369 1300 1043 936 485 395 --23000 358 --
NM_021083chrX63344 3101 3090 1329 569 137 --13527 --
NM_021103chr21203 ------
NM_021160chr6198 ------
NM_021238chr1262003 1986 1682 1663 587 215 --11675 --
NM_021639chr11193 ------
NM_021723chr7153 ------
NM_021911chr575339 4905 4367 4343 3885 1669 925 14013 15199 --
NM_021942chr41182 ------
NM_021954chr1343244 2700 538 34 --22797 323 11387
NM_021961chr1177223 6646 6019 4803 1317 884 610 1758 ----
NM_021964chr3146140 5811 4931 4802 4709 4495 4385 2433 1647 993 821 710 488 209 ------
NM_021970chr42606 158 ------
NM_022072chr31266 ------
NM_022162chr1621194 1155 ------
NM_022169chr11180 ------
NM_022351chr883134 2803 1008 996 766 598 571 26 ------
NM_022444chr73784 744 109 11648 1678 11877
NM_022456chr12147554 7525 7141 7044 6625 6384 1909 1467 1403 1094 789 651 233 65 12047 17537 --
NM_022716chr142484 2018 693 468 --22168 1079 --
NM_022782chr121346 ------
NM_022818chr1621619 1186 ------
NM_022843chr1331258 565 215 ----11491
NM_022893chr262946 2633 2417 2221 566 91 22163 375 --12286
NM_022918chr1132059 814 485 --1230 21480 471
NM_023071chr1211074 ------
NM_023079chr171563 ------
NM_024015chr171178 ------
NM_024055chr51585 ------
NM_024095chr121111 ------
NM_024122chrX135 ------
NM_024311chr171278 ------
NM_024328chr141263 ------
NM_024424chr111392 ------
NM_024425chr111392 ------
NM_024426chr111392 ------
NM_024501chr21758 ------
NM_024520chr21277 ------
NM_024539chrX11124 --1141 --
NM_024567chr81542 ------
NM_024580chr15133 ------
NM_024652chr151767 ------
NM_024744chr282307 2047 2029 1008 932 773 278 70 11731 ----
NM_024761chr975153 4485 4044 3629 3549 3337 1916 ------
NM_024947chr3118716 8324 6492 3815 3704 3642 3533 2284 1946 1481 1430 58775 7788 3627 3038 1849 ----
NM_024989chr2178096 8054 7725 6941 6752 6654 6188 5945 5882 5304 3070 2936 2542 1517 1272 465 242 58154 7989 7943 7258 207 27711 419 17862
NM_025073chr1104695 4632 4583 4132 3556 3496 1896 1704 870 544 --1644 --
NM_025134chr16102553 2471 2385 2362 2250 2069 2006 780 442 358 --12491 --
NM_025138chr1341205 1172 1041 321 --11424 11055
NM_025146chr352505 2483 1666 1048 890 ------
NM_025160chr134310 4189 697 23744 1092 13757 12616
NM_025238chr1521376 591 41087 633 618 610 --21426 1331
NM_030647chr766142 5409 4537 4105 2026 980 35796 1421 105 --14689
NM_030648chr4105591 5484 3423 1907 1494 1427 1171 875 724 379 25027 463 13403 --
NM_030674chr1285290 4522 4403 2207 2147 938 825 534 --11535 --
NM_030784chr62146 94 ------
NM_030816chr162452 2402 2332 791 569 511 22660 2385 --13307
NM_030965chr11568 ------
NM_031291chr42522 231 ------
NM_031296chr472649 2534 2216 2194 2172 1915 532 ----12080
NM_031305chr421613 404 ----11594
NM_031418chr1162481 2148 1953 841 794 426 12845 ----
NM_031442chrX63185 2614 2594 2287 1969 814 1991 11113 --
NM_031483chr2022271 990 ------
NM_031845chr253680 3630 3054 1414 771 ----1129
NM_031847chr253680 3630 3054 1414 771 ----1129
NM_031882chr51171 ------
NM_032012chr974658 4453 4228 3509 3241 1423 472 21153 893 33369 1588 1324 11296
NM_032145chr611701 ------
NM_032154chr101141 ------
NM_032228chr1173515 3089 3059 2586 1213 356 39 22729 134 ----
NM_032246chr154883 489 428 236 ----1165
NM_032250chr91884 ----1297
NM_032321chr242069 1036 1025 652 ------
NM_032439chr1031445 1343 1242 11214 ----
NM_032466chr841455 1312 1288 148 ------
NM_032482chr191864 ------
NM_032499chr151263 ------
NM_032523chr2175 ------
NM_032547chr41298 ------
NM_032558chr921233 326 ------
NM_032598chr17134 ------
NM_032784chr61842 ------
NM_032810chr1061188 946 436 267 151 116 1505 11126 --
NM_032813chr131151 ------
NM_032844chr10138 ------
NM_032873chr1154500 4397 4073 1603 1371 11074 13119 11356
NM_032968chrX43633 2808 1049 44 --1833 13001
NM_032969chrX43633 2808 1049 44 --1833 13001
NM_032973chrY43625 2803 1049 44 --1833 12996
NM_033067chr11684 ------
NM_033081chr2011162 ------
NM_033181chr653822 3009 2441 1384 781 1407 13172 --
NM_033254chr31102 ------
NM_033285chr874306 4113 3832 2906 2753 1777 565 13139 11679 --
NM_033360chr1264573 4404 3680 1085 967 869 13928 1619 --
NM_033389chr1743881 3842 699 629 13134 11346 23142 3123
NM_033396chr111309 ------
NM_033430chr463907 3596 1205 911 454 84 --13225 --
NM_033437chr463907 3596 1205 911 454 84 --13225 --
NM_033484chr51624 ------
NM_033505chr264937 4798 4638 4083 1408 1144 32610 1950 112 35806 2100 1994 1801
NM_033644chr512142 ------
NM_033645chr512142 ------
NM_033656chr2165332 4521 3700 2342 1609 51 --13674 35932 4364 395
NM_052864chr451941 1808 565 96 48 ------
NM_052885chr1254269 4240 3807 3774 1857 34701 1463 1412 ----
NM_052898chr821555 1462 ------
NM_052901chr911118 ------
NM_052932chr1162409 1867 1008 903 785 206 ----1539
NM_052937chr872668 2366 2292 755 338 307 109 12352 1793 --
NM_053016chr9116576 6173 6024 5978 5812 2737 2711 1633 1540 1495 362 45408 1420 1377 304 46749 6481 5391 700 --
NM_053023chr1133012 2509 2449 --22750 424 --
NM_057168chr721164 423 ------
NM_058237chr141249 ------
NM_079421chr191132 ------
NM_080655chr91193 ------
NM_080683chr41371 ------
NM_080684chr41371 ------
NM_080685chr41371 ------
NM_080927chr362949 2513 1231 549 235 179 12304 13252 --
NM_130436chr2122602 41 12749 ----
NM_130470chr111836 ------
NM_130471chr111836 ------
NM_130472chr111836 ------
NM_130473chr111836 ------
NM_130476chr111836 ------
NM_130811chr2021215 1126 ------
NM_133372chr532606 2318 1117 12532 12291 --
NM_133433chr51226 --1924 --
NM_133443chr1611754 ------
NM_133631chr32445 373 ------
NM_133638chr521218 538 ------
NM_133646chr245475 4426 449 243 --1553 12010
NM_134265chr171167 ------
NM_138292chr1163511 3354 3181 1070 638 341 13306 --12390
NM_138444chr1384434 4099 3889 3438 1534 896 716 703 11128 ----
NM_138713chr1686505 6418 6193 5853 5027 3288 2612 930 27939 6164 13011 --
NM_138714chr1686505 6418 6193 5853 5027 3288 2612 930 27939 6164 13011 --
NM_138731chr1474146 3298 2809 1062 495 311 211 --11511 12803
NM_138782chr542220 722 688 314 ------
NM_138959chr186198 5998 5926 4467 2721 2557 2339 1999 25083 2525 --11516
NM_139207chr1261812 1598 1533 1431 600 493 ----11526
NM_139312chr1011402 ------
NM_144571chr497017 6565 5803 5468 4620 1881 905 744 40 25084 4336 14477 --
NM_144574chr141446 ------
NM_144599chr1545442 5435 4756 4200 --21643 439 11055
NM_144721chr42215 132 1387 --1317
NM_144726chr51243 ------
NM_144736chr22748 152 ------
NM_144949chr262308 995 736 547 430 66 11800 22301 1682 --
NM_144963chr851779 773 517 270 64 --11700 --
NM_145174chr2251442 1191 979 469 217 21093 1028 21367 278 --
NM_145251chr1411407 ------
NM_145259chr245082 1839 1769 302 16828 12311 --
NM_145263chr41203 ------
NM_145307chr1063240 1428 529 439 98 67 --14351 --
NM_145330chr21153 ------
NM_145698chr1052095 2087 2031 1514 723 1498 --12145
NM_145739chr2175 ------
NM_145800chrX1102 ------
NM_145802chrX151 ------
NM_147128chr731215 1084 22 ------
NM_147147chr674212 4124 4049 4005 3741 2845 619 13821 13993 --
NM_147164chr91581 ------
NM_147175chrX1543 ----31870 1633 1385
NM_152264chr1121104 1057 ------
NM_152282chr331128 965 271 --1914 11018
NM_152478chr191468 ------
NM_152624chr5197074 6860 6837 6713 5746 5661 5585 5473 5353 5314 4923 4518 2835 2388 1976 1931 1791 1737 623 16252 27002 2061 --
NM_152635chr102466 425 ------
NM_152641chr1272902 2701 2500 2492 2398 1171 509 --12360 --
NM_152707chr101859 ----1892
NM_152756chr554299 3919 3794 1013 774 ------
NM_152774chr772468 2211 2036 2009 1910 1729 771 31046 1002 587 ----
NM_152838chr2053073 2978 742 439 22 22591 908 --13414
NM_152919chr1953477 3386 2913 2707 282 ------
NM_152994chr21428 ------
NM_152999chr753428 3244 1700 1640 1439 ----1889
NM_153188chr553991 2232 2207 552 398 14152 11085 15628
NM_153235chr632262 387 181 --1663 --
NM_153261chr161558 ------
NM_153371chr1342273 2192 2165 1722 ----1268
NM_153810chr1054797 4066 3950 3741 707 23631 667 --1870
NM_170719chr1341205 1172 1041 321 --11424 11055
NM_172236chr203760 299 159 --1251 --
NM_173082chr621168 1051 ------
NM_173198chr941053 367 250 122 1926 ----
NM_173200chr941053 367 250 122 1926 ----
NM_173214chr1686505 6418 6193 5853 5027 3288 2612 930 27939 6164 13011 --
NM_173468chr465892 5557 4151 4123 1225 758 12221 14969 --
NM_173531chr1952828 2795 2534 2359 1222 1563 ----
NM_173582chr11106039 5599 4215 2105 1834 1333 1159 896 809 314 1254 45072 3949 1394 544 --
NM_173607chr1462088 1794 1574 1548 753 672 ------
NM_173642chr1107602 7418 6936 3215 1911 1824 1414 940 676 531 --22843 2291 --
NM_173814chr151474 ------
NM_173829chr565471 4746 4623 2003 1403 981 24835 2135 25130 1370 --
NM_173849chr141227 ------
NM_175085chr212475 157 --124 --
NM_175623chr12147554 7525 7141 7044 6625 6384 1909 1467 1403 1094 789 651 233 65 12047 17537 --
NM_175624chr12147649 7620 7236 7139 6720 6479 2004 1562 1498 1189 884 746 328 160 12142 17632 --
NM_175625chr12147649 7620 7236 7139 6720 6479 2004 1562 1498 1189 884 746 328 160 12142 17632 --
NM_175767chr51603 ------
NM_175876chr142116 1008 277 260 1209 22640 91 --
NM_175884chr711411 ------
NM_178151chrX147432 6968 6855 6827 6801 6583 5872 4783 2978 2066 1853 1088 931 348 2829 55 16808 --
NM_178152chrX147432 6968 6855 6827 6801 6583 5872 4783 2978 2066 1853 1088 931 348 2829 55 16808 --
NM_178153chrX147432 6968 6855 6827 6801 6583 5872 4783 2978 2066 1853 1088 931 348 2829 55 16808 --
NM_178498chr1163937 3856 3640 819 515 98 23976 3601 ----
NM_181302chr141446 ------
NM_181308chr141446 ------
NM_181332chrX12495 --11940 --
NM_181459chr21919 ------
NM_181836chr552551 1990 1846 437 332 1623 11017 --
NM_181886chr42523 34 ------
NM_181887chr42523 34 ------
NM_181888chr42523 34 ------
NM_181889chr42523 34 ------
NM_181890chr42523 34 ------
NM_181891chr42523 34 ------
NM_181892chr42570 81 ------
NM_181893chr42523 34 ------
NM_182515chr1966205 6001 5560 4384 4158 2491 21410 1273 26336 5845 --
NM_182896chr31355 --11615 --
NM_182898chr795740 5730 4944 4114 2162 1596 1161 133 38 --14160 11974
NM_182899chr795740 5730 4944 4114 2162 1596 1161 133 38 --14160 11974
NM_182976chr11200 ------
NM_194434chr1895436 5257 4866 4274 4053 2306 2188 1453 664 14257 11937 --
NM_194463chrX11124 --1141 --
NM_198181chr1562229 329 205 175 147 117 --12507 12768
NM_198404chr131610 ------
NM_198459chr12863 236 ----1165
NM_198485chr342264 1631 753 574 ------
NM_198506chr43543 402 328 ----11119
NM_198549chr152365 2265 889 583 188 12549 21328 950 --
NM_198581chr286106 5603 5519 1874 1435 968 345 145 --2884 82 1202
NM_198793chr322676 1539 --33021 1110 878 12601
NM_199000chr71849 ------
NM_199050chr2153336 2548 1565 1517 1470 ------
NM_199053chr41204 ------
NM_199168chr1021279 186 ------
NM_199324chr472736 1281 1115 647 421 376 304 ------
NM_199462chr144983 3140 603 89 --14275 --
NM_199482chr241986 1490 497 93 ----1430
NM_201413chr21173 ------
NM_201414chr21173 ------
NM_201428chr1141548 565 382 280 ------
NM_201429chr1141548 565 382 280 ------
NM_201430chr1141474 491 308 206 ------
NM_201436chr73670 544 123 ------
NM_201516chr73726 600 179 ------
NM_201517chr73670 544 123 ------
NM_203390chr821873 756 21716 1571 1364 1744
NM_205836chr52524 468 --1506 --
NM_206594chr163457 3451 3406 3254 3146 2548 --12486 --
NM_206595chr163457 3451 3406 3254 3146 2548 --12486 --
NM_206854chr685108 4579 4213 4160 3723 1572 961 854 44776 4548 1910 1471 ----
NM_206855chr696073 5544 5178 5125 4688 2537 1926 1819 921 35741 5513 2436 1691 --
NM_206907chr563049 2982 997 403 242 152 1823 1815 --
NM_206909chr896912 6723 6133 5525 3202 2555 2270 1367 1128 --35778 1544 399 --
NM_207292chr3113282 3030 2993 2648 2463 2369 1300 1043 936 485 395 --23000 358 --
NM_207293chr3113282 3030 2993 2648 2463 2369 1300 1043 936 485 395 --23000 358 --
NM_207294chr3113282 3030 2993 2648 2463 2369 1300 1043 936 485 395 --23000 358 --
NM_207295chr3113282 3030 2993 2648 2463 2369 1300 1043 936 485 395 --23000 358 --
NM_207296chr3113282 3030 2993 2648 2463 2369 1300 1043 936 485 395 --23000 358 --
NM_207297chr3113307 3055 3018 2673 2488 2394 1325 1068 961 510 420 --23025 383 --
NM_207303chr1053983 1637 1290 236 68 1497 33640 3409 2840 --
NM_212461chr121178 ------
NM_213589chr294643 4310 3967 3790 2047 1238 1100 1043 999 ------