TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-628-3p
miRNA Sequence: UCUAGUAAGAGUGGCAGUCGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX75925 5643 5454 2655 2250 998 251 12564 46506 5664 2207 560 1418
NM_000129chr641488 1390 1255 1066 ----11456
NM_000170chr9----1522 --
NM_000217chr1275064 4437 1868 1011 618 223 107 --11024 --
NM_000237chr831944 1566 514 11321 11714 --
NM_000252chrX31147 1126 445 ----11374
NM_000259chr15145946 5929 5233 4761 4399 2366 2158 1825 1764 1026 672 619 583 75 11505 11684 --
NM_000314chr1062472 2266 883 608 474 395 1685 1998 --
NM_000332chr6107097 6305 5340 5008 1860 1848 1145 1108 461 58 16672 22461 744 --
NM_000335chr31330 --11385 --
NM_000337chr556447 6178 5888 5554 2157 --16200 182
NM_000378chr1131115 1092 449 11181 1991 --
NM_000408chr2103286 3114 2780 2445 2232 1320 1279 876 469 401 12967 13246 1632
NM_000430chr1742616 1470 335 136 1798 22587 410 --
NM_000436chr511440 11347 2360 110 --
NM_000461chr364285 3957 3793 3701 1473 41 11329 --24469 1803
NM_000462chr1561473 1396 1262 561 349 234 ------
NM_000489chrX53260 3230 3006 1191 130 --1748 21239 1227
NM_000555chrX107473 6440 6205 5635 5085 2961 2005 1903 1363 265 12331 26877 5455 --
NM_000618chr12116535 6452 6422 5869 5745 5187 4920 4885 4602 2124 1752 24958 2607 14202 14637
NM_000635chr19------11288
NM_000814chr1554225 3429 3087 1455 1065 --1492 --
NM_000828chrX21856 307 ------
NM_000838chr642749 2607 2550 1023 11103 12364 --
NM_000868chrX82639 2630 2459 2180 935 745 607 189 ------
NM_000875chr1556280 2707 2069 1825 778 24281 1379 35994 5807 2304 --
NM_000877chr232962 1014 144 12387 11873 --
NM_000891chr1753691 3593 2649 999 87 --12710 1568
NM_000910chr431865 1821 578 1178 --11877
NM_000933chr2051566 1318 1172 269 216 1457 1436 --
NM_000944chr441898 1513 504 281 ----22264 375
NM_000950chrX83608 3536 3035 2498 2346 1160 1109 893 --1190 --
NM_000959chr163593 3175 2788 2434 1115 633 13143 22855 2706 --
NM_000966chr12----1850 --
NM_001001436chr162774 575 --1707 --
NM_001001481chr843142 2466 900 131 --2442 205 --
NM_001001549chr712524 --1742 12462
NM_001001664chr294140 3827 3396 3147 2631 1464 1330 1240 850 --13762 --
NM_001002860chr1444657 3901 3862 1461 --14372 1151
NM_001004317chr673564 3313 3190 3037 2998 1090 965 14191 23482 3140 --
NM_001004360chr262013 1841 1255 540 467 426 --1183 --
NM_001004441chr541466 1199 652 150 1577 1352 11097
NM_001005386chr262227 2082 1835 751 316 301 11721 2400 355 --
NM_001005861chr3----1203 --
NM_001006612chrX2430 104 --155 1438
NM_001006623chr252612 959 562 426 408 12482 --1594
NM_001007024chr1763899 3807 3196 3130 2675 1291 --13274 --
NM_001007246chr2181974 1944 673 517 497 467 150 40 1343 ----
NM_001007527chr51203 ----1522
NM_001008225chr7----1198 --
NM_001008239chr1853055 3023 2512 1370 1186 --11218 1250
NM_001008392chr332813 2568 757 --1222 --
NM_001008564chr1342246 2035 1530 289 1386 ----
NM_001008925chr483447 3307 2336 2158 841 608 297 104 1201 ----
NM_001009555chr43693 527 489 ----11705
NM_001009571chr731422 1233 501 --21133 1105 --
NM_001009959chr272565 1740 945 939 924 874 645 ----22477 1049
NM_001010888chrX94654 3777 3346 2959 1702 1392 1237 229 158 --1958 23155 1781
NM_001010984chr172332 2255 2132 949 903 529 208 12143 1307 --
NM_001011537chr31621 21479 488 11791 --
NM_001011553chr74648 283 243 31 ----1885
NM_001012732chr471288 1277 1170 1116 979 152 57 --196 --
NM_001012755chrX83617 3597 1923 1908 1677 852 719 694 11587 14215 --
NM_001013399chr651113 914 862 790 318 ------
NM_001014797chr1026230 575 16268 27458 2083 25657 396
NM_001015882chr92705 362 --1247 1305
NM_001017395chr363654 3436 3020 847 838 439 13467 ----
NM_001017923chr1431584 1306 109 --1517 --
NM_001017926chr841587 714 499 59 11653 21776 1374 --
NM_001024647chr1267714 7433 6842 5831 531 217 ----11284
NM_001024847chr332136 926 278 11877 --22481 1684
NM_001024855chr331674 144 81 1237 --11665
NM_001025076chr10136025 5535 5516 4685 4568 3772 2426 2081 1653 1242 1166 767 284 26044 1704 15299 1289
NM_001025108chr233947 3217 2705 23560 3524 13772 1600
NM_001025252chr862749 1283 1264 709 594 494 ------
NM_001025580chrX114296 3755 3345 1679 1658 1414 1293 842 566 202 90 22696 1221 13556 --
NM_001025596chr112404 189 ------
NM_001029858chr673100 764 326 320 305 290 251 12922 191 --
NM_001030055chr1463734 3576 3303 1842 1201 1036 34497 3741 2902 ----
NM_001030272chr112439 156 1469 150 181
NM_001031623chr631204 607 373 ----1497
NM_001031695chr2275272 3950 3889 3654 1968 1631 867 11026 171 13341
NM_001031804chr1684437 4364 4018 3530 1723 1614 902 893 --33094 305 74 --
NM_001032280chr611708 ----11692
NM_001032282chr82493 453 ----11062
NM_001034841chr1645541 2071 759 443 14243 2716 436 --
NM_001039547chr3117196 7042 6202 2876 1737 1599 1550 1507 1334 877 306 --27814 595 27852 6905
NM_001039590chrX53176 1223 934 613 506 --23429 1007 --
NM_001039618chr1155502 4949 4288 4080 3959 15439 --11619
NM_001039693chr233733 1552 1494 --23257 938 --
NM_001039840chrX96055 5300 5137 4829 4672 3777 2267 1468 801 24985 4705 21307 948 24252 396
NM_001039937chr1364067 3446 3374 2828 1664 700 --13117 13811
NM_001040057chr751270 1011 507 250 84 --11310 --
NM_001040142chr222335 447 --11735 --
NM_001040272chr941903 1856 1790 1701 --11778 --
NM_001040429chr1363635 2651 2321 1389 1095 217 --12753 12539
NM_001040450chr1572624 2564 2299 944 825 775 397 ----1925
NM_001040712chr952679 2644 1253 831 30 ------
NM_001042355chr1674176 3872 1360 869 726 445 247 13346 33396 1913 1371 1473
NM_001042383chr373124 2943 2289 2202 1033 258 54 --1467 1232
NM_001042388chr181866 ----1700
NM_001042404chr131959 1899 463 11826 11305 --
NM_001042473chr104598 388 284 224 134 ----
NM_001042494chr1581123 1094 979 943 803 544 435 76 23854 315 13079 --
NM_001042555chr1294629 4558 4469 1876 1786 1742 1559 1012 375 24680 4601 --23850 572
NM_001042683chr631634 1523 593 11819 11207 --
NM_001049chr1422347 1501 1515 11524 --
NM_001121chr1031802 250 23 11580 2639 216 --
NM_001130chr192712 684 ------
NM_001167chrX116589 6551 6444 5217 1806 1705 1237 210 186 105 38 16183 11210 --
NM_001198chr652383 1908 372 317 161 --22336 2033 12353
NM_001241chr212445 11690 12363 1748
NM_001259chr7105374 3871 1859 1612 1387 1150 838 831 166 97 --22241 643 --
NM_001270chr51260 ----1831
NM_001304chr1743138 1308 692 126 --1334 --
NM_001307chr17----1468 --
NM_001332chr521430 1186 11028 ----
NM_001351chr341628 1514 1406 1131 --21422 714 1131
NM_001390chr182919 521 --13196 --
NM_001401chr911222 --11277 --
NM_001429chr2231089 375 332 --1383 --
NM_001430chr272021 1935 1864 1787 684 391 179 ------
NM_001448chrX41801 565 462 119 ----11782
NM_001514chr13509 497 160 ------
NM_001543chr544602 4539 3239 1409 --14606 --
NM_001616chr253410 2296 1266 610 166 32752 2458 2161 13073 --
NM_001656chr571948 1933 1853 1807 1671 606 297 11903 21610 1267 --
NM_001659chr1221764 827 --11030 1228
NM_001759chr1264738 4502 3819 1806 748 566 23854 1860 13961 12000
NM_001792chr183453 406 99 ------
NM_001806chr1932155 1882 815 ----11028
NM_001880chr22329 234 ----1227
NM_001931chr1141172 152 111 71 ----1933
NM_001946chr1221169 1143 1128 ----
NM_001957chr432237 768 299 --12207 --
NM_001980chr1222295 1957 --21705 836 --
NM_002025chrX158401 7642 7171 7151 6978 6671 6320 5789 5651 3136 2128 1650 1205 1085 196 --35735 3044 1523 26607 6340
NM_002061chr151663 772 632 395 77 1439 1504 --
NM_002062chr6----1378 --
NM_002126chr1731405 1382 626 13375 1770 2608 287
NM_002128chr1322532 554 --1463 1759
NM_002140chr921230 889 --11003 1951
NM_002158chr293767 3459 2960 2780 2768 2389 2328 390 154 22995 669 ----
NM_002193chr2------11612
NM_002202chr51898 ----1201
NM_002214chr785601 5460 5136 4442 779 732 241 206 12085 ----
NM_002253chr411439 1537 11102 --
NM_002270chr5115108 4691 4336 4292 3501 2116 1754 1361 1248 1057 148 ------
NM_002310chr5146491 6042 6029 5907 5345 4685 4480 4457 4408 2557 1647 900 60 48 ------
NM_002345chr123593 85 75 --1279 --
NM_002399chr1521095 949 --11266 --
NM_002402chr731129 279 257 --1791 --
NM_002449chr51867 ----11054
NM_002481chr196432 6056 5813 3104 3080 2983 2757 1463 1189 12899 37883 6358 2665 --
NM_002508chr131943 516 312 ----11880
NM_002546chr84796 525 305 243 1725 ----
NM_002597chr11322 --1146 --
NM_002613chr1635263 5052 3839 ------
NM_002655chr8104982 4757 4338 3821 3699 3492 2075 2056 1807 599 --2449 274 --
NM_002670chr331570 519 151 1278 ----
NM_002718chr372442 2417 1870 1756 1042 965 579 2907 517 --1875
NM_002731chr122080 453 2805 220 12151 --
NM_002737chr1756589 6387 6282 5421 1530 35108 4031 1857 1138 16250
NM_002748chr1541091 1078 942 61 --165 --
NM_002822chr1261657 1393 1206 474 331 29 11265 ----
NM_002834chr1263855 3651 2505 1493 1368 1247 --24035 1387 --
NM_002851chr72555 195 ------
NM_002869chr1121511 158 --11537 1762
NM_002942chr321038 301 --11042 --
NM_002948chr3----1218 --
NM_002994chr421928 741 --1754 --
NM_003045chr1354730 4709 4643 4463 4086 14814 14404 --
NM_003114chr82805 721 --1180 1625
NM_003128chr262506 1799 949 884 564 472 ----1808
NM_003131chr61299 ------
NM_003161chr1733012 2747 2378 --33519 2577 2210 --
NM_003221chr632935 863 109 --23792 816 --
NM_003269chr631202 980 519 --11195 --
NM_003337chr51610 ----11078
NM_003359chr431200 469 454 ------
NM_003390chr1161114 1023 397 348 166 113 --2855 772 --
NM_003430chr1941256 1094 421 253 4528 360 276 192 ----
NM_003468chr254043 3858 1471 983 217 11549 24047 1614 --
NM_003478chr1193013 2871 2692 2285 2068 913 893 859 839 12683 12993 --
NM_003489chr2163245 2268 732 527 473 285 13255 2347 138 23352 2404
NM_003503chr13489 248 27 ------
NM_003566chr1253369 3279 3070 2220 552 1111 ----
NM_003590chr233062 1347 267 12643 13297 11402
NM_003620chr173809 427 368 1330 1749 --
NM_003629chr152960 2712 1142 1033 300 ----23352 57
NM_003672chr161557 1547 1239 509 433 299 --11303 --
NM_003690chr23530 428 161 ------
NM_003701chr13----1974 --
NM_003749chr1392270 2204 2183 2111 1769 964 711 697 380 --1428 --
NM_003772chr1141338 1117 1081 932 ----1456
NM_003870chr1551951 1827 702 446 394 --21962 457 --
NM_003873chr1042387 2180 768 546 1430 12320 11849
NM_003885chr17155 ----12359
NM_003887chr22387 202 --1214 --
NM_003895chr2121992 1688 22074 1514 12004 --
NM_003913chr6104364 3605 3508 3266 2946 1446 866 795 767 68 13163 24336 1408 --
NM_003932chr2251496 1463 367 303 215 --1392 --
NM_003943chr421090 290 --1127 --
NM_003948chr462027 1721 906 858 757 311 21850 950 12090 --
NM_004080chr76530 505 430 382 304 135 1161 11476 --
NM_004100chr652196 2167 1862 1712 511 --1523 11017
NM_004171chr11139561 8562 6909 3659 3100 2988 2620 2532 2397 1814 1073 999 230 39606 9466 7526 26367 3800 --
NM_004272chr52726 306 11554 ----
NM_004274chr1442915 2081 771 130 11246 ----
NM_004279chr752389 590 565 271 218 11684 1759 --
NM_004281chr10----199 --
NM_004302chr1212951 --12330 12824
NM_004326chr121067 88 --11044 --
NM_004329chr10----1162 --
NM_004331chr872507 2246 2191 706 502 236 180 ------
NM_004342chr731429 590 93 1750 12115 --
NM_004349chr821254 372 ----1105
NM_004365chr5------1345
NM_004389chr2--1787 1609 1758
NM_004392chr1352628 2505 2194 1686 254 21656 862 11789 --
NM_004397chr1153943 3543 2784 1497 440 12624 ----
NM_004405chr211031 --1764 --
NM_004458chrX52213 2167 1723 234 145 ------
NM_004459chr1751992 1602 1579 1455 231 ----11434
NM_004504chr262788 2504 2238 867 764 590 1448 22651 366 123
NM_004525chr241147 1020 296 287 11066 11033 --
NM_004529chr941236 897 412 392 --11014 11468
NM_004575chr421536 1517 ----1650
NM_004586chrX95146 4972 4347 3704 3592 2019 1371 540 419 ------
NM_004719chr1242538 1923 1820 1769 22406 283 22591 257 1694
NM_004775chr1862409 2161 2011 1493 924 559 ----1709
NM_004795chr1361850 1812 1691 1681 1462 569 11477 11716 --
NM_004834chr283394 3303 3265 3257 2774 2662 2113 839 1290 2587 26 --
NM_004856chr15----1446 --
NM_004857chr1474798 4721 4333 3796 1364 974 252 --33355 3288 3213 --
NM_004859chr1752858 2648 2373 758 633 12456 12776 1905
NM_004866chr574822 4637 2004 1222 856 162 56 31922 1514 1413 13226 --
NM_004932chr521442 318 --11655 --
NM_004969chr101601 1104 1518 --
NM_004973chr6149 --11656 --
NM_004985chr12123364 3089 2900 2776 1809 1574 745 686 566 430 396 34 13877 34225 972 73 --
NM_005028chr1041640 1500 683 544 ------
NM_005063chr1041360 1318 252 66 11121 13256 1487
NM_005114chr41158 1135 ----
NM_005121chr17103179 3046 2977 2918 2643 2499 2424 1079 986 119 ----13587
NM_005126chr371778 1730 1712 1641 646 573 406 ------
NM_005164chr1252447 1892 1814 433 286 12139 1468 135
NM_005188chr11138264 8251 8105 1545 1462 1418 1198 801 774 686 671 191 52 16104 13165 --
NM_005206chr1711003 ------
NM_005233chr362557 2173 893 488 231 91 22278 1820 ----
NM_005242chr521142 1114 --21091 137 --
NM_005256chr113832 800 239 1281 ----
NM_005277chr441965 1533 531 179 11811 21629 255 --
NM_005339chr453658 3503 3045 1649 1558 11536 11235 --
NM_005392chr941751 1446 1197 214 --11401 --
NM_005436chr1043675 2824 1438 397 ----11311
NM_005491chrX21427 1406 --11982 --
NM_005502chr942911 2903 2589 2188 --1499 --
NM_005509chr531763 649 30 --1406 11777
NM_005542chr721951 668 ----11648
NM_005596chr976373 6350 5435 2575 1897 1580 650 --46003 4352 2232 1137 16403
NM_005611chr1621104 223 --31199 1152 1033 --
NM_005639chr1221418 1386 11343 ----
NM_005665chr1114869 4663 4649 4262 3766 3739 3149 3066 1329 1220 261 ----11006
NM_005688chr321093 255 2454 434 ----
NM_005746chr762786 1056 1005 684 600 591 11791 --2955 659
NM_005748chr1293000 2903 2651 2638 2402 2132 1003 573 523 --1671 --
NM_005754chr521239 348 --1866 --
NM_005765chrX1761 ----1346
NM_005813chr262144 2105 1790 965 491 393 22435 845 --12341
NM_005859chr551299 1293 1007 563 383 --21303 1151 --
NM_005909chr573821 3498 2748 1555 1190 297 179 11076 12954 --
NM_005941chr884044 4015 3988 3924 3714 2852 1256 872 ----13474
NM_005977chr132838 683 ----2712 225
NM_006038chr2051782 838 738 602 243 ----12092
NM_006055chr252990 2811 2358 2210 329 12968 33229 3208 2905 --
NM_006080chr763007 2674 2132 1042 638 403 ------
NM_006154chr1582687 1124 1090 674 548 518 472 32 ----1905
NM_006246chr1441136 292 121 26 ------
NM_006256chr192805 2618 2179 2173 1725 1009 686 488 420 --1593 --
NM_006281chr821164 372 ------
NM_006315chr464446 4332 3385 2954 2878 1705 ----22841 1046
NM_006352chr121836 689 --1400 --
NM_006364chr141116 --1493 --
NM_006415chr931131 886 297 ------
NM_006420chr2042868 2123 1184 939 --12158 1387
NM_006451chr54853 363 213 119 --1288 2780 767
NM_006467chr532182 2019 162 --21576 360 --
NM_006520chrX51688 1635 1211 1115 223 193 184 --
NM_006538chr233962 870 91 ----12653
NM_006539chr161525 ------
NM_006544chr14105809 5507 4843 4441 3790 1892 1442 1182 692 586 11606 11712 14658
NM_006577chr231278 933 895 11172 ----
NM_006599chr16167877 7623 7300 7015 6593 6067 5738 3275 2421 2403 2274 1997 914 336 272 74 1347 11009 15189
NM_006609chr222674 2061 12761 22609 1879 1667
NM_006614chr3103053 3022 2279 2239 999 519 482 344 317 28 --22543 534 --
NM_006624chr1051980 1867 1326 682 470 --1632 --
NM_006626chr922383 2027 --32118 1765 620 --
NM_006682chr732603 1881 1093 22366 1086 ----
NM_006690chr2011720 --11770 --
NM_006704chr13------1353
NM_006750chr1656174 2376 1199 500 439 --1886 --
NM_006751chr23423 280 87 1177 --1882
NM_006775chr683113 2917 2682 2560 2112 937 713 381 1606 1778 --
NM_006777chrX62920 2626 1992 965 513 376 --1325 --
NM_006838chr1211420 --21887 1823 --
NM_006873chr253557 3220 2433 920 341 32976 752 396 --11293
NM_006915chrX102461 2433 2407 2188 2020 1702 890 297 98 83 --2803 429 1271
NM_006930chr541316 744 307 122 1778 1227 --
NM_006981chr972650 2297 1177 647 633 278 51 11142 ----
NM_006988chr2141083 418 258 213 ----11271
NM_007005chr921195 160 11338 1525 --
NM_007007chr12114680 4649 4468 4352 4124 3924 3515 3203 534 517 259 23294 643 1263 --
NM_007038chr21105928 5790 5538 5490 4959 4070 4024 2192 1672 382 25654 5331 --21112 540
NM_007054chr543835 3225 3037 1586 13754 ----
NM_007068chr221110 --139 --
NM_007084chr1311124 11499 11325 --
NM_007107chr3102286 2270 2138 1806 1553 732 334 327 223 212 ------
NM_007137chrX105317 4454 4318 4247 3701 1705 689 545 361 234 --11926 --
NM_007146chr1752868 2278 760 327 106 32702 2306 1993 ----
NM_007175chr8103597 3568 3534 3097 3053 2949 2878 584 578 111 --11207 12601
NM_007195chr1893556 3332 3203 3016 2667 2461 875 840 65 1746 13356 --
NM_007202chr171498 1308 1260 1250
NM_007249chr13119442 9112 9033 8027 7400 6698 6428 5945 3770 1347 1076 --22267 1812 11701
NM_007269chr12151 34 ----1156
NM_007331chr432391 657 381 --22726 1924 --
NM_007347chr1563164 1116 810 592 337 110 12817 --12047
NM_007350chr1244205 2808 1560 1464 11550 1324 --
NM_012074chr141435 ----1460
NM_012081chr593430 3412 3388 2684 2538 966 910 862 117 13454 1652 1312
NM_012120chr632489 2168 2155 --12289 --
NM_012207chr1041114 790 300 247 151 ----
NM_012214chr2105785 5079 4665 2093 1179 1146 998 849 750 370 14693 21948 1069 1457
NM_012234chr363311 3167 1510 1444 1358 1209 1696 13666 13690
NM_012247chr10------1719
NM_012281chr742181 2052 1901 418 21805 486 12191 --
NM_012287chr3104348 4329 4191 4123 3517 3248 2792 2759 206 78 --24407 3662 1532
NM_012309chr1143408 1753 1682 1543 11781 14281 11921
NM_012334chr5104414 4244 3687 3445 3224 3102 1386 747 227 30 13707 ----
NM_012338chr741194 1137 435 258 ----143
NM_012479chr742434 2241 1100 821 11090 1654 21998 291
NM_013243chr1531493 1098 592 --1535 1106
NM_013246chr11------1910
NM_013281chr2051464 1138 512 184 160 11043 ----
NM_013309chr1571946 761 694 488 463 402 155 ------
NM_013320chr12----145 --
NM_013357chr82808 545 --1109 --
NM_013374chr3112865 2774 2716 2210 2118 952 923 737 610 543 520 23156 365 12819 12885
NM_013396chr2161371 1160 562 475 467 242 1485 11283 --
NM_013437chr881283 1276 1194 996 939 183 120 54 1419 ----
NM_014071chr201414 ------
NM_014112chr895293 4943 4856 4494 1746 1311 868 371 272 35334 1417 389 25079 3855 --
NM_014154chr351634 1152 515 392 195 --11312 --
NM_014232chr1731289 678 203 ----1208
NM_014319chr1241815 1213 489 264 --11997 --
NM_014393chr841859 1730 1602 87 12341 1451 1589
NM_014415chr341372 542 353 210 11274 --11643
NM_014423chr5175671 4842 4625 4265 4091 3884 3811 3713 3620 1723 1340 1087 908 871 845 561 440 11014 ----
NM_014469chr112797 250 ------
NM_014586chr2134397 3558 3389 ----14220
NM_014615chr16113320 3265 2519 2259 1422 1196 830 716 652 392 56 ------
NM_014616chr393157 2487 2352 1288 801 791 736 593 367 12905 --1450
NM_014646chr1832242 2134 1174 ----13124
NM_014671chr731204 473 165 --21473 1452 --
NM_014674chr374022 3232 2531 1308 792 389 364 23099 355 23998 2868 --
NM_014682chr892037 2024 1952 1928 1887 1609 1545 388 318 ----1213
NM_014701chr1563080 2701 2290 2155 1024 861 11145 32802 2561 1270 --
NM_014729chr852323 2082 1937 177 111 --22142 1608 2815 96
NM_014730chr1233258 1842 385 15002 1979 11672
NM_014746chr244080 3913 1099 457 --13690 --
NM_014751chr81370 1717 12067 11643
NM_014779chr341113 1026 445 237 1130 ----
NM_014795chr221173 405 ----11203
NM_014810chr183503 3178 3163 2451 2322 1026 267 254 ------
NM_014830chr1273798 2945 2824 612 412 328 170 --13385 --
NM_014838chr223901 557 198 ----1310
NM_014847chr11383 --1387 --
NM_014877chr17107766 7231 7142 6648 6609 6394 6222 4985 2776 1554 36658 4787 143 27248 1035 --
NM_014898chr1932136 266 224 1479 1311 1430
NM_014910chr191289 ----1305
NM_014912chr1063423 3185 2710 713 169 139 131 ----
NM_014934chr1373434 2736 1211 895 866 744 365 --11175 11143
NM_014937chr1021338 457 --11297 --
NM_014946chr272720 2372 1097 1017 950 918 644 32882 2823 2420 ----
NM_014961chr432152 2114 75 12240 ----
NM_014962chr2062704 2514 2266 1810 556 218 11137 22172 1836 --
NM_014969chr131090 388 125 11169 1809 --
NM_014974chr1051789 1761 1255 462 226 11678 --1480
NM_014988chr442697 1939 1896 42 1631 ----
NM_014989chr621831 1558 11940 ----
NM_014991chr473163 3071 3008 2311 1248 1197 298 ------
NM_015020chr1653429 3371 1513 1181 554 --23161 697 161
NM_015025chr232613 2509 2458 22412 2257 ----
NM_015026chr12114405 4321 3823 3472 3454 3159 1869 1655 1639 592 88 1418 33002 707 374 13863
NM_015039chr184075 3785 3467 3363 1688 1179 454 270 --22979 1568 14336
NM_015045chr1052276 1706 817 185 171 ----1841
NM_015076chr651687 1472 1189 541 523 21306 1095 --13166
NM_015087chr1351679 905 843 728 642 ------
NM_015092chr1683845 3702 3098 3020 1627 1334 1276 500 33898 3457 1083 11290 23089 2956
NM_015130chr441275 1149 878 299 1861 1106 --
NM_015132chr731603 1556 125 --1789 --
NM_015144chr1653944 2865 1098 728 29 ------
NM_015163chr1431888 1394 572 21978 484 --1359
NM_015192chr2052291 1079 536 208 64 ----1590
NM_015199chr311191 22356 711 11840 --
NM_015215chr152868 2448 2150 1076 420 --12547 --
NM_015236chr431472 1339 343 ------
NM_015272chr1612141 ----1472
NM_015282chr263026 3017 2772 1894 833 118 --1165 --
NM_015313chr1144295 3757 3737 1002 24013 3641 23106 1602 24086 3219
NM_015336chr1252591 2183 767 461 156 21955 1771 ----
NM_015344chr852063 1660 761 658 428 11889 2613 384 --
NM_015347chr1242902 2356 2027 387 1915 1705 --
NM_015396chr341218 1201 985 497 ----1250
NM_015397chr941748 258 227 217 11585 --11856
NM_015429chr33874 140 92 1131 --1145
NM_015455chr563641 3069 2824 1646 764 162 1204 13043 --
NM_015475chr24990 935 914 390 ----2777 27
NM_015477chr153927 844 819 --1708 --
NM_015508chr321350 203 1138 2289 211 1425
NM_015534chr11931 --125 --
NM_015553chr675155 4992 3320 1996 1702 1495 249 11799 11050 --
NM_015567chr1321157 1060 ----11036
NM_015569chr1104308 4122 3983 3897 3199 1555 898 892 514 127 1649 ----
NM_015602chr151695 1577 1316 1236 282 --1380 --
NM_015635chr932212 680 141 12019 ----
NM_015850chr862420 1998 817 753 518 505 12372 ----
NM_015879chr18108254 8114 7245 6910 5984 5489 3095 2207 1729 1406 28432 2970 1551 13423
NM_015906chr1104519 3313 3298 3005 2963 1835 1729 1182 1054 410 24789 154 24474 3223 11339
NM_015971chr17------1331
NM_015986chr17------2316 128
NM_016009chr174892 4552 3741 1036 930 908 783 1296 2993 373 --
NM_016040chr162002 1722 936 909 681 595 ------
NM_016083chr693819 3792 3778 3662 3550 3541 3177 1303 150 1412 1738 1879
NM_016129chr4------1142
NM_016131chr252334 2242 1848 1573 1564 --1886 --
NM_016230chr63473 442 193 --1376 --
NM_016231chr1721504 102 ----1166
NM_016271chr1851667 544 423 346 302 ----3797 633 428
NM_016279chr52429 28 ----153
NM_016289chr241690 1584 1567 94 12168 11555 11432
NM_016315chr291770 1677 750 706 699 452 345 192 61 --1611 --
NM_016322chr983147 3074 2697 2530 1087 1056 844 68 --2730 96 --
NM_016441chr272203 1974 1879 1858 966 649 237 11579 1136 --
NM_016472chr1461279 1081 530 443 412 205 ------
NM_016519chr43417 86 74 --1456 --
NM_016530chr15123792 3347 3044 2828 2608 2584 1344 795 737 542 473 255 ------
NM_016531chr4103600 3446 3348 3255 3019 2754 2689 2577 1350 388 1366 ----
NM_016584chr12------1191
NM_016586chr14165 --1377 --
NM_016626chr1861591 1582 1513 1128 258 195 --1213 1569
NM_016644chr52462 422 --1391 --
NM_017412chr8----11261 --
NM_017423chr471839 1669 777 671 638 186 92 --22165 477 1289
NM_017495chr20------11443
NM_017544chrX4883 383 200 167 ----1131
NM_017610chr1572085 1678 1319 554 517 398 233 1147 11839 --
NM_017628chr474674 4282 4191 2086 1222 379 344 13972 14102 --
NM_017629chr131536 1303 562 --2554 319 --
NM_017635chr1151634 1616 1610 1326 1203 ----1468
NM_017637chr9117974 7775 7499 7172 5953 5784 3114 2114 974 797 720 ----22799 1126
NM_017643chr1742621 908 102 90 ------
NM_017658chr1494653 4120 3831 3371 1488 1049 666 622 281 34019 3009 1179 --14214
NM_017694chr241955 1650 802 666 ------
NM_017860chr1--2707 645 1623 --
NM_017915chr124471 225 157 101 ------
NM_017919chr9115804 5784 4491 4213 3977 3712 3700 2275 2222 1071 668 11322 ----
NM_017944chr1152922 1949 1193 1107 893 1275 22987 1169 --
NM_018027chr1073310 3062 3008 2953 2897 2602 2154 --1857 13159
NM_018043chr1131327 1017 1001 --1959 --
NM_018121chr1072531 2513 2421 2370 759 238 78 --11106 --
NM_018159chrX41300 689 529 426 11122 11565 --
NM_018191chr1331862 1721 493 11856 21615 477 12091
NM_018252chr11232 1560 ----
NM_018287chr1041181 1103 1029 904 11007 ----
NM_018312chr1131488 653 399 --21756 382 --
NM_018332chr16------11372
NM_018361chr883883 3694 3054 1457 761 401 374 89 11465 31075 925 574 --
NM_018362chr1163882 1220 1205 743 679 65 13105 33823 3442 984 --
NM_018364chr1103440 3153 3140 3033 2858 1520 1384 1229 1024 1008 --23190 1137 --
NM_018371chr861536 1325 1224 479 470 53 --11399 --
NM_018373chr14126325 6112 6002 5262 5075 4985 4377 4249 2464 2143 934 706 1364 21586 245 --
NM_018426chr6------184
NM_018482chr882404 2387 2171 1630 1021 782 523 396 --1214 --
NM_018638chr12155420 5307 5030 4397 3768 3759 3708 2077 1735 882 862 772 712 296 80 1603 13879 11438
NM_018898chr572386 2312 2230 2140 1652 787 185 --12306 --
NM_018979chr1272314 1725 857 587 534 437 94 1821 ----
NM_018999chr1094801 4320 3935 1367 1322 1029 868 805 173 34881 3927 1552 11472 --
NM_019042chr721247 317 --2936 141 --
NM_019050chr412178 11785 11580 --
NM_019063chr262266 1871 465 397 257 218 2613 288 1783 --
NM_019080chr1341502 1441 1428 554 ----21433 513
NM_019084chr1032316 2222 2133 22414 995 21725 820 --
NM_019593chr2092984 2934 2467 1111 1079 1025 818 792 688 ------
NM_020144chr742005 1935 426 369 --11426 1620
NM_020148chr1872918 2878 2862 2614 2157 725 298 --23002 2804 12714
NM_020177chr532676 1124 468 --1334 11283
NM_020337chr433122 1975 142 159 --11931
NM_020338chr1023636 3288 ----13690
NM_020341chr2031997 1561 236 ----1531
NM_020342chr252489 2139 2133 706 588 --1303 12091
NM_020357chr371657 550 452 379 334 307 203 ------
NM_020362chr1----1742 --
NM_020363chrY41540 1447 1432 1161 --11197 1219
NM_020390chr374882 4770 4559 3710 1580 1383 1264 24218 3466 14548 --
NM_020403chr1341758 1569 551 252 ----21158 202
NM_020432chr742021 1963 847 776 11668 1160 --
NM_020443chr186532 6355 6204 5278 4351 2193 1537 1339 14715 22537 236 --
NM_020640chr332121 1732 884 21721 493 12228 --
NM_020651chr21424 --11631 --
NM_020676chr32854 710 ------
NM_020708chr2052538 2484 2330 2321 2312 --12334 --
NM_020734chr1273366 2684 816 483 358 262 162 --1535 --
NM_020748chr1762054 1605 809 713 654 63 ----11706
NM_020752chr1041795 1082 883 726 12273 12497 --
NM_020754chr34418 315 150 55 ----1168
NM_020772chr17118478 8459 7931 7620 7246 5733 5562 5266 3033 2892 1185 18251 --25478 1190
NM_020774chr18116245 5219 5068 5011 4775 4299 4180 4041 2323 2133 2101 11359 25418 4223 1118
NM_020783chr181475 --139 2193 124
NM_020830chr263185 2899 2640 2303 2243 2061 33233 3097 2478 12412 --
NM_020870chr42384 239 ------
NM_020871chrX62444 2342 2005 1612 351 237 --22298 1602 --
NM_020873chr33255 247 235 --2864 104 --
NM_020921chr1493126 2817 2538 1322 1182 530 519 328 39 21015 440 11357 --
NM_020935chr2114673 3844 3295 3069 1461 1280 1123 973 815 603 46 --1526 13970
NM_020962chr1541760 1668 398 265 ----12241
NM_021038chr353339 3249 2170 2103 2080 22198 888 1747 --
NM_021047chr192696 156 ------
NM_021072chr552647 2127 2098 2070 1921 --12430 --
NM_021097chr262963 2856 2705 2605 2207 140 ------
NM_021102chr19----1379 --
NM_021145chr721045 795 ----1785
NM_021148chr732472 2259 225 172 11818 12190
NM_021183chrX42596 2331 1686 351 --22286 1948 --
NM_021190chr131309 543 329 --1465 1345
NM_021191chr1232168 1727 1644 1820 1338 32582 2053 702
NM_021215chr2011991 --12064 --
NM_021238chr1251933 1498 1342 782 415 12029 22119 2092 11938
NM_021255chr1483605 3232 3223 2802 2734 1485 41 30 --13987 --
NM_021269chr1952069 583 310 206 37 3709 145 61 --1395
NM_021813chr655725 5589 3676 2096 2073 1583 25807 5258 --
NM_021814chr621479 245 --31581 450 275 --
NM_021815chr253006 2482 732 555 379 1227 1239 --
NM_021818chr1461526 1166 1023 986 306 227 ----1145
NM_021961chr1197142 6122 5794 5170 4909 4597 2308 1791 932 --11281 --
NM_021964chr3146486 6186 6137 5166 5042 4613 4518 2449 1857 1639 1482 1232 247 29 25228 4694 26490 4552 15901
NM_022058chr231989 755 147 ------
NM_022130chr561312 1223 920 572 440 211 11395 ----
NM_022351chr893875 3573 3187 2914 2886 2448 1095 231 122 21394 938 1678 13444
NM_022475chr41115 ------
NM_022483chr581612 1305 697 667 636 250 177 113 1219 2567 278 --
NM_022726chr651725 1380 1301 1148 392 ----11423
NM_022733chr11369 ------
NM_022737chr19----11076 --
NM_022763chr342676 2547 2064 836 12046 ----
NM_022781chr933261 2819 903 --13248 --
NM_022832chr451931 1014 411 345 247 1299 --11971
NM_022841chr1572747 2602 2379 2277 817 465 212 --11841 --
NM_022897chr541116 1032 911 332 1789 1992 --
NM_022898chr14114641 4592 4571 4510 4489 1907 1527 1505 1238 1100 277 ------
NM_023016chr252798 1022 838 477 57 ------
NM_024590chr431828 1297 1197 ----1709
NM_024624chr21191 11050 --11613
NM_024639chr642935 2218 1082 511 11815 22591 2056 --
NM_024683chr17----136 --
NM_024692chr221592 447 ----11480
NM_024721chr842520 1809 1657 330 ----2560 506
NM_024761chr995216 4455 3305 3246 2054 1415 904 885 189 --25146 718 1336
NM_024828chr931519 546 195 --21177 114 --
NM_024947chr3168999 8861 8494 7710 7200 6927 5845 5827 2812 2552 2226 1874 1415 951 761 403 49128 8409 1028 284 28189 2039 --
NM_024948chr103777 752 648 --1219 --
NM_024949chr474631 3625 3460 3454 1337 1158 1129 11740 ----
NM_025054chr854035 2825 2620 996 414 --13018 1490
NM_025126chr121673 ----1648
NM_025134chr1652583 2528 2350 340 98 1823 --11612
NM_025147chr22391 263 ----1256
NM_025191chr143525 2986 2490 279 12676 --12846
NM_025208chr1142174 769 541 96 --12115 --
NM_025235chr1042089 753 423 338 11568 1771 --
NM_030625chr1061655 816 792 445 310 87 11958 21951 33 1488
NM_030627chr5144080 4061 3963 3928 3901 3793 3617 2623 1529 1498 1372 954 779 388 --11577 --
NM_030647chr786139 5654 5339 4150 1662 1394 656 642 13869 45830 5808 5786 2508 --
NM_030763chrX1933 --1147 --
NM_030791chr1481824 1447 741 544 471 444 201 45 --11633 1509
NM_030806chr1138762 8716 6804 6283 3629 3255 2628 1716 1497 760 518 228 181 ----15951
NM_030809chr1242370 2355 2049 894 1676 12282 --
NM_030978chr9----1469 --
NM_031216chr1851532 841 566 185 132 ------
NM_031296chr492495 2212 2203 1093 744 591 570 524 456 11944 12313 --
NM_032051chr22----1547 --
NM_032102chr1143137 3108 958 728 --22501 1108 --
NM_032124chr183965 774 182 --11133 --
NM_032144chr221790 1368 11182 11394 1614
NM_032199chr1053906 3799 2871 2759 652 11381 13110 --
NM_032329chr224309 757 ----14360
NM_032352chr1451230 1193 1183 426 161 --136 --
NM_032431chr111382 --1826 --
NM_032547chr451215 1123 1066 1018 295 11025 --11266
NM_032784chr62924 137 ----1822
NM_033055chr12299 253 --1217 --
NM_033132chr1342354 2183 2163 651 --11849 12086
NM_033224chr7127119 5684 5578 5530 5460 3153 3064 3053 2330 1759 1525 763 26529 4936 ----
NM_033260chr6----1625 --
NM_033505chr295951 5331 4838 4227 2363 1115 1060 592 508 --26586 5183 11516
NM_052832chr832750 2379 1074 ----11886
NM_052879chr1274133 3589 3494 2879 2788 2526 657 ----13720
NM_052885chr1243549 1963 1911 1136 13373 44187 1499 1105 332 --
NM_052905chr231767 1338 290 11841 1714 --
NM_052911chr182199 91 ----1901
NM_052937chr842616 1964 1710 679 12217 ----
NM_053024chr331313 613 26 --190 --
NM_053056chr1152625 2493 2183 2090 609 ------
NM_057175chr452672 2464 1828 1700 373 ----12185
NM_058167chr1------1307
NM_078476chr621787 1737 --1388 --
NM_080867chr14144185 3306 1897 1625 1449 1435 1237 962 883 847 831 632 551 133 24198 1209 --14880
NM_080872chr864094 3307 2577 1454 985 840 2827 400 13123 --
NM_080927chr373039 2640 2339 2207 1359 309 192 --21239 64 13279
NM_138423chr1511770 12205 12324 11415
NM_138473chr1274202 3945 3311 1760 1327 770 416 13486 13505 --
NM_138731chr14124201 3963 3466 3252 3147 3113 3069 3062 2868 2787 1415 297 ----13877
NM_138782chr542305 1953 1820 1802 ----21894 1655
NM_138966chr181547 ----1592
NM_144563chr25777 750 616 215 172 ------
NM_144571chr4116929 6675 6624 5725 5641 5260 5061 2344 1444 1183 37 12062 26535 1640 --
NM_144600chr1631283 1224 42 ----1629
NM_144632chr262295 2161 950 844 136 115 ----11718
NM_144664chr1162618 2060 1877 1857 1021 513 --1820 --
NM_144778chr1382189 1993 1695 1091 1044 608 466 61 --12100 --
NM_144963chr812742 1869 ----
NM_145274chr172720 368 ----1190
NM_145284chrX42480 2169 714 131 --1188 --
NM_145735chr1332304 1876 687 1857 32861 2109 1081 --
NM_152347chr17--124 --280 35
NM_152402chr41165 --1558 1510
NM_152409chr5103206 3200 3057 2888 2725 2635 1296 1067 346 283 --23581 2518 --
NM_152512chr224562 511 223 85 --1131 --
NM_152551chr683071 3041 2207 2144 266 188 147 117 ----1223
NM_152594chr1521899 538 --2464 353 --
NM_152622chr593411 3259 3209 2860 2620 2548 2541 1300 742 --22492 1386 --
NM_152638chr1241246 396 239 68 ----1212
NM_152641chr1232014 581 62 ----12603
NM_152756chr553853 3509 2957 1386 678 1499 1134 21548 624
NM_152758chr842472 887 866 742 1587 11917 --
NM_152835chr142225 1111 917 335 --1175 12363
NM_152902chr172062 1983 1320 1300 626 414 74 --21935 1422 --
NM_153020chr631127 530 139 11632 11360 --
NM_153226chr101983 --1950 --
NM_153261chr162275 211 11312 --11336
NM_153267chr92774 216 181 --2201 27
NM_153371chr1352270 2006 1890 1808 1524 ----1915
NM_153456chr1376265 5322 4323 3929 3885 1065 766 --46229 4463 4188 1399 1609
NM_170606chr72665 464 --1359 --
NM_172071chr187314 7230 5904 5703 5282 5105 1390 1353 35667 2480 525 1828 1538
NM_172127chr462023 1941 1705 1639 624 261 --11662 --
NM_173164chr16------198
NM_173468chr4135900 5572 5474 5233 5103 4208 1371 1329 1222 1085 544 459 451 11299 35186 476 173 --
NM_173494chrX2610 93 --1863 --
NM_173552chr3122425 2306 2277 2115 1848 1678 1557 1001 583 557 497 357 1806 ----
NM_173560chr62413 217 --1390 --
NM_173567chr1------188
NM_173576chr101774 --1336 --
NM_173648chr231085 1019 981 ------
NM_173808chr184424 3978 3743 3375 2948 1539 668 318 ------
NM_173829chr5155869 5513 5458 5253 4852 4844 4048 2287 2033 1767 1478 1206 325 293 75 --34711 3901 1711 34115 4018 868
NM_173851chr833304 3181 3016 21537 883 23966 2849 1363
NM_174890chr102667 21 --2510 285 --
NM_175061chr721980 1821 --1661 --
NM_175607chr331390 280 107 11295 --1112
NM_175747chr611100 --1712 --
NM_175856chr53618 232 90 ------
NM_175907chr1811965 --11741 1567
NM_176814chr721510 524 ------
NM_176823chr143844 3067 2809 1118 23153 3112 ----
NM_176824chr451301 1150 906 541 516 --11040 --
NM_177424chr161487 1326 643 609 450 275 --1369 1596
NM_178313chr261978 1792 606 409 391 230 ------
NM_178558chr731189 306 282 1451 11174 1973
NM_178815chr1062139 2120 1008 876 578 492 12417 1384 --
NM_181672chrX41559 1425 1286 798 1382 --11979
NM_181782chr642012 1897 1441 503 --11675 --
NM_182485chr4113664 3315 3152 3052 2654 2635 782 593 460 198 56 12407 22488 557 --
NM_182488chr132923 301 --1756 --
NM_182503chr674284 3698 2140 1712 1699 1492 620 --1196 --
NM_182717chr1011025 ----1406
NM_182765chr1062102 1523 502 378 369 55 1826 ----
NM_183416chr121641 97 --11822 11424
NM_194071chr754258 3843 1664 762 236 --44659 1926 1479 741 14263
NM_194282chr462531 2429 2134 2065 226 87 --1757 12295
NM_194314chr185153 4159 1937 1751 1611 1347 809 157 --33593 1351 274 14198
NM_198270chrX42519 1340 1003 995 13219 ----
NM_198468chr654491 3953 1638 1214 1115 --13692 --
NM_198503chr152389 2203 621 422 308 --22223 172 --
NM_198513chr851829 1804 1734 1657 1250 --2770 451 1559
NM_198581chr2167473 6166 5455 2546 2201 2043 2019 1945 1704 1578 1441 1149 892 728 653 121 11217 37038 962 540 27321 5019
NM_199461chr1063013 2615 2591 1422 713 301 23330 1193 22973 388 --
NM_203301chr142576 110 ------
NM_203364chr1181131 1104 874 811 499 352 296 181 --197 --
NM_203406chr582950 2728 2670 2300 2232 2033 1154 805 --12168 --
NM_203458chr1103518 2952 2910 2790 2739 2563 1052 565 172 79 13106 13654 --
NM_206853chr683814 3675 2807 1145 1046 1031 251 152 24073 2862 12697 --
NM_207406chr466507 5468 5267 1965 1273 531 26016 1202 35031 1522 246 26464 1540
NM_207647chr942310 895 399 62 --22346 1941 --