TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-628-5p
miRNA Sequence: AUGCUGACAUAUUUACUAGAGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000081chr121765 523 11198 ----
NM_000084chrX126969 6396 6091 5886 5613 4870 2662 1786 1589 764 553 306 12079 26075 2782 14992
NM_000089chr72672 601 ------
NM_000115chr131638 --22005 249 --
NM_000194chrX1155 1494 1549 --
NM_000202chrX43173 2897 2563 1167 11369 --1750
NM_000217chr1264973 4163 3518 3332 1111 38 11167 ----
NM_000259chr1595546 5497 4709 4643 4363 3920 3887 462 332 11981 15659 --
NM_000264chr923348 343 ------
NM_000321chr13----11124 --
NM_000332chr677183 6552 5548 2773 2328 467 196 --16584 --
NM_000337chr565678 2370 2066 752 573 227 21428 663 ----
NM_000346chr171393 --11748 --
NM_000390chrX73192 3122 2888 2768 2466 991 603 12205 1584 --
NM_000408chr221234 735 11159 ----
NM_000428chr141763 ------
NM_000430chr1731465 669 579 13670 --12965
NM_000489chrX31038 643 186 1321 --12140
NM_000503chr851482 647 241 131 78 21286 99 1320 --
NM_000533chrX--21629 1330 1742 --
NM_000555chrX77128 6870 5846 2926 2618 1511 628 ----27074 2671
NM_000618chr1231499 1167 845 34105 2508 384 11725 --
NM_000663chr1652625 2599 2291 2271 720 12873 13114 --
NM_000809chr426943 216 37452 6100 977 1965 17597
NM_000813chr545578 1867 1067 336 13614 1384 --
NM_000814chr1574003 3739 3519 3014 1384 217 153 ------
NM_000829chr113609 327 151 ----11970
NM_000859chr521171 554 11734 11312 --
NM_000868chrX41908 984 880 525 12032 ----
NM_000875chr15106880 6099 5944 5615 5449 5442 5330 4908 2682 2214 --26136 2363 --
NM_000876chr62505 364 ------
NM_000891chr1752674 1453 892 460 171 43502 3384 2616 820 12604 --
NM_000950chrX53069 1380 1342 722 462 --12482 --
NM_001001323chr1242984 580 546 522 --12168 --
NM_001001481chr821336 909 --13057 --
NM_001001664chr211438 --13059 --
NM_001001890chr2112973 1345 13440 --
NM_001001928chr22117948 7013 6922 6616 2709 2692 2657 2426 2097 1197 418 --25108 660 --
NM_001001995chrX2754 210 ------
NM_001002294chr11104 ----1138
NM_001003652chr1857422 6252 2597 2266 1203 47212 6320 2899 1321 ----
NM_001003674chr18127091 6301 5784 4871 4832 4516 4378 2823 2099 1682 1360 1120 24842 999 15761 --
NM_001003686chr71375 ------
NM_001003760chr643347 2924 657 246 23551 203 ----
NM_001003800chr963090 2900 2277 1167 355 150 13198 1417 --
NM_001004065chr923419 713 1113 ----
NM_001004317chr623484 830 11690 --12823
NM_001005404chr1754457 3437 2988 1559 1283 1854 --2953 588
NM_001006684chrX----152 --
NM_001007094chr1053826 3546 3435 427 89 22974 913 1301 --
NM_001007102chr641534 1494 609 28 ------
NM_001007559chr1831945 58 38 1144 ----
NM_001007794chr1----1608 --
NM_001008405chr7--31835 190 133 ----
NM_001008541chr1021643 861 1174 1683 --
NM_001008660chr11--1293 --11323
NM_001009552chr82218 176 1594 ----
NM_001009555chr41331 1247 11743 1428
NM_001009881chr12100 89 ------
NM_001009899chr336026 5144 1532 12359 21018 441 1522
NM_001009993chr253827 3346 3173 1573 686 1558 14353 1778
NM_001010854chr14--2307 283 ----
NM_001010861chr13792 482 417 11741 12518 --
NM_001010888chrX44250 3336 3072 195 21273 961 ----
NM_001010922chr123759 688 23347 2997 ----
NM_001010934chr721028 730 1353 ----
NM_001011666chr726223 687 14388 ----
NM_001011885chr1521205 210 --2732 637 --
NM_001012267chr931689 732 564 21476 517 ----
NM_001012398chr163418 329 224 1901 ----
NM_001012418chr634096 120 77 23321 2891 ----
NM_001012614chr4----1230 --
NM_001012755chrX31929 226 106 ----11763
NM_001012968chrX32559 2202 496 ------
NM_001013650chr31615 ----1172
NM_001013693chr112626 ------
NM_001014286chr13----195 --
NM_001014797chr1067147 6150 5887 5524 5471 1987 26210 1491 17626 15667
NM_001015877chrX42722 2296 1919 1232 ------
NM_001017392chr191238 ----1389
NM_001017395chr333642 3451 2987 --11465 --
NM_001017440chr778098 7997 7975 7489 6912 2883 1360 23291 132 28039 669 --
NM_001017969chr9------1621
NM_001018025chrX3786 602 48 1146 1328 --
NM_001018050chr2253003 2729 2556 1332 1300 --1912 11343
NM_001018064chr94773 753 721 388 1745 11571 --
NM_001018065chr935492 5401 1934 1284 --11887
NM_001018104chr16187 2809 27 ----
NM_001024649chr522698 122 11806 ----
NM_001024678chr8------171
NM_001024808chr1222820 1847 22660 50 --11778
NM_001024847chr332191 1546 470 --1221 --
NM_001024948chr173049 2242 2145 1085 793 786 677 21252 1016 --13110
NM_001025068chr311719 ------
NM_001025079chr321239 370 23106 869 13774 --
NM_001025233chr1242185 2008 437 33 ----12223
NM_001025266chr384592 4456 4380 4220 3917 1784 1376 864 --11024 --
NM_001025580chrX33223 3112 1085 1469 ----
NM_001029875chr552973 2464 2126 2017 852 12685 ----
NM_001031725chr1------147
NM_001031804chr1631504 735 376 1916 --12794
NM_001032296chr1352821 2430 2053 525 208 --11176 12892
NM_001033045chr234162 2901 1223 12847 --14286
NM_001033566chr172633 369 --1673 --
NM_001033578chr832101 1644 252 12432 ----
NM_001033602chr1341716 1691 763 107 --32148 445 171 --
NM_001033925chr102342 131 11764 1473 --
NM_001034915chr811090 1138 11034 --
NM_001034954chr1032878 473 321 12681 180 --
NM_001035003chr4180 11025 ----
NM_001037174chr241974 1644 1476 386 ------
NM_001037339chr121697 1658 11711 ----
NM_001037872chr2----1163 --
NM_001037954chr1131217 925 149 1532 ----
NM_001039538chr253152 2346 967 700 565 13480 1913 --
NM_001039762chr1042005 947 636 484 21984 1625 ----
NM_001039802chr13938 920 504 --140 --
NM_001039840chrX44926 1941 1338 1244 22395 1444 12220 --
NM_001040142chr21134 21910 182 --1167
NM_001040152chr723995 847 --15012 --
NM_001040158chr5----1186 --
NM_001040159chr411008 11073 11231 --
NM_001040202chr422146 304 12550 12151 --
NM_001040214chr631806 702 24 12160 --1744
NM_001040272chr932289 1893 188 ------
NM_001040273chr1041329 662 654 35 --1764 --
NM_001040284chr1655599 5050 1536 1397 695 1117 ----
NM_001040402chr4----13090 --
NM_001040429chr1332823 2760 771 13186 ----
NM_001040441chr134860 4125 629 24207 323 ----
NM_001040653chr342133 2069 961 330 11810 --12346
NM_001042406chr621138 466 --1375 --
NM_001042481chr1422669 1043 --22476 1690 --
NM_001042494chr1573794 3620 3421 2850 2684 634 358 1479 ----
NM_001042510chr81697 21462 102 ----
NM_001042537chrX42009 1907 1767 972 11891 ----
NM_001042555chr1254037 2901 1630 1225 548 21672 1132 ----
NM_001042599chr297409 7152 5790 5390 5123 3085 3002 2571 441 ------
NM_001042601chr363171 2766 2526 2479 2069 1035 11152 ----
NM_001042603chr12--1570 63622 3493 3435 3377 3319 1360 --
NM_001106chr388079 8051 7593 6756 6618 3664 1897 1266 11993 23353 244 --
NM_001116chr1632552 2006 233 13003 ----
NM_001148chr432117 234 132 --1785 1292
NM_001149chr1021341 188 21212 252 172 --
NM_001167chrX84668 4352 2641 2416 1601 1277 1259 98 ------
NM_001204chr235538 5303 626 --1101 16377
NM_001206chr932935 2917 2237 1530 ----
NM_001241chr222185 335 21878 1722 12355 --
NM_001259chr765919 5572 4773 2405 2008 609 36017 5565 70 12115 1530
NM_001271chr1542474 1071 1042 361 --22954 2637 --
NM_001310chr1262775 2749 1956 804 108 23 ------
NM_001332chr51196 11608 ----
NM_001356chrX1182 32308 2281 360 ----
NM_001390chr1853151 2272 2231 1446 871 1509 12578 --
NM_001396chr2122256 1941 32813 2342 298 ----
NM_001455chr673425 1595 1440 822 800 329 287 193 ----
NM_001518chr731024 300 154 ------
NM_001660chr32709 634 1174 ----
NM_001663chr142848 672 ----1714
NM_001706chr31411 ----1259
NM_001753chr7--31168 706 456 1723 --
NM_001759chr1235197 1396 941 14660 --11445
NM_001806chr1972441 2281 2178 2095 1892 168 138 ------
NM_001830chrX42585 1032 865 411 --1419 --
NM_001839chr12733 23 ------
NM_001845chr1331134 1066 506 ------
NM_001858chr644908 4697 1261 178 15165 --11041
NM_001882chr5----1106 --
NM_001949chr622119 1038 12698 --1261
NM_001981chr122369 822 1933 ----
NM_001999chr51278 --1333 --
NM_002024chrX31923 446 233 22047 526 ----
NM_002025chrX79156 8249 6200 3720 3087 2681 221 58975 5908 5685 3616 1926 26747 635 --
NM_002026chr22815 249 1769 172 --
NM_002040chr21--12154 2943 282 --
NM_002115chr5------1181
NM_002126chr1763710 3696 1650 922 510 93 --1189 --
NM_002160chr9--1242 --1396
NM_002168chr15----1211 --
NM_002188chr5------1722
NM_002214chr742273 1011 364 267 25318 4380 ----
NM_002253chr421385 1035 11422 ----
NM_002336chr1254938 3808 3719 1748 1060 ----13278
NM_002349chr231393 476 450 --175 --
NM_002356chr662760 1824 1808 703 690 297 12430 11871 12487
NM_002397chr51203 11360 --11654
NM_002515chr142390 334 --12013 --
NM_002522chr173779 480 445 23863 1567 ----
NM_002536chrX------11619
NM_002605chr152370 89 2406 147 ----
NM_002613chr1675286 3856 3660 1553 1254 1011 741 --25392 3756 --
NM_002618chr2----1406 --
NM_002651chr11719 --1236 --
NM_002655chr831553 642 549 24021 389 14093 --
NM_002698chr1972577 971 938 865 631 136 107 ------
NM_002703chr41630 ------
NM_002736chr711868 ----1613
NM_002742chr141559 1710 1128 --
NM_002745chr2264548 4476 4093 1703 994 459 24575 967 11060 --
NM_002755chr151659 ------
NM_002825chr7--138 --1496
NM_002849chr121429 21020 326 ----
NM_002868chr1232338 388 75 1166 ----
NM_002869chr112227 183 1106 ----
NM_002874chr93897 835 188 1916 ----
NM_002890chr52326 35 1730 ----
NM_002928chr121629 1453 --1296 --
NM_002938chr431721 1434 650 ----11389
NM_003010chr1722447 1972 12318 1267 --
NM_003011chr9--11331 1443 1527
NM_003016chr1732035 1634 1403 ------
NM_003030chr311324 --11913 --
NM_003069chrX2627 101 --1738 --
NM_003076chr1251518 1281 638 602 571 --11208 --
NM_003108chr266757 5302 5198 1744 1072 896 21380 1017 ----
NM_003112chr7----12561 1388
NM_003128chr21258 --1620 --
NM_003185chr2021166 425 ----2872 284
NM_003204chr171143 ------
NM_003205chr1541635 1520 509 28 11999 ----
NM_003262chr354266 3726 3638 1839 1328 23325 1542 1505 --
NM_003269chr621225 366 ------
NM_003298chr374573 4212 4003 1858 1256 417 106 --11839 24633 452
NM_003300chr14127 --1393 --
NM_003304chr31446 --1244 --
NM_003338chr1051465 617 403 366 64 11576 ----
NM_003342chr1723128 383 12318 12972 --
NM_003369chr1142785 2667 2017 1703 --1939 --
NM_003390chr11----1104 --
NM_003392chr354228 4127 3367 2782 967 --23752 3376 --
NM_003400chr2----143 --
NM_003411chrY1565 21222 440 2620 467 --
NM_003418chr3----1674 --
NM_003439chr773384 3049 1277 1119 571 277 145 2325 288 1781 --
NM_003454chr1631036 455 206 ------
NM_003463chr611210 1791 1219 --
NM_003468chr211369 12719 24149 3890 --
NM_003478chr1122848 569 --1169 --
NM_003483chr123838 727 31 1820 12146 --
NM_003583chr1253355 2449 1376 997 126 11132 1601 12889
NM_003629chr11610 32170 1179 773 ----
NM_003633chr531944 1878 349 ------
NM_003679chr132501 2482 805 --12650 --
NM_003713chr11624 --11657 --
NM_003716chr31834 2291 159 ----
NM_003743chr221919 468 ----11716
NM_003749chr1331733 374 68 ------
NM_003758chr1511529 1351 ----
NM_003794chr311042 1741 ----
NM_003812chr2------1210
NM_003831chr1841731 445 170 46 ------
NM_003884chr321325 122 ------
NM_003895chr2142163 1883 1661 298 11782 ----
NM_003900chr5----2439 295 11449
NM_003901chr1032196 1718 669 12731 ----
NM_003913chr684310 3046 1494 1253 608 523 443 328 11721 ----
NM_003916chrX41085 418 256 76 11343 1105 --
NM_003939chr1084086 3862 3322 3205 2617 1000 199 179 11587 ----
NM_003972chr102481 124 162 ----
NM_004077chr123950 514 449 11162 ----
NM_004114chrX199 ------
NM_004124chr1452330 2285 809 622 376 --12716 --
NM_004133chr832482 903 857 --12243 --
NM_004157chr32710 53 --2649 158 --
NM_004170chr931821 1561 649 11717 ----
NM_004171chr11118588 8564 7882 6835 6600 6246 3542 2144 1184 157 127 27153 3087 12550 --
NM_004302chr1252867 1034 995 849 729 ------
NM_004326chr11441 ------
NM_004331chr832093 2038 692 --12631 2415 303
NM_004349chr82860 125 1134 ----
NM_004428chr1----1156 --
NM_004430chr811745 ----11768
NM_004432chr962427 2044 1947 1720 128 97 ------
NM_004438chr222171 1053 12727 ----
NM_004457chr21599 --1242 --
NM_004498chr151391 ------
NM_004501chr164102 3252 2533 956 826 210 --1238 1410
NM_004569chr142639 168 ----1274
NM_004586chrX74915 3986 3638 3522 3447 1408 421 1990 --1181
NM_004654chrY2444 164 ------
NM_004684chr4--199 1109 --
NM_004742chr3----1280 11305
NM_004745chr856443 6079 4605 2145 1869 ------
NM_004774chr17----12799 --
NM_004834chr221093 841 ------
NM_004842chr61356 --1628 --
NM_004852chr181713588 13489 12880 12869 12139 10796 10525 10222 9587 8823 4478 3733 3576 2857 2297 747 373 512592 11613 10175 9427 4653 110329 --
NM_004859chr1742291 1885 501 475 --12654 --
NM_004921chr141748 725 691 62 ------
NM_004929chr831329 1169 1028 --1230 --
NM_004947chr352316 2150 1781 1593 987 136 ----
NM_004973chr61149 ------
NM_004978chr121593 1489 --1465 11126
NM_004985chr1241686 125 87 75 ------
NM_004992chrX106667 6117 5960 5216 3129 3117 2744 2339 1342 1141 28457 132 36856 6514 5854 --
NM_004999chr643796 3527 2946 2915 12850 23564 1096 --
NM_005056chr121169 1814 73866 3737 3679 3621 3563 1604 246 --
NM_005063chr1053528 3065 2530 2486 298 --1559 --
NM_005066chr1----1109 --
NM_005116chr2054152 4125 4074 4023 1602 13590 ----
NM_005121chr1743659 2663 2448 1382 --23597 2962 --
NM_005156chr964872 4433 4128 4080 3948 3623 146 13605 --
NM_005201chr331003 816 101 --1311 --
NM_005222chr7------1289
NM_005230chr12--1595 1152 --
NM_005261chr8----1184 --
NM_005277chr421240 158 21673 1495 ----
NM_005329chr1642155 1981 1935 1500 --1631 --
NM_005339chr454062 3785 2658 949 292 13995 11499 --
NM_005342chrX31098 628 161 ----1716
NM_005358chr1321174 241 ------
NM_005374chr1752182 1797 1568 722 155 --2344 304 --
NM_005406chr1821017 307 21316 642 ----
NM_005436chr1093548 3211 2654 2614 1222 1133 1047 457 283 11384 13512 --
NM_005450chr17----1251 --
NM_005461chr201710 ----11606
NM_005504chr1224760 1106 34499 1780 725 ----
NM_005517chr13953 572 372 11208 1132 --
NM_005544chr22857 127 147 ----
NM_005599chr1--21257 1115 1164 --
NM_005604chr641835 1823 1812 1681 ------
NM_005668chr542879 861 252 92 --1405 --
NM_005711chr51734 1973 --1425
NM_005715chr632621 2357 759 ------
NM_005721chr2------1900
NM_005746chr722689 2093 1510 ----
NM_005759chr254156 3943 1691 859 565 --11352 --
NM_005819chr121018 767 1876 ----
NM_005822chr632286 2251 254 1305 1537 --
NM_005868chr73640 402 71 ------
NM_005885chr541496 509 131 91 ------
NM_005898chr1153069 2880 2740 2461 157 ------
NM_005909chr554118 3210 2822 2792 577 23628 1271 ----
NM_005933chr1122873 1122 ----11881
NM_005941chr833460 3031 2668 --11395 11662
NM_005955chr145349 4544 2217 615 23847 1713 ----
NM_005999chr1--21338 1101 ----
NM_006047chr2043506 3158 1324 799 --21027 345 --
NM_006060chr743994 1767 1697 1665 13033 ----
NM_006080chr722992 240 1354 ----
NM_006141chr161538 --1808 1521
NM_006158chr811427 ----1378
NM_006164chr21181 --1168 --
NM_006206chr452002 468 346 213 189 32408 1075 680 ----
NM_006224chr1752019 1767 1742 1560 165 1898 22352 1897 --
NM_006226chr21471 --1143 --
NM_006251chr532692 1254 1052 ------
NM_006275chr2042082 1866 852 323 11013 ----
NM_006282chr2074372 3616 2874 1348 1285 1196 78 43658 3375 1404 838 24615 165 --
NM_006283chr864671 4166 4047 3518 1587 1474 11529 --14684
NM_006298chr662721 2599 1256 1084 568 36 12232 12342 1720
NM_006306chrX45108 4993 1980 683 34951 4405 1652 15719 --
NM_006310chr1731002 488 285 2199 191 ----
NM_006313chr12----11473 --
NM_006321chr3------11518
NM_006330chr81324 21579 272 ----
NM_006352chr12654 165 ------
NM_006380chr172803 194 12705 24071 2817 --
NM_006425chr521317 459 --11395 --
NM_006469chr131641 1608 552 ------
NM_006504chr1032679 1857 387 --141 --
NM_006544chr143456 63 31 22151 890 --14957
NM_006546chr1766163 6124 4195 4041 1252 843 35581 1661 1172 1572 --
NM_006565chr1621137 462 ----2962 194
NM_006570chr9--1357 --1417
NM_006572chr1733223 2292 1213 ----1908
NM_006595chr1131573 79 69 ------
NM_006599chr1687156 6965 6495 6219 6023 5316 5100 1822 25688 2905 12252 --
NM_006609chr221849 566 11822 ----
NM_006644chr13----1538 --
NM_006704chr13------1344
NM_006710chr21107 --1243 --
NM_006711chr161254 --1726 --
NM_006726chr41451 3927 870 179 ----
NM_006750chr16107361 7063 6287 6259 5868 2691 2414 1739 1423 98 ------
NM_006751chr2----1153 --
NM_006761chr173770 644 269 1316 ----
NM_006763chr111346 ----1361
NM_006775chr652954 2528 2102 1929 103 --12033 --
NM_006777chrX32455 1171 327 11061 2491 368 --
NM_006788chr1862075 2056 1597 1479 1372 236 --1391 --
NM_006823chr831370 520 452 1199 11350 --
NM_006827chr1452827 2663 2368 915 360 --1292 --
NM_006838chr1231438 1349 1220 ------
NM_006852chr1752000 1096 1018 734 60 1650 ----
NM_006874chr42915 781 --11172 --
NM_006885chr1664053 3198 3170 2961 1298 445 ------
NM_006892chr2011445 ------
NM_006920chr231460 749 133 ----1166
NM_006981chr921004 965 ----1697
NM_007007chr1254782 4758 4739 991 710 24355 496 ----
NM_007010chr1721184 165 ------
NM_007011chr1576697 5890 4641 1975 1938 267 117 ------
NM_007068chr22------1125
NM_007106chr1352788 2620 645 548 394 2858 464 ----
NM_007129chr133830 734 667 ------
NM_007146chr1721783 674 ------
NM_007212chr121413 199 --11845 --
NM_007249chr1387614 2689 2531 2272 2164 1284 946 61 36690 6399 6078 12657 --
NM_007282chr32343 279 1738 ----
NM_007332chr8----1346 --
NM_007347chr1512580 33208 1011 949 --12985
NM_007350chr1254558 4454 3943 3796 684 11243 21545 1513 --
NM_007375chr142476 2457 1874 135 ------
NM_012081chr593715 3328 3114 3074 2711 2375 2346 959 113 ------
NM_012095chr1052869 2654 2206 2186 1259 1954 1715 12712
NM_012157chr32323 212 1966 1351 --
NM_012199chr134630 4386 3077 ------
NM_012281chr731955 1540 697 1911 ----
NM_012297chr41774 11039 21665 1594 --
NM_012300chr51631 --1472 --
NM_012330chr1031170 450 409 ------
NM_012399chr2221371 512 21632 333 ----
NM_012416chr941075 1005 785 769 11205 ----
NM_012471chrX21375 552 --1421 --
NM_013231chr1443877 3150 1211 1072 14406 11488 --
NM_013286chr352805 2621 1461 727 701 --1605 1298
NM_013354chr81139 31320 1311 578 --1235
NM_013381chr1252145 1731 964 577 475 ------
NM_013392chr2----184 --
NM_013960chr84768 243 160 33 ------
NM_014016chr331657 1302 423 1470 ----
NM_014048chr1694955 4840 4112 3630 2060 1888 975 180 64 35288 736 268 13351 --
NM_014112chr874974 4393 4259 3833 1599 1227 704 ------
NM_014117chr1642300 2168 2035 857 ----1241
NM_014157chr1643639 2812 406 238 13335 ----
NM_014181chr242141 2064 1076 842 ------
NM_014231chr121448 --11662 --
NM_014388chr144138 4034 1672 1140 25473 1596 1128 --
NM_014423chr533424 392 166 24099 2191 25349 4516 14244
NM_014456chr10----166 --
NM_014571chr142507 2164 2019 942 ------
NM_014572chr1321515 186 --11667 --
NM_014583chr3----1199 --
NM_014615chr1623038 2285 33276 308 205 13229 1496
NM_014629chr851334 1224 908 397 328 --1539 --
NM_014660chr72833 706 ------
NM_014682chr8--1715 --1692
NM_014686chr1922495 2027 12109 ----
NM_014705chr732099 1392 396 1856 ----
NM_014730chr1254636 3583 3270 1418 1384 --23632 1095 --
NM_014746chr224368 3291 21728 879 24208 2938 --
NM_014766chr763249 3234 1121 1012 704 404 22951 1513 ----
NM_014788chr972935 2836 674 524 478 306 73 ------
NM_014795chr22459 396 --1902 --
NM_014803chr1042594 2200 1032 94 12778 --12837
NM_014810chr142711 2674 2439 1372 12256 ----
NM_014820chr31103 --1530 --
NM_014830chr1263901 2548 1347 1252 1116 517 11430 1486 --
NM_014899chr522117 1210 12259 12558 --
NM_014903chr1221864 465 ------
NM_014932chr321221 610 1489 1571 --
NM_014939chr1861299 1099 1028 626 509 242 ------
NM_014943chr81846 --2837 465 --
NM_014991chr422980 866 12929 ----
NM_015017chr11992 1924 1913 --
NM_015025chr211661 --11766 --
NM_015039chr152685 1332 682 619 48 ------
NM_015049chr232292 1294 1287 2554 302 137 --
NM_015059chr1563878 3365 3352 3050 2903 808 --2296 159 --
NM_015064chr1253148 2712 2400 636 301 23129 2879 12476 --
NM_015071chr596288 5628 5531 4393 2140 919 475 218 193 14538 14952 --
NM_015074chr113237 24775 4434 13242 --
NM_015076chr643309 1696 952 285 2746 434 ----
NM_015090chr1126114 6073 5700 5104 4940 4855 4232 2461 2221 1670 631 319 21843 104 ----
NM_015132chr741848 1645 1340 294 --1458 --
NM_015144chr1673047 3001 2477 932 833 566 468 11058 23084 604 --
NM_015155chr1022116 922 ----11093
NM_015156chr1443886 1609 1103 736 --23584 331 --
NM_015185chrX52543 2071 1869 693 627 ------
NM_015186chr9------1341
NM_015191chr1122485 1769 --12675 --
NM_015206chr1533743 3490 1350 --21116 768 --
NM_015213chr111521 --1547 --
NM_015215chr132078 796 69 2233 26 ----
NM_015271chr443252 2906 1257 567 1685 1907 --
NM_015285chr1842280 1921 951 362 ------
NM_015299chr1443005 1382 236 35 ------
NM_015317chr242283 2151 1886 960 --11812 --
NM_015328chr731251 393 301 43100 2014 1897 82 ----
NM_015349chr612842 12610 --13022
NM_015361chr2----1220 --
NM_015375chr153923 3769 3151 723 193 1226 ----
NM_015409chr1262707 2645 2505 2082 989 102 ------
NM_015435chr831091 482 447 1142 ----
NM_015458chr843667 3306 1216 1144 --13277 --
NM_015534chr12406 184 --1828 --
NM_015559chr182858 249 --1953 --
NM_015568chr2084091 3827 3190 2781 1289 1222 505 319 --1836 --
NM_015569chr11106 --11077 --
NM_015576chr332702 1889 1093 ------
NM_015578chr1931948 1386 544 ----1707
NM_015678chr1321505 1444 1644 --1150
NM_015686chrX31845 1682 503 1271 ----
NM_015888chr122634 2081 1357 11093 12135
NM_015891chr621948 645 ----1751
NM_015906chr163452 3430 3199 3081 893 504 21011 594 11576 --
NM_015912chr821911 490 12013 1891 --
NM_016061chr231089 561 81 --1485 --
NM_016072chr122916 70 1158 1676 1210
NM_016076chr122973 2159 12935 12010 11204
NM_016078chr1721007 286 ------
NM_016083chr611447 43467 1343 1054 491 ----
NM_016100chr20------1171
NM_016125chr171417 1511 ----
NM_016206chr358457 7089 6906 2928 428 48884 7103 675 85 ----
NM_016217chr622296 1207 22748 2269 --13527
NM_016248chr1353905 3255 3213 574 108 23845 3457 ----
NM_016255chr643309 2170 1301 61 11083 12710 --
NM_016281chr121921 ------
NM_016289chr251619 1511 58 49 37 1549 ----
NM_016308chr131282 660 447 --1833 --
NM_016396chr1553054 2314 2114 990 977 ------
NM_016422chr1122628 578 12835 ----
NM_016441chr221673 344 --1729 --
NM_016472chr14--1183 11066 --
NM_016485chr61162 22149 1656 --1233
NM_016530chr152324 307 23653 3240 ----
NM_016531chr493549 3408 3042 796 774 729 476 322 24 13663 22917 160 --
NM_016577chr354513 3553 3393 2998 2858 --22904 901 --
NM_016588chr61676 1922 ----
NM_016620chr1--1245 --1992
NM_016626chr1811323 --11393 --
NM_017418chr9----156 --
NM_017420chr143628 506 36 1942 ----
NM_017488chr221115 548 1145 ----
NM_017508chr1142449 2120 1930 107 ------
NM_017519chr621313 547 ------
NM_017551chr1042694 2580 2094 1891 ----1209
NM_017610chr1531815 617 313 ----11408
NM_017633chr633557 3431 615 11465 ----
NM_017637chr9128646 7405 7177 6542 6223 6096 3390 2602 2188 2059 1723 69 57229 7164 2907 2766 896 46424 2894 945 671 --
NM_017643chr1723054 2124 ------
NM_017694chr21772 21561 601 ----
NM_017741chr441844 1825 1719 660 ------
NM_017749chr111151 --1743 --
NM_017752chrX31789 1382 56 --1176 --
NM_017754chr654721 4590 4509 3431 807 --14981 --
NM_017801chr322240 157 1673 11668 --
NM_017811chr921037 958 188 ----
NM_017813chr865614 5608 1933 1620 705 47 --1825 --
NM_017824chr1021015 245 1389 ----
NM_017848chrX34314 3200 1866 --13600 --
NM_017902chr10115735 5361 5160 4909 4729 4237 4184 2010 1985 768 517 13935 ----
NM_017919chr945457 5346 1968 696 --25733 4609 15724
NM_017944chr1143044 2269 943 736 23114 1178 ----
NM_017994chr712835 11063 12939 12685
NM_018015chrX1328 295 82 ----
NM_018027chr1032949 1004 216 --11246 --
NM_018061chr151576 1556 1382 1209 657 11080 31466 1243 394 --
NM_018064chr61126 ------
NM_018084chr233205 417 64 1776 1544 --
NM_018098chr3187 ----11000
NM_018121chr1043077 3030 2166 1198 --22992 2121 --
NM_018128chr1741031 282 104 96 --140 --
NM_018133chr332132 554 361 --11770 --
NM_018157chr1252190 2103 734 593 40 --22694 870 --
NM_018159chrX31254 216 22 ------
NM_018184chr321704 868 1362 1203 --
NM_018243chr421118 367 23987 1552 ----
NM_018254chr141965 1926 1903 208 1235 21940 1892 1743
NM_018293chr31770 12836 --12465
NM_018330chr1011355 21298 389 11345 --
NM_018362chr1133373 1514 576 --13634 --
NM_018364chr123579 3002 21570 1523 ----
NM_018374chr745260 4567 4193 1250 ------
NM_018375chr1431685 461 201 ------
NM_018388chrX21214 456 ------
NM_018403chr324145 1512 23684 1190 ----
NM_018448chr1211043 1448 ----
NM_018471chr23471 39 33 ------
NM_018482chr842552 2509 2193 1818 32251 566 414 ----
NM_018602chr152274 120 --1350 --
NM_018638chr1265249 5133 3693 1083 307 248 1413 ----
NM_018650chr1--21611 667 1168 --
NM_018682chr71748 ------
NM_018698chrX11736 --2332 132 --
NM_018712chr1121545 303 ------
NM_018847chr91741 11390 11539 --
NM_018948chr141091 1063 1008 22 ------
NM_018970chr762662 2643 1076 856 346 104 42443 2262 2250 891 ----
NM_018977chrX----11097 --
NM_018979chr1232527 936 589 2611 271 ----
NM_018999chr1044857 4205 4098 1307 1458 ----
NM_019002chr2------1230
NM_019006chr15----1491 --
NM_019045chrX--134 1916 --
NM_019066chr151441 1384 ----
NM_019071chr72532 230 ------
NM_019102chr7----156 --
NM_019106chr2232451 2331 857 12974 ----
NM_019610chr12855 480 ----11382
NM_020122chr275827 5353 4561 4298 4135 1049 973 --11015 14399
NM_020144chr71151 31460 438 214 ----
NM_020148chr1832806 2568 2232 --2381 40 --
NM_020159chr411176 --1314 1530
NM_020177chr553275 1290 1055 684 21 11006 1565 11146
NM_020180chr18----11114 --
NM_020342chr242448 1731 551 96 ------
NM_020348chr1062465 2382 2191 922 730 147 --11905 --
NM_020362chr1137 ----1692
NM_020381chr6133 21839 277 11921 --
NM_020382chr1221487 300 ----11496
NM_020403chr13----1131 --
NM_020432chr732073 528 331 ------
NM_020651chr2--11648 ----
NM_020699chr145337 4049 1609 1447 1153 ----
NM_020742chrX32739 2095 1024 2719 47 ----
NM_020750chr62545 111 ----11512
NM_020772chr1757604 7262 6732 2974 1152 26199 1024 38218 2742 559 --
NM_020794chr11211 --1137 --
NM_020800chr32300 265 1213 ----
NM_020801chr5----1440 12472
NM_020804chr642132 803 789 780 22585 823 11819 --
NM_020808chr1----1720 --
NM_020810chr1423221 1252 --12981 --
NM_020871chrX1244 1385 --1696
NM_020925chr121400 1118 ------
NM_020935chr234572 2995 1826 13275 ----
NM_020962chr1552363 1973 1824 1625 353 ------
NM_021005chr1531019 969 347 ------
NM_021033chr1343437 3166 3079 148 1180 13180 --
NM_021038chr323048 2413 13201 12596 --
NM_021064chr621358 374 21727 489 ----
NM_021076chr22------2171 160
NM_021116chr747734 7143 6126 5920 23321 918 1329 12955
NM_021140chrX1800 ----1413
NM_021145chr71841 --1716 --
NM_021183chrX32149 368 208 1826 11670 --
NM_021190chr111346 ------
NM_021643chr2125 --1378 --
NM_021815chr212732 12937 --12509
NM_021960chr11464 2631 227 11712 --
NM_021961chr1167375 6923 5217 4849 2389 1088 11369 26025 1803 --
NM_021964chr366492 5510 4634 732 400 381 --36284 5517 173 --
NM_021998chrX1555 --11112 --
NM_022037chr2192 1904 --1928
NM_022048chr1535775 5189 1012 25637 5521 ----
NM_022063chr1041663 1354 1340 322 --11297 --
NM_022170chr741493 1266 1191 147 11456 ----
NM_022459chr1374546 4089 2542 2275 981 642 196 15202 14530 --
NM_022465chr1232663 2006 1236 --12086 --
NM_022474chr1462187 2026 1853 1827 1077 794 12224 ----
NM_022719chr2212938 13717 23454 2650 11532
NM_022739chr173910 393 64 ------
NM_022753chr152835 2731 2320 1948 966 --1511 --
NM_022758chr652850 2737 2468 2242 175 --1688 --
NM_022776chr31252 ----11000
NM_022780chr211264 --2671 577 --
NM_022781chr932195 905 321 ----1897
NM_022821chr1168 ----1361
NM_022894chr221437 475 ------
NM_022898chr1444769 4384 3466 802 --11499 13080
NM_024016chr17----1664 --
NM_024122chrX169 --1100 --
NM_024496chr14--1330 1277 --
NM_024551chr1242439 2327 1652 929 ------
NM_024612chr174976 775 346 267 --1103 --
NM_024613chr811409 11494 1394 --
NM_024629chr4--11159 ----
NM_024665chr354033 3855 1777 403 367 21658 727 ----
NM_024721chr81404 --12131 --
NM_024749chr141764 1605 895 456 1404 ----
NM_024896chr942395 1997 1640 230 11917 12029 --
NM_024949chr454268 4137 1849 1369 930 ------
NM_024989chr276127 5606 5572 5448 1664 1002 78 77763 5782 5416 3003 2899 2783 1206 --15496
NM_024993chr211489 ------
NM_025054chr813074 ----12805
NM_025079chr1------1513
NM_025106chr121209 208 ----11925
NM_025133chr22208 130 ------
NM_025134chr1612289 31728 731 405 ----
NM_025146chr312135 1844 1681 12281
NM_025160chr173431 1469 1120 981 975 911 285 21066 994 13188 --
NM_025179chr123533 1324 ------
NM_025235chr101206 --12021 --
NM_030571chr541607 1441 1187 1136 ------
NM_030647chr736250 5066 3851 55686 3909 2403 1616 172 ----
NM_030648chr485292 4701 1824 1583 1460 1435 897 350 14261 21043 400 1128
NM_030762chr1231722 1356 565 ------
NM_030786chr121757 1191 151 ----
NM_030806chr188929 8041 6513 6432 3102 2884 1685 1207 53211 3002 1719 911 92 17269 38679 2418 1000
NM_030816chr13949 846 672 3518 171 130 1813 --
NM_030885chr331965 1559 82 ------
NM_031372chr4----11582 --
NM_031442chrX62794 2670 2424 1260 590 496 22357 2086 ----
NM_031445chr21640 --12518 11257
NM_031469chr633460 2971 56 1111 13653 --
NM_032017chr121987 1818 --1156 12107
NM_032104chr11503 1120 1643 --
NM_032217chr4--21074 339 3948 442 210 --
NM_032228chr1143505 3458 1385 1335 1691 ----
NM_032352chr14--11361 --11321
NM_032373chr1065718 4203 655 263 148 111 ----11933
NM_032408chr72471 417 ------
NM_032439chr1011338 21231 318 1458 --
NM_032440chr1022228 1061 31807 880 634 12174 --
NM_032458chrX33052 2626 2249 ------
NM_032471chr6--1830 --11054
NM_032499chr1521516 232 11112 ----
NM_032505chr31213 1183 --12021
NM_032521chr2011067 12348 13132 --
NM_032557chr41351 ------
NM_032560chr142317 25 1943 ----
NM_032564chr11----1165 --
NM_032603chr23729 657 496 --1178 196
NM_032632chr141147 1703 --1208
NM_032682chr322658 319 11416 22344 73 --
NM_032801chr1142217 2158 564 372 11811 ----
NM_032832chr631641 1085 288 ----1553
NM_032842chr7----11450 --
NM_032859chr1343783 1423 1229 878 13501 23730 252 --
NM_032961chr441349 1315 1278 170 ------
NM_033083chr363051 1338 1270 930 567 356 1942 --13454
NM_033117chr9----1117 --
NM_033127chr12726 535 1470 ----
NM_033143chr424066 3241 2554 56 ----
NM_033211chr52377 36 11354 ----
NM_033224chr797065 5626 5479 5158 5148 4929 1509 1264 475 --26955 6916 --
NM_033285chr864342 3647 3110 3061 478 404 24203 1715 1297 14486
NM_033389chr1763974 3767 3693 888 468 298 14464 23059 1873 --
NM_033631chr153310 3223 2615 2430 1257 ------
NM_033656chr2144818 4790 4395 192 13953 ----
NM_052832chr833002 2823 226 21142 429 ----
NM_052879chr1222514 363 --13196 --
NM_052905chr23749 743 716 31834 737 128 ----
NM_052907chr1224267 3840 21444 75 --11125
NM_052936chrX------2687 87
NM_052937chr82956 734 12526 1942 1140
NM_057175chr44939 744 448 404 1818 ----
NM_058237chr144932 906 873 364 ------
NM_080738chr111936 --11245 1754
NM_101395chr2122924 2609 33481 3010 966 --159
NM_133171chr2011049 --11034 11276
NM_133264chr1731294 975 704 ------
NM_133646chr231915 1803 1611 43763 1965 842 224 ----
NM_138333chr92677 362 ------
NM_138426chr7112494 2255 2064 1928 1838 1008 884 299 218 169 114 1848 ----
NM_138799chr23553 247 59 11667 ----
NM_139136chr12----1783 --
NM_139321chr2014015 13868 23226 615 --
NM_144571chr425496 2754 26463 2228 ----
NM_144574chr143519 419 225 ------
NM_144578chr14115374 4527 4436 4184 4125 3630 3582 2008 1902 1807 1771 15106 14283 1534
NM_144599chr1575404 5383 4647 4410 2002 1741 155 21837 1309 ----
NM_144721chr442570 2189 622 489 ------
NM_144963chr861037 572 542 201 71 57 12036 ----
NM_144967chrX------1763
NM_144973chr1264643 4513 3896 1440 1385 1368 ----15194
NM_145207chr441339 899 663 120 24799 3646 --13904
NM_145307chr1044330 4257 3188 466 ----11190
NM_145332chr62708 240 --1123 --
NM_147128chr7----11126 --
NM_147223chr232102 651 167 ----11899
NM_152265chr121335 144 2996 104 ----
NM_152400chr431750 1646 528 1562 22004 1904 --
NM_152409chr532641 2274 1289 13209 1967 --
NM_152525chr2------1135
NM_152545chr41504 ----2630 133
NM_152570chr91300 2256 50 ----
NM_152622chr533386 2898 201 --1122 --
NM_152641chr1252421 536 462 307 40 12863 ----
NM_152694chrX--1919 ----
NM_152758chr821032 161 32021 1920 932 ----
NM_152793chr754796 4177 1587 1091 89 13934 176 --
NM_152835chr142822 2247 1929 532 --1331 --
NM_153020chr61477 --11576 --
NM_153207chr1232542 1100 358 ----13561
NM_153267chr9----1600 --
NM_153607chr5185 --190 --
NM_153634chr121116 2620 570 ----
NM_153756chr12221 27 11666 --11851
NM_153810chr1064945 3515 1902 910 513 314 ------
NM_170606chr741487 1470 614 24 11186 ----
NM_170665chr1224146 4014 23901 3824 1504 23321 330
NM_171998chrX62263 2183 2073 1714 621 424 ------
NM_171999chr18------1687
NM_172071chr144919 2953 482 218 14533 17478 --
NM_172236chr202678 273 1566 1127 --
NM_173473chr1022722 2478 --1388 --
NM_173478chr172715 308 1842 1708 --
NM_173495chrX52562 2325 1787 1756 1648 ------
NM_173496chr104642 399 377 328 11147 ----
NM_173591chr121330 1140 1898 --
NM_173642chr1138432 7902 7007 6292 3001 2737 1648 1492 699 556 306 223 126 --27112 1308 --
NM_173667chr53892 563 422 --11861 --
NM_173808chr131599 604 102 ----14025
NM_173851chr853527 2992 1373 897 206 1286 ----
NM_174938chr91140 2523 61 ----
NM_175607chr3--11608 11520 --
NM_175736chr1277452 6711 4751 2620 2607 390 250 ----17534
NM_175767chr531715 1248 388 --11392 --
NM_175852chr151069 681 455 258 154 --12614 --
NM_175854chr1332267 1006 495 ------
NM_175907chr1842880 2658 2601 2463 --1324 --
NM_177968chr22327 137 ------
NM_178539chr1231514 846 208 ------
NM_178815chr1032222 2071 853 1234 22629 2561 --
NM_181077chr1531763 253 215 ------
NM_181358chr144221 3622 3211 2718 1978 ----
NM_181359chr122156 885 42363 707 277 190 ----
NM_182485chr422796 141 --1981 --
NM_182767chr123697 437 146 ------
NM_194247chr244309 2952 682 31 13078 ----
NM_194285chr1122930 302 ----21260 965
NM_194313chr921253 364 ----11914
NM_194314chr124754 1353 ------
NM_198081chr632427 661 398 --1737 --
NM_198273chr552956 2853 1270 1093 495 --23092 625 12489
NM_198581chr232075 505 226 32622 1856 234 1423 15959
NM_198859chr364881 4330 4197 1699 735 604 34866 4130 359 2935 129 1823
NM_199168chr1011414 --11324 --
NM_199320chr4--1532 ----
NM_199355chr1621442 1408 ------
NM_199461chr1043182 334 105 99 ----1456
NM_203301chr1431569 106 69 ------
NM_203390chr811447 --11764 --
NM_203463chr294229 3975 3859 3131 3062 1356 763 571 95 ------
NM_206853chr62102 66 ----22516 376
NM_207306chr1114213 1633 1398 1362 1038 790 646 348 300 271 40 ------
NM_207325chr1932084 1592 607 11667 11654 --
NM_213589chr245541 5522 5418 1385 ----15502
NM_213606chr1041069 991 811 447 12408 ----
NM_213662chr1742035 654 422 25 ------