TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-625-5p
miRNA Sequence: AGGGGGAAAGUUCUAUAGUCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5--1180 --1273
NM_000020chr1252125 1879 445 234 183 21978 1560 --11503
NM_000024chr52507 212 ----1440
NM_000025chr861135 989 465 393 343 89 31175 857 235 ----
NM_000037chr852169 611 430 182 137 42486 2457 2196 2078 22515 1967 --
NM_000081chr14432 320 285 24 11612 ----
NM_000084chrX86673 5848 5414 4854 4442 1996 1455 722 45867 4225 2220 1210 --15832
NM_000088chr1761218 1208 419 394 371 28 11189 21289 48 --
NM_000092chr273958 3115 3051 3013 1487 988 482 13123 12918 33961 3598 884
NM_000129chr641361 1178 481 437 21421 382 11180 --
NM_000138chr1542315 2291 377 66 ----169
NM_000168chr793238 3219 2832 2329 2112 2104 972 770 442 22492 2156 1594 12332
NM_000170chr93476 436 43 180 ----
NM_000176chr553387 3144 1098 633 406 ------
NM_000189chr291848 1468 419 282 269 247 73 46 28 1394 ----
NM_000192chr1231339 530 363 --1570 1314
NM_000202chrX93240 2762 2716 2694 2673 2614 1562 1479 232 11026 42491 2451 2417 234 11565
NM_000208chr1994536 3177 2923 1532 1395 1066 749 561 51 --1287 --
NM_000216chrX53149 800 789 315 211 13178 23824 619 11435
NM_000217chr12124177 3819 3789 3680 3661 3654 3593 3447 3405 2031 1954 1604 21004 318 35222 3355 641 --
NM_000221chr24621 286 227 212 2306 149 162 --
NM_000240chrX4669 618 428 324 22111 786 1846 --
NM_000244chr113544 306 166 156 --1220
NM_000259chr15146370 5743 5542 5034 5023 4912 4889 4546 4160 4019 1870 906 535 143 42428 2417 1917 114 --12249
NM_000264chr953360 2332 2144 1213 244 21175 1089 13133 --
NM_000267chr1753443 2936 767 385 64 --53458 2590 1124 883 81 13478
NM_000268chr22103534 3473 3345 2963 2875 1382 1089 1063 729 37 1787 43475 2607 2368 981 2438 130
NM_000271chr18------2580 224
NM_000276chrX62171 2129 1958 1446 464 150 ------
NM_000318chr862747 2018 1892 1869 545 123 --11871 --
NM_000319chr1231046 986 370 1823 165 2993 373
NM_000322chr64371 128 66 21 2643 98 --21435 1207
NM_000330chrX3735 611 438 1195 11509 --
NM_000332chr6116511 6504 6168 5951 5908 4885 2837 2306 498 443 34 26289 2871 25677 662 --
NM_000334chr17102106 2087 2031 1937 1801 1794 702 562 413 54 ------
NM_000335chr361828 1780 1770 1716 655 522 11536 2849 734 --
NM_000346chr1761965 1919 1336 1225 705 81 --11921 --
NM_000353chr163389 250 177 --1200 1147
NM_000362chr22113422 3008 2689 2268 1419 1216 819 401 274 175 51 52680 646 417 388 373 32884 845 31 23547 3407
NM_000368chr964693 1911 1037 804 376 267 --44359 4241 293 198 34369 3724 719
NM_000393chr241934 1391 1323 741 ----11937
NM_000430chr1773096 3062 1344 838 787 36 25 23619 2337 ----
NM_000435chr194998 746 717 632 2649 253 --1269
NM_000439chr582435 2272 1829 813 735 726 504 417 --1136 11615
NM_000448chr1152708 2496 959 69 44 --2390 46 --
NM_000449chr13941 238 114 --11060 1538
NM_000452chr1351968 1770 1312 804 585 --11888 21315 263
NM_000461chr3104361 4328 4133 2966 1428 1229 1154 1147 791 195 23309 879 44279 3583 1156 1095 --
NM_000476chr951269 1122 1053 331 64 122 1269 --
NM_000489chrX83065 3046 2917 2254 1055 426 293 107 --13067 --
NM_000495chrX51092 954 929 790 259 ------
NM_000500chr63508 69 40 --1380 1121
NM_000516chr201116 --2232 123 --
NM_000522chr74911 838 430 135 --1991 --
NM_000530chr12281 268 2341 133 3849 358 270 --
NM_000533chrX51832 1611 1381 761 175 171 --11614
NM_000555chrX157545 6996 6668 6106 5840 5820 5627 5607 5541 5033 5019 4934 2778 783 175 12575 25662 2701 37655 3087 1620
NM_000567chr12897 769 2891 410 --1134
NM_000578chr241512 1389 1278 464 61717 1548 1331 1313 1300 678 ----
NM_000599chr2174051 3878 3482 3246 3196 2855 1169 1120 1087 675 640 608 567 552 496 69 23 63534 3471 1680 1452 1229 773 --33298 2997 26
NM_000602chr721049 616 1580 11016 11181
NM_000609chr10112837 2796 2782 2730 2485 2313 2141 1215 852 503 84 72993 2857 2617 2303 2082 1087 628 1889 1986
NM_000612chr11103676 3630 3552 3314 2897 628 260 122 110 52 --32357 521 323 --
NM_000615chr1131845 1177 289 12421 1895 --
NM_000618chr1295786 5398 4177 2026 1279 1051 805 348 130 15331 46347 5599 5285 4222 22332 133
NM_000618chr1295786 5398 4177 2026 1279 1051 805 348 130 15331 46347 5599 5285 4222 22332 133
NM_000620chr12101867 823 594 506 409 402 253 159 126 67 32079 721 386 52024 1894 1400 339 128 --
NM_000660chr193232 218 210 ----1197
NM_000684chr1031248 435 316 ----1319
NM_000686chrX41356 520 361 96 ----199
NM_000700chr9------1198
NM_000719chr12226460 6315 6192 5884 5200 4480 4442 4420 4336 4226 4209 2647 2506 2359 2348 2136 2034 1908 1274 790 583 407 66431 6357 6333 5109 2113 253 26279 5331 36324 6064 1911
NM_000721chr172683 2656 2330 2241 1891 1835 1675 52121 2084 1817 779 441 41893 1687 301 191 32686 1740 527
NM_000723chr173432 250 106 41348 474 451 281 21289 494 2369 258
NM_000724chr102381 225 --11453 11386
NM_000725chr125940 871 315 266 260 1833 ----
NM_000757chr15893 785 761 736 90 1877 --1303
NM_000791chr53971 191 40 1129 134 --
NM_000793chr1464940 4926 4630 4546 3920 1454 1611 54538 3979 3368 1272 1076 --
NM_000800chr551345 510 358 282 77 --1360 1391
NM_000801chr203965 199 186 --2995 193 11068
NM_000809chr4189272 8794 8649 8550 8440 6854 6830 6815 6339 5762 5696 3551 3347 3247 3199 2645 580 375 26068 3607 37655 6856 2647 22844 1183
NM_000813chr532130 2114 2104 --139 13812
NM_000814chr1523940 2722 --23254 956 --
NM_000817chr241250 458 294 42 --144 --
NM_000831chr1115533 5258 4423 4101 3977 1623 1066 766 524 194 75 21770 299 ----
NM_000833chr1621386 1336 21227 597 11266 --
NM_000834chr123897 404 191 --31300 317 218 --
NM_000861chr341731 1030 598 504 22120 1985 ----
NM_000870chr56652 510 423 234 223 152 11012 2999 559 --
NM_000872chr102488 146 ----1557
NM_000875chr15196448 6417 6003 4896 4615 4374 2606 2410 2156 1726 1582 1405 1398 1337 973 846 634 317 211 21474 959 55874 5842 2158 610 325 12609
NM_000891chr1763600 3335 3137 2994 2967 2277 ----1664
NM_000898chrX3603 571 165 1792 --1593
NM_000901chr431924 250 38 2223 209 ----
NM_000922chr1131047 422 163 --11049 --
NM_000924chr1261353 1144 1129 1020 969 865 3369 256 79 1468 1418
NM_000945chr241706 1387 541 43 1823 ----
NM_000949chr53961 799 152 --2732 626 --
NM_000961chr2083850 3796 3739 3728 3185 2890 530 121 1476 13540 33409 597 133
NM_000964chr1751262 1181 943 412 128 1359 21338 462 11175
NM_000966chr1291041 1021 744 738 673 340 192 170 105 164 --2940 886
NM_001001132chr2171371 1336 1278 1251 1031 298 21 --21289 542 1301
NM_001001323chr1222872 104 2173 163 ----
NM_001001331chr372311 2058 1906 1860 353 322 252 --1901 --
NM_001001344chrX32049 1589 730 2854 332 --11592
NM_001001396chr1103909 3827 3735 3502 2979 1779 1686 862 767 614 1243 83983 3546 3320 3263 3072 1755 948 603 22913 1694
NM_001001433chr2082828 2697 2555 2388 698 154 148 42 1546 --12030
NM_001001481chr843151 2628 2616 723 ----13154
NM_001001484chr1022358 844 1275 1298 1500
NM_001001523chr151262 424 244 86 28 --1537 11205
NM_001001549chr742150 1908 1014 207 1542 ----
NM_001001550chr742150 1908 1014 207 1542 ----
NM_001001555chr742150 1908 1014 207 1542 ----
NM_001001890chr2174248 4169 2981 2830 2812 2786 626 --63993 2945 2855 2801 2788 1111 --
NM_001001924chr841870 1860 1482 1354 31833 1432 1390 --1206
NM_001001925chr841870 1860 1482 1354 31833 1432 1390 --1206
NM_001001931chr841870 1860 1482 1354 31833 1432 1390 --1206
NM_001002026chr362284 1717 931 450 371 330 --1339 --
NM_001002033chr17------2699 42
NM_001002233chr841824 1586 1448 867 2381 117 --11589
NM_001002762chr10112509 2036 1188 981 826 530 523 517 380 250 240 32660 2591 2164 12261 12149
NM_001002838chrX5692 670 350 101 79 --21787 440 1104
NM_001002860chr1444020 3366 1682 1499 ----21864 621
NM_001002909chr176345 334 313 220 204 55 1640 1372 11593
NM_001003406chr2262875 2855 2328 1256 674 454 23135 1030 23218 2654 12937
NM_001003407chr1094935 4869 4547 3833 3547 3421 3125 1859 720 11445 --11489
NM_001003408chr1094935 4869 4547 3833 3547 3421 3125 1859 720 11445 --11489
NM_001003652chr18138303 8040 7644 7498 7402 7384 6845 5974 5566 3455 2864 2819 2227 1207 18305 28496 6296
NM_001003674chr1872816 2663 2313 1943 1148 1139 448 21432 978 24708 4306 --
NM_001003675chr1872816 2663 2313 1943 1148 1139 448 21432 978 24708 4306 --
NM_001003676chr115733 643 363 262 148 21043 782 ----
NM_001003682chr141274 1183 560 412 ----1539
NM_001003694chr35577 566 432 146 49 ----1590
NM_001003760chr6103310 3232 2524 2515 1131 1113 1089 668 406 345 1288 1527 1676
NM_001003786chr176665 615 584 550 273 26 1479 --1466
NM_001003787chr176665 615 584 550 273 26 1479 --1466
NM_001003788chr176665 615 584 550 273 26 1479 --1466
NM_001003800chr983557 3292 1417 1389 1356 1329 1177 397 2576 352 --11108
NM_001003810chr43619 256 155 ----1259
NM_001003940chr1562572 2540 2384 1429 1256 1248 33028 2604 2400 53855 2762 2509 2386 1033 11177
NM_001003942chr1562572 2540 2384 1429 1256 1248 33028 2604 2400 53855 2762 2509 2386 1033 11177
NM_001003943chr1562576 2544 2388 1433 1260 1252 33032 2608 2404 53859 2766 2513 2390 1037 11181
NM_001004065chr973644 3153 557 487 438 424 176 22860 2561 --23352 1384
NM_001004106chr53804 223 141 2149 84 ----
NM_001004317chr621639 909 11225 43742 1028 625 570 --
NM_001004356chr431547 1127 1048 21178 1069 21549 1267 --
NM_001004358chr431547 1127 1048 21178 1069 21549 1267 --
NM_001004419chr1254363 4070 4038 3532 1533 34372 4357 3585 14315 24337 273
NM_001004439chr1551291 1075 923 153 131 3514 353 283 --11023
NM_001005210chr1162449 2382 2309 1655 263 21 12369 21607 230 --
NM_001005242chr122548 126 --1670 11593
NM_001005271chr1781121 1080 1044 988 855 353 197 178 2719 95 1276 --
NM_001005273chr1781121 1080 1044 988 855 353 197 178 2719 95 1276 --
NM_001005354chr122571 522 2421 49 --125
NM_001005404chr1784261 3198 2844 1222 1145 1077 643 128 11568 --23375 1339
NM_001005463chr1032088 1047 864 12435 --1716
NM_001005473chr5105842 5698 5641 5464 5195 4891 4334 2301 372 197 --11476 25845 5674
NM_001005505chr341248 1165 260 56 1103 --11251
NM_001005609chrX52609 2373 837 777 37 21325 140 33849 3447 3027 33670 3465 1407
NM_001005743chr1441207 367 256 250 ----11180
NM_001005744chr1441207 367 256 250 ----11180
NM_001005745chr1441207 367 256 250 ----11180
NM_001005782chr22201 28 ----131
NM_001005845chr82202 189 --152 1381
NM_001005849chr171561 1143 1135 --
NM_001006115chr3122462 2354 2251 1893 1815 1127 875 833 719 697 408 32 2627 417 12127 1918
NM_001006605chr111178 --1113 1909
NM_001006605chr111178 --1113 1909
NM_001006932chr682698 2692 2556 2290 2076 617 181 29 --52292 2078 1175 758 569 22736 225
NM_001006946chr2111645 1459 1423 1392 1226 613 599 526 299 279 88 ------
NM_001007023chr1464940 4926 4630 4546 3920 1454 1611 54538 3979 3368 1272 1076 --
NM_001007024chr1784237 3752 3585 3041 548 476 459 255 --23116 432 --
NM_001007025chr1784237 3752 3585 3041 548 476 459 255 --23116 432 --
NM_001007097chr964531 3108 3093 1958 1211 1052 23514 3506 23159 1831 13976
NM_001007156chr1591884 1763 1223 738 673 422 399 228 168 21725 433 1201 1171
NM_001007226chr1721298 224 ----11032
NM_001007227chr1721298 224 ----11032
NM_001007228chr1721298 224 ----11032
NM_001007229chr1721298 224 ----11032
NM_001007230chr1721298 224 ----11032
NM_001007237chr132190 589 50 11788 11939 1592
NM_001007277chr1151118 303 247 182 74 1825 2780 428 --
NM_001007553chr141191 146 89 77 --11116 --
NM_001008220chr593906 3781 3642 3253 2532 2517 884 706 125 63608 3412 3317 1065 594 158 2304 142 1235
NM_001008222chrX81334 1015 927 890 500 379 282 258 --1302 11170
NM_001008239chr18123715 3297 3233 2527 1400 1007 790 660 216 46 35 22 12508 2150 140 22530 219
NM_001008392chr341346 799 341 316 23413 589 --13379
NM_001008407chr721502 1335 41451 655 100 23 ----
NM_001008408chr7115935 5620 5598 5489 4467 4131 4069 3942 1108 992 129 14152 13927 26206 5798
NM_001008564chr131121 --1852 11449
NM_001008701chr19162964 2936 2896 2829 2739 2665 1062 1020 881 873 848 816 521 317 201 146 2891 325 52841 2478 2027 617 505 12868
NM_001008726chr1431618 1542 1528 --11652 21665 1531
NM_001008744chr1431391 274 86 --11249 --
NM_001008925chr423272 1149 --1602 --
NM_001009554chr441759 1583 1504 534 2888 658 23428 3421 1176
NM_001009554chr441759 1583 1504 534 2888 658 23428 3421 1176
NM_001009566chr141412 1114 1075 292 21324 1121 --161
NM_001009571chr721598 1197 --11557 11356
NM_001009880chr22104547 4373 4313 3919 1500 1305 888 828 503 366 33644 1571 1108 33590 1807 193 11253
NM_001009993chr224112 3659 24382 3193 43768 3735 2840 1465 21133 1036
NM_001010861chr141717 820 714 152 ----1155
NM_001010862chrX63132 2952 2604 2493 2151 198 1416 23107 95 --
NM_001010888chrX34080 3744 1409 14495 --14106
NM_001010895chr951359 497 456 182 51 ------
NM_001010898chr1143714 3347 3216 3025 2677 2457 2443 1169 955 802 349 343 142 29 43723 3374 3034 776 11003 --
NM_001010934chr721157 237 --133 1967
NM_001011513chr483948 3939 3220 3119 2863 2704 1523 1057 1935 ----
NM_001011658chrX41810 1392 688 357 ----11813
NM_001011666chr7105999 5865 4203 2466 1417 680 612 576 491 234 14786 11577 --
NM_001011708chr232794 2656 2020 22562 1130 12022 --
NM_001011885chr1521804 1307 --1140 --
NM_001012264chr144785 765 606 113 4796 748 636 244 ----
NM_001012267chr931976 1455 480 21567 298 ----
NM_001012329chr192154 2094 1583 1575 1556 659 494 332 103 32161 1914 1666 11735 1111
NM_001012393chr11134338 4185 4164 4090 3913 2047 1723 1705 958 889 283 277 39 11016 13213 --
NM_001012426chr6113290 3233 2875 2647 1113 962 944 917 796 325 280 93241 2449 2396 1190 1084 909 709 314 69 11332 --
NM_001012427chr6113290 3233 2875 2647 1113 962 944 917 796 325 280 93241 2449 2396 1190 1084 909 709 314 69 11332 --
NM_001012614chr41209 ----1242
NM_001012642chr1572114 2010 1977 1554 475 134 33 --31751 1410 162 --
NM_001012755chrX74598 4392 1289 1008 986 772 46 34417 1441 371 34572 3568 2040 23230 1144
NM_001012756chr1932997 2664 2442 2759 578 ----
NM_001012968chrX42074 1936 575 567 ----1399
NM_001012977chrX81173 524 488 418 199 159 147 83 --41149 987 287 177 --
NM_001012989chrX4603 268 248 34 ----1271
NM_001013031chr1072417 1105 1068 697 685 480 229 --21304 818 --
NM_001013415chr421357 313 --21426 59 --
NM_001013620chr1287603 7202 5992 5909 2930 1550 1020 806 22863 1695 22338 1022 --
NM_001013624chr1761185 1019 970 227 53 30 2911 838 --31027 973 296
NM_001013635chr1241216 1151 1048 138 --1290 11058
NM_001013690chr12112401 2363 2182 2122 1808 1636 906 571 475 409 37 32191 1746 494 21907 363 1936
NM_001013693chr142620 2451 430 201 12157 22632 2241 1238
NM_001013693chr142620 2451 430 201 12157 22632 2241 1238
NM_001013839chr1772232 635 568 515 351 228 210 2531 388 32318 1645 517 1176
NM_001014797chr1087732 5586 3025 2517 2343 1632 1460 438 27449 2355 67605 7238 5832 3153 2769 1050 12943
NM_001014839chr14773 407 318 66 1823 21038 106 1842
NM_001014841chr14773 407 318 66 1823 21038 106 1842
NM_001015048chr1453145 2935 2245 1302 1142 12190 --1586
NM_001015049chr1453145 2935 2245 1302 1142 12190 --1586
NM_001015053chr17111542 1494 1408 1124 568 559 509 424 417 235 189 --31235 520 272 --
NM_001015508chr81709 --1702 2630 103
NM_001015882chr93737 156 111 --1789 --
NM_001015887chr321520 1491 31315 444 203 1452 --
NM_001017368chr17112489 2337 2320 2214 2092 1124 929 885 853 407 338 --22216 309 --
NM_001017395chr393141 3082 2815 2763 1433 1049 962 418 26 22319 630 ----
NM_001017424chr161857 1577 531 525 279 269 ----1580
NM_001017425chr161857 1577 531 525 279 269 ----1580
NM_001017440chr7167646 7388 6999 6018 5758 3029 2576 2156 1995 1853 1737 1601 1425 1062 882 850 67616 5583 2944 2253 2096 1095 77449 7390 6552 1918 1739 1629 1517 3737 514 73
NM_001017916chr1781586 1393 773 704 602 430 182 175 2817 529 11703 --
NM_001017917chr1781586 1393 773 704 602 430 182 175 2817 529 11703 --
NM_001017923chr1421410 30 149 132 --
NM_001017926chr831729 1682 1409 ----11732
NM_001017970chr1442594 1037 69 23 --1110 1640
NM_001017995chr5154596 4206 3377 3029 2953 1934 1876 1166 1049 735 552 476 274 190 85 43855 3630 608 558 53133 3052 2955 1483 1272 --
NM_001017999chr172275 2095 1958 537 475 377 184 21501 1477 1369 --
NM_001017999chr172275 2095 1958 537 475 377 184 21501 1477 1369 --
NM_001018000chr172275 2095 1958 537 475 377 184 21501 1477 1369 --
NM_001018000chr172275 2095 1958 537 475 377 184 21501 1477 1369 --
NM_001018001chr172275 2095 1958 537 475 377 184 21501 1477 1369 --
NM_001018005chr15133 ----123
NM_001018050chr22103252 3225 3016 2763 2714 2696 2615 2135 1024 177 22754 156 ----
NM_001018052chr22103252 3225 3016 2763 2714 2696 2615 2135 1024 177 22754 156 ----
NM_001018057chr1141386 958 353 177 1166 1120 155
NM_001018064chr941782 843 285 227 --1782 --
NM_001018065chr9165853 5631 5079 5039 4836 4610 3960 2260 1728 1423 1076 864 844 622 603 372 12123 35855 1672 575 --
NM_001018066chr9165853 5631 5079 5039 4836 4610 3960 2260 1728 1423 1076 864 844 622 603 372 12123 35855 1672 575 --
NM_001018074chr553387 3144 1098 633 406 ------
NM_001018075chr553387 3144 1098 633 406 ------
NM_001018076chr553387 3144 1098 633 406 ------
NM_001018077chr553387 3144 1098 633 406 ------
NM_001018108chr15102156 1901 865 735 700 598 588 337 177 116 31830 1437 511 42034 1822 160 78 1907
NM_001018111chr7113529 3393 2839 1399 1273 1012 558 188 149 130 119 23790 1486 11126 12676
NM_001020658chr111413 2443 134 --125
NM_001020658chr111413 2443 134 --125
NM_001023567chr152933 735 ----1578
NM_001024094chr553387 3144 1098 633 406 ------
NM_001024401chr16122677 2433 2078 2011 1894 1805 1039 960 914 789 777 444 32522 1880 1095 --22815 2113
NM_001024455chrX72457 2434 2141 2027 1764 766 50 12596 2971 323 12064
NM_001024460chr631019 442 156 --1985 1269
NM_001024647chr1276407 6046 5196 5070 4911 4676 1058 13085 1111 --
NM_001024649chr542890 1835 913 895 1465 2543 37 12198
NM_001024808chr12102635 2424 2365 1903 1039 821 732 539 475 85 --32749 2544 310 1865
NM_001024809chr1751262 1181 943 412 128 1359 21338 462 11175
NM_001024847chr351627 689 597 228 119 1751 1910 --
NM_001024934chr61554 --1206 1128
NM_001024935chr61554 --1206 1128
NM_001024936chr61554 --1206 1128
NM_001024937chr176712 695 609 290 281 45 1186 4566 512 248 82 1519
NM_001024948chr122854 2391 12426 11273 --
NM_001025068chr32659 82 11555 1690 --
NM_001025069chr32659 82 11555 1690 --
NM_001025076chr10145924 5493 5120 4979 4903 4736 4422 4338 4275 2252 2213 2011 1530 167 25003 4283 14266 --
NM_001025077chr10157282 6851 6478 6337 6261 6094 5780 5696 5633 4992 2888 1525 1399 1326 246 36361 5641 1173 45624 1162 1128 222 1166
NM_001025079chr392921 2656 2555 2542 2527 1132 901 779 737 13097 21108 632 11139
NM_001025105chr531379 1227 1021 --159 --
NM_001025107chr1132711 2125 1726 857 706 686 631 461 340 301 213 101 71 --41728 884 504 454 1216
NM_001025107chr1132711 2125 1726 857 706 686 631 461 340 301 213 101 71 --41728 884 504 454 1216
NM_001025108chr242824 640 631 119 22646 518 --1647
NM_001025233chr1232757 626 68 21928 145 --12089
NM_001025252chr822368 2270 --1379 --
NM_001025253chr822368 2270 --1379 --
NM_001025266chr3124320 3819 1956 1686 1607 1537 1392 1278 1246 697 490 395 34401 4028 893 41900 1609 502 496 --
NM_001025366chr641496 1417 606 245 128 ----
NM_001025366chr641496 1417 606 245 128 ----
NM_001025367chr641496 1417 606 245 128 ----
NM_001025367chr641496 1417 606 245 128 ----
NM_001025368chr641496 1417 606 245 128 ----
NM_001025368chr641496 1417 606 245 128 ----
NM_001025369chr641512 1433 622 261 144 ----
NM_001025369chr641512 1433 622 261 144 ----
NM_001025370chr641496 1417 606 245 128 ----
NM_001025370chr641496 1417 606 245 128 ----
NM_001025579chr1731127 763 22 1124 1478 11178
NM_001025580chrX53027 614 464 384 319 43933 3606 3208 3148 13259 --
NM_001025603chr13941 238 114 --11060 1538
NM_001025616chr441911 1733 1634 423 11566 1624 --
NM_001029858chr662948 2908 1298 841 538 238 23351 133 ----
NM_001029859chr1182270 1805 921 781 643 563 462 313 21667 878 21829 137 --
NM_001029864chr2062464 2449 2412 820 371 266 32087 1880 1735 12119 --
NM_001029883chr263050 2510 2382 990 921 752 11988 --12703
NM_001029998chr431314 576 286 ----11317
NM_001030006chr1762624 2507 2409 1980 856 262 12134 42348 781 642 601 --
NM_001030007chr16152982 2951 2821 2714 2545 2469 1285 830 769 443 294 257 240 234 82 1189 12716 33634 2837 547
NM_001030055chr1424729 833 11481 1835 14033
NM_001031677chr52389 41 ----1430
NM_001031679chr1263480 3359 3152 2660 2526 2496 --33154 2728 301 12361
NM_001031690chr7132829 2755 2739 2252 2070 2061 1169 1136 941 820 435 415 68 53048 2865 2761 1988 1067 12246 12341
NM_001031695chr22165197 5146 5081 4720 4503 4468 4379 4128 3643 3592 2043 1562 949 827 621 598 25097 1296 54932 3908 3477 1873 610 34986 3646 952
NM_001031732chr443344 2439 544 273 22997 2914 22892 660 42785 2770 1180 496
NM_001031804chr1643660 3596 637 293 --24167 448 13267
NM_001032221chr981650 1590 1503 1495 1463 1281 1205 594 2738 673 1304 --
NM_001032280chr671521 1476 1176 1110 603 455 154 ----11524
NM_001032288chr2021056 625 1579 3381 36 30 --
NM_001032289chrX5339 234 221 172 108 --173 --
NM_001032296chr1352845 2803 965 391 53 11945 42847 2176 840 708 --
NM_001032380chr10--1528 --1132
NM_001033025chr151522 1249 1231 1222 56 --21243 1233 --
NM_001033047chr451935 1860 1774 628 430 22294 299 21862 77 --
NM_001033057chr31664 ----11787
NM_001033059chr622003 337 2670 359 1652 --
NM_001033081chr15721 455 199 191 62 --1613 --
NM_001033082chr15721 455 199 191 62 --1613 --
NM_001033087chr2062694 2501 2082 1084 895 137 ------
NM_001033117chr3134436 4282 4042 3496 3489 3479 3471 1612 1592 1344 1319 317 259 24332 545 34700 1325 292 --
NM_001033551chr1783821 3134 1646 1375 1129 1088 432 221 23691 3625 33742 2877 256 23194 330
NM_001033561chr172833 335 1317 2824 808 1299
NM_001033576chr1772562 2297 1753 837 822 162 68 1445 1776 --
NM_001033723chr852630 2480 2466 1993 1971 12265 --1769
NM_001034850chr52317 132 --1134 --
NM_001034954chr1031290 777 436 2540 516 1265 --
NM_001034955chr1031290 777 436 2540 516 1265 --
NM_001034956chr1031290 777 436 2540 516 1265 --
NM_001034957chr1031290 777 436 2540 516 1265 --
NM_001035235chr52461 242 ----1464
NM_001035254chr9102507 2454 2393 2123 1989 731 661 646 469 226 21947 121 179 1832
NM_001035534chr981432 1262 1244 1182 1093 1030 321 44 11155 11378 1495
NM_001037131chr22124 98 2234 176 1405 --
NM_001037132chr762226 2138 2033 1698 281 230 --11691 12229
NM_001037133chr762226 2138 2033 1698 281 230 --11691 12229
NM_001037165chr7148926 8365 7086 6074 5779 5615 5542 5534 2217 1635 1520 1042 717 274 23243 1749 57529 6559 6451 5617 254 --
NM_001037317chr141717 820 714 152 ----1155
NM_001037332chr582196 2172 1791 768 580 346 300 195 1171 32253 491 259 1522
NM_001037333chr582196 2172 1791 768 580 346 300 195 1171 32253 491 259 1522
NM_001037954chr1143005 2237 1346 126 --13397 --
NM_001038702chr532408 2182 1883 22229 791 ----
NM_001038707chr171540 747 451 173 164 118 84 11434 ----
NM_001038707chr171540 747 451 173 164 118 84 11434 ----
NM_001039140chr204184 177 86 56 1191 1199 --
NM_001039199chr2053786 3153 1856 846 681 --33849 3205 3058 13164
NM_001039350chr771283 696 684 239 174 75 64 21102 278 182 --
NM_001039459chr761156 882 458 329 200 126 --1465 --
NM_001039469chr113281 225 107 1234 2219 124 --
NM_001039479chr1451701 809 628 377 123 21634 862 11836 --
NM_001039538chr263064 2794 1375 1033 925 818 ------
NM_001039570chr22154387 4198 4155 4115 4092 4036 3532 3346 1838 1321 1100 432 137 104 33 33980 3605 1826 2192 96 --
NM_001039571chr22154387 4198 4155 4115 4092 4036 3532 3346 1838 1321 1100 432 137 104 33 33980 3605 1826 2192 96 --
NM_001039577chr163724 3075 1758 1334 1285 778 11447 21336 677 1832
NM_001039582chrX4225 88 71 52 177 ----
NM_001039590chrX43836 3453 3221 3206 13619 23838 2879 --
NM_001039591chrX43836 3453 3221 3206 13619 23838 2879 --
NM_001039618chr1155852 5069 4632 1217 510 ----14635
NM_001039690chr16102218 2166 2064 1941 1897 1584 589 334 256 85 2912 449 11586 11518
NM_001039711chr131049 747 204 2904 161 3897 828 195 --
NM_001039712chr131049 747 204 2904 161 3897 828 195 --
NM_001039771chr1461055 976 953 859 315 97 --1887 1325
NM_001039802chr141311 1139 892 425 --2427 178 --
NM_001039840chrX45947 4588 2341 1675 --15924 --
NM_001039877chr195812 761 743 650 162 1182 2763 247 1152
NM_001039937chr1353701 3055 1142 1100 287 11497 --2290 247
NM_001040002chr1791061 1016 932 482 363 342 328 206 117 21251 89 --11069
NM_001040020chr71225 ----11502
NM_001040057chr721253 24 --1450 --
NM_001040108chr1462109 1205 1000 485 464 456 ----1172
NM_001040110chr751847 1531 1474 1454 597 ------
NM_001040144chr16102218 2166 2064 1941 1897 1584 589 334 256 85 2912 449 11586 11518
NM_001040146chr16102218 2166 2064 1941 1897 1584 589 334 256 85 2912 449 11586 11518
NM_001040151chr11183995 3830 3774 3765 3681 3630 3443 3382 3121 2989 1641 854 823 558 485 394 361 111 21824 1488 54390 4262 3928 649 313 11644
NM_001040152chr755022 771 457 344 189 13428 --11795
NM_001040172chr56652 510 423 234 223 152 11012 2999 559 --
NM_001040173chr56652 510 423 234 223 152 11012 2999 559 --
NM_001040181chr32804 733 ----166
NM_001040182chr32804 733 ----166
NM_001040183chr32804 733 ----166
NM_001040199chr32804 733 ----166
NM_001040200chr32804 733 ----166
NM_001040214chr622217 1745 ----1279
NM_001040272chr922342 1517 52154 952 704 462 138 31455 286 102 --
NM_001040284chr1665178 5022 4493 3693 745 131 --1954 --
NM_001040424chr2182909 2092 2086 1900 932 472 281 145 12883 ----
NM_001040429chr1333509 376 65 ----11210
NM_001040439chr1641426 1352 1122 235 --11310 11365
NM_001040441chr134027 1597 1282 13945 21937 1623 13959
NM_001040458chr5101685 723 695 646 618 610 473 440 240 110 ----11507
NM_001040624chr882345 2339 2079 2039 1878 529 112 44 2539 457 1136 31915 1864 512
NM_001040625chr882345 2339 2079 2039 1878 529 112 44 2539 457 1136 31915 1864 512
NM_001040626chr882345 2339 2079 2039 1878 529 112 44 2539 457 1136 31915 1864 512
NM_001040627chr882345 2339 2079 2039 1878 529 112 44 2539 457 1136 31915 1864 512
NM_001040628chr882345 2339 2079 2039 1878 529 112 44 2539 457 1136 31915 1864 512
NM_001040629chr882345 2339 2079 2039 1878 529 112 44 2539 457 1136 31915 1864 512
NM_001040630chr882345 2339 2079 2039 1878 529 112 44 2539 457 1136 31915 1864 512
NM_001040647chr72484 371 ----1270
NM_001040648chr72484 371 ----1270
NM_001040709chr182349 2154 909 889 829 751 742 187 41681 916 101 87 51633 820 428 95 80 --
NM_001040715chr1661050 998 815 460 379 373 1808 ----
NM_001042404chr141934 1754 1588 286 11608 11323 --
NM_001042413chr994060 3822 2887 2682 1594 1124 1092 1001 521 23170 2981 12757 --
NM_001042424chr462777 650 558 480 370 270 22571 2528 32290 635 288 --
NM_001042425chr671521 1476 1176 1110 603 455 154 ----11524
NM_001042472chr203507 460 43 --1558 155
NM_001042486chr2061136 573 468 408 248 170 --11528 1417
NM_001042492chr1753443 2936 767 385 64 --53458 2590 1124 883 81 13478
NM_001042494chr1543331 2612 1004 596 154 33498 1250 902 23643 210
NM_001042495chr1543331 2612 1004 596 154 33498 1250 902 23643 210
NM_001042496chr1543331 2612 1004 596 154 33498 1250 902 23643 210
NM_001042497chr1543331 2612 1004 596 154 33498 1250 902 23643 210
NM_001042498chrX4371 358 309 245 --1210 1128
NM_001042506chrX91183 1107 524 488 418 199 159 147 83 --41159 987 287 177 --
NM_001042539chr16111040 982 939 933 420 400 356 272 255 243 120 1989 1164 --
NM_001042555chr1274132 3553 3127 3034 1279 1090 780 23540 1214 64774 4168 4134 3199 1857 1845 21237 1177
NM_001042599chr2177621 7611 6789 6716 6443 6327 6187 5767 5738 5543 5513 5474 5365 2981 1581 895 351 27593 693 12809 57624 6330 5979 540 51
NM_001042601chr333296 2323 36 --2663 504 --
NM_001042603chr1274769 4698 4193 1790 1784 145 129 24371 1372 23910 1548 14848
NM_001042604chr344328 4145 3834 3080 --14147 --
NM_001042632chr2052316 1981 1672 1616 936 11807 31928 1905 123 --
NM_001042633chr2052316 1981 1672 1616 936 11807 31928 1905 123 --
NM_001042669chr441911 1733 1634 423 11566 1624 --
NM_001042681chr142156 923 269 204 1221 22399 2250 --
NM_001042682chr142156 923 269 204 1221 22399 2250 --
NM_001042682chr142156 923 269 204 1221 22399 2250 --
NM_001042728chr1291041 1021 744 738 673 340 192 170 105 164 --2940 886
NM_001042749chrX--11816 --1442
NM_001042750chrX--11816 --1442
NM_001042751chrX--11816 --1442
NM_001043318chr14123771 3711 3253 2711 1489 1095 1064 885 816 794 728 576 33393 3282 1671 33197 3167 810 --
NM_001043351chr162152 1500 745 142 120 33 --1417 --
NM_001044385chr283805 3065 2962 1333 880 837 779 415 --11205 --
NM_001046chr522319 849 ----1852
NM_001095chr1281840 1725 1669 1520 1282 707 588 120 41226 468 279 265 21494 1274 --
NM_001100108chr197853 5841 3006 2426 2152 1571 1151 1097 793 37474 6653 1232 36756 1221 939 32201 1565 708
NM_001106chr3158436 8211 7570 7304 3643 3302 2662 2397 2203 1196 1014 509 479 462 332 27146 6926 59709 6274 2963 2250 498 --
NM_001111chr1132711 2125 1726 857 706 686 631 461 340 301 213 101 71 --41728 884 504 454 1216
NM_001113490chrX2770 580 13574 2655 56 --
NM_001117chr185760 703 651 607 547 11718 1741 --
NM_001119chr461498 1369 1260 347 240 126 --21009 390 --
NM_001122679chr5--1180 --1273
NM_001128chr16152982 2951 2821 2714 2545 2469 1285 830 769 443 294 257 240 234 82 1189 12716 33634 2837 547
NM_001146chr81103 ----11759
NM_001148chr431813 1510 320 11660 --1323
NM_001160chr1262667 1113 977 679 439 168 ------
NM_001167chrX76286 4664 4605 2536 1787 1440 400 15725 ----
NM_001173chr1424729 833 11481 1835 14033
NM_001177chr1241989 1531 49 21 --1386 --
NM_001186chr2162758 1141 702 643 156 38 --23218 704 --
NM_001188chr641249 850 92 78 3983 445 242 1329 11052
NM_001191chr2081335 1118 946 570 473 453 205 59 21401 382 1443 --
NM_001198chr662304 2190 2176 827 806 750 --21902 123 2960 753
NM_001204chr2107383 5370 5215 2773 2205 1797 1760 1182 891 93 1609 ----
NM_001206chr952199 908 306 213 148 ----12202
NM_001219chr731396 897 25 11898 31398 641 148 --
NM_001222chr1041613 1492 1417 1316 ----11420
NM_001232chr13449 131 110 2483 326 ----
NM_001256chr1752155 2110 602 273 63 2800 548 12503 --
NM_001259chr7116080 5482 4473 4186 1937 1507 1127 1060 923 144 63 11515 15989 --
NM_001271chr1562793 2572 1278 1110 738 683 ----1308
NM_001275chr143405 271 59 ----1279
NM_001278chr10170 ----173
NM_001282chr1762624 2507 2409 1980 856 262 12134 42348 781 642 601 --
NM_001304chr1732350 171 55 33303 2940 24 11200 --
NM_001310chr1232487 2340 535 --22100 1240 11973
NM_001315chr621892 386 1491 21875 786 1108
NM_001328chr41209 ----1242
NM_001331chr1182188 1101 1033 940 932 502 299 202 2925 209 21732 216 1229
NM_001332chr541282 571 451 81 ----11377
NM_001343chr541210 696 540 268 ----2645 620
NM_001364chr11174486 4300 4176 3984 3781 3759 3312 3297 3241 3220 3170 3124 2937 1549 1089 921 855 --33709 3341 3188 --
NM_001387chr552570 1098 793 222 141 22772 615 33001 2925 1236 --
NM_001392chr18------167
NM_001397chr1142559 2286 2275 2234 2046 2021 1969 1845 1826 928 730 497 185 113 31041 999 506 --22260 1795
NM_001399chrX52609 2373 837 777 37 21325 140 33849 3447 3027 33670 3465 1407
NM_001406chr17111379 1306 1164 1158 1128 581 451 441 408 305 126 2501 54 31517 534 410 --
NM_001408chr171299 1287 1094 412 352 197 39 2601 45 51497 1485 1266 1102 211 --
NM_001412chrX43708 3392 3195 416 --13058 --
NM_001417chr1261961 1794 1774 1303 1218 25 11783 21776 1202 11469
NM_001419chr1973603 3577 3146 3099 3051 1739 278 13616 33843 3033 835 11867
NM_001420chr1972581 2556 2529 2510 2146 221 209 22669 1156 ----
NM_001421chrX71615 1469 1436 610 554 357 128 11262 31684 1368 1361 --
NM_001423chr1242080 1902 1566 525 1696 ----
NM_001427chr771726 1540 790 768 726 716 688 21403 295 6829 810 759 752 745 736 --
NM_001432chr463165 2437 1448 1409 626 404 12893 ----
NM_001438chr110493 476 464 447 428 364 307 249 211 195 --2436 384 1162
NM_001439chr151522 1249 1231 1222 56 --21243 1233 --
NM_001447chr561240 1226 939 920 527 483 1158 ----
NM_001449chrX41081 490 117 102 ----1134
NM_001451chr1661006 976 503 344 190 122 ------
NM_001453chr631522 367 146 --21259 353 --
NM_001465chr531873 1390 307 --11618 --
NM_001493chrX3732 208 47 1738 1231 178
NM_001495chr85936 286 224 143 117 1403 31034 923 907 --
NM_001497chr942269 484 115 83 21976 1114 ----
NM_001520chr163671 157 25 2578 207 1228 --
NM_001527chr6104745 3438 3391 3004 1848 1835 1741 1365 1067 202 ----13301
NM_001542chr132190 589 50 11788 11939 1592
NM_001543chr5124723 4527 4442 3870 3707 3459 3422 1570 679 448 327 215 43472 1398 398 304 44219 1875 1604 708 24829 3580
NM_001546chr6------11250
NM_001560chrX92550 2425 2418 2170 1746 1692 871 854 57 ----21749 1710
NM_001587chrX62171 2129 1958 1446 464 150 ------
NM_001616chr232977 2536 1371 21124 580 1824 --
NM_001619chr1181023 1005 403 357 269 134 107 64 --1975 --
NM_001634chr622003 337 2670 359 1652 --
NM_001642chr114895 860 844 460 --11235 --
NM_001655chr1121882 78 --11541 11891
NM_001659chr12142579 2539 2501 2264 2222 2209 2045 1996 912 416 362 156 147 80 21818 891 22627 2018 --
NM_001663chr1442695 867 178 23 1766 1543 --
NM_001668chr172123 2109 1520 500 133 102 92 --2596 149 22270 109
NM_001678chr1791731 1700 1627 1411 636 559 445 320 192 21609 76 41329 638 581 497 21195 206
NM_001683chr372311 2058 1906 1860 353 322 252 --1901 --
NM_001684chr1103626 3544 3452 3219 2696 1496 1403 579 484 331 --83700 3263 3037 2980 2789 1472 665 320 22630 1411
NM_001690chr3102293 2223 1695 1652 726 649 315 208 141 37 ----1545
NM_001717chr153529 283 262 1977 ----
NM_001720chr171664 869 796 637 262 169 143 ------
NM_001730chr1321514 32 143 11516 --
NM_001730chr1321514 32 143 11516 --
NM_001731chr12------1277
NM_001743chr21152 --190 1139
NM_001746chr542890 1835 913 895 1465 2543 37 12198
NM_001754chr2174248 4169 2981 2830 2812 2786 626 --63993 2945 2855 2801 2788 1111 --
NM_001755chr1642105 1941 909 767 --11816 --
NM_001759chr12134509 4364 4287 3999 3523 3373 2131 1951 1416 1338 1262 1185 1035 --23702 3576 13550
NM_001761chr1651762 1276 1134 477 208 21490 1228 ----
NM_001773chr151184 249 78 72 49 41305 1275 479 122 31230 1100 62 186
NM_001777chr392921 2656 2555 2542 2527 1132 901 779 737 13097 21108 632 11139
NM_001789chr341465 1277 213 47 --139 --
NM_001791chr141311 1139 892 425 --2427 178 --
NM_001806chr1922724 550 21057 229 --1553
NM_001830chrX63381 3156 2694 1043 979 741 ------
NM_001838chr174915 597 122 88 2257 36 ----
NM_001842chr94491 459 434 428 --1199 --
NM_001852chr14567 534 491 56 1103 1603 --
NM_001858chr684990 4205 4155 3189 1095 831 791 194 ----14993
NM_001885chr11------146
NM_001892chr531379 1227 1021 --159 --
NM_001894chr2261055 940 933 906 793 253 --11094 --
NM_001895chr2051015 779 426 296 226 1792 21004 277 21022 384
NM_001903chr53918 727 664 ----1673
NM_001915chr1781586 1393 773 704 602 430 182 175 2817 529 11703 --
NM_001918chr197014 6061 5674 3479 3209 3173 2983 1145 193 27696 2040 25970 5615 26645 1008
NM_001923chr112103 61 --1200 1137
NM_001933chr1451015 540 317 187 66 --2462 58 --
NM_001935chr21306 ----11004
NM_001936chr771283 696 684 239 174 75 64 21102 278 182 --
NM_001938chr12360 44 ----11551
NM_001945chr531100 1003 990 11058 2277 256 --
NM_001949chr632097 1129 428 --3732 318 311 33047 2091 99
NM_001954chr62821 204 127 3525 177 95 --
NM_001964chr54922 206 131 95 1193 1187 --
NM_001969chr1421311 524 --1964 151
NM_001970chr175594 580 477 400 106 --1243 1144
NM_001975chr126783 767 753 120 93 44 ----3795 546 248
NM_001982chr1271115 986 367 316 259 246 207 189 280 71 1110
NM_001987chr12114157 3987 3493 1635 1602 1314 649 640 631 501 276 --21699 1592 12937
NM_001995chr471166 589 581 439 321 286 51 ----1977
NM_002006chr4105839 5486 5188 1945 1845 1752 1730 1504 1419 1128 22312 1465 35437 1754 198 --
NM_002014chr126604 545 480 279 209 49 --2574 561 1216
NM_002015chr1322836 2104 12353 32326 2192 1322 --
NM_002025chrX138688 8439 8350 7528 7441 7389 6067 3405 3055 2262 1150 1077 653 36645 6485 412 37567 7560 6814 28787 5693
NM_002048chr92224 160 --21068 185 --
NM_002062chr671589 1539 1053 549 500 211 148 11279 1150 51577 1157 1072 552 325
NM_002068chr193619 505 215 --1217 1680
NM_002072chr95407 393 360 223 34 --2788 374 --
NM_002077chr961794 1561 1549 1532 510 153 --11918 --
NM_002080chr165835 798 347 239 223 ------
NM_002082chr53767 186 104 2112 47 ----
NM_002086chr1772066 2046 1941 1878 1836 1807 1602 --1250 22037 500
NM_002092chr433753 2009 729 --24809 3760 13933
NM_002094chr162356 103 --1332 1359
NM_002126chr1772781 1081 1043 864 790 549 320 33805 3300 314 1988 1995
NM_002131chr661296 1242 1080 949 916 240 31086 813 93 4848 433 398 217 --
NM_002138chr43619 256 155 ----1259
NM_002139chrX2602 120 --1133 1615
NM_002146chr1751114 512 500 438 145 --31367 413 151 --
NM_002147chr176944 801 354 306 166 68 ----2947 309
NM_002149chr24738 694 495 99 1162 1185 --
NM_002196chr202311 221 1232 1739 --
NM_002196chr202311 221 1232 1739 --
NM_002202chr52772 28 ----1775
NM_002204chr172228 195 31206 934 219 11337 --
NM_002205chr124770 179 120 44 1846 --1945
NM_002210chr221406 160 ----1980
NM_002221chr172888 2667 2631 2524 2249 2231 1095 12291 145 --
NM_002227chr14385 263 189 47 ------
NM_002230chr1751014 892 430 323 85 2307 139 2988 45 --
NM_002241chr1103145 1018 816 606 391 186 117 93 42 27 42194 1070 199 110 22096 608 22269 652
NM_002247chr1061960 1745 1738 1572 102 81 22081 1842 2664 91 152
NM_002254chr252252 798 771 470 319 31823 1728 296 22243 883 1410
NM_002264chr384572 4135 1266 902 712 569 352 343 34409 3371 617 21260 1020 --
NM_002267chr1342154 262 254 26 1451 ----
NM_002270chr575450 5057 3729 3441 2177 1409 492 --14040 --
NM_002285chr242824 640 631 119 22646 518 --1647
NM_002293chr142618 350 248 30 12415 --22164 1737
NM_002309chr22143050 3002 2875 2753 2732 2596 2490 2382 2244 2055 849 728 716 231 32923 2444 484 33004 2002 1126 12289
NM_002310chr5116118 4677 4013 2465 2404 2257 1941 1885 1841 1360 503 12275 21046 972 45446 5421 2407 2260
NM_002313chr1094935 4869 4547 3833 3547 3421 3125 1859 720 11445 --11489
NM_002319chr74323 301 190 33 2815 23 2329 310 1749
NM_002332chr125645 619 188 181 90 ----1636
NM_002334chr1161605 1309 311 286 104 39 1737 31515 769 688 21990 318
NM_002336chr1234820 4466 1231 2864 748 14963 --
NM_002349chr22622 161 ----11600
NM_002355chr124910 878 167 30 31374 91 39 --1571
NM_002356chr622826 256 --2176 41 12611
NM_002359chr17113892 3469 3323 3046 2787 2760 1615 1602 1253 125 72 1109 42834 2828 385 97 13472
NM_002373chr1551322 1310 489 333 162 4926 497 38 22 --1483
NM_002374chr263064 2794 1375 1033 925 818 ------
NM_002375chr381702 624 368 226 183 166 54 32 12154 61830 540 294 76 64 44 12142
NM_002382chr145492 228 215 177 55 2347 184 21310 118 --
NM_002383chr1610863 805 762 756 243 223 179 95 78 66 1812 1352 --
NM_002387chr575026 4618 4568 3427 1346 415 293 --3752 425 212 24571 3593
NM_002399chr1531333 1075 119 ----1885
NM_002406chr53409 299 93 --4834 356 170 95 1416
NM_002430chr2292113 2058 994 729 706 654 454 294 39 --41935 1740 1729 63 --
NM_002442chr12101712 1290 1275 1126 610 453 306 243 205 106 41576 1331 1297 193 21569 437 --
NM_002451chr933555 3055 1198 --33297 3241 277 --
NM_002473chr229447 207 195 182 150 137 117 82 55 --2995 152 --
NM_002486chr93758 503 270 ----1707
NM_002499chr1542314 694 456 216 11996 22047 177 11638
NM_002501chr19194129 3919 3900 3891 3885 3689 3654 3208 3094 3061 2972 2553 1559 1546 1495 1392 551 80 32 73611 3533 1413 1340 542 189 122 74054 3873 3198 1215 870 573 355 1621
NM_002507chr1741908 1826 1531 1277 31271 796 482 11745 31602 1397 289
NM_002508chr161619 1580 546 361 304 143 1156 --21955 146
NM_002516chr19362 47 37 --2234 56 --
NM_002522chr1773046 2582 2526 1340 1126 673 82 22625 1238 12733 191
NM_002524chr13957 847 73 1134 --1960
NM_002542chr32212 65 253 30 143 --
NM_002545chr11134338 4185 4164 4090 3913 2047 1723 1705 958 889 283 277 39 11016 13213 --
NM_002547chrX73944 3933 2899 742 358 341 215 23921 267 13980 11292
NM_002556chr1191981 1577 821 757 730 672 433 340 98 11951 21841 302 11775
NM_002569chr1571416 1344 1326 987 362 355 35 21410 468 ----
NM_002570chr1561184 1166 1115 825 402 121 --1369 162
NM_002576chr11189 1330 1226 21124 106
NM_002577chr373714 3125 1622 1540 1526 794 335 --41494 906 898 809 --
NM_002578chrX2369 326 2157 33 ----
NM_002581chr955569 3683 2153 789 434 21481 599 13767 1810
NM_002586chr6101645 1437 1290 1095 395 322 304 235 215 128 3402 388 329 11165 11300
NM_002588chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_002601chr22328 181 ----2113 74
NM_002608chr2261399 1243 563 264 189 94 11360 31511 341 96 1145
NM_002609chr581713 581 555 351 321 267 116 38 ----1250
NM_002612chr7------21361 91
NM_002613chr16105380 4130 3924 3256 2118 1866 1418 1291 1261 547 11684 34671 3354 1944 14396
NM_002616chr172383 49 1375 --1117
NM_002622chr52622 83 --2220 27 1634
NM_002646chr1121855 1808 1740 1497 1377 855 799 788 498 185 79 64 ------
NM_002648chr64929 512 220 22 --2983 975 --
NM_002651chr15868 837 634 320 213 2652 560 ----
NM_002657chr20123394 3232 3206 3184 3041 2903 2860 2491 2465 2372 950 289 32477 1040 74 53656 2517 1147 802 530 13166
NM_002670chr341540 1461 1331 1243 --11542 1438
NM_002698chr19192599 2330 2309 2296 2285 2277 2266 2113 2035 1195 1123 1067 1033 1009 755 325 315 214 190 21934 224 42222 1142 1131 1015 12607
NM_002699chr191507 1373 1068 1045 537 423 416 385 284 11142 31367 1080 530 --
NM_002709chr253483 3201 2395 507 443 --23203 1032 --
NM_002714chr63973 446 91 ----2194 100
NM_002716chr11123559 3521 3503 3460 3449 3399 3346 3295 2558 2279 2235 1432 12443 13510 12496
NM_002718chr362693 2570 1864 357 214 104 1183 1894 --
NM_002719chr1422120 1759 ----1318
NM_002721chr92357 199 ----1202
NM_002725chr1164401 4264 4138 3329 3246 1760 1676 1127 1032 909 513 462 403 295 251 88 64293 3584 1319 998 417 311 --1101
NM_002731chr142961 676 655 255 --22621 662 --
NM_002734chr1761537 1526 656 74 35 29 ------
NM_002742chr142661 216 --1663 --
NM_002745chr2254459 4179 4109 4072 1693 44012 3483 1324 390 2320 198 1507
NM_002747chr183646 564 509 ----11512
NM_002775chr103398 45 31 ----134
NM_002776chr1991938 1647 1452 706 642 376 314 159 106 21577 697 2737 86 1178
NM_002821chr65567 251 236 165 87 1549 2309 157 --
NM_002824chr122462 392 3384 333 313 1136 --
NM_002829chr96876 347 274 45 32 26 1854 ----
NM_002833chr1541288 367 313 153 31309 357 122 31428 414 325 --
NM_002837chr1274535 4051 2943 2920 2894 955 615 13918 ----
NM_002840chr131379 667 519 1597 21218 373 --
NM_002843chr1172424 2217 1110 759 745 739 642 22886 1118 53269 2108 747 703 256 --
NM_002847chr721000 121 --11002 11348
NM_002850chr1961215 1143 973 965 942 394 1363 31058 795 237 --
NM_002855chr11183633 3553 3196 3121 3064 3005 2759 2559 1497 1358 700 654 455 352 326 256 200 37 21455 211 62260 1034 899 829 572 191 11479
NM_002859chr12141819 1609 1352 1320 1192 600 541 464 335 243 219 203 160 121 31715 1339 33 2667 412 --
NM_002866chr194499 452 187 31 2170 41 123 2233 51
NM_002868chr1292313 1993 1927 1494 773 419 413 311 234 22414 2162 82236 2172 2106 1982 913 745 372 330 1776
NM_002869chr1191764 1754 1713 1706 1484 453 444 416 98 --11771 1859
NM_002874chr91874 --1886 1894
NM_002880chr33562 225 77 2873 238 ----
NM_002881chr221401 102 --2242 231 11266
NM_002886chr353362 1872 1300 1253 154 24152 1120 54601 4595 1874 270 244 24915 1350
NM_002945chr172856 253 1683 2132 60 --
NM_002956chr1231018 927 166 --11272 --
NM_002957chr983822 3738 2938 2638 1471 1370 1001 823 23522 2792 33694 3229 485 11004
NM_002959chr1114241 4126 3996 3957 3491 1589 963 896 614 502 90 14150 13327 11435
NM_002966chr12212 25 ----181
NM_002996chr16121877 1852 1652 1478 1387 1302 1239 747 630 358 269 185 4475 161 127 55 ----
NM_002997chr2111645 1459 1423 1392 1226 613 599 526 299 279 88 ------
NM_003010chr1721808 703 11910 32377 1819 935 --
NM_003011chr93586 97 46 --2381 99 --
NM_003012chr852970 2781 2409 1114 1084 --22714 161 --
NM_003016chr1711849 1356 51858 1851 1688 773 277 --
NM_003026chr921080 383 ----1468
NM_003028chr9153777 3320 2920 2711 2637 2626 2605 2513 2481 2358 1494 1066 987 407 364 --1989 --
NM_003030chr331820 133 76 1141 21407 1344 --
NM_003034chr12117371 7277 6550 5268 5087 2603 2085 1032 726 634 596 16705 15270 16021
NM_003042chr34693 619 536 415 21871 1715 1417 --
NM_003043chr3104203 3850 3759 3745 3446 2915 2802 1188 1181 946 73933 3591 3430 3412 2704 1305 1024 13058 --
NM_003045chr13114945 4670 4524 4198 3416 3282 3119 1289 801 555 183 --2365 279 13062
NM_003047chr1131343 1180 1173 1162 1093 506 322 306 187 160 111 74 31 11267 21246 275 11064
NM_003051chr131705 1698 736 11645 --11549
NM_003060chr53876 409 190 2510 390 --1402
NM_003074chr361884 857 734 641 255 72 --21919 1392 --
NM_003075chr122319 23 ----170
NM_003076chr12101681 1655 1603 1432 1371 666 505 400 241 203 11324 51434 1417 1406 1039 481 --
NM_003081chr201437 125 21147 978 --
NM_003107chr651862 529 446 368 344 1203 2674 663 --
NM_003108chr2136552 6503 6301 5499 5102 2858 2273 1763 1060 1039 854 334 270 25063 1859 26369 1877 --
NM_003110chr175842 769 164 152 52 140 1201 --
NM_003112chr752759 2362 1152 1045 650 ----1218
NM_003118chr541986 744 56 45 1422 22065 634 159
NM_003128chr252874 1939 1134 273 100 --12824 --
NM_003131chr6142107 1961 1767 1431 817 798 677 648 601 525 507 369 249 202 21926 193 32207 668 654 --
NM_003137chr652022 2001 906 75 69 --154 12025
NM_003139chr114815 804 766 234 1221 1716 2618 38
NM_003144chr61351 ----1354
NM_003150chr1741924 1880 1599 1580 --1311 --
NM_003155chr852439 2424 284 259 122 21038 538 42449 2327 2078 275 12427
NM_003156chr1181218 1179 1146 995 868 376 244 41 --21020 65 31149 402 280
NM_003161chr1753462 2395 1199 1158 237 --12881 --
NM_003164chr114438 418 179 113 1151 --1548
NM_003173chrX31377 390 183 41207 1049 479 60 ----
NM_003178chr372170 1801 1592 1479 597 448 410 31668 434 273 1450 --
NM_003179chrX81444 1384 1221 394 383 288 247 191 21451 1125 31362 1209 1202 1417
NM_003185chr2031107 512 469 --2527 475 --
NM_003189chr162835 2568 2296 2154 1257 924 --2675 251 22157 259
NM_003194chr6--128 --1373
NM_003199chr1874515 1848 1383 923 809 715 89 ------
NM_003200chr19102078 2018 1890 1827 1519 933 918 893 773 228 ----12037
NM_003202chr5--3591 584 63 --11200
NM_003216chr22103138 2346 2113 2085 1312 1238 1072 776 657 532 21118 343 1469 12088
NM_003217chr12101442 804 616 548 389 325 251 133 35 21 --1211 1765
NM_003220chr671521 1476 1176 1110 603 455 154 ----11524
NM_003224chr206859 815 783 621 149 36 1733 1952 --
NM_003234chr361885 1686 1554 681 482 437 1389 --2695 232
NM_003239chr142733 719 --2849 749 1841
NM_003242chr351627 689 597 228 119 1751 1910 --
NM_003250chr172390 144 1296 --152
NM_003255chr17102369 2105 2091 1649 839 644 552 210 149 142 1341 21015 282 --
NM_003270chrX7995 792 439 347 295 56 27 --1794 --
NM_003274chr2121199 259 41817 965 711 456 12026 --
NM_003286chr2041140 1109 1097 785 1446 1439 --
NM_003298chr3125197 5090 4918 4607 4208 2461 2237 1679 1406 796 735 127 --36015 5263 4947 21312 871
NM_003309chr651646 708 574 566 186 ------
NM_003320chr11114182 4164 4153 3647 3570 3330 2755 1599 1581 1404 681 32745 1270 831 11329 --
NM_003339chr531406 1198 626 --21498 113 --
NM_003342chr1782691 2536 2188 2098 965 852 560 484 --22718 854 1827
NM_003348chr1241418 1318 268 34 --41396 593 407 55 1271
NM_003349chr2021056 625 1579 3381 36 30 --
NM_003352chr22201 28 ----131
NM_003363chr33633 522 453 148 2555 460 --
NM_003369chr114802 583 525 118 --32618 2583 686 --
NM_003370chr197571 553 259 244 162 63 29 --5739 591 577 232 217 --
NM_003371chr941980 1711 630 613 1623 1860 --
NM_003373chr1081809 1751 1440 1415 634 612 501 339 --1355 --
NM_003376chr641496 1417 606 245 128 ----
NM_003376chr641496 1417 606 245 128 ----
NM_003385chr21268 --1797 1276
NM_003387chr272799 2421 1854 949 197 86 73 12770 42801 943 930 373 --
NM_003390chr114825 731 311 23 --1733 --
NM_003392chr364056 3314 1311 1104 1021 626 1518 11049 1104
NM_003404chr2021753 593 11497 11444 11365
NM_003406chr851811 1736 1678 1621 139 --11747 11624
NM_003410chrX42903 2432 2415 2045 ----1401
NM_003439chr731398 770 723 --130 --
NM_003458chr3134000 3832 3783 3556 3210 3197 1304 1015 976 937 777 551 448 33932 3295 2975 33820 3813 1289 1724
NM_003459chr24659 293 117 111 ----1141
NM_003463chr653231 2745 2652 2634 919 22778 515 --22637 261
NM_003468chr293491 1397 1086 1079 1072 957 886 497 174 --11127 12642
NM_003470chr1651872 1269 540 531 503 1547 21733 1725 --
NM_003474chr1022238 1640 31651 469 387 --11988
NM_003478chr1132449 348 183 --11322 --
NM_003481chr122481 391 1365 --1484
NM_003482chr12142648 2626 2512 1996 1118 989 977 926 539 529 509 503 53 34 32401 758 202 32490 2474 531 --
NM_003485chr143883 875 268 --51243 1098 898 890 83 --
NM_003489chr2121117 747 --12192 11174
NM_003505chr771666 1280 601 587 571 469 103 153 1698 1778
NM_003507chr23571 364 25 11944 3599 327 105 --
NM_003557chr151191 396 233 185 179 1144 1360 1635
NM_003559chr17103882 3834 3539 3094 1128 1008 927 608 442 279 53495 2887 2789 2638 2476 32747 2504 247 32737 644 600
NM_003563chr1721298 224 ----11032
NM_003564chr13575 538 194 2200 174 1240 1430
NM_003566chr1262691 2231 1260 490 361 211 ------
NM_003567chr1------144
NM_003574chr1854143 4123 3922 1695 1689 15146 35134 1979 475 --
NM_003575chr741556 1464 1340 514 1153 21369 1200 1976
NM_003576chr1352845 2803 965 391 53 11945 42847 2176 840 708 --
NM_003593chr173600 526 464 1112 --2699 552
NM_003607chr163783 2784 1374 1102 733 395 23657 1291 21424 73 --
NM_003617chr194552 4245 3636 3515 3108 1626 672 554 64 1890 54559 4545 4524 3619 1480 2199 45
NM_003624chr1931163 547 364 21203 935 2556 238 --
NM_003629chr132865 1091 629 23473 1047 21102 440 --
NM_003633chr532438 636 329 11929 21596 1025 --
NM_003634chr226866 428 292 240 211 197 1928 3794 35 29 1907
NM_003636chr111189 3585 275 146 140 2528 296
NM_003637chr171534 1440 1214 626 393 113 29 1430 2348 235 1362
NM_003644chr17216324 6155 6022 5977 5565 5084 4899 4348 4292 4189 4171 4036 2477 2459 2134 1484 1378 1256 957 751 512 44505 4492 1039 171 55673 2183 2123 1350 1258 46363 4295 740 357
NM_003655chr173485 239 82 --4588 576 542 163 --
NM_003670chr331092 999 38 ----1302
NM_003671chr963156 3093 2930 2419 948 924 12743 52755 2710 2300 1072 852 --
NM_003713chr131174 608 580 ----11177
NM_003714chr542457 2195 1097 1002 12496 22369 2276 133
NM_003735chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_003736chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_003743chr22870 580 12009 --11602
NM_003744chr1441207 367 256 250 ----11180
NM_003749chr1342016 1848 1663 189 ------
NM_003758chr1521277 1126 ----11323
NM_003758chr1521277 1126 ----11323
NM_003759chr452849 1485 1103 345 42 --12843 13148
NM_003763chr2082828 2697 2555 2388 698 154 148 42 1546 --12030
NM_003768chr151560 1554 325 310 195 164 21575 301 3318 246 57
NM_003774chr1253311 2802 2690 2339 716 ------
NM_003795chr6--1188 --1490
NM_003800chr641845 1532 778 182 11810 11847 --
NM_003809chr175459 445 119 73 45 1199 ----
NM_003819chr12294 250 ----1253
NM_003822chr121974 490 32555 1172 736 12538 1425
NM_003840chr852056 1929 1686 1511 47 11898 --133
NM_003842chr841774 1527 843 33 41743 879 437 128 --1506
NM_003861chr1432853 2166 378 --12032 11054
NM_003870chr1542007 1994 1626 76 --12049 11815
NM_003872chr2102751 2677 2433 2366 2223 2174 1194 874 835 425 --21024 876 --
NM_003877chr122892 207 ----1179
NM_003885chr1742019 1912 127 115 1424 12650 11993
NM_003893chr103462 329 322 ----1420
NM_003901chr10102696 2333 2302 1942 1894 1826 1712 890 421 159 11840 --11897
NM_003913chr6114172 4031 3926 3742 3533 3207 2691 2675 1638 626 96 32919 2698 2683 ----
NM_003927chr183777 367 321 ----2324 36
NM_003930chr731832 1714 159 1795 --11955
NM_003931chr61554 --1206 1128
NM_003932chr2231934 1800 1366 1147 11368 --
NM_003936chr2111096 987 774 751 407 390 376 297 289 270 28 --3420 362 312 --
NM_003939chr10163991 3808 3328 3280 3146 1529 1195 1053 735 650 479 404 313 286 276 117 2904 668 33823 1499 556 23430 1395
NM_003947chr331082 416 165 1885 --1307
NM_003949chr17131932 1917 1896 1874 1857 1791 1685 1383 1362 578 514 189 113 1302 1272 --
NM_003955chr17101489 1140 607 539 288 277 226 153 142 57 --1298 --
NM_003958chr643561 1005 876 516 --23104 3071 11498
NM_003966chr596162 2092 2055 1947 1936 1858 1261 895 42 26951 2218 37074 6020 2678 --
NM_003971chr17158 --160 1420
NM_003983chr1694396 3610 1618 1599 1235 1041 495 474 455 23781 3435 54328 4300 4049 3180 1302 12718
NM_004050chr1452070 1876 756 592 535 22006 874 2613 554 --
NM_004063chr83921 748 240 1389 1113 --
NM_004077chr1241108 1057 1047 180 1476 21101 198 11236
NM_004080chr721181 440 2290 275 ----
NM_004087chr341347 617 574 68 --11399 --
NM_004093chr1372569 1300 1294 593 269 130 30 1599 32984 1311 416 --
NM_004097chr25745 363 357 283 207 --1719 --
NM_004103chr87771 759 742 731 143 117 58 --1744 --
NM_004113chr331825 1720 1589 --241 25 11723
NM_004114chrX1986 1335 --1989
NM_004117chr661686 624 613 539 410 59 21930 1629 2872 823 21408 62
NM_004124chr1463044 2724 2309 2186 630 233 --22847 2726 --
NM_004162chr351007 809 467 326 184 ----11041
NM_004171chr11179332 9097 9032 8654 8503 8241 7772 6585 6570 6514 6452 3523 2047 477 418 330 292 16897 36426 2806 1169 26863 301
NM_004185chr12223 26 ----182
NM_004187chrX81340 1329 1094 1007 979 420 365 355 11069 3465 452 215 11010
NM_004200chr11133230 2901 2226 2103 2066 1184 1064 1055 1027 916 782 772 385 62750 2341 1209 1112 341 184 2832 791 22587 1097
NM_004206chr31236 ----144
NM_004210chr1082127 1413 586 548 392 244 234 93 21638 675 21352 113 1316
NM_004215chr8----1501 1148
NM_004230chr1952206 2102 1682 770 451 11948 12336 12105
NM_004254chr115351 304 294 92 22 --1284 1263
NM_004263chr251672 1519 1412 1244 725 1504 21611 243 --
NM_004272chr531754 589 344 3767 718 122 ----
NM_004274chr1473048 2982 389 337 330 177 80 23034 2760 --31223 261 145
NM_004279chr762256 2235 1988 1939 737 540 ------
NM_004290chr52878 40 1303 --1399
NM_004296chr14103815 3709 3344 3225 3030 2887 2745 1183 1090 366 42594 2470 1388 505 22689 897 22673 843
NM_004302chr124777 764 750 576 31113 865 784 1477 12309
NM_004308chr1161460 1180 738 636 382 322 31819 1634 127 2560 58 --
NM_004311chr10112939 2563 2525 2479 2257 2137 1257 898 849 340 224 --52789 2734 2552 2322 426 --
NM_004319chr1102928 2457 2438 2423 864 707 682 459 293 178 22894 2449 32727 2562 2541 32526 2441 2065
NM_004321chr263387 2552 1111 701 606 44 63318 3124 2931 2860 482 50 23396 3353 1781
NM_004326chr151144 1035 1012 997 846 --31151 978 836 1358
NM_004331chr82479 457 ----1460
NM_004338chr1872816 2663 2313 1943 1148 1139 448 21432 978 24708 4306 --
NM_004344chrX195 ----198
NM_004346chr421022 75 --2358 77 --
NM_004371chr12616 65 --285 42 1625
NM_004380chr16125 41856 1806 1658 519 --11017
NM_004391chr3132091 2036 1825 1751 1586 1501 1446 1434 1421 806 602 154 104 31488 1361 377 21704 328 --
NM_004392chr1352256 1895 556 347 170 1426 ----
NM_004393chr372241 1968 1851 1648 1542 738 165 --11816 11831
NM_004397chr1164016 3899 940 601 410 368 13040 21356 401 13001
NM_004414chr212624 159 ----21179 493
NM_004416chr1231084 886 747 --2690 25 1741
NM_004420chr1142320 1587 450 442 22133 2023 71889 1882 1875 1618 841 426 295 11644
NM_004423chr382590 2453 1011 524 420 302 219 55 1364 42717 2443 785 379 12350
NM_004426chr1261574 1408 1317 539 462 341 --1665 11288
NM_004427chr14495 425 114 41 31158 305 154 4814 460 412 291 1257
NM_004430chr862186 1756 1066 1000 391 380 2624 221 6962 956 812 209 138 31 2979 383
NM_004431chr11203 --2323 115 1335
NM_004432chr912163 --21841 394 12166
NM_004437chr142271 792 450 436 1374 32412 1113 634 42665 2420 2274 39
NM_004438chr253204 2958 2065 1063 1014 ------
NM_004441chr361273 465 442 429 415 389 ----1453
NM_004442chr161681 1559 1448 672 635 368 11592 31604 1450 1154 132
NM_004454chr342034 1725 1645 1547 1573 12240 --
NM_004457chr2198 --1200 11085
NM_004474chr161033 957 694 377 287 48 1408 1392 --
NM_004475chr176398 277 241 189 181 46 ----1280
NM_004481chr171831 1692 764 639 544 498 200 3678 512 236 11732 1820
NM_004485chr1103379 2725 2680 1709 1170 1061 1030 875 659 48 23272 1203 43208 2790 2770 2699 --
NM_004487chr351150 1079 1070 427 31 11090 ----
NM_004491chr19153795 3532 3445 3190 2914 1652 1573 1372 923 915 667 322 272 264 113 13721 ----
NM_004494chr161240 1013 814 507 135 99 21174 973 1242 1345
NM_004496chr142281 152 --3409 319 312 1155
NM_004499chr51132 ----1135
NM_004500chr1462028 1925 1905 1292 630 368 2742 90 21480 120 --
NM_004501chr142652 1251 349 35 11507 33546 1552 1257 22655 849
NM_004503chr123205 113 30 3332 172 62 2257 38 --
NM_004516chr1941264 1258 847 839 ----152
NM_004527chr1791061 1016 932 482 363 342 328 206 117 21251 89 --11069
NM_004530chr1671133 1054 978 327 203 168 30 1753 1220 --
NM_004586chrX84454 4054 3897 3378 2171 1948 1874 153 11212 12173 34517 1877 673
NM_004588chr1194074 3217 3095 3057 2800 836 736 459 41 72974 2948 2648 1088 943 425 152 13247 --
NM_004598chr562986 2921 2678 1320 634 100 22581 1333 1486 --
NM_004602chr2011405 --31301 339 283 --
NM_004603chr761051 974 916 841 344 116 1738 11116 --
NM_004606chrX4308 267 41 34 ----166
NM_004612chr974551 4342 3934 1697 1469 829 216 ----14202
NM_004615chrX2247 121 ----1753
NM_004630chr1141033 863 307 283 --21057 1047 --
NM_004634chr35577 566 432 146 49 ----1590
NM_004637chr341285 1174 1155 888 --31001 444 73 11164
NM_004655chr1731207 540 392 ----2995 395
NM_004656chr34956 880 83 63 --177 1250
NM_004660chrY1119 --1236 11495
NM_004686chr84725 636 434 351 ----1354
NM_004709chrX2232 220 ----1434
NM_004717chr751384 581 373 350 73 ------
NM_004719chr1232532 2452 421 1207 2423 194 --
NM_004734chr1362900 2376 264 166 74 31 193 --1169
NM_004736chr142130 1893 1419 56 ----12133
NM_004742chr351258 1243 457 263 43 1465 --146
NM_004745chr8166673 6600 6247 6221 5908 5172 4869 4625 4282 1780 1666 640 536 278 89 42 24736 1680 46138 6092 488 24 36924 4908 1946
NM_004748chr1554096 3935 3425 2866 1143 ------
NM_004755chr1431242 869 90 --11022 146
NM_004758chr1741063 1038 845 164 11091 1418 1758
NM_004759chr172019 1982 1976 1633 1512 731 61 22026 1920 31576 1328 229 11780
NM_004760chr72782 268 1907 --1712
NM_004762chr1741857 1571 760 231 --2520 55 --
NM_004774chr1753130 2487 2374 2323 1027 12099 22852 341 --
NM_004779chr52530 224 2218 75 --1882
NM_004798chr2093216 3181 3008 2311 1325 1148 982 821 680 13135 4318 309 294 106 11328
NM_004815chr154549 4355 3692 3509 857 14439 34431 4061 3991 1285
NM_004822chr1793528 1602 1573 1253 551 519 304 171 104 33072 2881 587 33731 3711 529 --
NM_004831chr193821 778 719 1302 1763 1172
NM_004834chr273403 2892 2807 2530 1346 159 143 --12867 1310
NM_004836chr21363 ----1798
NM_004841chr161162 921 802 716 322 192 --21154 880 1195
NM_004845chrX63937 3910 2886 877 845 279 14105 23205 1633 1369
NM_004849chr6----11681 1197
NM_004850chr221132 152 --1146 --
NM_004857chr1453583 3452 3391 1719 543 13596 11014 --
NM_004859chr1732660 2406 768 --22601 255 21942 611
NM_004863chr1445020 3925 1872 418 3601 339 36 23736 333 --
NM_004866chr544007 409 235 48 14968 23472 1479 14757
NM_004869chr1821494 1147 ----1161
NM_004871chr1784237 3752 3585 3041 548 476 459 255 --23116 432 --
NM_004873chr1453145 2935 2245 1302 1142 12190 --1586
NM_004879chr114996 181 125 60 1703 2658 306 --
NM_004884chr1571666 1572 1123 623 569 549 227 1661 --11579
NM_004887chr521004 886 1936 --1889
NM_004898chr432548 2167 476 2876 465 22745 2276 --
NM_004904chr7105999 5865 4203 2466 1417 680 612 576 491 234 14786 11577 --
NM_004926chr1441747 531 157 130 190 31460 547 72 2519 133
NM_004929chr821412 291 ----11415
NM_004930chr14530 285 177 147 --3276 94 82 --
NM_004936chr942130 1915 896 52 32449 2063 365 ----
NM_004938chr94448 167 130 72 1293 1846 --
NM_004943chr194972 824 239 125 21225 209 21143 466 --
NM_004947chr372095 2082 2001 867 788 380 208 178 42582 2084 848 281 12591
NM_004952chr15915 335 325 304 104 2873 724 3702 671 164 --
NM_004956chr722889 1793 13570 23463 442 --
NM_004961chrX41058 556 517 240 3173 128 42 ----
NM_004976chr11164840 4722 4678 4454 4422 4334 3882 3645 2009 1889 1845 1747 1504 1473 1357 911 84868 4852 4392 4316 4155 3718 3287 1334 64842 4763 3310 1738 1312 846 --
NM_004977chr196568 453 382 157 142 65 1501 179 --
NM_004978chr171614 1578 1567 530 409 366 223 11273 21117 503 21285 182
NM_004979chrX51119 1009 811 795 310 21025 287 31057 389 189 --
NM_004985chr1244101 851 582 176 ------
NM_004992chrX298086 7976 7793 7048 6973 6786 6536 6131 5921 5699 5280 3418 3098 3081 3005 2815 1816 1809 1800 1537 1510 1378 1282 1268 953 439 342 324 63 107784 7753 5914 2978 2609 2570 1064 762 450 431 97462 6979 6355 6173 5776 3089 3070 1818 1222 32623 1276 345
NM_004992chrX298086 7976 7793 7048 6973 6786 6536 6131 5921 5699 5280 3418 3098 3081 3005 2815 1816 1809 1800 1537 1510 1378 1282 1268 953 439 342 324 63 107784 7753 5914 2978 2609 2570 1064 762 450 431 97462 6979 6355 6173 5776 3089 3070 1818 1222 32623 1276 345
NM_004993chr1441360 1346 992 593 11354 1505 --
NM_004995chr1471264 618 382 209 196 168 136 11319 ----
NM_004999chr654437 3172 1333 1299 1243 --1534 33697 3224 1246
NM_005010chr762226 2138 2033 1698 281 230 --11691 12229
NM_005011chr751847 1531 1474 1454 597 ------
NM_005020chr74599 556 80 71 --1236 1164
NM_005028chr1052251 1903 1662 619 182 ------
NM_005032chrX4339 284 259 189 --1723 --
NM_005056chr1275013 4942 4437 2034 2028 389 373 24615 1616 24154 1792 15092
NM_005057chr181747 671 655 644 592 484 478 187 1371 1673 --
NM_005060chr151262 424 244 86 28 --1537 11205
NM_005063chr10123762 3631 3244 3086 2989 1390 1198 1130 955 455 267 235 --1994 --
NM_005065chr1425237 1450 24833 1461 32035 1858 1646 --
NM_005066chr1--1241 --1766
NM_005078chr1551472 1235 1172 329 223 1350 11147 1294
NM_005079chr822368 2270 --1379 --
NM_005080chr224945 831 654 274 --1743 3834 355 281
NM_005095chr152239 2048 1582 873 246 --22213 1835 1897
NM_005096chrX31104 1084 135 41021 451 226 61 1882 1896
NM_005105chr131805 1528 684 --11765 1760
NM_005116chr20103915 3845 3443 3239 1685 1430 564 520 317 267 24193 991 11005 --
NM_005119chr131307 1284 1168 1167 21208 404 --
NM_005121chr1743258 2993 2389 1338 --11523 --
NM_005135chr1543331 2612 1004 596 154 33498 1250 902 23643 210
NM_005147chr16--21025 993 --1869
NM_005155chr63724 450 175 5597 514 211 185 119 ----
NM_005156chr974575 3512 3349 1524 280 198 21 --34958 4559 168 24732 3703
NM_005157chr961877 1712 1583 603 416 386 --21332 202 --
NM_005161chr11152086 1978 1647 1393 805 774 695 467 461 444 389 329 249 140 117 12193 3483 366 331 2740 392
NM_005184chr1991309 1148 1121 1097 349 289 183 174 80 41189 433 332 312 31349 1281 1160 --
NM_005186chr115510 146 139 131 34 --1563 --
NM_005187chr1671645 1616 1496 1432 1306 359 343 21626 600 1524 --
NM_005197chr1465506 4531 4379 3821 3787 516 25493 2440 --26159 308
NM_005202chr191959 1804 1616 1598 888 724 431 200 35 2423 399 2895 148 2482 203
NM_005219chr561749 1627 1613 624 461 91 --2492 366 --
NM_005220chr1751304 1253 1129 469 196 11433 31290 449 115 31132 269 135
NM_005225chr2051196 1135 1127 926 82 1905 21141 1015 --
NM_005229chrX2806 796 51232 943 338 220 171 1990 1358
NM_005233chr342185 2003 1002 171 ----1174
NM_005235chr2177621 7611 6789 6716 6443 6327 6187 5767 5738 5543 5513 5474 5365 2981 1581 895 351 27593 693 12809 57624 6330 5979 540 51
NM_005238chr1162962 2865 2806 2658 2572 2547 11193 --12893
NM_005240chr12804 192 --2710 549 --
NM_005254chr1511283 --1980 1455
NM_005261chr82345 102 ----1105
NM_005276chr123587 254 233 1641 3706 634 625 --
NM_005276chr123587 254 233 1641 3706 634 625 --
NM_005277chr42663 170 ----1666
NM_005281chr13977 753 297 --1658 1305
NM_005311chr742150 1908 1014 207 1542 ----
NM_005312chr9102142 1857 1006 964 955 945 382 323 298 183 22194 906 31950 966 542 --
NM_005329chr1642242 2068 883 276 21728 199 --1386
NM_005333chrX2922 860 1795 --167
NM_005334chrX81153 592 581 498 483 386 131 32 31548 1509 1234 2457 247 --
NM_005336chr282079 1853 1737 1459 731 432 419 410 41926 1800 477 172 32153 1879 116 --
NM_005339chr423635 244 --34352 4308 604 21681 1034
NM_005342chrX42682 2653 2044 266 12014 12122 12656
NM_005359chr1886345 5826 4813 2385 2185 1681 1445 184 11469 56358 4615 4307 4291 746 11448
NM_005370chr1921249 833 1391 11167 --
NM_005374chr17102362 2130 2106 1788 1773 701 691 426 387 61 --32371 2263 2083 1661
NM_005385chr362710 2422 2178 2171 2119 926 ------
NM_005386chr204881 814 734 98 --3591 584 108 --
NM_005397chr7113529 3393 2839 1399 1273 1012 558 188 149 130 119 23790 1486 11126 12676
NM_005398chr101259 --2952 272 144
NM_005399chr171585 1428 1316 1209 867 560 44 --24011 3454 --
NM_005400chr26480 419 405 164 144 96 --1421 12805
NM_005407chr1491580 1506 1383 1285 1257 1246 316 310 274 1450 31582 294 204 --
NM_005413chr24362 95 74 21 2102 43 383 54 34 --
NM_005417chr2061806 1568 755 261 250 138 21583 370 21752 1430 --
NM_005430chr1281039 949 844 800 415 406 308 237 31033 143 50 3823 388 151 --
NM_005433chr1812193 ----2322 161
NM_005436chr103657 323 244 12569 1864 23797 2509
NM_005437chr102390 118 --21278 220 --
NM_005438chr114248 123 116 51 ----161
NM_005439chr127497 462 390 171 132 73 57 1359 ----
NM_005458chr962232 1796 1705 950 464 31 11802 ----
NM_005465chr121634 356 11580 1796 1359
NM_005474chr17111542 1494 1408 1124 568 559 509 424 417 235 189 --31235 520 272 --
NM_005475chr1262995 2691 2148 2031 1301 205 13076 12200 1434
NM_005477chr1552109 1901 862 798 41 --22287 1045 --
NM_005477chr1552109 1901 862 798 41 --22287 1045 --
NM_005497chr1774936 4801 3733 1860 1639 1517 1011 1853 --13736
NM_005502chr962970 2495 2249 2179 2140 455 --1642 --
NM_005505chr122639 329 2792 91 2382 80 1689
NM_005515chr71186 --159 1624
NM_005522chr73379 313 247 11027 ----
NM_005536chr81312 ----140
NM_005578chr364795 4763 3872 3484 1735 461 21588 1458 24806 4780 --
NM_005581chr193350 339 135 --4391 107 100 93 --
NM_005596chr954960 2500 2464 2281 273 --34943 2190 995 1850
NM_005599chr131312 1037 336 1485 11046 --
NM_005602chr361145 853 495 228 166 90 --1158 21148 169
NM_005604chr651966 774 64 44 38 --4745 583 124 81 11969
NM_005605chr82223 213 ----1298
NM_005627chr61176 ----1945
NM_005639chr1221551 1495 ----11709
NM_005644chr11366 --2360 353 --
NM_005652chr16111200 1163 1119 1023 1015 1003 989 981 815 191 173 1915 11110 --
NM_005668chr534122 3849 763 --11392 --
NM_005669chr562232 2063 1965 1757 830 334 ------
NM_005677chr351404 1061 1042 287 53 21342 244 11510 --
NM_005678chr15--2887 764 2945 808 2999 131
NM_005686chr161547 1307 1245 1075 337 30 31251 1211 417 11136 --
NM_005725chr13884 670 550 21566 66 12357 --
NM_005730chr12133287 3244 3135 2950 2785 2355 1357 1152 684 654 507 424 46 --33459 3204 731 11087
NM_005731chr23356 265 109 ----1274
NM_005737chr252740 2718 1795 1000 466 --11834 --
NM_005746chr722524 2402 ----12699
NM_005754chr53899 174 160 ----1325
NM_005768chr123543 507 52 ----1521
NM_005779chr523632 433 1271 2849 28 --
NM_005789chr17122166 2147 1919 1575 1539 792 706 486 466 441 313 209 --31519 1512 303 11804
NM_005801chr17267 58 1198 1754 --
NM_005807chr12228 209 --1222 --
NM_005808chr341346 799 341 316 23413 589 --13379
NM_005814chr151092 936 98 90 71 1132 2285 50 --
NM_005819chr193437 3230 3193 1274 1090 493 468 391 130 23461 161 32482 812 29 --
NM_005828chr17114750 4030 3967 3872 1541 559 445 338 260 249 243 34593 3883 1322 54752 4153 3757 3731 1785 1586
NM_005840chrX106561 5495 5094 4761 1829 1437 1096 584 493 33 --76878 1831 916 591 576 531 464 --
NM_005843chr2189 1763 2458 91 11941
NM_005852chr1781121 1080 1044 988 855 353 197 178 2719 95 1276 --
NM_005853chr16------1370
NM_005871chr101882 ----1209
NM_005877chr2211590 2605 52 1162 1175
NM_005883chr1992944 2769 2544 2428 2421 1058 964 703 34 188 1297 22857 2219
NM_005885chr541563 1263 1073 76 --2168 31 11266
NM_005895chr1274038 3745 3217 2965 1088 654 402 42675 1668 1536 1356 22979 1299 --
NM_005898chr1141294 1065 417 252 --193 --
NM_005901chr18138303 8040 7644 7498 7402 7384 6845 5974 5566 3455 2864 2819 2227 1207 18305 28496 6296
NM_005909chr544253 3527 3250 2831 13222 23529 3324 13409
NM_005911chr23945 546 493 --1485 2345 22
NM_005920chr1163603 3508 3417 3156 3142 3086 3055 2717 2415 1464 1163 1153 979 224 83 68 33597 1132 837 63492 3225 2436 2422 1269 1139 12377
NM_005933chr11133047 2912 2834 2764 1951 1854 845 758 515 504 380 342 224 --62422 1953 1082 735 710 698 11857
NM_005934chr19122045 1969 1782 1727 944 926 504 479 244 170 147 76 32251 2157 1986 1740 --
NM_005935chr474608 3720 2118 1769 1528 815 650 11813 23926 883 --
NM_005937chr17133860 3648 3577 3415 3037 2578 1272 1193 943 827 516 295 202 33751 3535 1460 63845 3339 3130 2587 1108 1046 23418 1293
NM_005938chrX31313 1262 25 11319 11084 21292 278
NM_005941chr843590 3546 2945 256 21452 841 14193 --
NM_005943chr671713 1397 1144 514 397 108 60 3149 36 28 11244 --
NM_005955chr1105086 4563 3985 3873 2083 2037 1591 1378 1196 907 34361 2180 2098 13987 11381
NM_005957chr1123733 3562 3513 3168 1807 1525 1456 1189 1147 865 858 738 2122 102 54456 3219 3208 699 51 13416
NM_005964chr1721053 180 1612 21392 1047 --
NM_005967chr124558 457 115 104 3638 536 280 1273 --
NM_005996chr1221358 141 1347 11537 --
NM_006007chr974149 3733 2793 1766 520 212 100 13510 14136 --
NM_006015chr16912 355 225 175 162 21 --21246 128 --
NM_006016chr622067 1895 --11835 12070
NM_006030chr341248 1165 260 56 1103 --11251
NM_006034chr1162385 1958 1789 498 95 66 21911 737 2419 151 12377
NM_006036chr23977 845 130 --31962 1577 429 --
NM_006037chr244194 3002 1598 69 --33768 3092 1919 --
NM_006040chr162508 114 2970 924 31394 568 454 --
NM_006047chr2042744 2530 1316 633 --1920 --
NM_006048chr121212 499 --21214 422 --
NM_006054chr1131367 1012 151 --11422 1142
NM_006055chr222449 155 12322 --1426
NM_006079chr64605 301 290 71 ----1293
NM_006091chr1591716 1647 1552 1408 713 671 565 472 226 21752 636 41397 367 253 66 1497
NM_006094chr852387 2224 1558 932 809 ------
NM_006095chr443974 3005 2848 914 ----11180
NM_006096chr851563 1274 410 270 56 1279 11262 --
NM_006106chr1133273 2632 995 --21245 560 --
NM_006108chr1132306 730 267 21581 408 --11706
NM_006133chr1182273 2157 1731 1608 1590 1543 975 873 22164 373 42360 1935 977 965 --
NM_006136chr731174 1009 469 ----1370
NM_006148chr17152955 2868 2611 2257 2207 2125 2070 972 926 608 553 543 329 317 180 2892 417 32651 2598 198 22576 782
NM_006160chr1791576 1257 1234 1040 626 460 340 256 215 2299 242 3395 328 229 21444 193
NM_006167chr832032 854 346 146 1948 22173 204
NM_006176chr113724 75 54 1149 1592 1603
NM_006180chr941782 843 285 227 --1782 --
NM_006185chr114478 229 75 61 1555 1659 --
NM_006191chr126788 766 716 119 85 44 1140 ----
NM_006194chr1421313 39 2931 61 ----
NM_006195chr941399 990 516 21 ------
NM_006197chr821766 1581 --2217 139 1248
NM_006201chrX51093 880 866 134 81 ----11100
NM_006202chr19161888 1832 1820 1687 1649 1407 1286 1244 793 601 363 103 70 57 49 37 1780 41390 164 157 27 1379
NM_006203chr534198 3792 2202 25439 5344 11272 --
NM_006206chr422238 713 1916 2715 450 --
NM_006216chr22456 447 ----1450
NM_006224chr1761966 1617 872 864 499 225 --12141 1310
NM_006237chr1372146 2114 855 697 547 81 67 21510 181 2738 699 2550 145
NM_006241chr332421 2176 786 ----22393 621
NM_006243chr15896 796 737 661 362 --1729 --
NM_006245chr65973 388 374 344 171 1266 1178 --
NM_006251chr543185 1035 798 493 --33172 1167 600 13188
NM_006252chr176326 6310 6253 6243 2561 1540 663 --26177 2643 25346 2462
NM_006268chr1161028 982 855 370 323 77 151 21107 87 --
NM_006275chr2022274 191 --22486 2377 --
NM_006282chr2054714 3140 1538 1375 546 1403 13410 44641 3428 1541 319
NM_006283chr8144891 4372 4059 3568 1862 1368 1285 1075 847 554 491 362 322 258 14078 24417 243 --
NM_006300chr1932285 285 217 1410 ----
NM_006306chrX105923 4611 4575 4417 4398 3949 1529 1464 909 727 152 2267 84 --
NM_006315chr4124490 4219 3700 3370 1392 1350 1186 996 857 575 312 226 23566 207 23632 1002 1814
NM_006321chr341631 1619 1524 51 11422 2878 235 --
NM_006328chr114627 589 471 255 2583 139 1233 --
NM_006336chr931348 1335 1233 21127 535 11241 11388
NM_006352chr131557 1290 1278 --2388 336 --
NM_006358chr223870 412 363 1377 3452 75 51 --
NM_006361chr1751746 1641 1293 768 150 --31295 745 572 --
NM_006367chr14963 824 784 82 --1965 --
NM_006371chr3105211 5036 4820 3476 1127 817 668 574 64 26 35145 4623 596 1776 --
NM_006373chr1761262 983 450 314 146 112 --31085 358 271 --
NM_006380chr1753546 3280 1695 966 33 21196 1124 11412 --
NM_006386chr2262242 1980 1686 612 545 75 --42233 1779 639 128 1289
NM_006389chr1171061 1009 896 879 855 237 212 41129 548 541 414 2503 401 2899 44
NM_006390chr1251498 1489 1340 662 549 11392 1157 --
NM_006393chr1054272 3982 870 747 580 ------
NM_006411chr65405 270 121 102 23 --2876 44 --
NM_006434chr1031290 777 436 2540 516 1265 --
NM_006449chr252127 2040 1734 1546 467 21580 1485 --11704
NM_006454chr482860 2844 2008 1078 945 803 206 65 22601 2076 11987 --
NM_006457chr483948 3939 3220 3119 2863 2704 1523 1057 1935 ----
NM_006459chr1051647 756 633 360 23 1515 11535 --
NM_006460chr1741175 297 173 124 ------
NM_006464chr2134493 4054 3770 3283 2991 2871 1759 1743 1611 1592 963 261 100 11563 31622 1167 294 --
NM_006465chr15102268 2177 1997 1768 1425 831 777 594 377 356 2553 282 32143 424 358 32005 804 272
NM_006469chr121407 286 1294 --1336
NM_006488chr24621 286 227 212 2306 149 162 --
NM_006517chrX61497 599 582 575 216 30 --41971 627 182 42 --
NM_006521chrX31282 76 31 41224 511 356 194 --21106 79
NM_006532chr1962068 1772 827 588 425 241 ----1577
NM_006538chr274077 3472 2932 1016 730 536 528 23007 2925 22620 312 13475
NM_006544chr1456121 5687 5297 2014 433 --1211 --
NM_006546chr17226621 6225 6217 6002 5995 5952 5794 5779 5217 5159 5065 4557 4379 4153 4118 2658 2504 2185 1420 959 785 65 36019 5912 768 116519 6277 5959 4390 4351 4215 2645 2152 1683 1550 424 25797 749
NM_006547chr732075 1743 276 ----21872 330
NM_006555chr741962 1893 1723 1717 ------
NM_006559chr121134 129 164 1138 --
NM_006561chr10145924 5493 5120 4979 4903 4736 4422 4338 4275 2252 2213 2011 1530 167 25003 4283 14266 --
NM_006593chr24753 745 270 90 167 1282 --
NM_006595chr1132040 1888 434 11897 31907 1354 441 --
NM_006599chr16107416 7403 5565 5153 5142 2561 2505 1080 843 773 --77547 7390 5731 2578 1760 1154 1082 11044
NM_006603chrX--11816 --1442
NM_006618chr121594 430 ----11485
NM_006621chr151698 1597 480 210 94 31609 1445 244 --1603
NM_006624chr1041388 851 577 171 --11601 --
NM_006626chr961791 1681 985 791 254 91 --11047 --
NM_006628chr1543956 3540 3192 46 34247 4222 4021 11176 --
NM_006629chr182882 324 12458 ----
NM_006640chr17111830 1561 1195 716 705 567 434 410 159 97 52 1115 ----
NM_006650chr593906 3781 3642 3253 2532 2517 884 706 125 63608 3412 3317 1065 594 158 2304 142 1235
NM_006651chr451476 557 427 56 44 2963 150 11300 --
NM_006654chr1274132 3553 3127 3034 1279 1090 780 23540 1214 64774 4168 4134 3199 1857 1845 21237 1177
NM_006690chr2072198 1641 937 539 464 433 52 5930 789 563 487 403 12285 11988
NM_006694chr11110 1261 3362 283 272 1118
NM_006699chr132359 1971 455 1578 2399 129 --
NM_006708chr651085 993 387 305 258 --1130 --
NM_006717chr943298 3065 2286 1163 12166 22277 306 12289
NM_006720chr1094935 4869 4547 3833 3547 3421 3125 1859 720 11445 --11489
NM_006729chrX84987 4870 4436 4336 4051 2198 1037 170 15455 24898 926 --
NM_006736chr271762 1510 742 616 527 129 117 --21436 131 --
NM_006742chr1671713 1457 1411 1318 781 318 222 21792 810 21781 440 31497 425 339
NM_006750chr16117520 7159 6736 5569 3163 3100 2066 1750 1744 1722 578 36059 3153 1999 48001 7522 7305 372 11807
NM_006751chr24826 748 333 171 --1335 --
NM_006761chr174736 713 700 45 1629 2727 707 --
NM_006766chr832625 618 604 1658 22653 371 1448
NM_006772chr6121700 1693 1680 1559 1325 1207 1073 668 588 561 458 433 11222 51647 1579 1310 676 322 11409
NM_006777chrX32873 2690 548 12651 22837 355 12693
NM_006795chr1191573 1449 1384 1244 1096 486 467 266 112 --41409 1120 566 523 --
NM_006801chr193574 517 75 ----1549
NM_006802chr14980 398 289 45 11143 --2375 71
NM_006814chr2072440 971 832 569 400 241 42 1686 32252 2134 34 --
NM_006823chr821341 181 ----1869
NM_006825chr124954 831 104 71 183 1961 --
NM_006827chr1463036 2590 2262 924 309 22 1827 22870 2238 23201 349
NM_006851chr1242805 2406 2082 381 1407 ----
NM_006852chr1752865 2566 2363 691 138 --32481 1144 591 22227 726
NM_006856chr1241158 874 765 75 1225 1363 11050
NM_006861chr124545 220 202 69 145 31313 571 152 --
NM_006875chrX5884 799 769 755 187 --1215 --
NM_006884chr331820 133 76 1141 21407 1344 --
NM_006885chr1653113 2935 2819 1514 156 11128 43442 2821 1365 1042 23513 1106
NM_006888chr1473298 3206 3175 3129 2713 2384 997 1195 2999 27 --
NM_006915chrX51816 1652 991 350 40 ------
NM_006922chr2------12600
NM_006924chr1764028 3780 2964 2807 161 138 11338 43766 3756 991 700 --
NM_006931chr1241580 1574 429 24 152 21664 291 1355
NM_006937chr171561 1143 1135 --
NM_006943chr20163306 3297 2901 2842 2827 2814 2623 1034 668 459 376 309 204 163 137 101 33059 979 742 22816 847 --
NM_006950chrX5866 169 133 111 103 1731 --2620 298
NM_006965chr1851168 937 379 268 97 --11152 --
NM_006990chr192155 1965 1780 1622 660 450 331 183 128 --21878 239 22083 164
NM_006999chr51596 128 --1401
NM_007007chr1234332 3249 2950 11102 --13252
NM_007011chr15145359 4743 4646 2715 1998 1439 1241 1086 643 578 357 303 207 54 54179 2378 1113 86 77 55848 4581 4539 1890 1560 12658
NM_007038chr2186053 4198 2330 2237 1281 425 299 233 --1401 23831 2240
NM_007040chr194889 348 146 128 3936 724 364 2991 166 3911 423 46
NM_007042chr342542 2314 2297 445 12497 11944 --
NM_007050chr20198048 5940 5749 5734 5132 5046 3231 3136 3127 3113 2791 2733 2375 1730 1505 753 541 385 372 87779 7146 6667 5605 5075 2825 1427 620 15048 13116
NM_007054chr553517 3195 3027 2746 1042 1878 13607 --
NM_007067chr1741437 1081 604 125 31535 1296 1123 11209 --
NM_007078chr1041975 494 399 303 1939 ----
NM_007106chr1362726 2628 2431 2402 2166 387 ----12169
NM_007144chr1741128 484 472 371 ----190
NM_007146chr1742637 1097 559 141 1939 32789 2669 380 12189
NM_007158chr141191 146 89 77 --11116 --
NM_007170chr13915 785 86 1275 --1343
NM_007172chr2262284 1325 1124 707 318 187 ----12294
NM_007174chr1221843 806 41555 1527 950 787 1695 1631
NM_007185chr121099 198 2435 343 3809 682 221 --
NM_007192chr1421113 1001 1415 --137
NM_007195chr1883196 3149 3132 2994 2949 1271 918 820 21407 1018 --1901
NM_007202chr174772 684 611 56 --2648 605 --
NM_007203chr973644 3153 557 487 438 424 176 22860 2561 --23352 1384
NM_007212chr13909 626 358 --2418 154 2832 258
NM_007222chr831729 1682 1409 ----11732
NM_007224chr123636 498 467 ----1507
NM_007236chr1531715 437 59 1256 32394 376 94 21582 101
NM_007249chr13218983 8971 8946 8147 8016 7965 7881 7549 6959 6861 6805 6628 6211 6021 2793 2596 2079 1354 1289 1200 75 1396 67410 7271 5822 5752 2673 2081 35760 2822 2599
NM_007286chr582026 1941 1393 816 748 693 472 234 21318 664 2722 288 --
NM_007294chr1751278 1053 998 386 195 ------
NM_007295chr1751278 1053 998 386 195 ------
NM_007296chr1751278 1053 998 386 195 ------
NM_007297chr1751278 1053 998 386 195 ------
NM_007298chr1751278 1053 998 386 195 ------
NM_007299chr1751278 1053 998 386 195 ------
NM_007300chr1751278 1053 998 386 195 ------
NM_007302chr1751278 1053 998 386 195 ------
NM_007303chr1751278 1053 998 386 195 ------
NM_007304chr1751278 1053 998 386 195 ------
NM_007305chr1751278 1053 998 386 195 ------
NM_007313chr961877 1712 1583 603 416 386 --21332 202 --
NM_007350chr1264086 3552 3417 3257 1732 1616 ----23555 1735
NM_007358chr111655 ----21821 1658
NM_007365chr13708 586 43 32046 487 56 2843 729 21918 657
NM_007373chr10----21779 381 11156
NM_007375chr142362 1082 492 290 12040 ----
NM_012069chrX52549 1927 624 273 230 --2403 232 --
NM_012074chr148814 768 729 158 150 129 108 39 --3955 824 110 --
NM_012081chr53289 191 161 12649 ----
NM_012083chr103947 541 240 21261 1147 11091 --
NM_012102chr142156 923 269 204 1221 22399 2250 --
NM_012104chr11113388 3367 3225 3163 3082 2398 1427 1034 1021 432 320 22643 1391 21445 33 21430 1024
NM_012104chr11113388 3367 3225 3163 3082 2398 1427 1034 1021 432 320 22643 1391 21445 33 21430 1024
NM_012137chr152743 2378 624 435 171 --11931 --
NM_012141chr1353701 3055 1142 1100 287 11497 --2290 247
NM_012156chr20103065 2412 2173 721 672 663 657 463 406 81 23373 581 73046 2825 2509 2378 1273 735 357 1743
NM_012164chr9106691 6676 6082 5809 5692 2312 1665 1545 1328 448 36325 6254 4571 25396 1146 36510 5285 2043
NM_012166chr961314 1020 456 444 96 90 --21463 425 --
NM_012193chr1184617 4370 4032 3692 3352 1865 1816 684 24997 3579 35152 4634 333 24730 4422
NM_012199chr1174520 4450 4114 3599 2956 2929 2899 1870 1787 1647 1478 1440 1075 939 783 670 636 43831 3131 605 216 54080 4055 1529 1153 1085 --
NM_012210chr94966 352 170 46 11255 --11228
NM_012214chr254519 3952 2422 2167 858 1154 ----
NM_012218chr1941927 1060 717 274 ----21078 593
NM_012219chr362659 2504 1144 567 388 186 22518 2379 23036 278 12395
NM_012232chr1782033 1849 1797 1622 1456 334 50 31 --41894 1887 1806 323 --
NM_012244chr1451505 1317 1164 574 290 31497 1431 1192 51658 1633 498 346 35 11649
NM_012249chr243225 2229 1113 384 33326 2459 2275 ----
NM_012252chr784501 4245 3745 3719 1004 923 730 461 14577 14503 --
NM_012257chr71171 ----1872
NM_012262chr184299 4251 3711 3368 2061 1939 1286 775 14311 14879 14254
NM_012279chr5111875 1594 1585 1527 1361 807 577 327 278 178 77 1751 1744 31364 500 272
NM_012287chr351691 1340 1318 1247 443 1766 1553 1345
NM_012288chr6115441 4670 4189 3638 2030 2008 1912 1823 865 173 82 34953 4898 441 74522 4153 3935 2229 2019 1257 226 34683 2011 1243
NM_012294chr753890 3053 2927 192 22 ------
NM_012296chr1193360 3247 3192 2714 2489 1529 1471 857 61 43433 2848 2629 850 3398 160 86 13378
NM_012297chr442083 1679 806 427 --11837 22086 167
NM_012300chr52478 213 1691 12075 1250
NM_012301chr72609 215 --31772 1549 317 --
NM_012306chr12133539 3421 3126 3056 2409 2403 2294 2276 1227 840 434 60 53 53520 2922 2263 1161 28 1374 --
NM_012308chr11101673 872 642 586 576 471 350 195 139 109 4971 911 548 459 2804 42 --
NM_012309chr11114170 3975 3816 3800 3209 1983 1410 1168 608 497 445 14088 21501 1400 44196 3372 1171 600
NM_012316chr1165352 4493 3879 3793 1922 1676 1642 1315 1283 1101 981 943 745 697 381 155 12207 33689 3560 903 13796
NM_012334chr533968 3425 1582 13080 2440 360 --
NM_012395chr773121 3002 2810 2315 2108 1165 310 --32355 2293 312 12336
NM_012398chr1992920 2761 2649 2512 2289 2018 1894 847 131 42843 2326 2281 737 32784 2542 2372 --
NM_012399chr2251529 1445 1364 308 129 11552 ----
NM_012416chr94437 247 134 124 --2820 98 1250
NM_012448chr1782553 2167 2057 2042 1570 1021 731 690 21840 550 2543 241 --
NM_012464chr432362 2026 1171 ------
NM_012473chr225674 555 239 89 26 --1219 1266
NM_012478chr173929 678 270 3346 327 233 3835 297 101 1681
NM_012479chr752706 1929 939 792 60 12209 ----
NM_013229chr1262667 1113 977 679 439 168 ------
NM_013231chr1453198 1532 1446 1125 701 23439 1155 33302 3237 1200 11535
NM_013245chr163723 648 262 --2226 120 1290
NM_013253chr1141386 958 353 177 1166 1120 155
NM_013261chr452922 2875 2773 100 65 11416 ----
NM_013269chr1254290 3997 3965 3459 1460 34299 4284 3512 14242 24264 200
NM_013279chr11102140 2096 2043 1844 1697 1641 815 517 500 372 1929 42220 1621 612 361 --
NM_013293chr72611 38 ----176
NM_013313chr2283378 2525 2301 2264 964 882 167 21 12551 13513 13414
NM_013341chr232794 2656 2020 22562 1130 12022 --
NM_013354chr851354 375 358 318 77 --1101 --
NM_013372chr1553179 2806 2280 1081 464 1949 1472 --
NM_013374chr342516 2393 2033 803 --12035 1850
NM_013382chr14112099 2059 2021 1775 1769 1752 1604 873 727 562 241 ----22119 1632
NM_013399chr1651794 1522 1246 80 25 1119 1352 --
NM_013403chr195812 761 743 650 162 1182 2763 247 1152
NM_013411chr192481 2241 1987 1812 1750 1733 1716 915 601 12752 21850 607 --
NM_013433chr1961930 1924 1430 1347 1332 142 11257 41948 1932 1878 477 --
NM_013434chr291939 1722 1644 1298 606 587 452 442 398 --21742 696 --
NM_013434chr291939 1722 1644 1298 606 587 452 442 398 --21742 696 --
NM_013438chr9--1642 11298 11607
NM_013444chrX5234 225 211 186 158 ----21002 174
NM_013449chr12112718 2262 2133 1131 727 657 557 533 343 337 37 22117 834 72376 2006 1991 627 324 183 176 21103 646
NM_013450chr231047 355 349 --21049 357 --
NM_013952chr262090 1034 789 771 663 629 3698 583 275 32382 930 516 --
NM_013953chr262090 1034 789 771 663 629 3698 583 275 32382 930 516 --
NM_013989chr1464940 4926 4630 4546 3920 1454 1611 54538 3979 3368 1272 1076 --
NM_013992chr262090 1034 789 771 663 629 3698 583 275 32382 930 516 --
NM_013993chr62821 204 127 3525 177 95 --
NM_013994chr62821 204 127 3525 177 95 --
NM_013999chr1791098 1053 969 519 400 379 365 243 154 21288 126 --11106
NM_014000chr1081809 1751 1440 1415 634 612 501 339 --1355 --
NM_014005chr592498 2458 2100 1965 1943 1211 824 655 635 ----1397
NM_014015chr164699 161 136 28 1119 121 --
NM_014021chr162954 2328 2221 1206 281 130 --11320 1141
NM_014030chr1791140 1123 986 870 811 479 416 245 227 2748 208 1860 --
NM_014034chr641131 979 260 58 1972 ----
NM_014057chr951523 1354 1319 1113 435 --1503 --
NM_014079chr32725 712 2348 86 --1335
NM_014089chr131121 --1852 11449
NM_014106chr1532129 2039 675 ----21922 939
NM_014112chr854815 4764 4327 904 130 --14739 --
NM_014117chr1692363 2321 2264 2241 1783 1053 1044 1036 95 --22271 1944 12324
NM_014141chr7105207 5053 4714 4204 4193 3928 3903 3634 3502 209 24849 3857 ----
NM_014155chr1175675 5510 2283 1490 1353 403 143 --11074 12118
NM_014157chr1673321 2797 1435 1343 981 793 89 33934 3270 3179 32998 1273 628 1547
NM_014182chr124624 472 129 81 1245 1727 --
NM_014186chr1172245 2163 1719 575 509 177 61 12129 ----
NM_014189chr461498 1369 1260 347 240 126 --21009 390 --
NM_014190chr481850 1721 1612 699 592 478 76 63 --21361 742 --
NM_014217chr161857 1577 531 525 279 269 ----1580
NM_014223chr13599 510 163 --179 1640
NM_014231chr1281948 1843 1712 1613 1604 639 235 118 41805 167 99 85 31956 1487 133 1269
NM_014232chr17121620 1213 1151 1031 437 423 405 341 279 251 134 97 144 31495 413 384 31637 363 63
NM_014232chr17121620 1213 1151 1031 437 423 405 341 279 251 134 97 144 31495 413 384 31637 363 63
NM_014233chr1742174 1372 527 48 31636 223 110 31725 1528 75 --
NM_014238chr1741707 1371 570 247 --139 --
NM_014240chr384086 3364 2665 1140 369 307 299 223 --2636 447 12782
NM_014246chr2242322 2270 2159 2028 12122 --1157
NM_014263chr1021311 1179 11252 185 --
NM_014275chr55892 810 783 740 567 1754 1827 --
NM_014282chr971226 1121 919 286 190 164 109 ------
NM_014284chr14773 407 318 66 1823 21038 106 1842
NM_014289chrX31258 354 123 21245 142 11183 --
NM_014292chr2291758 1613 1578 1345 1229 550 500 274 94 21798 1496 21782 1231 --
NM_014293chr22194005 3999 3794 3738 3722 3522 3407 3366 3279 3230 3163 1364 1048 767 659 563 541 487 183 21386 397 6580 570 422 133 99 69 12749
NM_014299chr194832 399 143 122 11762 2653 434 1714
NM_014309chr22165187 5136 5071 4710 4493 4458 4369 4118 3633 3582 2033 1552 939 817 611 588 25087 1286 54922 3898 3467 1863 600 34976 3636 942
NM_014323chr223408 382 147 ----1163
NM_014331chr486061 5855 5843 5389 5160 3005 2503 2177 --47537 6460 5162 504 12234
NM_014333chr1142661 1004 850 442 21990 396 2359 336 --
NM_014342chr111190 --11324 11482
NM_014345chr65953 947 937 907 172 --1179 1276
NM_014368chr951613 371 269 210 163 --1165 1374
NM_014376chr582196 2172 1791 768 580 346 300 195 1171 32253 491 259 1522
NM_014381chr1462109 1205 1000 485 464 456 ----1172
NM_014388chr195862 4989 4803 4187 4150 4121 3935 3846 3685 24876 1167 56032 3866 3742 3707 3687 25805 4391
NM_014393chr83947 731 220 --1371 21716 734
NM_014397chr921437 1424 1122 --1331
NM_014400chr192344 23 3446 415 124 125 --
NM_014423chr554687 1654 1134 115 34 13994 11003 --
NM_014431chr102461 22 1323 1361 21598 114
NM_014445chr352206 1938 1820 1582 31 ------
NM_014458chr121180 32 --21274 256 21282 883
NM_014478chr72484 371 ----1270
NM_014494chr161390 21912 958 32074 2053 315 1135
NM_014504chr752171 770 602 277 251 --1253 1773
NM_014521chr221742 603 1159 --21693 1668
NM_014554chr1252017 1675 1606 1448 1411 --12295 1554
NM_014563chrX41810 1392 688 357 ----11813
NM_014587chr1651509 1472 1189 263 196 --21254 432 --
NM_014591chr1051079 1047 892 387 374 21284 289 --2377 350
NM_014604chr173636 539 152 ----1159
NM_014606chr4101259 1120 1114 1031 962 465 401 332 37 27 ------
NM_014607chr232064 827 514 --21953 829 2620 517
NM_014613chr592696 2676 2133 1934 976 950 705 435 22 --22310 1908 --
NM_014630chr1593855 3820 3458 3072 973 927 555 532 473 43435 3278 2506 160 23202 984 22910 558
NM_014634chr2273580 3515 3202 2728 643 439 27 33624 3093 56 21108 33 22417 121
NM_014636chr984141 3495 3137 3113 2875 2714 980 667 21101 845 51730 1366 1359 837 650 --
NM_014646chr18102999 2945 2491 2219 2116 861 645 240 137 37 197 12493 --
NM_014647chr1642156 1571 1556 713 11447 ----
NM_014653chr1272063 1733 1702 1575 1321 541 116 11495 1212 21578 1504
NM_014661chr1073752 3296 1550 1397 515 358 297 1507 ----
NM_014665chr8113689 3516 3501 3315 3292 2372 1218 466 363 184 154 22757 2471 --12444
NM_014671chr721613 509 --1135 1579
NM_014674chr343507 3256 3205 1503 --43184 3177 3165 642 --
NM_014676chr111413 2443 134 --125
NM_014677chr811011 --21058 1035 --
NM_014682chr812271 ----2541 143
NM_014690chr7132829 2755 2739 2252 2070 2061 1169 1136 941 820 435 415 68 53048 2865 2761 1988 1067 12246 12341
NM_014702chr653106 2954 2725 2565 2463 ----13109
NM_014711chr1641502 429 159 36 ----1432
NM_014721chr6117492 7227 6942 6312 5229 4707 2175 1940 1282 882 538 14512 25764 5338 15188
NM_014726chr1761252 1008 286 210 155 31 11154 --1495
NM_014730chr12185050 4769 4222 3948 3733 3647 3540 3429 3323 1926 1511 1483 1475 1443 925 894 627 243 23838 2047 43745 3679 1313 814 24869 4448
NM_014730chr12185050 4769 4222 3948 3733 3647 3540 3429 3323 1926 1511 1483 1475 1443 925 894 627 243 23838 2047 43745 3679 1313 814 24869 4448
NM_014731chr2071802 1443 1251 701 497 480 65 41481 1423 578 86 21355 144 --
NM_014735chrX62123 1665 1507 1449 766 439 11456 --11668
NM_014739chr664011 2740 2731 1636 1142 337 12654 21539 1096 14014
NM_014742chr2081645 1448 1254 1119 680 567 473 399 2706 588 3576 569 258 21472 1188
NM_014743chr4103058 2615 2305 2010 1178 1114 610 421 194 100 ----1613
NM_014747chr1245757 5417 5383 5286 5141 5122 4919 4887 4438 4107 4004 3968 3959 3734 3647 2104 2050 1465 1227 1024 901 720 485 63 13726 44931 4440 4118 3691 --
NM_014751chr842147 2092 778 243 1848 --2769 397
NM_014755chr294123 2876 1526 1299 1287 1237 1003 211 67 11565 33047 1545 1528 14126
NM_014757chr591955 1801 1645 1636 1620 950 831 714 618 21835 1722 1750 11763
NM_014761chr164747 305 137 70 21059 160 1284 --
NM_014765chr142532 719 544 173 --1721 12078
NM_014766chr763523 3399 1255 792 398 173 12832 21267 21 1401
NM_014767chr10132842 2746 2650 2620 2534 2326 1373 1166 1082 1067 1040 583 446 31401 407 394 43556 2250 1286 490 11334
NM_014770chr1231023 994 180 41152 1103 1042 967 ----
NM_014772chr18123579 3436 3129 2841 2803 2633 2211 925 822 605 288 268 23357 311 22734 2218 --
NM_014774chr153025 2797 2203 2080 839 3867 594 94 --2954 729
NM_014776chr1222383 418 21062 771 12624 12645
NM_014784chr18976 805 738 432 399 202 95 39 1814 2388 204 --
NM_014798chr1771791 1402 653 401 196 185 109 21797 1745 21692 1510 11281
NM_014800chr761156 882 458 329 200 126 --1465 --
NM_014803chr101298 2833 647 1355 --
NM_014807chr113617 600 53 3717 265 45 ----
NM_014810chr122649 1415 --32816 2609 2585 1890
NM_014812chr141934 1754 1588 286 11608 11323 --
NM_014824chr1151530 1396 501 212 154 ------
NM_014826chr163783 2784 1374 1102 733 395 23657 1291 21424 73 --
NM_014830chr12123541 3406 2802 2653 2580 2483 2475 2401 927 734 498 75 1305 33670 2623 1574 33843 3433 2880
NM_014836chr10--1528 --1132
NM_014839chr13924 881 384 11823 ----
NM_014840chr1231261 1091 418 12364 12298 21264 1148
NM_014849chr141262 989 308 232 1346 4890 356 280 64 11174
NM_014850chr3134436 4282 4042 3496 3489 3479 3471 1612 1592 1344 1319 317 259 24332 545 34700 1325 292 --
NM_014868chr124787 318 56 26 ----159
NM_014869chr361240 1185 996 369 225 211 --1213 --
NM_014873chr161609 1307 1176 474 370 139 --11727 11841
NM_014876chr223764 297 21 193 21603 116 --
NM_014877chr1767003 6009 2556 2050 909 96 --1903 --
NM_014888chr71225 ----11502
NM_014893chrY2749 28 11799 1882 --
NM_014897chr1783079 2568 2292 2080 1101 338 100 25 1924 --13082
NM_014901chr592027 1405 752 713 566 492 284 261 199 1325 --11891
NM_014902chr2061136 573 468 408 248 170 --11528 1417
NM_014903chr1252394 2112 2072 376 325 1522 ----
NM_014904chr1043302 2973 327 115 33170 1449 1236 --23158 755
NM_014906chr1721465 1016 53375 1503 1372 453 35 --11019
NM_014909chr1483962 3730 3226 3072 2940 2772 2569 464 33831 2660 413 23943 3196 13168
NM_014913chr182420 288 ----11183
NM_014914chr22124 98 2234 176 1405 --
NM_014920chr653240 2418 1341 955 52 1641 12534 155
NM_014921chr19162964 2936 2896 2829 2739 2665 1062 1020 881 873 848 816 521 317 201 146 2891 325 52841 2478 2027 617 505 12868
NM_014924chr1442239 1099 839 615 13142 2984 309 2618 51
NM_014925chr124655 365 207 184 1765 1810 --
NM_014932chr311339 ----1712
NM_014935chr173744 2816 2785 1502 1243 918 359 12372 63823 3465 2438 1349 1166 861 --
NM_014938chr1252016 814 718 401 48 1601 31936 1682 497 --
NM_014944chr141412 1114 1075 292 21324 1121 --161
NM_014945chr582008 1285 1237 1225 692 644 618 442 --1698 --
NM_014947chr142596 2397 1018 205 --1527 --
NM_014952chr1572027 1983 1800 1374 831 550 386 11483 3586 449 246 --
NM_014962chr202308 275 ----22544 952
NM_014963chr193435 228 85 2468 425 2418 48 --
NM_014974chr1051434 1413 1367 709 52 11477 11308 --
NM_014978chr1031322 412 298 ----1381
NM_014982chr14104323 3592 2141 2127 1783 1374 1107 806 665 34 --33754 1136 36 --
NM_014988chr462185 2164 2065 1143 979 54 11137 ----
NM_014989chr652026 1293 619 563 395 --11356 --
NM_014991chr442375 2248 2145 54 1536 1255 --
NM_014994chr1572210 1471 886 784 766 660 178 21956 792 3838 631 468 1518
NM_014996chr331003 185 126 1846 2210 147 --
NM_014997chr751939 1872 1108 246 179 11950 22893 209 --
NM_015000chr1253088 2410 2261 2221 1910 ----12124
NM_015001chr13724 270 166 ----1929
NM_015002chr1242162 1703 673 660 21665 170 1343 1797
NM_015008chr393141 3082 2815 2763 1433 1049 962 418 26 22319 630 ----
NM_015020chr1652386 1388 1219 1190 211 12798 11133 13704
NM_015023chr1141693 1637 1555 1544 1522 1449 1231 1220 1214 1136 678 508 460 196 21244 93 51674 1425 1150 1128 116 --
NM_015024chr841376 1336 269 105 2976 149 --11125
NM_015025chr211757 1900 11007 12199
NM_015026chr1234565 1485 955 --44743 4542 4470 3528 1958
NM_015027chr1661985 1784 1502 1240 673 228 ----1633
NM_015032chr1342588 978 897 518 ----11949
NM_015033chr992676 2424 2412 2157 1062 859 799 395 250 --22695 505 --
NM_015039chr1124112 1523 1428 1009 901 398 359 320 196 164 105 80 33854 3261 283 1590 14115
NM_015042chr15214296 4279 4262 4252 4058 3847 3718 3608 3443 3109 2837 2828 2805 1742 1481 1117 1082 880 851 489 198 41435 1361 833 342 63661 3643 1490 962 858 609 --
NM_015044chr1652990 2675 2625 2492 2006 --12067 --
NM_015049chr243186 2952 2764 2051 --22553 497 --
NM_015051chr963377 2851 1341 1122 971 786 --22809 144 1981
NM_015057chr13--149 --1185
NM_015063chr196938 383 294 194 141 129 21351 878 4501 217 188 87 1391
NM_015064chr1282718 2251 2225 1086 1050 1038 821 141 11408 22730 1321 23112 991
NM_015068chr743874 1439 1316 1103 ----1647
NM_015071chr595166 4497 4321 4152 2315 2286 2167 1079 901 14788 2791 655 21071 997
NM_015074chr1124748 3797 3714 3677 3418 3386 3145 3128 1911 1669 1451 150 24590 158 33716 561 121 13154
NM_015075chrX72093 1760 1598 1571 856 820 809 11730 12246 1361
NM_015076chr664318 2960 2842 1077 910 215 23207 3183 --1202
NM_015080chr116621 402 373 223 98 72 1920 1176 --
NM_015082chr562504 1872 1650 788 679 437 11851 22093 484 12399
NM_015085chr17144190 3790 3344 3252 3001 1699 1377 1015 851 833 773 613 242 40 33643 1462 1106 84119 4069 3474 3395 1656 1390 1219 252 --
NM_015086chr1261588 1458 1231 1170 1003 556 169 1558 21050 957
NM_015087chr1362671 2554 2306 2053 432 79 11833 --12254
NM_015090chr1115911 5892 5753 5710 5435 4717 2088 1557 1383 1126 598 35870 5209 5200 44847 758 462 387 12100
NM_015092chr1684360 3543 3195 2838 1840 990 657 649 12847 33818 992 678 13623
NM_015094chr22134154 3942 3934 3146 2867 1590 1312 1126 1117 816 741 608 481 44335 3478 1858 1519 24323 1119 13605
NM_015097chr321522 110 12309 22294 1475 --
NM_015100chr15828 737 614 155 132 21721 1608 41350 750 631 363 21567 806
NM_015107chrX112442 1883 1865 1657 1632 1591 1495 319 209 172 48 2873 178 11885 1465
NM_015125chr194449 211 168 82 2524 218 2504 157 1375
NM_015133chr1641426 1352 1122 235 --11310 11365
NM_015138chr1542600 822 477 199 3794 205 187 161 12585
NM_015141chr32842 226 11826 1574 --
NM_015143chr431276 560 221 1568 ----
NM_015144chr1653341 2514 1077 380 285 1958 1660 13789
NM_015155chr1022330 904 2853 62 2976 156 12333
NM_015156chr1493632 3429 3154 2994 2625 858 627 576 285 11567 1636 1177
NM_015157chr1161101 775 448 442 321 260 ----1928
NM_015171chr161416 2148 78 --1112
NM_015176chr11165 ----11311
NM_015185chrX102632 2387 2211 960 942 845 557 382 317 311 --32741 2323 515 22472 2452
NM_015191chr1132025 1048 101 1552 1169 11051
NM_015200chr41593 11864 31993 710 235 1245
NM_015202chr1671707 1390 1366 1154 496 209 28 177 ----
NM_015205chr13134416 4123 3972 1415 1282 1250 1221 1192 1163 1142 764 704 38 13722 14086 1422
NM_015208chr1833718 2894 1363 ----1943
NM_015209chr172275 2095 1958 537 475 377 184 21501 1477 1369 --
NM_015215chr13781 308 139 12294 13212 --
NM_015219chr1772232 635 568 515 351 228 210 2531 388 32318 1645 517 1176
NM_015225chr963103 2985 2650 1935 842 424 12031 1439 --
NM_015235chr1031987 1877 107 12010 1109 --
NM_015236chr411275 --2230 202 1986
NM_015245chr672575 2331 2130 2059 2039 1059 766 --22261 1754 --
NM_015250chr941859 1594 386 254 1159 263 57 --
NM_015252chr21606 2867 27 2325 154 --
NM_015254chr872785 2765 2743 932 722 633 496 1100 22493 408 --
NM_015264chr22104547 4373 4313 3919 1500 1305 888 828 503 366 33644 1571 1108 33590 1807 193 11253
NM_015270chr1292246 2030 1672 1640 1481 933 533 394 351 1514 32223 396 244 11543
NM_015271chr424350 1680 --32923 2860 1009 11683
NM_015272chr1641853 1681 516 225 --1187 11931
NM_015278chr633253 2357 1362 21345 170 --174
NM_015282chr242687 2505 2038 664 --2931 411 22489 66
NM_015284chr182103 2028 1933 1906 1761 1675 1623 1534 21586 567 12092 --
NM_015288chr5113662 2800 2752 1318 1133 1113 992 706 639 175 40 33297 2582 1154 43392 2837 2599 1077 --
NM_015299chr14123816 3793 3747 3714 3592 3301 3271 1594 1360 1319 370 76 23919 3447 23781 3287 --
NM_015305chr14101749 1421 1288 387 290 263 156 139 132 110 --31981 1290 120 --
NM_015310chr8177959 7836 7790 7155 6989 6870 6754 6257 6228 5474 3233 3002 2738 2732 2492 2112 1233 --37225 1717 1517 --
NM_015313chr1173432 3327 3243 3122 2976 2945 1624 23543 3474 23344 685 1219
NM_015315chr5113168 3150 2664 2242 2169 2108 963 650 641 402 196 --42940 863 549 202 --
NM_015326chr152482 2202 2092 332 179 42300 793 786 142 32709 2072 1016 1204
NM_015328chr782697 2547 1022 421 366 317 93 55 1283 22686 2287 22325 673
NM_015335chr1242158 1915 1847 508 --141 --
NM_015338chr2061559 1351 1265 767 752 343 11518 11854 1127
NM_015346chr1451734 1429 436 391 341 11595 11431 2608 82
NM_015349chr632259 2072 650 22091 1013 21953 548 --
NM_015365chrX53027 614 464 384 319 43933 3606 3208 3148 13259 --
NM_015367chr2241663 1348 665 539 1419 ----
NM_015375chr183833 3665 3532 1762 1690 1589 1546 576 --21411 45 13514
NM_015385chr1031290 777 436 2540 516 1265 --
NM_015387chr231926 720 683 11564 --1462
NM_015393chr411226 13536 3675 168 140 1282
NM_015397chr961561 1507 1402 1349 753 292 --31279 780 195 11497
NM_015436chr423091 968 --1421 --
NM_015443chr174968 541 478 431 1326 21017 216 --
NM_015444chr32106 56 --1260 1659
NM_015457chr115797 706 352 229 87 1852 --175
NM_015460chr342083 1324 566 291 ------
NM_015469chr9------173
NM_015470chr29969 952 780 426 417 231 172 126 63 51123 1096 1057 373 255 31117 1051 428 1292
NM_015475chr21406 --2984 745 --
NM_015481chr1251084 1073 878 225 82 2933 234 51013 814 316 227 113 --
NM_015488chr281683 1601 1556 1516 349 302 291 124 21574 1430 21508 1347 1409
NM_015493chr194205 148 137 62 21452 492 178 --
NM_015509chr1241155 443 167 135 --21157 93 21542 1140
NM_015520chr33646 530 461 1411 --12485
NM_015527chr167738 695 618 593 522 261 41 3587 207 128 1251 144
NM_015534chr13885 215 96 --1887 --
NM_015542chr101961 163 --1964
NM_015548chr6------1795
NM_015550chr7113601 3299 2727 2715 2275 2244 1413 844 770 151 38 1379 22636 643 12278
NM_015553chr694741 4711 4140 3607 3560 1863 1490 848 21 21692 1243 13406 --
NM_015557chr183550 2801 2789 2757 2733 2660 1371 1289 23076 520 21070 656 23434 2713
NM_015569chr164598 3685 1918 1443 619 401 --14502 --
NM_015571chr621926 356 --11028 12613
NM_015575chr2103151 3135 2773 2516 2379 2260 804 709 523 28 1311 22698 398 12997
NM_015577chr521322 125 1297 --1153
NM_015578chr1932008 1768 1371 --22096 462 --
NM_015609chr192458 2443 2102 2092 1903 894 735 182 134 --2868 190 12450
NM_015651chr982013 1745 1736 444 412 399 285 76 --21794 304 --
NM_015680chr23573 116 109 --1575 1594
NM_015686chrX52421 1764 402 136 79 32372 1798 55 32383 2091 444 1405
NM_015695chr671801 801 739 537 462 443 177 31676 708 222 51826 1725 619 133 100 --
NM_015711chr197670 653 223 149 100 30 23 --1686 --
NM_015716chr176712 695 609 290 281 45 1186 4566 512 248 82 1519
NM_015719chr195712 575 524 179 149 --2739 245 --
NM_015726chr151703 1362 489 335 249 --21870 1690 11851
NM_015831chr77915 874 769 591 363 352 340 --1106 1343
NM_015840chr1132711 2125 1726 857 706 686 631 461 340 301 213 101 71 --41728 884 504 454 1216
NM_015841chr1132711 2125 1726 857 706 686 631 461 340 301 213 101 71 --41728 884 504 454 1216
NM_015850chr861931 1843 351 244 173 94 21822 877 --12445
NM_015872chr191770 1757 1725 1410 1335 1156 732 717 586 21792 204 51776 1709 1455 1388 132 --
NM_015881chr1141386 958 353 177 1166 1120 155
NM_015886chr855253 5170 5159 4787 117 ------
NM_015892chr1072472 2196 2147 1869 729 611 429 --22149 439 --
NM_015898chr19182314 2307 2250 2118 1917 1846 1743 1595 1583 1001 884 630 589 577 549 529 248 193 21728 901 71659 1574 943 441 254 215 195 12495
NM_015904chr22711 235 3698 286 242 ----
NM_015906chr174508 4270 3662 3644 3349 746 432 ----13647
NM_015912chr882530 2097 2028 1970 1940 1854 943 302 1719 ----
NM_015981chr5112968 2916 2520 2500 2349 2104 2085 281 246 225 201 42797 2355 538 412 62502 2373 1192 586 552 466 32202 103 78
NM_016018chr852811 2675 2643 2031 1763 --12859 1767
NM_016021chr612166 --21905 1896 12077
NM_016032chrX81334 1015 927 890 500 379 282 258 --1302 11170
NM_016057chr1231194 995 890 2160 76 31123 1104 374 11058
NM_016083chr643671 2794 1276 187 ------
NM_016131chr231976 769 743 --2949 795 --
NM_016132chr1543335 1250 880 306 --21269 351 --
NM_016147chr114453 270 235 224 21186 209 ----
NM_016151chr165360 344 318 107 73 153 1366 --
NM_016156chr1142269 1970 1586 463 --22171 1769 --
NM_016162chr125845 316 227 129 42 1363 ----
NM_016169chr10143264 3014 2645 2638 2540 2477 1289 1172 1158 1125 1002 643 595 473 11304 12479 --
NM_016185chr17------2699 42
NM_016201chr3102277 2174 1440 836 772 717 653 501 327 38 --22003 231 32163 1504 107
NM_016206chr357277 7268 7180 2234 211 18627 58559 7493 6465 3360 2355 21596 787
NM_016224chr652111 2077 636 76 40 31902 1790 364 31512 1348 289 179
NM_016233chr16704 419 281 151 135 29 ------
NM_016234chr103738 287 196 1922 192 --
NM_016248chr1353248 1300 1293 1266 624 11321 41287 1248 1085 757 34002 627 554
NM_016255chr643214 2908 1090 560 1496 1596 --
NM_016260chr286256 6064 5676 5637 5559 4713 4668 82 25614 5358 36590 5075 1494 25975 567
NM_016272chr22112458 2452 1955 1941 1860 1769 1741 884 771 622 355 1793 42564 2426 715 363 42435 1863 1816 774
NM_016281chr122978 905 183 4985 894 882 186 --
NM_016287chr131803 821 665 1277 21606 107 --
NM_016320chr1151093 835 361 119 57 2288 145 ----
NM_016322chr932934 2405 2356 --1242 12896
NM_016353chr852004 1914 844 501 271 --11836 --
NM_016376chr1783262 3066 3013 3005 2687 1718 1078 279 24206 1726 24222 324 --
NM_016396chr1542983 2884 2171 958 --12050 --
NM_016410chr9------1560
NM_016422chr1142819 730 693 145 22414 2198 --1109
NM_016424chr17----11308 11523
NM_016436chr2052016 928 813 784 536 --1232 --
NM_016456chr15684 677 645 588 105 --4138 131 89 82 --
NM_016507chr1732270 2196 554 12282 43066 2272 685 196 22342 598
NM_016513chr653240 2418 1341 955 52 1641 12534 155
NM_016522chr1151672 1473 1331 1078 240 --11541 --
NM_016530chr1563099 2498 1024 746 719 314 ------
NM_016531chr441077 338 327 181 --21589 755 --
NM_016544chr272844 1443 1253 1132 718 602 51 --43801 2853 1169 1160 --
NM_016559chr341397 1291 1124 326 11466 ----
NM_016569chr1221358 141 1347 11537 --
NM_016577chr393989 3743 3285 2963 2770 2734 1494 709 396 --44381 4369 973 438 --
NM_016592chr2031242 1207 24 --31323 1214 336 --
NM_016604chr53973 339 298 2914 502 1834 --
NM_016605chr552764 2538 2349 1898 1745 --41920 1878 1863 933 12061
NM_016618chr22419 177 ----123
NM_016621chr1194042 3978 3837 3603 3318 3263 3036 3018 723 14324 44293 3139 3129 657 13155
NM_016623chr82126 118 --1133 --
NM_016652chr2031282 426 382 11782 --11285
NM_016654chr1511283 --1980 1455
NM_016819chr33519 372 192 2360 126 1350 --
NM_016829chr34308 254 186 21 2236 180 1166 --
NM_016929chr684546 3727 3343 3273 1514 1363 1073 954 24014 52 13994 11457
NM_016946chr16949 565 552 290 187 172 1241 12935 --
NM_016952chr1154020 3624 3610 3576 2708 21236 199 42904 2809 544 210 --
NM_016953chr286024 5867 4565 3996 3794 1654 860 230 --1591 1716
NM_017409chr124312 54 38 21 1617 187 1590
NM_017410chr1251109 503 478 421 289 1897 11064 --
NM_017413chrX52043 1010 357 295 286 31672 941 54 42166 2049 1815 970 1159
NM_017415chr584563 4524 4216 1285 1254 952 703 667 44210 2883 1698 1065 21228 190 --
NM_017420chr1443015 2787 2461 79 --22789 2470 --
NM_017437chr1442185 2097 612 551 --22375 2319 --
NM_017447chr2133833 3145 216 23951 46 --13984
NM_017449chr161681 1559 1448 672 635 368 11592 31604 1450 1154 132
NM_017452chr2011405 --31301 339 283 --
NM_017453chr2011405 --31301 339 283 --
NM_017454chr2011405 --31301 339 283 --
NM_017456chr1741857 1571 760 231 --2520 55 --
NM_017481chr11362 47 33 172 ----
NM_017488chr22379 359 1263 11294 21307 394
NM_017554chr362093 463 427 154 86 33 11630 --11389
NM_017563chr396125 5178 4748 3897 2188 1375 1163 68 47 25355 57 65395 5096 5055 4525 1182 146 --
NM_017575chr1741539 514 425 366 21474 1023 1303 --
NM_017580chr1022041 545 --21962 1497 --
NM_017582chr12640 509 11512 31505 96 23 --
NM_017590chr22112681 2176 1782 1645 1639 830 634 540 423 407 394 --32438 542 150 1233
NM_017594chr912771 32796 528 53 --23066 887
NM_017596chr1144315 4242 4003 3969 3436 3083 1298 1141 751 708 312 170 127 54 44548 4424 1763 510 41492 841 56 41 51301 1287 987 745 66
NM_017602chrX3372 124 114 131 3141 126 85 --
NM_017610chr152747 30 ----11992
NM_017628chr475143 4817 4319 2114 497 451 153 11233 1155 13615
NM_017629chr131520 759 342 ----1762
NM_017633chr653723 1430 281 217 203 ------
NM_017637chr9139029 8186 7401 6849 6270 6193 6181 6143 5747 3016 2157 1654 211 69036 8869 8319 3107 2449 372 58707 7508 6607 6299 6289 23543 1575
NM_017640chr61147 ----2578 235
NM_017644chr344883 4836 3507 135 14905 24838 4585 --
NM_017645chr963014 2215 2110 2101 1947 188 22128 887 12086 --
NM_017649chr1071201 1154 1131 994 845 497 280 ------
NM_017650chr765072 4465 4076 1012 929 857 172 1864 --
NM_017658chr1443947 3059 362 261 ----1264
NM_017666chrX62051 1561 1407 813 489 220 11422 ----
NM_017672chr153866 443 66 --168 --
NM_017679chr173465 169 40 1115 1549 1561
NM_017694chr231441 374 90 --1376 --
NM_017700chr41133 --1180 1421
NM_017709chr194207 2969 2932 2878 2819 1627 1097 868 552 --11580 --
NM_017712chr19186186 6138 6012 5716 5710 5695 5611 5396 5218 4882 2436 2006 1870 1744 1705 1565 1344 625 35748 5702 4203 66208 5732 2333 672 217 150 1208
NM_017715chr74706 662 482 53 --3691 275 186 --
NM_017719chr322500 191 --1695 12503
NM_017736chr1643211 2812 2380 1946 1261 12958 --
NM_017737chr121563 502 1617 1349 --
NM_017758chr1751474 1087 952 490 431 --2546 213 1434
NM_017761chr121442 1128 --11098 11562
NM_017762chr1542389 1783 790 50 --31785 1725 968 --
NM_017772chr631474 1323 1212 11669 41794 1612 462 437 --
NM_017797chr195988 962 768 351 29 2248 109 ----
NM_017811chr942778 2715 1166 140 23162 2059 53081 2708 2500 2146 799 --
NM_017813chr8135416 5349 5255 5068 4870 4728 4654 3628 2137 2046 1432 735 149 --11123 --
NM_017848chrX84476 4454 3977 3804 3758 1812 1131 106 --54178 3862 1814 1768 147 --
NM_017849chr2122871 2224 2086 2045 2030 1258 936 898 538 215 118 24 4913 717 130 40 42873 2047 949 217 2287 82
NM_017893chr1051448 1028 926 538 318 41323 1235 284 241 11242 31483 357 117
NM_017902chr10195643 5450 5440 5111 5064 4638 4601 4473 4450 4357 4192 4061 3801 2227 2002 1979 1003 808 369 15391 --14553
NM_017921chr1792237 1838 1692 1591 577 538 485 273 79 21826 1778 3799 731 170 11714
NM_017944chr1153023 2276 885 627 23 ------
NM_017954chr721598 1197 --11557 11356
NM_017987chr102545 494 2794 172 1486 12125
NM_017994chr742831 1972 799 523 11209 1993 --
NM_018026chr11111316 1108 1073 1059 1006 973 511 281 204 100 25 51340 1328 963 405 296 71093 1075 1023 226 219 166 27 --
NM_018027chr1041281 850 306 228 22252 2008 42245 367 245 36 22292 2046
NM_018028chr1991216 1198 988 912 887 514 342 281 73 3893 537 318 1524 11028
NM_018036chr1464087 3406 3337 3258 880 287 --13787 --
NM_018045chr173069 2631 2545 2255 1967 450 75 1699 12456 12344
NM_018061chr161374 1186 570 129 105 61 11717 --21189 64
NM_018071chr148657 602 338 273 258 195 177 36 1720 1109 2767 605
NM_018084chr243277 2285 990 689 --12330 --
NM_018085chr187866 7763 6656 6429 5584 2377 959 815 36841 5998 776 67122 5934 1494 628 249 215 26734 823
NM_018086chr231629 1321 512 --11814 --
NM_018121chr1062237 2033 2004 1221 652 448 --22213 450 --
NM_018150chr14904 833 812 74 1103 1572 1614
NM_018157chr1223273 683 1793 33040 622 350 12505
NM_018178chr15801 641 329 153 21 1663 2191 29 2804 258
NM_018182chr17102206 2065 1999 1841 1686 694 543 451 319 174 32175 1651 766 41827 1773 798 422 --
NM_018195chr1141777 612 553 172 12003 11783 --
NM_018200chr1552338 2181 1789 722 246 --11945 1565
NM_018205chr1072254 2031 1991 1957 1712 744 305 1697 1307 --
NM_018206chr164520 483 111 68 ----1486
NM_018207chr161497 1315 1157 324 254 163 11208 --1567
NM_018214chr651300 369 323 195 37 2361 146 ----
NM_018225chr9125352 5346 4816 4675 4132 1871 1846 1840 1541 1050 933 324 14958 25358 3607 13657
NM_018239chr1072254 2031 1991 1957 1712 744 305 1697 1307 --
NM_018240chr14843 676 322 63 3707 348 146 2211 116 --
NM_018243chr4113302 3265 3060 1565 1499 1453 1385 1184 962 465 115 --11366 --
NM_018244chr206891 426 311 228 213 152 31040 964 258 1844 --
NM_018247chr63742 670 153 --12003 --
NM_018263chr272269 2102 1928 1780 1029 717 385 11039 ----
NM_018287chr101334 ----1914
NM_018299chr843151 2628 2616 723 ----13154
NM_018312chr1141909 1867 1702 1627 ----1454
NM_018315chr421357 313 --21426 59 --
NM_018319chr1431391 274 86 --11249 --
NM_018322chr651189 928 423 140 47 11226 ----
NM_018327chr2041638 644 93 51 --185 --
NM_018330chr1011755 ----11554
NM_018351chr12124523 4434 4075 3980 3587 3408 3371 2896 2868 1840 1032 834 14147 --14155
NM_018362chr1163497 3324 3274 860 389 121 12708 --1863
NM_018364chr143241 2820 1275 330 12940 13071 --
NM_018371chr841119 1027 642 387 ----1551
NM_018400chr11183995 3830 3774 3765 3681 3630 3443 3382 3121 2989 1641 854 823 558 485 394 361 111 21824 1488 54390 4262 3928 649 313 11644
NM_018403chr321057 530 13238 13713 1402
NM_018409chr433093 2986 2340 22940 2864 --1726
NM_018424chr931790 1350 401 --1429 1451
NM_018426chr6--1158 2411 102 1245
NM_018440chr8148221 7684 7132 5470 5272 2452 1830 1782 963 768 705 577 398 242 56557 6502 5964 5608 2029 35536 5472 443 46896 2455 771 147
NM_018452chr6_random53727 2563 1479 901 195 ----193
NM_018457chr122571 522 2421 49 --125
NM_018482chr822338 1733 --12066 12341
NM_018489chr121557 219 --11500 --
NM_018509chr1741327 687 672 178 1623 31452 689 388 11519
NM_018553chr1761843 1698 1252 411 227 78 --21565 594 --
NM_018566chr111096 14333 --21954 996
NM_018638chr1233463 1002 22 ----34068 3466 2213
NM_018639chr1251339 1203 1017 380 173 ------
NM_018644chr1172092 2084 1370 705 76 58 25 21607 740 11396 11671
NM_018660chr893010 2440 2264 2238 2004 1902 789 551 293 12018 42065 2010 870 211 31029 621 160
NM_018667chr1662760 2148 1016 788 531 67 42273 2092 983 739 ----
NM_018684chrX31286 483 458 1236 21061 401 --
NM_018712chr111286 1293 1955 --
NM_018717chr43945 936 757 1453 2913 730 12097
NM_018718chr7102118 1928 1801 651 441 234 154 134 63 38 --11964 21804 1685
NM_018837chr202743 700 1285 --1346
NM_018841chr183422 3359 3123 2453 1566 1306 1028 516 11084 11519 --
NM_018898chr542375 261 136 74 160 --12060
NM_018899chr542375 261 136 74 160 --12060
NM_018900chr542375 261 136 74 160 --12060
NM_018901chr542375 261 136 74 160 --12060
NM_018902chr542375 261 136 74 160 --12060
NM_018903chr542375 261 136 74 160 --12060
NM_018904chr542375 261 136 74 160 --12060
NM_018905chr542375 261 136 74 160 --12060
NM_018906chr542375 261 136 74 160 --12060
NM_018907chr542375 261 136 74 160 --12060
NM_018908chr542375 261 136 74 160 --12060
NM_018909chr542375 261 136 74 160 --12060
NM_018910chr542375 261 136 74 160 --12060
NM_018911chr542375 261 136 74 160 --12060
NM_018912chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018913chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018914chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018915chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018916chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018917chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018918chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018919chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018920chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018921chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018922chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018923chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018924chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018925chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018926chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018927chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018928chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018929chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_018933chr52570 68 --1131 171
NM_018945chr673119 2663 1368 1176 260 155 32 12636 23387 137 --
NM_018963chr2131207 529 396 --1146 --
NM_018979chr1262329 1983 879 639 462 174 2402 394 ----
NM_018992chr1631328 1296 43 --11670 --
NM_018999chr1094840 4739 4602 4228 3214 3097 1880 1336 998 33549 1858 1346 11849 13177
NM_019000chr52317 132 --1134 --
NM_019001chr344328 4145 3834 3080 --14147 --
NM_019004chr731802 1759 141 11727 1214 --
NM_019008chr2283729 2963 2844 2665 1405 604 387 49 11101 21292 1190 12779
NM_019022chr1842280 1091 395 148 ----1398
NM_019027chr432038 780 726 --11796 --
NM_019063chr222334 1470 ----2906 767
NM_019096chr64985 904 807 761 1832 1910 --
NM_019098chr831574 603 205 --11657 --
NM_019106chr22113371 2801 2400 2247 1371 1250 1234 784 755 427 80 43031 2375 1317 263 43184 1381 757 749 1766
NM_019114chr972429 2230 2117 1857 953 893 879 ----12439
NM_019116chr16113159 2817 2775 2598 2547 1364 1060 646 563 541 202 1760 12819 12601
NM_019117chrX73261 2877 2724 2218 1396 822 480 ----13134
NM_019592chr93889 843 563 --2329 244 1125
NM_019859chr102519 177 ----1588
NM_019885chr2132344 2179 1998 1042 934 822 699 651 640 528 421 188 131 1553 2339 207 --
NM_019895chr32804 733 ----166
NM_020039chr1281840 1725 1669 1520 1282 707 588 120 41226 468 279 265 21494 1274 --
NM_020062chr204852 696 253 164 1385 139 1882
NM_020066chr14900 877 867 343 1388 ----
NM_020122chr274508 4385 4202 2006 1587 1420 475 --25300 5270 15788
NM_020131chr141615 1369 89 29 21630 1139 61617 1487 1371 600 433 104 11335
NM_020134chr251166 1052 948 460 310 1432 61063 1020 927 920 877 206 --
NM_020144chr732126 1624 669 --1179 --
NM_020148chr1832472 344 304 12662 22544 633 --
NM_020150chr1071919 1611 680 549 375 173 63 11850 --11922
NM_020151chr291489 1299 1290 1152 1133 663 598 386 326 --1665 --
NM_020168chr1551330 1143 911 189 87 --1474 --
NM_020177chr543265 1276 311 163 --32371 2167 400 --
NM_020178chr173841 100 74 ----1103
NM_020182chr20163453 3358 3170 3025 2978 2781 2603 2246 1449 1249 1237 1007 964 852 781 119 12359 31430 1413 875 23005 1324
NM_020184chr272050 2030 1959 1951 1746 1547 457 --2904 464 --
NM_020200chr1031018 846 84 1446 ----
NM_020205chr1113360 3331 2589 2557 1371 1359 1075 808 732 648 212 --53428 1353 1100 1077 524 13485
NM_020211chr1591379 1324 1305 1297 1020 456 282 243 161 21250 49 1347 --
NM_020228chr1141927 1796 1637 596 ------
NM_020239chr171540 747 451 173 164 118 84 11434 ----
NM_020240chr532408 2182 1883 22229 791 ----
NM_020245chr674696 1802 1712 1667 1390 1089 1014 1387 12002 14823
NM_020248chr192154 2094 1583 1575 1556 659 494 332 103 32161 1914 1666 11735 1111
NM_020309chr1951031 843 829 426 123 2895 795 2931 232 1221
NM_020310chr1742253 1966 1947 796 32197 2047 55 52500 784 412 336 283 --
NM_020336chr20113552 3513 2932 2830 2686 2587 2547 1452 1342 1015 599 1995 ----
NM_020337chr462894 2571 2263 1115 656 275 22839 2439 1939 --
NM_020338chr10113182 2646 2445 2402 1181 1029 1020 430 330 137 26 22930 1335 32908 1396 1073 --
NM_020340chr621628 280 21399 23 --2626 80
NM_020348chr1092675 2239 1768 1711 1091 525 346 162 120 12247 1164 51699 1016 528 394 83
NM_020360chr172587 227 1519 --192
NM_020382chr1241063 608 359 36 --61463 1412 1260 991 546 384 1472
NM_020384chrX91715 1670 1649 1633 1473 1426 284 244 228 31881 1735 1614 1490 21476 1235
NM_020390chr334259 3355 1024 11698 14609 --
NM_020416chr432048 989 659 --31937 880 424 1914
NM_020440chr12992 236 13143 22945 2864 1284
NM_020443chr1206977 6846 6731 6614 6543 6160 5840 5648 5459 4813 4229 1484 1257 1121 1111 918 884 281 70 64 24442 490 --45661 5447 2774 858
NM_020465chr1661707 1635 1512 1373 187 70 ----1436
NM_020466chr654290 4155 3747 1454 749 --13195 --
NM_020475chr852106 548 367 119 74 42423 2394 2133 2015 22452 1904 --
NM_020476chr852106 548 367 119 74 42423 2394 2133 2015 22452 1904 --
NM_020477chr852106 548 367 119 74 42423 2394 2133 2015 22452 1904 --
NM_020478chr852169 611 430 182 137 42486 2457 2196 2078 22515 1967 --
NM_020480chr852106 548 367 119 74 42423 2394 2133 2015 22452 1904 --
NM_020526chr171767 1492 1271 1210 1192 687 575 1222 11653 --
NM_020530chr222843 697 2223 169 3395 358 102 --
NM_020638chr1251763 717 443 224 201 2293 37 21317 261 --
NM_020640chr321629 775 ----1280
NM_020673chr20157260 6484 6456 6390 6069 5602 5142 3116 2301 1682 1676 1370 1102 151 110 --36538 1819 1339 22404 1373
NM_020679chr175155 133 120 96 22 ----2431 192
NM_020689chr2051507 1165 337 218 155 1177 1514 --
NM_020699chr1135141 4913 4854 4111 4035 3840 3768 3356 3344 985 381 185 51 53908 3790 3374 1953 1751 43364 3273 1890 946 74983 4857 4114 1805 1670 413 64
NM_020713chr20102421 2390 1271 640 585 367 344 152 146 93 42838 820 101 86 22868 170 1703
NM_020717chrX84145 3765 1731 1621 1544 1110 616 147 23289 1144 21878 1065 --
NM_020734chr1253266 3208 2943 938 561 ------
NM_020739chr1554096 3935 3425 2866 1143 ------
NM_020742chrX21800 28 11865 2945 811 --
NM_020749chr841870 1860 1482 1354 31833 1432 1390 --1206
NM_020750chr641340 1281 52 25 --21342 1165 2489 299
NM_020752chr1052834 2340 1977 1886 214 ------
NM_020760chr221334 1236 ----21337 1239
NM_020766chrX33207 1457 1096 22994 1468 34563 2835 1003 13408
NM_020772chr17128451 8201 7035 5395 3453 3447 3083 2855 2645 2298 1527 491 12532 58363 6725 5982 2286 481 17946
NM_020774chr1855882 4754 3986 1447 1284 --25118 1449 34595 3989 2296
NM_020783chr1821644 182 2965 461 1668 --
NM_020792chr362683 2130 1709 741 735 576 --31909 102 93 12260
NM_020795chr17111948 1318 1275 1252 729 432 315 275 163 89 25 --51791 1260 589 228 143 3791 424 412
NM_020796chr562543 2527 1998 655 235 136 22931 322 12761 22776 238
NM_020801chr522049 987 --12324 --
NM_020807chr1641370 1167 1156 250 --21560 338 --
NM_020810chr1473480 3236 3205 3099 3076 179 24 12747 ----
NM_020813chr1982702 2378 2031 1885 914 440 405 328 31961 335 46 3863 765 669 --
NM_020830chr24711 494 215 59 1248 --22716 719
NM_020832chr1371 52 34 --1221 1517
NM_020839chr321542 43 --31536 1129 299 11427
NM_020844chr8147281 6484 6454 6358 5656 5611 5242 5035 4996 4903 4821 2437 2110 50 36150 6059 26 ----
NM_020845chr1262453 2060 1936 1850 1716 383 21948 1869 --1277
NM_020850chr16113113 2754 2450 2047 913 883 616 315 198 140 117 33166 2041 1193 32767 890 133 --
NM_020856chr1921402 265 ----11319
NM_020861chr661160 1105 348 119 83 61 1492 2128 53 --
NM_020870chr421992 481 11459 2653 473 --
NM_020871chrX31685 993 766 12121 ----
NM_020888chr161796 1736 1524 1495 1450 202 21749 428 22007 1738 --
NM_020895chr19--197 --2264 28
NM_020898chr125755 743 524 239 120 --2777 282 1538
NM_020899chr1782376 1607 722 585 564 350 265 171 2653 537 41700 916 619 204 32368 944 219
NM_020918chr1022920 2726 1891 23092 146 --
NM_020922chrX5692 670 350 101 79 --21787 440 1104
NM_020924chr9191 1188 --1484
NM_020935chr274584 4348 4326 3221 925 221 67 --34350 4328 3713 --
NM_020944chr93208 197 116 --267 60 1248
NM_020948chr153256 2938 2708 2485 1132 --12978 12715
NM_020951chr1962363 2345 2022 1868 206 93 --32308 1740 565 1389
NM_020956chr19154411 3659 3276 3001 1403 1136 843 688 682 607 583 498 287 103 83 44445 4256 1086 954 31405 1295 698 1305
NM_020962chr15112437 1720 1641 918 803 759 740 713 562 456 170 4782 695 678 324 1639 --
NM_020964chr1874290 3965 3668 3083 1181 1143 934 13360 1786 21372 436
NM_020967chr2071249 1057 286 49 39 31 22 ------
NM_020977chr431813 1510 320 11660 --1323
NM_020983chr1292246 2030 1672 1640 1481 933 533 394 351 1514 32223 396 244 11543
NM_020993chr12102635 2424 2365 1903 1039 821 732 539 475 85 --32749 2544 310 1865
NM_021012chr1782462 2390 2364 2250 2019 1071 583 562 11200 22412 839 11125
NM_021020chr8143229 2614 2573 2529 2350 2178 1210 952 479 357 313 231 67 56 33106 3027 322 83015 2854 2305 1070 1033 954 387 162 --
NM_021032chr331825 1720 1589 --241 25 11723
NM_021079chr1783013 2560 1260 1175 844 754 547 425 33071 2805 2221 --32891 2706 486
NM_021083chrX53663 2941 2899 1431 947 ----12984
NM_021090chr22224750 4217 1940 1597 1516 1494 1376 1243 1113 1071 995 962 918 703 619 558 531 436 234 204 185 176 2903 504 11501 --
NM_021096chr2262875 2855 2328 1256 674 454 23135 1030 23218 2654 12937
NM_021097chr223042 2057 2867 475 2847 463 11159
NM_021120chrX83097 2954 2799 2380 1991 255 112 49 --2424 56 --
NM_021132chr1011233 --1320 11259
NM_021135chr682698 2692 2556 2290 2076 617 181 29 --52292 2078 1175 758 569 22736 225
NM_021136chr142286 103 --2288 95 --
NM_021155chr19162904 2511 2445 2253 2105 1961 1921 1855 1214 1171 1165 1052 947 765 675 302 32473 2405 1129 32235 146 94 1439
NM_021159chr451639 1559 1437 1143 563 153 21327 42 --
NM_021183chrX32262 2218 490 ----11759
NM_021202chr20103073 2864 1967 840 577 468 443 290 130 58 22587 376 12866 1149
NM_021205chr122204 1133 ----12444
NM_021215chr2092328 2307 2148 747 558 541 462 388 147 21763 356 12194 1241
NM_021238chr1261829 657 516 376 183 165 11784 11964 2660 379
NM_021253chr621382 1151 11135 21346 202 --
NM_021255chr1442989 2850 2535 1027 12594 --12928
NM_021260chr1481349 1333 1118 442 395 358 135 80 --2565 491 1138
NM_021627chr341016 950 283 21 --1771 --
NM_021629chr375057 4212 3685 1120 892 464 24 34062 3503 1296 13574 --
NM_021633chr131339 1331 1238 1256 11333 --
NM_021638chr4164223 4113 3736 3715 3378 3254 3190 3156 1930 1521 1296 1272 1134 1039 806 540 45051 1650 1399 152 33470 1796 1778 21524 1046
NM_021647chr441759 1583 1504 534 2888 658 23428 3421 1176
NM_021648chr641729 1095 982 187 --21924 990 22726 341
NM_021649chr52680 609 21544 1529 1411 --
NM_021800chr101439 145 --1134
NM_021809chr2082278 2070 2043 989 508 275 205 64 --22280 2057 12350
NM_021813chr6115086 1827 1752 1655 1547 1536 1359 1096 1085 686 561 24334 38 15415 --
NM_021905chr682276 1873 1836 1652 1600 1502 1441 644 11399 22012 51 22069 1942
NM_021907chr23271 231 100 ----186
NM_021911chr532130 2114 2104 --139 13812
NM_021912chr1523940 2722 --23254 956 --
NM_021923chr431547 1127 1048 21178 1069 21549 1267 --
NM_021939chr174617 524 313 93 2506 300 ----
NM_021945chr692805 2643 2524 1300 1271 1148 826 549 371 22882 800 33391 793 273 --
NM_021946chrX91332 1302 1235 1081 1053 1047 589 192 31 21067 940 2415 70 153
NM_021948chr14287 278 258 57 ----160
NM_021949chrX42344 1884 1025 292 31149 627 170 --21887 254
NM_021950chr1131964 1936 326 11494 22217 2112 --
NM_021959chr64854 811 639 66 --2199 83 1182
NM_021960chr142770 1843 505 487 12534 ----
NM_021961chr11176992 6615 6465 6373 6301 6048 5362 4793 2923 2790 2707 2573 2556 2036 1753 1548 277 42625 2145 1875 1589 16472 12926
NM_021964chr326624 1884 25376 4953 15368 12527
NM_021976chr62894 680 2910 385 11048 2289 251
NM_021980chr10------155
NM_021984chrX41058 556 517 240 3173 128 42 ----
NM_021987chrX41058 556 517 240 3173 128 42 ----
NM_021988chr2021056 625 1579 3381 36 30 --
NM_021990chrX41058 556 517 240 3173 128 42 ----
NM_021991chr175717 595 268 133 26 --1691 1271
NM_022003chr1171030 863 803 453 381 345 151 1140 --2168 111
NM_022048chr15166365 6246 5054 4842 4528 2351 2006 1689 1643 1622 1175 691 532 526 492 326 36127 4162 2216 34061 589 336 35966 1444 235
NM_022058chr211428 31719 188 23 11510 --
NM_022059chr174811 801 771 79 2724 373 2743 703 --
NM_022060chr1491317 1221 1112 1009 904 504 374 341 85 1434 2878 423 --
NM_022062chr1151889 1568 1328 598 207 31848 1521 122 31589 1515 1337 --
NM_022090chr51217 ----1511
NM_022114chr1104347 3868 3730 3617 3596 3506 1607 1386 1303 116 63515 3103 1327 1096 1060 898 33230 1461 976 --
NM_022117chrX5560 447 440 200 65 3543 428 40 ----
NM_022130chr561434 345 233 184 92 25 ------
NM_022138chr621307 47 --1581 150
NM_022140chr542206 1550 940 248 --12270 12146
NM_022166chr16235813 5603 5513 5451 5167 5111 5067 5009 4741 2398 2365 1952 1909 1766 1706 1696 1373 1356 1114 1014 716 649 463 15037 45169 4930 434 279 35061 5047 818
NM_022169chr1131270 986 119 41405 1232 1221 132 51420 1398 1078 525 243 --
NM_022170chr73298 278 262 1239 --1419
NM_022336chr252141 1900 1841 1680 25 --11870 --
NM_022340chr373390 3320 3074 2407 2346 1162 539 ----22573 1117
NM_022442chr2021056 625 1579 3381 36 30 --
NM_022455chr52252 115 --179 1255
NM_022456chr1276407 6046 5196 5070 4911 4676 1058 13085 1111 --
NM_022459chr1345959 2475 1906 86 34171 1916 1313 66318 4255 4104 1835 613 531 --
NM_022462chr19253670 3565 3397 3192 3074 3062 3007 2953 2580 2548 2378 1480 1416 1382 1324 1203 1194 989 877 856 850 718 690 240 29 33547 3363 36 32859 863 524 --
NM_022465chr12102942 2894 2252 1874 1134 775 748 621 160 77 42492 2258 990 319 52914 2825 1951 1884 655 31903 710 689
NM_022473chr1594254 4168 3972 1200 1101 951 461 277 80 23556 906 13098 11719
NM_022474chr1452760 2403 876 781 161 --12209 1788
NM_022491chr1242663 793 450 71 --23038 2633 11120
NM_022494chr102362 110 --1323 1365
NM_022552chr231150 271 256 --31040 992 262 --
NM_022572chr281683 1601 1556 1516 349 302 291 124 21574 1430 21508 1347 1409
NM_022574chr792121 2096 2051 2017 1942 1735 1629 1427 1369 21930 809 52212 2152 1844 1741 1445 22188 1487
NM_022716chr153005 2942 2080 1025 536 --1196 12320
NM_022719chr2243744 3135 2837 2621 21359 857 23880 539 1656
NM_022726chr621748 230 --1269 11588
NM_022730chr28962 837 402 299 199 181 167 113 2820 189 2262 73 --
NM_022733chr161183 1088 985 842 222 48 --2991 979 21044 316
NM_022737chr1951031 916 402 357 250 31203 974 885 1146 --
NM_022745chr152912 2834 2465 2221 998 12850 12056 12915
NM_022748chr722355 460 21114 959 11035 32697 2035 463
NM_022749chr851414 1375 559 481 84 11205 21214 952 --
NM_022753chr172782 2283 2115 1981 1061 608 188 ------
NM_022754chr531858 1296 621 ----193
NM_022755chr962401 2235 942 728 512 283 --2891 875 32645 2329 446
NM_022758chr6102536 2486 2333 2278 2214 2178 1048 718 397 75 22863 2448 2616 399 1407
NM_022778chr141421 920 523 320 ----2541 22
NM_022781chr963028 2308 675 607 260 38 --22668 681 --
NM_022822chr118834 813 773 652 639 575 355 230 199 1142 --
NM_022832chr462297 2244 2071 902 78 65 22407 85 22493 2299 22349 1729
NM_022833chr981432 1262 1244 1182 1093 1030 321 44 11155 11378 1495
NM_022836chr151603 1471 1399 440 431 11280 1446 --
NM_022840chr1841086 956 54 42 ------
NM_022841chr1531757 994 962 1987 --12668
NM_022845chr1642059 1895 863 721 --11770 --
NM_022898chr1453541 3426 3208 3098 1123 13559 33858 3619 3531 --
NM_022910chr1661707 1635 1512 1373 187 70 ----1436
NM_022912chr272939 2765 2711 976 838 678 199 12840 1230 --
NM_022917chr93973 947 322 1102 21219 975 --
NM_022918chr11--11373 --1199
NM_023009chr15279 188 153 140 126 --1147 2629 170
NM_023067chr381110 999 871 420 243 203 188 141 ----11145
NM_023071chr1251035 385 292 206 159 ------
NM_023076chr1642635 2227 233 53 22524 2405 1855 --
NM_023079chr1761641 1628 1447 671 527 91 --61630 1286 1269 656 501 57 2518 27
NM_023105chr861931 1843 351 244 173 94 21822 877 --12445
NM_023106chr861931 1843 351 244 173 94 21822 877 --12445
NM_023110chr861931 1843 351 244 173 94 21822 877 --12445
NM_023111chr861931 1843 351 244 173 94 21822 877 --12445
NM_023112chr1442985 2961 2136 941 12726 42087 1921 1067 934 12139
NM_023929chr832587 2119 1946 --1669 1662
NM_023930chr113838 810 739 1236 --1831
NM_024007chr552819 2061 1964 1045 713 1949 1715 12852
NM_024016chr176784 542 317 263 214 140 --2595 525 --
NM_024017chr1751507 1476 1059 154 26 21462 40 21449 1212 --
NM_024019chr45995 337 146 71 44 1907 179 --
NM_024046chr311027 3427 384 108 21237 328 1354
NM_024095chr1231153 270 158 2263 194 ----
NM_024103chr1991689 1582 1383 1331 722 505 403 249 21 3536 352 31 11276 11426
NM_024107chr175566 537 187 158 37 1125 1308 --
NM_024294chr6102536 2486 2333 2278 2214 2178 1048 718 397 75 22863 2448 2616 399 1407
NM_024295chr842043 1871 1465 400 1392 3522 271 45 11468
NM_024297chr172157 79 --1173 1428
NM_024345chr994466 4281 4244 3828 1000 338 324 304 222 24355 1228 25845 326 25577 5003
NM_024408chr172738 2632 2326 1498 1019 698 438 --1581 --
NM_024416chr951523 1354 1319 1113 435 --1503 --
NM_024423chr1884155 3079 2850 1625 1560 1451 1314 1147 23834 2767 --23814 3082
NM_024430chr1861807 1796 1404 1292 1223 236 11337 --21716 1604
NM_024494chr12223 26 ----182
NM_024511chr483065 2997 2197 1189 752 694 555 421 ----1743
NM_024522chr181650 1564 1331 588 324 314 306 85 31786 1714 1540 --11323
NM_024524chr333042 2652 541 22712 2469 12495 --
NM_024541chr1071848 1529 1489 1263 1202 661 478 --11452 --
NM_024551chr1232558 2446 2181 --42455 2448 1717 363 --
NM_024551chr1232558 2446 2181 --42455 2448 1717 363 --
NM_024554chr141514 1357 1249 205 11228 1612 --
NM_024586chr14488 254 180 174 --1182 --
NM_024590chr421327 1271 --11243 --
NM_024594chr551637 1627 1326 246 183 --11418 21485 547
NM_024602chr17795 696 688 628 359 77 45 --1872 1802
NM_024641chr652640 2392 2103 2043 550 12280 12249 --
NM_024646chr11887 1685 14001 1757
NM_024665chr333845 3372 396 --34667 3838 354 --
NM_024674chr163221 3205 3166 3059 2193 650 --1147 13062
NM_024676chr171114 982 881 545 318 216 166 31143 840 190 ----
NM_024704chr205407 330 291 251 102 176 --1718
NM_024721chr81137 ----1487
NM_024742chr1661746 1704 1196 393 237 204 ------
NM_024744chr232396 1758 602 --1879 --
NM_024749chr132176 2035 533 1233 --22143 524
NM_024761chr9115036 4433 4272 3875 1750 1705 1062 819 620 595 577 1151 45038 3587 2125 43 14286
NM_024770chr266671 5656 4861 4344 1905 561 1759 14918 1509
NM_024779chr1251601 1480 1336 1279 193 21330 274 41608 479 223 214 21061 1022
NM_024803chr101369 --187 1372
NM_024811chr1181912 1583 1558 598 331 180 122 98 31889 1628 393 31808 1619 600 1106
NM_024830chr571557 1532 804 732 713 260 227 --11963 1299
NM_024834chr1031640 554 526 11884 ----
NM_024874chr191259 1112 1101 967 472 415 266 199 55 1160 1417 1861
NM_024875chr105473 271 140 79 61 11646 31214 322 156 2286 147
NM_024881chr19123803 3330 3266 3022 2936 2392 1516 1046 728 583 472 41 1319 --1747
NM_024887chr181587 1358 1345 807 688 522 110 58 2571 212 21443 356 --
NM_024889chr1041636 1223 1116 325 71199 1184 1148 1133 717 632 71 11177 --
NM_024896chr941958 1868 830 693 --31880 447 60 --
NM_024909chr6131571 1547 1438 1404 1393 1321 1223 562 524 484 477 458 421 11558 21474 491 21418 1226
NM_024920chr431504 314 304 ------
NM_024939chr1651409 1039 463 455 176 1157 --1179
NM_024947chr389135 7992 6674 3096 3066 2083 631 360 13547 48967 8955 6882 2085 18158
NM_024949chr444895 4318 1467 374 11215 14126 --
NM_024989chr267541 7280 6528 6179 1879 1551 --16148 26535 6197
NM_024991chr1031290 777 436 2540 516 1265 --
NM_025027chr1931161 987 242 ----1111
NM_025058chr16778 681 605 548 301 36 --3555 131 94 --
NM_025061chr195958 900 389 316 244 1431 --1961
NM_025074chr443090 1054 660 411 --2888 391 --
NM_025083chr15101913 1832 1499 1434 628 618 442 412 183 35 11885 21821 630 2534 424
NM_025090chr1761389 1311 1252 1081 1007 999 ------
NM_025134chr1641923 1812 1682 556 --11930 --
NM_025146chr31825 22640 2585 2104 68 --
NM_025151chr841824 1586 1448 867 2381 117 --11589
NM_025160chr163300 3127 1444 1291 758 470 13791 41565 1457 1293 879 22840 235
NM_025164chr1181822 1713 1615 788 479 444 240 129 ----11405
NM_025179chr1174600 4484 4437 4384 4218 4210 3975 3547 3188 1874 1757 1478 1320 920 456 149 111 43554 3298 1817 961 23316 480 34694 3651 473
NM_025182chr95747 741 414 221 207 1923 ----
NM_025191chr142967 2808 2291 1065 --1224 --
NM_025222chr372824 1987 1934 1905 929 799 465 --12934 1981
NM_025224chr2062178 2149 2070 1487 759 453 21814 459 31923 724 123 11459
NM_025230chr1431189 478 56 1700 2161 68 --
NM_025236chr61683 4748 566 235 71 2673 632 1266
NM_025248chr1783266 2072 1100 607 586 449 336 33 140 33188 380 57 22961 339
NM_025251chr86851 812 475 404 398 70 1124 11047 --
NM_025263chr66739 636 541 437 393 272 1343 1142 --
NM_030576chr1761721 879 669 397 318 250 2362 300 1175 --
NM_030594chr1541215 1017 275 260 ------
NM_030621chr1452866 1602 932 410 236 --23341 1395 --
NM_030623chr241191 1079 590 34 11426 --1622
NM_030627chr543214 886 437 71 1661 13174 1440
NM_030629chr1631392 1386 614 --31859 1720 1434 --
NM_030634chr152088 1990 915 575 473 1185 --1328
NM_030640chr123870 232 62 1326 ----
NM_030645chr181013 971 341 315 302 183 122 106 1984 1190 1344
NM_030647chr766043 4700 4255 1435 78 29 1811 44762 4754 4559 712 25078 1983
NM_030648chr474803 4779 4517 4268 3903 3572 1688 14312 25200 918 --
NM_030660chr1441360 1346 992 593 11354 1505 --
NM_030661chr781623 1553 1396 1296 284 144 125 36 --1153 11634
NM_030664chr1022358 844 1275 1298 1500
NM_030674chr12135196 4290 4251 4029 3867 3612 1711 1590 1386 1156 762 247 181 35113 3893 1304 1764 55603 4689 4554 1488 1249
NM_030761chr142223 2194 2096 1861 52661 1900 1759 1036 71 --2955 810
NM_030786chr121723 646 --11889 --
NM_030796chr772156 1947 857 582 493 113 45 ----11733
NM_030802chr173199 70 58 2289 252 199 2756 653
NM_030806chr1158632 8569 8324 8245 8071 7385 7188 7099 6400 1880 1635 1459 1028 727 721 17059 59173 7880 7745 7436 435 22548 786
NM_030808chr1711041 138 1392 11092
NM_030809chr1242116 1740 948 46 41826 1749 616 374 22463 950 --
NM_030881chr2262242 1980 1686 612 545 75 --42233 1779 639 128 1289
NM_030884chr381702 624 368 226 183 166 54 32 12154 61830 540 294 76 64 44 12142
NM_030914chr97921 851 131 109 91 83 60 1122 2782 257 --
NM_030915chr271931 1881 1806 1517 951 877 62 --31872 1703 774 --
NM_030918chr1175239 4790 4424 4375 4253 4094 4024 3805 3611 3448 2125 1724 1330 832 507 492 98 14212 23436 509 35018 4277 1727
NM_030920chr162060 1764 1471 810 793 228 ------
NM_030952chr141276 908 398 387 2921 320 177 --
NM_030962chr1141261 374 131 118 ------
NM_030964chr563261 1503 1381 1058 501 390 32578 508 178 63563 2408 1060 695 636 361 12554
NM_030981chr1191038 1020 971 884 809 390 316 78 40 --11137 1818
NM_031216chr1811507 31637 107 87 21681 80 --
NM_031266chr51132 ----1135
NM_031268chr16105380 4130 3924 3256 2118 1866 1418 1291 1261 547 11684 34671 3354 1944 14396
NM_031305chr441911 1733 1634 423 11566 1624 --
NM_031309chr831755 589 218 2693 390 32220 1470 344 1248
NM_031314chr1462028 1925 1905 1292 630 368 2742 90 21480 120 --
NM_031369chr43619 256 155 ----1259
NM_031370chr43619 256 155 ----1259
NM_031372chr431664 517 429 --1473 --
NM_031411chr542375 261 136 74 160 --12060
NM_031426chr992360 2284 1899 1781 1071 1023 227 203 45 --32104 312 220 12167
NM_031427chr1485553 5528 5483 5475 5210 2213 1975 480 25766 1299 1170 11324
NM_031439chr831542 1410 183 2271 189 21230 93 31545 1326 247
NM_031445chr263314 2445 2173 1267 1219 221 1254 1410 12403
NM_031450chr116565 487 208 145 57 33 --168 --
NM_031468chr7167646 7388 6999 6018 5758 3029 2576 2156 1995 1853 1737 1601 1425 1062 882 850 67616 5583 2944 2253 2096 1095 77449 7390 6552 1918 1739 1629 1517 3737 514 73
NM_031483chr2033236 2410 2360 1152 1482 --
NM_031492chr112543 77 --1180 --
NM_031844chr142652 1251 349 35 11507 33546 1552 1257 22655 849
NM_031845chr263064 2794 1375 1033 925 818 ------
NM_031847chr263064 2794 1375 1033 925 818 ------
NM_031849chr542375 261 136 74 160 --12060
NM_031857chr542375 261 136 74 160 --12060
NM_031860chr542375 261 136 74 160 --12060
NM_031866chr102751 245 1947 21045 389 1223
NM_031890chr22112857 2720 2597 2468 2173 1218 1210 1116 687 656 223 22080 1103 52635 2147 1212 956 341 --
NM_031953chr44462 343 120 62 ------
NM_031992chr73298 278 262 1239 --1419
NM_032012chr964327 4315 1812 1237 900 768 --1630 24765 511
NM_032017chr1151864 1834 1764 1600 1382 1360 1288 848 833 783 734 715 670 480 97 3584 450 344 21515 434 11453
NM_032041chr882345 2339 2079 2039 1878 529 112 44 2539 457 1136 31915 1864 512
NM_032042chr542913 2527 610 474 12514 2411 386 --
NM_032050chr223408 382 147 ----1163
NM_032052chr222532 82 1912 --1548
NM_032088chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_032092chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_032105chr1247585 6979 6813 6802 6704 6278 5653 5615 5489 5475 5330 5021 2521 2121 2056 1831 1788 1737 1669 1638 1130 845 784 737 87766 7020 6694 6631 6606 6023 1038 852 67698 6588 5332 1051 763 32 27364 7238
NM_032109chr591188 462 434 424 347 245 228 221 191 1147 --1443
NM_032121chrX2746 588 22059 897 12569 --
NM_032144chr291620 1610 1569 1562 1341 302 293 265 251 --11627 1711
NM_032153chr342806 2729 2279 2149 --12731 12222
NM_032160chr1843716 1540 756 321 33347 2870 2691 1874 11316
NM_032192chr174710 552 533 504 2681 53 2701 94 1231
NM_032199chr1033836 3691 898 11348 --1608
NM_032217chr41242 1183 2251 244 --
NM_032221chr204708 687 493 307 --1614 171
NM_032228chr1121269 888 13031 22566 2357 --
NM_032239chr41908 --2447 217 --
NM_032242chr393198 2826 2546 2208 2164 2150 671 385 136 --33058 2913 824 12153
NM_032246chr152111 105 --1457 169
NM_032268chr1662750 2558 2199 651 533 353 11087 92872 662 569 535 473 355 224 158 151 --
NM_032281chr1972581 2556 2529 2510 2146 221 209 22669 1156 ----
NM_032283chr171713 1587 1534 491 476 144 126 --2706 525 --
NM_032291chr11150 ----21348 153
NM_032315chr1------164
NM_032316chr332325 2200 1532 31998 464 332 22440 1534 11511
NM_032325chr1141287 709 305 21 31905 1859 598 1517 --
NM_032329chr2104321 4210 2852 1656 1568 1130 620 562 233 68 11099 23263 1327 --
NM_032345chr122390 170 3403 160 141 1392 --
NM_032364chr123745 195 77 185 21007 747 1215
NM_032373chr1045764 4315 4300 3595 --13870 --
NM_032389chr112885 759 11084 31071 991 216 2345 313
NM_032403chr5101667 1653 1487 718 390 384 357 132 58 39 21365 316 1177 21397 505
NM_032408chr74997 803 160 139 --21114 990 --
NM_032420chr55758 621 364 283 181 2198 33 1220 3367 237 159
NM_032431chr112223 83 1139 1982 1302
NM_032434chr24251 208 182 155 21364 1226 2175 131 --
NM_032439chr1041698 653 228 180 --21621 39 --
NM_032440chr1042289 1952 1895 1800 ----22814 1803
NM_032445chr1521930 1601 ----12296
NM_032446chr552654 989 296 211 62 --12656 --
NM_032449chr1102261 2100 1149 845 716 569 526 515 353 157 ------
NM_032452chr1481443 1227 624 513 216 165 97 75 31353 552 229 41451 1305 1247 1075 --
NM_032511chr6162 ----1382
NM_032538chr6162586 2415 2364 2333 2297 1914 1804 1140 1097 891 849 748 464 439 257 230 42453 2442 397 29 32681 2517 903 --
NM_032539chrX4767 237 201 100 --194 --
NM_032552chr981856 1795 1685 1245 787 242 159 107 21657 281 ----
NM_032569chr1661788 1366 792 488 55 36 1477 21476 169 1442
NM_032575chr1671531 1349 711 510 418 304 296 41363 363 328 247 51950 512 462 306 281 12025
NM_032581chr731501 235 132 --41896 1308 237 212 122
NM_032595chr1761367 1293 1180 561 118 85 41172 549 373 142 2468 53 11120
NM_032632chr1422029 811 11434 21545 813 11500
NM_032682chr363553 2961 1268 1170 265 88 ------
NM_032711chr17113892 3469 3323 3046 2787 2760 1615 1602 1253 125 72 1109 42834 2828 385 97 13472
NM_032741chr65405 270 121 102 23 --2876 44 --
NM_032780chr1111159 3940 862 814 1437 2466 56
NM_032826chr7105196 5106 4878 4062 3726 3694 3341 2074 1919 618 1420 21224 567 34442 3368 537
NM_032832chr61592 --41094 447 415 390 --
NM_032833chr131700 425 222 22155 1633 ----
NM_032836chr1941029 689 652 408 --2957 893 --
NM_032840chr128975 880 810 733 432 421 302 296 1402 130 1305
NM_032842chr71486 --1292 11301
NM_032873chr1164482 3946 3483 2952 1684 658 11699 23509 286 22898 321
NM_032918chr12----31113 57 46 --
NM_032924chr751108 1075 151 32 24 ------
NM_032960chr181392 1355 1349 1006 510 427 328 104 21399 1293 1949 11153
NM_032968chrX2524 232 --24087 2626 --
NM_032969chrX2524 232 --24087 2626 --
NM_032973chrY31362 524 232 --24079 2625 --
NM_032982chr772001 934 917 841 782 565 431 42423 2141 319 122 22079 1851 --
NM_032983chr742815 2110 1245 478 43237 2955 1133 936 22893 2665 12352
NM_032991chr421022 75 --2358 77 --
NM_032995chr231668 1107 492 1131 --2222 166
NM_032998chr131049 747 204 2904 161 3897 828 195 --
NM_033014chr951523 1354 1319 1113 435 --1503 --
NM_033016chr2261399 1243 563 264 189 94 11360 31511 341 96 1145
NM_033018chrX51093 880 866 134 81 ----11100
NM_033020chr174508 4270 3662 3644 3349 746 432 ----13647
NM_033089chr20146 21136 510 2504 348 --
NM_033127chr12542 517 270 31 1544 --
NM_033129chr20131972 1771 1709 1703 1558 1503 1480 530 402 299 233 203 100 32016 551 194 31333 325 152 1469
NM_033133chr17123733 3610 3527 3519 2836 2648 2617 1359 1298 725 612 544 11515 1179 13720
NM_033136chr561526 1221 691 539 463 258 --2541 159 1572
NM_033137chr561526 1221 691 539 463 258 --2541 159 1572
NM_033141chr1441404 1377 447 337 2461 265 11502 21852 1511
NM_033147chr23271 231 100 ----186
NM_033148chr23271 231 100 ----186
NM_033161chr961804 1535 1336 471 387 101 1246 21463 107 --
NM_033181chr643671 2794 1276 187 ------
NM_033224chr7107681 7545 6699 5974 5548 5413 2907 2051 62 45 12765 26222 912 15416
NM_033225chr883029 2858 2611 1991 1112 610 576 85 1374 1957 1775
NM_033259chr32592 331 --1736 1897
NM_033274chr5123343 3181 2911 2352 1378 1258 936 699 596 584 146 106 33349 287 118 73116 3000 1079 1046 822 811 22 1939
NM_033285chr831493 1163 1090 11198 13194 34016 1166 574
NM_033290chrX41205 920 912 153 23023 929 ----
NM_033309chr1641013 271 85 55 ----1840
NM_033315chr17152205 2126 2102 2072 2018 1992 1809 1785 1389 1381 881 491 451 391 354 21815 1638 12207 --
NM_033326chr1142302 1695 1629 155 11822 --11904
NM_033331chr963156 3093 2930 2419 948 924 12743 52755 2710 2300 1072 852 --
NM_033360chr1244222 972 703 297 ------
NM_033364chr3----11355 171
NM_033375chr1791122 512 476 467 447 380 351 147 49 1130 11416 --
NM_033380chrX51092 954 929 790 259 ------
NM_033381chrX51092 954 929 790 259 ------
NM_033389chr1774012 3861 3315 1409 838 807 638 11004 1409 14140
NM_033419chr1771546 1324 1179 1171 1045 413 322 1440 51225 1206 504 307 64 --
NM_033425chr1143005 2237 1346 126 --13397 --
NM_033426chr1442239 521 433 71 --22241 1988 --
NM_033429chr1553148 2875 2515 822 26 --22877 2824 --
NM_033430chr414157 ----24018 1546
NM_033437chr414157 ----24018 1546
NM_033449chr562080 1876 1831 1640 1323 185 41494 1461 1365 731 11679 22146 323
NM_033503chr1562572 2540 2384 1429 1256 1248 33028 2604 2400 53855 2762 2509 2386 1033 11177
NM_033505chr276578 6276 5642 2650 2094 1008 627 --42441 932 720 521 35635 1026 59
NM_033512chr832737 1883 1005 21139 337 41212 1196 1167 1147 12299
NM_033551chr5113168 3150 2664 2242 2169 2108 963 650 641 402 196 --42940 863 549 202 --
NM_033624chr1242162 1703 673 660 21665 170 1343 1797
NM_033626chrX51481 458 407 395 284 1511 --11754
NM_033631chr173921 3471 1510 1440 990 974 680 2998 217 2984 510 11376
NM_033632chr421357 313 --21426 59 --
NM_033637chr10163991 3808 3328 3280 3146 1529 1195 1053 735 650 479 404 313 286 276 117 2904 668 33823 1499 556 23430 1395
NM_033642chrX1986 1335 --1989
NM_033644chr52478 213 1691 12075 1250
NM_033645chr52478 213 1691 12075 1250
NM_033656chr2155484 1523 1413 1040 950 14923 1524 1953
NM_052840chr1551606 1515 1444 1111 287 1583 21458 567 --
NM_052845chr1293031 2629 2326 2086 900 821 717 163 33 1211 ----
NM_052854chr114463 455 196 168 1430 ----
NM_052885chr1243118 3014 1927 903 --21816 978 --
NM_052896chr132057 1937 83 2424 60 32530 1997 1963 --
NM_052897chr122655 600 1296 2682 590 2265 144
NM_052898chr851875 1788 1378 504 256 ------
NM_052906chr22165045 4995 4980 4914 4792 4696 4690 4534 3856 3612 3097 2023 1860 1698 1176 986 44258 4238 3599 586 34776 3557 1250 15003
NM_052910chr1331914 1497 182 21815 52 31450 1349 399 11404
NM_052917chr293015 3008 2944 2699 2617 2609 2500 2388 164 --33066 2925 2726 12996
NM_052918chr1072616 1304 1267 896 884 679 428 12276 11017 --
NM_052925chr197998 984 883 862 737 664 147 --6990 972 856 766 714 706 --
NM_052934chr182265 1858 1834 1427 880 148 136 125 31750 502 110 2773 160 --
NM_052953chr3------177
NM_052978chr1441932 1394 299 96 ----21788 1240
NM_053016chr998007 7174 7049 7014 5197 2358 1037 218 160 35592 4893 1353 25302 4934 27081 7017
NM_053023chr11173165 3058 3043 2793 2594 2585 2344 2156 2010 1283 648 620 562 402 321 193 171 12364 2578 179 --
NM_053024chr341465 334 176 137 --11001 --
NM_053025chr341252 707 419 324 --1543 1454
NM_053026chr341252 707 419 324 --1543 1454
NM_053027chr341252 707 419 324 --1543 1454
NM_053028chr341252 707 419 324 --1543 1454
NM_053031chr341252 707 419 324 --1543 1454
NM_053032chr341252 707 419 324 --1543 1454
NM_053043chr7115935 5620 5598 5489 4467 4131 4069 3942 1108 992 129 14152 13927 26206 5798
NM_053056chr1152387 2376 122 78 67 --1157 --
NM_053279chr851875 832 709 292 95 1160 11089 --
NM_054013chr55892 810 783 740 567 1754 1827 --
NM_054025chr1172092 2084 1370 705 76 58 25 21607 740 11396 11671
NM_054027chr591782 1657 853 720 641 506 398 302 90 --2855 69 11800
NM_054035chr173800 690 683 --145 1645
NM_057161chr63374 360 24 --4450 354 214 187 --
NM_057169chr1222383 418 21062 771 12624 12645
NM_057170chr1222383 418 21062 771 12624 12645
NM_057178chr17112489 2337 2320 2214 2092 1124 929 885 853 407 338 --22216 309 --
NM_057749chr8----11198 1933
NM_058240chr1451272 374 269 80 44 31226 663 65 --11282
NM_078470chr1062621 2397 2281 907 345 199 --12577 --
NM_078471chr1731207 858 323 291 63 21247 425 --
NM_078487chr942433 2218 1199 355 42752 2366 668 317 ----
NM_078625chr631082 505 219 --11048 1332
NM_079834chr19101646 1426 1214 1197 554 499 369 197 100 39 21578 1230 ----
NM_080391chr14501 488 434 411 --2509 472 --
NM_080392chr14550 537 483 460 --2558 521 --
NM_080415chr172857 634 2698 27 1658 --
NM_080425chr201116 --2232 123 --
NM_080426chr201116 --2232 123 --
NM_080491chr1193360 3247 3192 2714 2489 1529 1471 857 61 43433 2848 2629 850 3398 160 86 13378
NM_080538chr351404 1061 1042 287 53 21342 244 11510 --
NM_080539chr351404 1061 1042 287 53 21342 244 --11511
NM_080541chr351404 1061 1042 287 53 21342 244 11510 --
NM_080546chr942090 1818 721 406 1767 --1518
NM_080599chr101961 163 --1964
NM_080607chr205945 801 770 691 389 3760 405 350 1693 1877
NM_080621chr2071283 1073 1022 893 846 320 260 31015 438 380 21275 357 --
NM_080625chr202909 829 1903 130 1954
NM_080654chr1171105 370 345 264 246 114 106 --1116 --
NM_080666chr1431618 1542 1528 --11652 21665 1531
NM_080669chr1784859 4823 3178 3015 1982 1492 915 577 14017 23184 268 11320
NM_080671chr242277 1760 1625 846 1731 12279 --
NM_080676chr2062694 2501 2082 1084 895 137 ------
NM_080717chr1231339 530 363 --1570 1314
NM_080759chr1352256 1895 556 347 170 1426 ----
NM_080760chr1352256 1895 556 347 170 1426 ----
NM_080792chr2061952 728 677 398 200 148 1587 21487 487 --
NM_080836chr20143987 3969 3506 3463 3014 1878 1492 1162 759 457 402 228 127 48 54714 3555 3534 1322 78 93989 3915 3549 3244 2891 1456 1420 404 171 11165
NM_080867chr1453668 1679 1551 465 458 --14698 --
NM_080872chr843811 3772 3647 689 --1129 --
NM_080927chr332816 2427 449 ----23217 843
NM_080928chr74820 594 345 243 ----152
NM_130385chr1173151 2983 1179 1158 943 489 391 22932 2708 --160
NM_130438chr2161276 1004 995 282 267 192 2819 533 1295 --
NM_130440chr131379 667 519 1597 21218 373 --
NM_130442chr761156 882 458 329 200 126 --1465 --
NM_130446chr374096 3576 1685 1620 1102 947 123 169 ----
NM_130459chr9101539 1485 1420 1179 1113 628 601 415 185 91 31372 1138 515 193 --
NM_130463chr63898 647 314 2103 56 2782 38 2854 797
NM_130781chr52389 41 ----1430
NM_130797chr771283 696 684 239 174 75 64 21102 278 182 --
NM_130799chr113544 306 166 156 --1220
NM_130800chr113544 306 166 156 --1220
NM_130801chr113544 306 166 156 --1220
NM_130802chr113544 306 166 156 --1220
NM_130803chr113544 306 166 156 --1220
NM_130804chr113544 306 166 156 --1220
NM_130811chr201437 125 21147 978 --
NM_130830chr3133404 2938 2615 1529 1340 1140 1071 490 441 395 321 292 95 32902 1056 306 43442 3284 507 160 22729 284
NM_130847chr1185812 4830 4525 4500 4273 1570 1562 381 25771 5482 33924 2314 1181 --
NM_133170chr20198048 5940 5749 5734 5132 5046 3231 3136 3127 3113 2791 2733 2375 1730 1505 753 541 385 372 87779 7146 6667 5605 5075 2825 1427 620 15048 13116
NM_133171chr2051018 976 886 799 167 1817 1333 --
NM_133264chr1793505 3150 3055 2968 366 290 142 108 23 23392 2553 42523 2445 797 74 23722 237
NM_133265chrX2770 580 13574 2655 56 --
NM_133266chr1141065 791 312 153 2322 272 1862 --
NM_133330chr462777 650 558 480 370 270 22571 2528 32290 635 288 --
NM_133331chr462777 650 558 480 370 270 22571 2528 32290 635 288 --
NM_133334chr4126415 6323 6115 5991 5662 5032 4767 2399 1707 1554 1210 342 12509 ----
NM_133335chr462777 650 558 480 370 270 22571 2528 32290 635 288 --
NM_133367chr643105 2395 970 540 13306 ----
NM_133370chr443344 2439 544 273 22997 2914 22892 660 42785 2770 1180 496
NM_133445chr963215 1337 1198 1140 140 41 33060 1153 1090 --23542 3395
NM_133452chr1961191 914 874 360 279 259 --21172 1126 --
NM_133457chr751491 1353 1203 1006 213 1219 1523 --
NM_133478chr232517 1574 371 --1679 2482 218
NM_133493chr693760 3190 1168 627 616 432 385 310 275 --53560 3543 1836 1204 231 --
NM_133499chrX7936 632 239 203 181 173 64 1801 --2690 368
NM_133625chr341336 324 235 119 21029 437 1474 --
NM_133647chr1543331 2612 1004 596 154 33498 1250 902 23643 210
NM_134268chr1751156 1095 968 156 124 ----1954
NM_134325chr151800 1393 1369 499 415 41285 675 655 37 1308 --
NM_134421chr24738 694 495 99 1162 1185 --
NM_138270chrX83065 3046 2917 2254 1055 426 293 107 --13067 --
NM_138282chr63898 647 314 2103 56 2782 38 2854 797
NM_138288chr1421846 1797 11809 1790 --
NM_138300chr141649 1246 1137 40 31480 1366 1329 41592 575 523 337 21273 552
NM_138319chr1561184 1166 1115 825 402 121 --1369 162
NM_138328chr1793246 3176 2704 2645 2571 2414 2346 2250 1254 52742 2577 2474 2394 284 2743 359 13136
NM_138333chr952626 2478 1966 1043 128 22135 2020 --22610 216
NM_138338chr22103252 3225 3016 2763 2714 2696 2615 2135 1024 177 22754 156 ----
NM_138357chr1011355 --21582 1392 11615
NM_138375chr183860 340 113 --31228 490 298 --
NM_138426chr742313 1803 642 635 ------
NM_138434chr741502 1355 406 132 1113 11504 --
NM_138444chr1343478 1396 89 43 1304 33017 156 112 --
NM_138457chr6113290 3233 2875 2647 1113 962 944 917 796 325 280 93241 2449 2396 1190 1084 909 709 314 69 11332 --
NM_138459chr653376 2610 1039 1021 333 ----11284
NM_138468chr256220 4780 2046 1288 874 --24853 1078 --
NM_138473chr12104571 4494 4252 4130 3890 3800 1359 935 707 536 34232 4210 1314 65081 4987 4760 4295 3735 333 24637 4533
NM_138576chr1453541 3426 3208 3098 1123 13559 33858 3619 3531 --
NM_138578chr2081335 1118 946 570 473 453 205 59 21401 382 1443 --
NM_138621chr274077 3472 2932 1016 730 536 528 23007 2925 22620 312 13475
NM_138713chr16107416 7403 5565 5153 5142 2561 2505 1080 843 773 --77547 7390 5731 2578 1760 1154 1082 11044
NM_138714chr16107416 7403 5565 5153 5142 2561 2505 1080 843 773 --77547 7390 5731 2578 1760 1154 1082 11044
NM_138717chr63724 450 175 5597 514 211 185 119 ----
NM_138732chr116621 402 373 223 98 72 1920 1176 --
NM_138734chr116621 402 373 223 98 72 1920 1176 --
NM_138793chr1721787 1323 11311 31745 1396 644 --
NM_138923chrX4308 267 41 34 ----166
NM_138967chr15222385 2255 2032 1989 1908 1725 1716 989 979 944 932 921 629 615 600 583 556 539 259 112 106 99 52429 2007 1916 681 590 193 11732
NM_138971chr11113388 3367 3225 3163 3082 2398 1427 1034 1021 432 320 22643 1391 21445 33 21430 1024
NM_138971chr11113388 3367 3225 3163 3082 2398 1427 1034 1021 432 320 22643 1391 21445 33 21430 1024
NM_138972chr11113388 3367 3225 3163 3082 2398 1427 1034 1021 432 320 22643 1391 21445 33 21430 1024
NM_138972chr11113388 3367 3225 3163 3082 2398 1427 1034 1021 432 320 22643 1391 21445 33 21430 1024
NM_138973chr11113388 3367 3225 3163 3082 2398 1427 1034 1021 432 320 22643 1391 21445 33 21430 1024
NM_138973chr11113388 3367 3225 3163 3082 2398 1427 1034 1021 432 320 22643 1391 21445 33 21430 1024
NM_139012chr621892 386 1491 21875 786 1108
NM_139014chr621972 466 1571 21955 866 1188
NM_139067chr122319 23 ----170
NM_139071chr12101681 1655 1603 1432 1371 666 505 400 241 203 11324 51434 1417 1406 1039 481 --
NM_139125chr381343 1298 1261 1232 493 225 124 32 2635 594 11350 --
NM_139132chr1151093 835 361 119 57 2288 145 ----
NM_139135chr16912 355 225 175 162 21 --21246 128 --
NM_139177chr1741186 556 459 108 --11084 --
NM_139276chr1741924 1880 1599 1580 --1311 --
NM_139279chr262377 1255 1232 1201 1028 509 2666 522 12689 --
NM_139280chr1711050 11387 31367 1259 137 1151
NM_139283chr12----32399 840 47 --
NM_139312chr1021311 1179 11252 185 --
NM_139321chr2083180 2951 1485 1350 1318 749 734 725 21497 23 --43069 1529 1321 172
NM_139323chr2021753 593 11497 11444 11365
NM_144568chr143571 459 127 --1582 2557 210
NM_144571chr4106997 6335 5655 4356 4291 2750 2686 2639 1996 1980 --37013 6990 2202 11726
NM_144578chr1435330 5227 915 15237 35089 981 394 --
NM_144579chr272245 2176 1109 935 853 728 691 11176 ----
NM_144590chr1022485 1882 12405 2539 467 --
NM_144599chr1564534 4325 4141 3659 1832 1555 13578 13989 --
NM_144609chr174985 366 109 97 --125 2296 112
NM_144617chr195917 843 835 765 49 3932 879 695 1892 --
NM_144723chr55624 301 290 273 150 --1152 --
NM_144732chr194889 348 146 128 3936 724 364 2991 166 3911 423 46
NM_144778chr13----183 12666
NM_144967chrX3398 370 338 2419 377 ----
NM_144969chrX1546 1274 1267 --
NM_144973chr1254907 4039 3762 965 407 145 14041 --
NM_145008chr114809 766 128 44 --129 --
NM_145025chr67944 431 394 336 316 301 209 1416 ----
NM_145055chr18123715 3297 3233 2527 1400 1007 790 660 216 46 35 22 12508 2150 140 22530 219
NM_145056chr193269 129 26 1164 2325 248 --
NM_145112chr145492 228 215 177 55 2347 184 21310 118 --
NM_145113chr144500 487 449 327 2619 456 31582 390 40 --
NM_145117chr1173159 2278 1304 1259 1155 1068 34 22218 60 63172 2397 2377 948 940 447 --
NM_145176chr653387 2740 1108 162 156 --12232 11029
NM_145206chr1083070 3059 2554 2324 2261 1023 778 584 2705 119 11255 12243
NM_145239chr166489 481 466 414 242 63 --11184 --
NM_145259chr275057 4403 2854 1201 779 588 573 14725 44855 799 448 55 15391
NM_145296chr194815 606 582 48 4696 685 589 213 2623 112 --
NM_145307chr1022968 204 14254 13527 14164
NM_145320chr7113601 3299 2727 2715 2275 2244 1413 844 770 151 38 1379 22636 643 12278
NM_145321chr7113601 3299 2727 2715 2275 2244 1413 844 770 151 38 1379 22636 643 12278
NM_145322chr7113601 3299 2727 2715 2275 2244 1413 844 770 151 38 1379 22636 643 12278
NM_145349chr1762118 1856 1778 762 595 414 11789 --1360
NM_145350chr1741470 1208 1130 114 11141 ----
NM_145686chr273403 2892 2807 2530 1346 159 143 --12867 1310
NM_145687chr273403 2892 2807 2530 1346 159 143 --12867 1310
NM_145690chr851811 1736 1678 1621 139 --11747 11624
NM_145714chr162307 78 187 --145
NM_145733chr2231160 189 36 2820 164 1973 --
NM_145798chr175327 283 133 42 34 3802 647 216 3821 622 562 --
NM_145799chrX103039 2921 2050 483 452 396 367 355 289 265 33009 2095 1029 2710 108 1302
NM_145804chr1171067 1026 883 288 272 231 131 1121 1111 --
NM_145808chr792743 2559 2421 1974 1080 746 633 541 239 ------
NM_145888chr1991938 1647 1452 706 642 376 314 159 106 21577 697 2737 86 1178
NM_145899chr661296 1242 1080 949 916 240 31086 813 93 4848 433 398 217 --
NM_145901chr661296 1242 1080 949 916 240 31086 813 93 4848 433 398 217 --
NM_145902chr661296 1242 1080 949 916 240 31086 813 93 4848 433 398 217 --
NM_145903chr661296 1242 1080 949 916 240 31086 813 93 4848 433 398 217 --
NM_145904chr661296 1242 1080 949 916 240 31086 813 93 4848 433 398 217 --
NM_145905chr661296 1242 1080 949 916 240 31086 813 93 4848 433 398 217 --
NM_147150chr973644 3153 557 487 438 424 176 22860 2561 --23352 1384
NM_147164chr94491 459 434 428 --1199 --
NM_147175chrX1560 ----133
NM_147189chr831870 885 90 11852 22235 1975 --
NM_147202chr982631 2593 2507 2500 2399 2374 2163 1940 12145 52567 847 607 529 146 --
NM_147223chr21763 12192 --11785
NM_147233chr22870 580 12009 --11602
NM_148414chr164390 161 40 26 1170 1318 1128
NM_148415chr162330 101 1110 --168
NM_148416chr162307 78 187 --145
NM_148571chr1721495 256 1593 1586 11498
NM_148894chr45902 816 797 787 281 ------
NM_148904chr14488 254 180 174 --1182 --
NM_148905chr14488 254 180 174 --1182 --
NM_148906chr14488 254 180 174 --1182 --
NM_148907chr14488 254 180 174 --1182 --
NM_148908chr14488 254 180 174 --1182 --
NM_148909chr14488 254 180 174 --1182 --
NM_152221chr2261055 940 933 906 793 253 --11094 --
NM_152237chr2261533 1254 532 451 391 223 11159 21146 322 11138
NM_152253chr2224171 1505 44178 3707 1367 1271 --11023
NM_152265chr131294 1106 363 11056 31296 418 182 --
NM_152275chr241981 1965 1449 499 --11856 --
NM_152280chr173456 3073 2946 2744 2610 2308 331 22795 338 11229 22275 764
NM_152296chr194288 223 69 33 141 1250 --
NM_152344chr1741162 1123 954 296 --11449 --
NM_152345chr1741122 940 260 223 2730 248 11109 --
NM_152371chr151932 1855 1731 735 664 1200 ----
NM_152380chr141367 1249 574 67 --1561 --
NM_152387chr23421 195 26 138 ----
NM_152388chr283805 3065 2962 1333 880 837 779 415 --11205 --
NM_152409chr552492 2486 2455 2409 1376 --33021 2800 2462 --
NM_152424chrX164605 4599 4208 4126 4004 3965 3939 3869 3638 3216 1430 971 802 597 489 152 44554 4189 3823 3061 34202 3683 3645 24011 492
NM_152441chr126743 688 572 183 170 98 ----1538
NM_152455chr1562821 619 531 269 246 206 1967 1248 --
NM_152470chr1893197 2976 2866 2667 2641 1407 1220 934 47 23602 1251 --12984
NM_152520chr23816 403 225 1135 1235 --
NM_152527chr221838 612 --12340 --
NM_152538chr321520 1491 31315 444 203 1452 --
NM_152588chr1241601 1521 1515 484 129 ----
NM_152594chr1531448 947 174 --1560 --
NM_152608chr132003 585 131 1518 12005 --
NM_152622chr533295 2884 261 3316 283 269 ----
NM_152629chr994060 3822 2887 2682 1594 1124 1092 1001 521 23170 2981 12757 --
NM_152636chr1121923 734 --22705 40 --
NM_152653chr34592 256 215 178 1185 ----
NM_152666chr11747 ----1750
NM_152671chr22148 77 --1192 1138
NM_152695chrX42289 2123 1526 739 ------
NM_152699chr393412 2788 2471 1154 1069 875 765 433 159 22804 230 22473 517 --
NM_152704chr133211 118 53 ----1769
NM_152716chr1141521 1399 317 307 21450 1164 11472 3369 172 104
NM_152727chr164224 218 212 106 150 ----
NM_152734chr6145158 4640 4590 4399 4391 3781 3735 2186 1147 758 708 573 496 356 34574 2050 1582 35104 3602 714 11962
NM_152749chr731145 1017 389 1801 ----
NM_152754chr732580 1514 624 --21516 348 1627
NM_152756chr533323 1435 766 --12863 --
NM_152758chr872868 2272 2213 1883 961 948 596 --1679 --
NM_152787chrX33758 3047 184 --21562 1449 11494
NM_152789chr721253 24 --1450 --
NM_152835chr152434 578 553 324 141 ------
NM_152838chr2042744 2530 1316 633 --1920 --
NM_152857chr6131 --3272 208 201 --
NM_152858chr6131 --3272 208 201 --
NM_152860chr1291439 1426 1068 999 435 323 235 128 118 1383 --11023
NM_152862chr23356 265 109 ----1274
NM_152866chr1131964 1936 326 11494 22217 2112 --
NM_152897chr204930 286 230 43 1421 ----
NM_152924chr15145359 4743 4646 2715 1998 1439 1241 1086 643 578 357 303 207 54 54179 2378 1113 86 77 55848 4581 4539 1890 1560 12658
NM_153013chr542288 1761 1548 352 21744 1629 22290 359 12353
NM_153020chr621594 40 --21375 42 --
NM_153025chr169587 523 474 410 346 277 219 155 91 --21453 652 --
NM_153029chr16154117 3838 3820 3707 3538 3398 3383 3151 3057 2699 1488 1390 1086 1063 104 43308 3095 2687 2633 53906 2904 2816 2621 678 33893 3178 3078
NM_153035chr1102924 2839 2156 2106 2015 1966 554 456 418 115 ----1328
NM_153050chr22224750 4217 1940 1597 1516 1494 1376 1243 1113 1071 995 962 918 703 619 558 531 436 234 204 185 176 2903 504 11501 --
NM_153051chr22224750 4217 1940 1597 1516 1494 1376 1243 1113 1071 995 962 918 703 619 558 531 436 234 204 185 176 2903 504 11501 --
NM_153188chr575450 5057 3729 3441 2177 1409 492 --14040 --
NM_153234chr562415 1999 1933 1793 1748 704 1358 12121 --
NM_153246chr6111908 1870 1806 1760 1723 1685 1570 1455 1417 1318 441 51784 1612 1551 1535 185 41972 1647 1378 1339 1662
NM_153257chr1911047 --2777 302 1311
NM_153262chr162604 2547 1282 574 540 463 22914 248 --13009
NM_153266chr113923 647 359 2898 227 --1859
NM_153273chr3122462 2354 2251 1893 1815 1127 875 833 719 697 408 32 2627 417 12127 1918
NM_153350chr1681672 1502 1490 686 658 433 401 171 1479 ----
NM_153367chr1093778 3718 3088 2894 2647 1418 1163 469 60 23534 1205 21463 762 1952
NM_153371chr1311970 2472 370 --1574
NM_153442chr10145434 5414 5163 5002 4965 4844 4760 4751 4542 4250 4076 844 166 128 25406 1378 35217 852 669 11396
NM_153487chr6134404 4348 3836 3441 3374 3367 3302 3163 3051 1779 1136 1061 684 54764 4068 1600 761 399 33827 1226 686 23911 3796
NM_153499chr1262642 2560 2540 1870 797 50 --22850 2121 --
NM_153500chr1262642 2560 2540 1870 797 50 --22850 2121 --
NM_153605chr341310 1161 639 133 --11289 --
NM_153619chr1572460 2297 2282 1197 826 812 220 1470 32259 1091 923 --
NM_153620chr741139 704 638 351 11418 ----
NM_153631chr781623 1553 1396 1296 284 144 125 36 --1153 11634
NM_153632chr781623 1553 1396 1296 284 144 125 36 --1153 11634
NM_153645chr2262284 1325 1124 707 318 187 ----12294
NM_153649chr162152 1500 745 142 120 33 --1417 --
NM_153685chr12111128 1120 1056 1011 1002 988 881 798 792 440 305 1485 41114 1086 1067 1021 --
NM_153693chr123205 113 30 3332 172 62 2257 38 --
NM_153705chr1141788 787 760 698 22280 161 1109 --
NM_153759chr231150 271 256 --31040 992 262 --
NM_153810chr1094268 3732 3441 1965 1152 923 830 650 567 --1765 34318 570 324
NM_153827chr176712 695 609 290 281 45 1186 4566 512 248 82 1519
NM_153836chr221841 517 --1729 1577
NM_170600chr92266 130 1324 --168
NM_170607chr1741015 994 370 139 --41422 625 596 242 --
NM_170663chr176712 695 609 290 281 45 1186 4566 512 248 82 1519
NM_170665chr1274243 3805 3778 3470 3376 3126 572 21797 1789 --43574 3103 1295 529
NM_170674chr1531333 1075 119 ----1885
NM_170677chr1531333 1075 119 ----1885
NM_170679chr521174 274 --21087 276 --
NM_170692chr161162 921 802 716 322 192 --21154 880 1195
NM_170706chr1124112 1523 1428 1009 901 398 359 320 196 164 105 80 33854 3261 283 1590 14115
NM_170707chr17949 927 731 310 261 246 49 ----1626
NM_170708chr17949 927 731 310 261 246 49 ----1626
NM_170721chr175856 832 257 213 205 --21311 1286 11158
NM_170724chr61961 ----1932
NM_170743chr182318 1961 1948 795 684 428 181 96 3833 485 449 11175 --
NM_170769chr61683 4748 566 235 71 2673 632 1266
NM_171825chr5112968 2916 2520 2500 2349 2104 2085 281 246 225 201 42797 2355 538 412 62502 2373 1192 586 552 466 32202 103 78
NM_172016chr621382 1151 11135 21346 202 --
NM_172020chr742025 478 160 38 1529 2343 26 1507
NM_172069chr242358 1857 856 259 137 31680 321 266 11860
NM_172070chr21420 1899 1622 22034 298
NM_172071chr1126419 6329 6155 6149 5959 5496 2404 2300 1337 1310 564 421 15826 46353 6130 4846 4772 --
NM_172127chr451604 1476 1382 851 118 ----11365
NM_172128chr451560 1432 1338 807 74 ----11321
NM_172130chr111189 3585 275 146 140 2528 296
NM_172169chr1041613 1492 1417 1316 ----11420
NM_172170chr1041613 1492 1417 1316 ----11420
NM_172171chr1041613 1492 1417 1316 ----11420
NM_172173chr1041613 1492 1417 1316 ----11420
NM_172208chr641033 912 291 197 ----3964 881 317
NM_172211chr15893 785 761 736 90 1877 --1303
NM_172226chr1262642 2560 2540 1870 797 50 --22850 2121 --
NM_172230chr112223 83 1139 1982 1302
NM_172315chr1531333 1075 119 ----1885
NM_172316chr1531333 1075 119 ----1885
NM_172349chr52252 115 --179 1255
NM_173064chr182318 1961 1948 795 684 428 181 96 3833 485 449 11175 --
NM_173082chr641344 985 618 455 ------
NM_173156chr172069 1822 671 383 290 209 80 ------
NM_173167chr1772562 2297 1753 837 822 162 68 1445 1776 --
NM_173174chr87771 759 742 731 143 117 58 --1744 --
NM_173175chr87771 759 742 731 143 117 58 --1744 --
NM_173176chr87771 759 742 731 143 117 58 --1744 --
NM_173191chr1051079 1047 892 387 374 21284 289 --2377 350
NM_173192chr1051079 1047 892 387 374 21284 289 --2377 350
NM_173193chr1051079 1047 892 387 374 21284 289 --2377 350
NM_173194chr1051079 1047 892 387 374 21284 289 --2377 350
NM_173195chr1051079 1047 892 387 374 21284 289 --2377 350
NM_173214chr16107416 7403 5565 5153 5142 2561 2505 1080 843 773 --77547 7390 5731 2578 1760 1154 1082 11044
NM_173358chrX2574 561 1486 1399 1500
NM_173359chr371674 1591 1464 1391 1221 367 338 --11223 11294
NM_173468chr452106 1705 864 672 30 ------
NM_173470chrX52167 2138 726 444 75 1489 --11883
NM_173475chr1661674 1578 1543 1292 1168 673 21569 219 --1676
NM_173491chr52991 911 --21288 102 11446
NM_173510chr2262474 924 906 885 667 343 ----1888
NM_173511chr283920 2845 2466 1507 952 576 510 151 11490 11041 1611
NM_173519chr832058 1442 205 1118 1259 21445 208
NM_173527chr141742 --1630 1485
NM_173552chr332456 707 28 --22148 457 --
NM_173595chr12315237 5141 4982 4967 4768 4723 4486 4354 4213 4149 3927 3646 3244 3211 2103 2004 1847 1752 1603 1562 1445 834 660 507 501 437 393 359 336 325 22 85219 4774 4691 3638 3447 2023 1635 277 125168 4636 4314 4205 3789 3593 3586 1160 997 726 366 305 21872 573
NM_173642chr1189173 8745 8683 8573 7911 7533 5975 2677 2506 2383 2175 1542 1446 1190 1014 549 514 46 28758 8171 58715 7400 5658 1363 905 38481 5987 2144
NM_173653chr331007 559 183 1900 1371 --
NM_173808chr154459 4300 1626 915 400 --14502 --
NM_173822chr271790 1759 1654 833 587 265 177 1753 1746 --
NM_173825chr352976 2876 2111 558 352 1709 22840 2827 --
NM_173829chr586117 5965 5579 4672 4569 2446 2209 147 --22346 2173 --
NM_173833chr841241 1168 318 167 --3492 457 169 --
NM_173851chr853724 2842 604 303 23 13355 ----
NM_173854chr172087 1800 1473 971 800 670 30 3866 760 78 62255 1935 1479 776 729 66 21966 24
NM_174902chr1151524 1290 1186 686 230 21167 154 1145 --
NM_174911chr8113927 3754 2949 2684 2522 1134 1118 1040 1028 254 230 22507 670 41109 830 79 68 --
NM_174934chr11113403 1347 1106 1034 983 921 871 605 310 275 167 22632 545 32833 932 576 21199 344
NM_175056chr331615 1440 747 --1364 --
NM_175058chr112461 245 156 --11046
NM_175061chr741656 1519 823 267 ----21346 270
NM_175063chr194430 215 176 33 21191 339 2369 223 --
NM_175611chr21141 ----1239
NM_175623chr1276407 6046 5196 5070 4911 4676 1058 13085 1111 --
NM_175629chr231150 271 256 --31040 992 262 --
NM_175733chr1141708 1679 628 574 32160 1950 1727 11695 --
NM_175736chr12267292 6671 6663 6597 6426 6237 6057 5599 5479 5381 4998 4863 4781 4772 3024 2537 2389 2260 1925 1817 1331 856 828 766 677 364 55958 5589 5281 2458 310 57622 6404 6120 6059 2709 12753
NM_175747chr61893 ----2815 266
NM_175852chr162827 2418 2284 2190 1928 1880 12734 32037 1869 637 12500
NM_175861chr1285774 4892 4301 2261 2249 2237 1360 576 35399 4673 2228 15688 45918 4895 3935 1894
NM_175866chr1132 --11175 11185
NM_175876chr152329 2078 692 621 421 ----21129 556
NM_175898chr1541579 1277 585 42 2323 254 1577 1470
NM_175907chr184970 675 168 148 --32051 544 206 12313
NM_175931chr1671645 1616 1496 1432 1306 359 343 21626 600 1524 --
NM_176792chr1071410 1366 1110 914 458 374 152 --2921 141 1461
NM_176801chr481850 1721 1612 699 592 478 76 63 --21361 742 --
NM_176814chr71571 ----1939
NM_176815chr352738 1113 985 133 40 --134 --
NM_176863chr17122166 2147 1919 1575 1539 792 706 486 466 441 313 209 --31519 1512 303 11804
NM_176871chr873053 2982 2751 2695 2322 1251 371 23020 2494 22432 1133 13354
NM_176880chr194356 177 102 86 258 24 --2450 152
NM_177401chr1931370 1288 304 41329 1197 320 113 2407 251 11240
NM_177414chr131174 608 580 ----11177
NM_177424chr142120 2084 1315 238 1748 ----
NM_177438chr1452866 1602 932 410 236 --23341 1395 --
NM_177441chr175566 537 187 158 37 1125 1308 --
NM_177452chr1472129 1956 1577 987 773 764 720 --11864 --
NM_177559chr2051015 779 426 296 226 1792 21004 277 21022 384
NM_177560chr2051015 779 426 296 226 1792 21004 277 21022 384
NM_177972chr11114182 4164 4153 3647 3570 3330 2755 1599 1581 1404 681 32745 1270 831 11329 --
NM_177977chr17131932 1917 1896 1874 1857 1791 1685 1383 1362 578 514 189 113 1302 1272 --
NM_177996chr20103065 2412 2173 721 672 663 657 463 406 81 23373 581 73046 2825 2509 2378 1273 735 357 1743
NM_178011chr1043222 2808 2792 112 12758 12766 --
NM_178013chr14102597 2237 2112 1208 991 939 657 499 422 257 62676 1192 1157 982 972 930 32283 575 366 --
NM_178014chr64621 286 67 37 3853 641 74 2899 657 --
NM_178026chr203488 161 58 134 --2413 67
NM_178037chr1282718 2251 2225 1086 1050 1038 821 141 11408 22730 1321 23112 991
NM_178038chr1282718 2251 2225 1086 1050 1038 821 141 11408 22730 1321 23112 991
NM_178039chr1262353 1159 721 685 673 456 11043 42365 1310 1141 956 22747 626
NM_178040chr1262353 1159 721 685 673 456 11043 42365 1310 1141 956 22747 626
NM_178123chr2------1367
NM_178126chr1772023 1420 1411 866 538 169 93 21826 228 3374 295 48 --
NM_178151chrX157545 6996 6668 6106 5840 5820 5627 5607 5541 5033 5019 4934 2778 783 175 12575 25662 2701 37655 3087 1620
NM_178152chrX157545 6996 6668 6106 5840 5820 5627 5607 5541 5033 5019 4934 2778 783 175 12575 25662 2701 37655 3087 1620
NM_178153chrX157545 6996 6668 6106 5840 5820 5627 5607 5541 5033 5019 4934 2778 783 175 12575 25662 2701 37655 3087 1620
NM_178229chr13914 783 80 1136 1370 1679
NM_178426chr182223 2209 1620 600 233 202 192 67 --3696 249 86 22370 209
NM_178427chr172123 2109 1520 500 133 102 92 --2596 149 22270 109
NM_178441chr1481349 1333 1118 442 395 358 135 80 --2565 491 1138
NM_178502chr122547 68 1166 2493 239 1159
NM_178505chr1032540 1108 412 23257 77 --11297
NM_178578chr2072440 971 832 569 400 241 42 1686 32252 2134 34 --
NM_178585chr442375 2248 2145 54 1536 1255 --
NM_178586chr1422120 1759 ----1318
NM_178858chr1081256 1117 508 480 244 230 78 51 21262 407 2400 85 --
NM_178860chr174639 350 156 91 1773 1722 --
NM_178863chr167410 398 154 110 58 48 26 --160 --
NM_180976chr65973 388 374 344 171 1266 1178 --
NM_180977chr65973 388 374 344 171 1266 1178 --
NM_181077chr1531466 933 735 ----1578
NM_181332chrX21800 28 11865 2945 811 --
NM_181351chr1131845 1177 289 12421 1895 --
NM_181356chr64878 667 425 148 --2783 669 2686 655
NM_181357chr1431189 478 56 1700 2161 68 --
NM_181358chr161617 1601 1005 534 82 41 23558 1383 23977 1611 --
NM_181359chr172009 1721 878 790 779 96 87 51924 1835 634 210 111 ----
NM_181443chr202308 275 ----22544 952
NM_181458chr2------1163
NM_181481chr1872816 2663 2313 1943 1148 1139 448 21432 978 24708 4306 --
NM_181482chr1872816 2663 2313 1943 1148 1139 448 21432 978 24708 4306 --
NM_181483chr1872816 2663 2313 1943 1148 1139 448 21432 978 24708 4306 --
NM_181486chr1231339 530 363 --1570 1314
NM_181491chr982806 2402 2380 2363 960 849 278 193 13020 22212 306 11081
NM_181505chr174710 552 533 504 2681 53 2701 94 1231
NM_181521chr16207018 6828 6628 6074 6057 6050 6039 4623 2897 2833 2291 2022 1722 1285 663 627 193 142 64 22 11530 77139 6318 5659 5406 5337 2835 1287 --
NM_181643chr141554 1389 1379 497 1446 ----
NM_181670chr122256 237 ----1553
NM_181672chrX62093 1269 699 668 651 264 --11845 --
NM_181673chrX62093 1269 699 668 651 264 --11845 --
NM_181689chr204881 814 734 98 --3591 584 108 --
NM_181702chr82345 102 ----1105
NM_181714chr66745 733 592 557 550 465 ------
NM_181715chr1122 141 3354 67 59 --
NM_181784chr242284 959 613 185 --51931 1046 331 74 22 --
NM_181809chr1123462 3445 3170 3016 2819 1494 1116 1074 894 871 347 175 --33279 1202 956 --
NM_181833chr22103534 3473 3345 2963 2875 1382 1089 1063 729 37 1787 43475 2607 2368 981 2438 130
NM_181836chr512203 ----12133
NM_181838chr531406 1198 626 --21498 113 --
NM_181839chr821341 181 ----1869
NM_181844chr1761313 551 399 391 282 70 1209 31854 1846 1837 --
NM_181861chr1262667 1113 977 679 439 168 ------
NM_181868chr1262667 1113 977 679 439 168 ------
NM_181869chr1252752 1062 764 524 253 ------
NM_181876chr432048 989 659 --31937 880 424 1914
NM_181897chr362693 2570 1864 357 214 104 1183 1894 --
NM_182470chr151548 123 --2551 48
NM_182471chr151548 123 --2551 48
NM_182485chr442703 2510 2361 249 ------
NM_182493chr1654877 4365 3957 3919 2146 1383 23959 1055 14282
NM_182503chr654862 4142 3690 3430 395 24679 2214 33812 2042 1982 --
NM_182507chr12122278 2245 2070 2032 1959 1899 1826 1729 1620 731 671 534 1327 1656 --
NM_182509chr1451518 1495 1253 564 411 1605 11534 21414 1035
NM_182547chr71276 ----154
NM_182557chr11122041 2034 1784 1583 1536 1504 1420 702 501 453 442 254 3527 388 247 42074 711 679 68 11734
NM_182580chr162445 1969 1837 1724 921 621 1566 32424 2292 2271 12371
NM_182643chr852387 2224 1558 932 809 ------
NM_182646chr442703 2510 2361 249 ------
NM_182700chr771693 695 311 222 90 38 27 2664 320 ----
NM_182705chr174860 650 353 36 ----1261
NM_182717chr10------1391
NM_182720chr10------1391
NM_182721chr10------1391
NM_182722chr10------1391
NM_182723chr10------1391
NM_182728chr1451505 1317 1164 574 290 31497 1431 1192 51658 1633 498 346 35 11649
NM_182757chr673513 2697 2683 2606 711 599 89 ------
NM_182763chr142759 1832 494 476 12523 ----
NM_182764chr2051018 976 886 799 167 1817 1333 --
NM_182830chr14--12000 1585 2629 102
NM_182853chr10------1391
NM_182898chr7105999 5865 4203 2466 1417 680 612 576 491 234 14786 11577 --
NM_182899chr7105999 5865 4203 2466 1417 680 612 576 491 234 14786 11577 --
NM_182907chr662304 2190 2176 827 806 750 --21902 123 2960 753
NM_182936chr1451272 374 269 80 44 31226 663 65 --11282
NM_182948chr142961 676 655 255 --22621 662 --
NM_182964chr1173159 2278 1304 1259 1155 1068 34 22218 60 63172 2397 2377 948 940 447 --
NM_182970chr20154184 3888 3736 3652 3416 2898 2829 2693 1679 1527 1508 1264 598 301 192 2198 107 34194 540 325 24187 3898
NM_183002chr1451272 374 269 80 44 31226 663 65 --11282
NM_183004chr1421311 524 --1964 151
NM_183006chr2061136 573 468 408 248 170 --11528 1417
NM_183011chr10------1391
NM_183012chr10------1391
NM_183013chr10------1391
NM_183050chr631919 311 285 11681 12235 --
NM_183078chr643467 911 782 422 --23010 2977 11404
NM_183238chr1283362 2526 2429 2407 2386 916 605 567 32879 2678 200 33529 2637 2532 12410
NM_183360chr23271 231 100 ----186
NM_183361chr23271 231 100 ----186
NM_183380chr6------1795
NM_183398chr52878 40 1303 --1399
NM_183399chr52878 40 1303 --1399
NM_183400chr52878 40 1303 --1399
NM_183401chr52878 40 1303 --1399
NM_183416chr121748 506 --21519 248 --
NM_194071chr7214900 4864 4224 4092 3655 3448 3429 2028 1875 1549 1517 1349 1156 1132 714 447 218 174 154 79 29 34921 1166 682 24158 1745 --
NM_194247chr253737 3573 2827 2789 940 --32918 942 574 --
NM_194278chr14123771 3711 3253 2711 1489 1095 1064 885 816 794 728 576 33393 3282 1671 33197 3167 810 --
NM_194282chr411048 13063 --12581
NM_194283chr553203 3165 2688 2665 700 23703 2917 ----
NM_194285chr1133044 1102 865 1881 --11082
NM_194286chr12185882 5812 5796 4826 4509 4334 4147 4049 3853 1931 1632 1617 1558 1395 1262 1079 997 525 66092 4858 2448 917 362 54 44436 4375 2326 393 35864 4495 1695
NM_194313chr961581 1562 709 650 257 85 21332 197 1173 --
NM_194328chr963028 2308 675 607 260 38 --22668 681 --
NM_194329chr963028 2308 675 607 260 38 --22668 681 --
NM_194330chr963028 2308 675 607 260 38 --22668 681 --
NM_194332chr963028 2308 675 607 260 38 --22668 681 --
NM_194434chr1854143 4123 3922 1695 1689 15146 35134 1979 475 --
NM_194449chr181679 161 3823 667 232 1104
NM_197941chr572978 2373 2168 2050 932 907 613 12274 ----
NM_197956chr971649 1636 1524 548 499 191 111 --1454 --
NM_198040chr14495 425 114 41 31158 305 154 4814 460 412 291 1257
NM_198056chr361828 1780 1770 1716 655 522 11536 2849 734 --
NM_198120chr8----1501 1148
NM_198204chr1741015 994 370 139 --41422 625 596 242 --
NM_198205chr1741015 994 370 139 --41422 625 596 242 --
NM_198225chr10--1528 --1132
NM_198236chr18976 805 738 432 399 202 95 39 1814 2388 204 --
NM_198240chr1231018 927 166 --11272 --
NM_198256chr232002 1421 334 21500 762 11526 --
NM_198268chr161617 1601 1005 534 82 41 23558 1383 23977 1611 --
NM_198269chr161617 1601 1005 534 82 41 23558 1383 23977 1611 --
NM_198291chr2061806 1568 755 261 250 138 21583 370 21752 1430 --
NM_198324chr1241108 1057 1047 180 1476 21101 198 11236
NM_198334chr117925 728 659 596 314 221 174 2340 197 --1233
NM_198335chr117925 728 659 600 314 221 174 2340 197 --1233
NM_198390chr1631392 1386 614 --31859 1720 1434 --
NM_198392chr691945 1499 842 779 652 593 372 219 35 2505 213 --11452
NM_198395chr53899 174 160 ----1325
NM_198399chr32659 82 11555 1690 --
NM_198490chr3123268 3033 2635 2617 2479 2425 2197 994 561 333 299 49 43298 1338 942 34 23011 2400 12782
NM_198503chr12746 181 ----12022
NM_198513chr82705 144 --180 11482
NM_198560chr393469 3121 2665 1417 1324 1088 759 535 272 32466 1456 225 41388 1331 1296 1126 12423
NM_198568chr641062 293 154 91 2863 52 ----
NM_198581chr277255 5860 5571 4945 2743 2323 2286 37058 4706 1089 27460 2863 25244 2326
NM_198595chr4164223 4113 3736 3715 3378 3254 3190 3156 1930 1521 1296 1272 1134 1039 806 540 45051 1650 1399 152 33470 1796 1778 21524 1046
NM_198679chr9102142 1857 1006 964 955 945 382 323 298 183 22194 906 31950 966 542 --
NM_198686chr1482572 2207 887 749 594 553 488 279 21842 773 11879 4757 528 373 184
NM_198793chr392917 2652 2551 2538 2523 1128 897 775 733 13093 21104 628 11135
NM_198834chr1751987 1948 1551 181 130 22016 245 ----
NM_198836chr1751987 1948 1551 181 130 22016 245 ----
NM_198837chr1751987 1948 1551 181 130 22016 245 ----
NM_198838chr1751987 1948 1551 181 130 22016 245 ----
NM_198839chr1751987 1948 1551 181 130 22016 245 ----
NM_198844chr171791 ----1939
NM_198859chr344891 4521 4317 1561 24840 3795 --14914
NM_198889chr41242 1183 2251 244 --
NM_198896chr1191764 1754 1713 1706 1484 453 444 416 98 --11771 1859
NM_198900chr12267292 6671 6663 6597 6426 6237 6057 5599 5479 5381 4998 4863 4781 4772 3024 2537 2389 2260 1925 1817 1331 856 828 766 677 364 55958 5589 5281 2458 310 57622 6404 6120 6059 2709 12753
NM_198904chr511549 1429 1726 1521
NM_198935chr2042719 2184 2113 264 1580 1402 --
NM_198956chr771693 695 311 222 90 38 27 2664 320 ----
NM_198993chr1751468 1219 607 398 113 21723 1454 31586 359 102 1349
NM_199003chr81334 11109 --1946
NM_199054chr1961607 1527 1392 762 290 278 3604 491 41 41803 1332 481 445 11610
NM_199072chr772542 2476 2183 890 843 832 280 ------
NM_199076chr1071201 1154 1131 994 845 497 280 ------
NM_199138chr133211 118 53 ----1769
NM_199144chr2021056 625 1579 3381 36 30 --
NM_199160chr951554 312 210 151 104 --1106 1315
NM_199169chr20163453 3358 3170 3025 2978 2781 2603 2246 1449 1249 1237 1007 964 852 781 119 12359 31430 1413 875 23005 1324
NM_199170chr20163453 3358 3170 3025 2978 2781 2603 2246 1449 1249 1237 1007 964 852 781 119 12359 31430 1413 875 23005 1324
NM_199171chr20163453 3358 3170 3025 2978 2781 2603 2246 1449 1249 1237 1007 964 852 781 119 12359 31430 1413 875 23005 1324
NM_199203chr2021056 625 1579 3381 36 30 --
NM_199245chr12102354 2249 2118 2019 2010 1045 641 524 426 342 42211 573 505 491 72362 1893 1709 1657 539 180 47 1675
NM_199262chr17102272 2222 2156 2073 1929 1898 1476 1461 543 254 22046 872 61712 1483 945 804 256 237 --
NM_199320chr42827 793 ----12166
NM_199320chr42827 793 ----12166
NM_199321chr171791 ----1939
NM_199324chr452827 2676 2645 1190 106 13282 23319 955 --
NM_199421chr1453668 1679 1551 465 458 --14698 --
NM_199437chr1141927 1796 1637 596 ------
NM_199438chr1141927 1796 1637 596 ------
NM_199439chr1141927 1796 1637 596 ------
NM_199454chr1104347 3868 3730 3617 3596 3506 1607 1386 1303 116 63515 3103 1327 1096 1060 898 33230 1461 976 --
NM_199462chr183833 3665 3532 1762 1690 1589 1546 576 --21411 45 13514
NM_199478chrX51832 1611 1381 761 175 171 --11614
NM_199482chr231926 720 683 11564 --1462
NM_199487chr206891 426 311 228 213 152 31040 964 258 1844 --
NM_201263chr1----12073 11490
NM_201266chr2102751 2677 2433 2366 2223 2174 1194 874 835 425 --21024 876 --
NM_201278chr1142269 1970 1586 463 --22171 1769 --
NM_201279chr2102751 2677 2433 2366 2223 2174 1194 874 835 425 --21024 876 --
NM_201281chr1142269 1970 1586 463 --22171 1769 --
NM_201348chr1164401 4264 4138 3329 3246 1760 1676 1127 1032 909 513 462 403 295 251 88 64293 3584 1319 998 417 311 --1101
NM_201428chr1121367 151 --11422 1142
NM_201429chr1121367 151 --11422 1142
NM_201430chr1131293 603 77 --11348 168
NM_201432chr17216324 6155 6022 5977 5565 5084 4899 4348 4292 4189 4171 4036 2477 2459 2134 1484 1378 1256 957 751 512 44505 4492 1039 171 55673 2183 2123 1350 1258 46363 4295 740 357
NM_201433chr17216324 6155 6022 5977 5565 5084 4899 4348 4292 4189 4171 4036 2477 2459 2134 1484 1378 1256 957 751 512 44505 4492 1039 171 55673 2183 2123 1350 1258 46363 4295 740 357
NM_201520chr1731749 1410 283 11364 123 1542
NM_201567chr341465 1277 213 47 --139 --
NM_201568chr172069 1822 671 383 290 209 80 ------
NM_201569chr172069 1822 671 383 290 209 80 ------
NM_201570chr102381 225 --11453 11386
NM_201571chr102381 225 --11453 11386
NM_201572chr102381 225 --11453 11386
NM_201590chr102381 225 --11453 11386
NM_201591chr42663 170 ----1666
NM_201592chr42663 170 ----1666
NM_201593chr102381 225 --11453 11386
NM_201596chr102381 225 --11453 11386
NM_201597chr102381 225 --11453 11386
NM_201599chrX31104 1084 135 41021 451 226 61 1882 1896
NM_201632chr5--3591 584 63 --11200
NM_201634chr5--3690 683 162 --11299
NM_201995chr115604 184 178 162 130 --2628 618 --
NM_201998chr115669 249 243 227 195 --2693 683 --
NM_203305chr9102507 2454 2393 2123 1989 731 661 646 469 226 21947 121 179 1832
NM_203318chr1731207 858 323 291 63 21247 425 --
NM_203327chr20103915 3845 3443 3239 1685 1430 564 520 317 267 24193 991 11005 --
NM_203342chr142271 792 450 436 1374 32412 1113 634 42665 2420 2274 39
NM_203343chr142271 792 450 436 1374 32412 1113 634 42665 2420 2274 39
NM_203346chr282079 1853 1737 1459 731 432 419 410 41926 1800 477 172 32153 1879 116 --
NM_203372chr2198 --1200 11085
NM_203379chr103738 287 196 1922 192 --
NM_203380chr103738 287 196 1922 192 --
NM_203417chr212624 159 ----21179 493
NM_203418chr212624 159 ----21179 493
NM_203434chr951186 799 474 465 241 ----11189
NM_203446chr2151845 721 413 381 266 1708 11886 --
NM_203458chr133723 3197 1499 32724 226 191 ----
NM_203459chr111893 --12616 11896
NM_203504chr442083 1679 806 427 --11837 22086 167
NM_203505chr442083 1679 806 427 --11837 22086 167
NM_203506chr1772066 2046 1941 1878 1836 1807 1602 --1250 22037 500
NM_205768chr131557 1290 1278 --2388 336 --
NM_205848chr182707 2661 2222 2043 1885 777 733 725 22246 323 11825 22508 752
NM_205860chr121974 490 32555 1172 736 12538 1425
NM_205861chr181587 1358 1345 807 688 522 110 58 2571 212 21443 356 --
NM_206594chr110493 476 464 447 428 364 307 249 211 195 --2436 384 1162
NM_206595chr110493 476 464 447 428 364 307 249 211 195 --2436 384 1162
NM_206852chr142286 103 --2288 95 --
NM_206853chr621602 1428 --21012 701 --
NM_206854chr663561 3545 1248 1220 687 565 --11962 23548 196
NM_206855chr674526 4510 4205 2213 2185 1652 1530 134 1140 24513 1161
NM_206857chr142286 103 --2288 95 --
NM_206866chr2162758 1141 702 643 156 38 --23218 704 --
NM_206876chr253483 3201 2395 507 443 --23203 1032 --
NM_206907chr543185 1035 798 493 --33172 1167 600 13188
NM_206909chr8177959 7836 7790 7155 6989 6870 6754 6257 6228 5474 3233 3002 2738 2732 2492 2112 1233 --37225 1717 1517 --
NM_206914chr1241572 1432 480 112 --41919 508 501 170 --
NM_207043chr151883 1722 794 302 23 ------
NM_207044chr151883 1722 794 302 23 ------
NM_207047chr151883 1722 794 302 23 ------
NM_207111chr7112512 2345 2290 2167 2027 993 686 565 514 378 242 41944 975 253 71 1841 --
NM_207116chr7112512 2345 2290 2167 2027 993 686 565 514 378 242 41944 975 253 71 1841 --
NM_207119chr1072254 2031 1991 1957 1712 744 305 1697 1307 --
NM_207171chr15828 737 614 155 132 21721 1608 41350 750 631 363 21567 806
NM_207304chr13------12553
NM_207387chr1741354 635 356 73 2562 29 --21157 638
NM_207391chr197941 837 456 280 243 166 37 --11300 --
NM_207396chr171343 1324 1239 1147 590 500 196 ------
NM_207429chr1142532 1861 1703 119 --32185 2101 493 --
NM_207577chr11162602 2592 2563 2553 2542 2296 2027 1948 934 766 757 351 317 255 201 40 12196 --12646
NM_207645chr118916 513 347 148 133 105 89 23 11218 2520 476 --
NM_207647chr961990 1779 1739 1709 548 517 ------
NM_212464chr152830 642 21708 258 2613 204 1338
NM_212471chr1761537 1526 656 74 35 29 ------
NM_212472chr1761537 1526 656 74 35 29 ------
NM_212551chr18882 692 342 328 296 205 123 106 --1911 --
NM_213648chr5--3591 584 63 --11200
NM_213662chr1742018 1974 1693 1674 289 47 1405 --