TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-629-3p
miRNA Sequence: GUUCUCCCAACGUAAGCCCAGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000259chr1555859 1251 1219 423 255 1290 14444 1275
NM_000332chr6106875 6786 5968 5701 5411 1607 1466 1385 833 255 34715 1206 341 1836 32048 843 212
NM_000337chr555170 1866 1488 1434 650 36562 5304 1745 --24391 1395
NM_000376chr1282965 2881 2660 2478 2020 952 908 822 42757 2081 612 350 32389 1079 897 22788 2741
NM_000461chr373595 2923 2905 1085 251 111 97 31743 1498 998 --13925
NM_000462chr1511542 11846 --21546 639
NM_000555chrX56894 6139 2124 1669 468 37102 2811 1133 25382 1798 26763 570
NM_000599chr2134033 4021 3777 3704 3441 3016 2967 2952 1537 1507 1481 916 517 24006 2978 41729 1599 919 437 53416 3342 1651 1580 521
NM_000633chr1894875 4680 4432 4024 1604 1404 1302 531 441 --2547 474 24030 619
NM_000719chr12136613 5525 4682 4308 4284 2414 2232 2067 951 799 483 463 436 45817 5792 5692 2585 64368 2201 646 489 294 205 41784 1140 806 172
NM_000831chr184833 2316 2156 2110 1573 1356 1267 743 2787 619 35688 2398 1852 21248 644
NM_000964chr1741289 398 142 134 --1147 --
NM_001001557chr872078 1408 1401 374 254 106 64 31797 1466 91 1380 31456 457 153
NM_001002762chr1052484 1949 1837 282 102 2799 543 12478 2118 110
NM_001002814chr8123703 3138 3120 3044 2972 2786 2677 2466 2434 1219 1201 1187 11491 12989 13545
NM_001003940chr15103283 2924 2660 2643 1526 1470 1277 1140 636 232 12450 22743 2665 23749 2787
NM_001003942chr15103283 2924 2660 2643 1526 1470 1277 1140 636 232 12450 22743 2665 23749 2787
NM_001003943chr15103287 2928 2664 2647 1530 1474 1281 1144 640 236 12454 22747 2669 23753 2791
NM_001004419chr1263568 3242 1704 976 421 354 44085 3622 1774 1420 13936 13774
NM_001005473chr5116417 6012 6003 4954 2467 1059 1039 974 962 950 681 3666 139 38 --61890 1069 1049 1017 1001 956
NM_001005502chr12114584 4428 3760 3621 1735 1493 1475 1461 1323 593 451 34041 3775 104 25189 4578 34588 3542 790
NM_001008220chr5143845 3775 3696 3586 3421 2927 2897 2790 2748 933 833 533 467 326 42684 678 611 96 53853 3383 3164 2984 222 43688 3027 1578 1140
NM_001013659chr19165354 5149 5040 5013 4574 4426 4412 4277 4086 3712 3698 3577 3563 3462 2167 1502 44175 3923 3285 365 --15439
NM_001014797chr10107174 7161 6920 5922 5294 5205 3135 1547 1031 527 26534 3299 12072 36776 6069 5926
NM_001017440chr7177502 7202 6448 6201 5533 5453 5409 5101 2566 2449 2359 2115 1840 1806 1748 1286 937 87679 6962 6952 6494 3193 2555 1137 548 37744 6378 5631 47299 3185 2433 1216
NM_001017535chr1282965 2881 2660 2478 2020 952 908 822 42757 2081 612 350 32389 1079 897 22788 2741
NM_001018111chr7113889 3817 3727 3557 2744 1463 1341 1048 242 92 75 33316 2918 803 21580 97 --
NM_001024455chrX62554 2263 1668 897 874 269 2904 886 --12611
NM_001024647chr1295310 5176 2824 2777 2763 2636 2323 2129 1815 55643 5325 5237 1643 840 37106 2276 2263 15958
NM_001024809chr1741289 398 142 134 --1147 --
NM_001025077chr10116683 6669 6662 6471 6002 5457 523 507 469 430 91 26465 2117 1513 --
NM_001031695chr2285405 3682 3548 3488 3412 2127 579 436 64312 3660 3542 1105 354 347 12172 21985 1909
NM_001037165chr7258913 8652 8600 8385 8057 7997 7965 7834 7482 6473 6414 6374 6305 3541 3419 3109 2939 2681 2532 2268 1615 1186 430 92 21 26761 1338 108194 6797 6293 2948 2667 1688 1652 1574 386 302 16701
NM_001040152chr794811 4648 4456 4227 3575 1642 1587 1576 295 ----14862
NM_001040441chr1145198 5048 4804 4662 4644 4630 4495 2103 1821 1674 967 953 820 311 21734 1383 --13816
NM_001042599chr286497 3111 2732 2425 2264 1999 825 244 2201 29 --27655 3019
NM_001099678chr365283 5148 4993 4925 4776 4131 32500 1130 349 --36151 5213 4213
NM_001106chr3138942 6586 6549 3842 3811 3588 3439 3339 3315 3032 2727 2234 752 69748 3725 3518 3494 3279 801 68500 6366 6235 2918 1802 643 --
NM_001167chrX106219 6201 5384 4409 4208 4194 4092 793 785 779 25021 4121 15366 12338
NM_001315chr631624 182 45 2621 447 --21557 1486
NM_001543chr5174701 4680 4556 4113 3929 3877 3094 2992 1713 1632 1363 1154 591 516 429 257 146 --54751 4742 4661 4569 413 14493
NM_001874chr12114584 4428 3760 3621 1735 1493 1475 1461 1323 593 451 34041 3775 104 25189 4578 34588 3542 790
NM_001918chr1218207 7551 7436 7413 5746 3408 3012 2546 2532 2400 1812 1798 1655 1536 1522 1178 981 503 485 471 336 27634 7423 23411 3297 --
NM_002886chr345129 3178 807 520 34615 3871 1660 3810 499 354 1378
NM_003034chr1298013 7176 6961 6953 6062 1988 1239 488 170 48122 7844 7558 6194 ----
NM_003107chr64947 802 697 42 2256 48 51961 716 605 510 21 12537
NM_003108chr2146971 6884 5918 4690 2680 2467 2361 2304 2228 2183 1929 1790 1689 415 22242 1701 22380 2222 57000 6524 662 142 60
NM_003714chr582063 1927 655 504 494 326 311 91 12977 32066 1947 601 32896 1955 949
NM_003822chr142314 402 58 49 11181 21248 63 --
NM_004098chr104856 398 295 65 2993 287 2123 57 1301
NM_004200chr11152677 2633 2514 2483 2435 2048 670 604 451 413 274 216 202 130 101 1373 22498 107 12021
NM_004441chr371071 1052 906 280 55 27 21 190 11121 1913
NM_004588chr1193797 3473 2716 1305 1291 1170 1021 393 266 33881 1587 235 1229 13955
NM_004759chr161909 1814 1438 822 814 488 1833 42075 1993 805 656 --
NM_004774chr1783011 2336 1133 1080 563 298 275 264 --32065 2053 288 --
NM_004863chr14104926 4698 4432 4322 4168 3652 3478 1706 1556 1464 34604 3673 2095 14150 35146 4252 3696
NM_005197chr1474295 4087 2308 1909 1611 705 496 75971 5671 3920 1967 888 867 503 15957 --
NM_005235chr286497 3111 2732 2425 2264 1999 825 244 2201 29 --27655 3019
NM_005397chr7113889 3817 3727 3557 2744 1463 1341 1048 242 92 75 33316 2918 803 21580 97 --
NM_005840chrX107443 7424 6344 6331 6033 5941 2987 1983 139 76 27473 4947 57369 6334 2017 1993 84 --
NM_005910chr17134031 3490 3420 3377 2905 1099 1038 616 539 529 367 343 34 21498 40 5758 646 597 570 337 13388
NM_005935chr475033 4421 1599 1146 892 780 737 44826 4273 1265 348 11606 1489
NM_005937chr17143975 3436 3226 2793 2689 2667 1144 997 731 662 589 577 143 100 21378 416 43677 643 390 378 11164
NM_005938chrX71401 1242 1208 1158 1138 985 188 1204 2936 212 21145 992
NM_006141chr1692195 2180 974 503 489 471 277 246 113 1497 --12189
NM_006371chr3104679 4256 4033 4014 3882 1927 1901 1458 1419 1242 11226 11472 24703 1160
NM_006389chr1151040 154 148 142 79 2976 969 ----
NM_006544chr1455723 5621 5405 1500 779 14997 35726 1582 1215 24494 4298
NM_006546chr17176550 5743 5485 5433 5402 5087 5041 4709 4409 4322 4068 4062 1930 1886 1382 1181 985 35300 2241 637 14688 35636 1508 648
NM_006650chr5143845 3775 3696 3586 3421 2927 2897 2790 2748 933 833 533 467 326 42684 678 611 96 53853 3383 3164 2984 222 43688 3027 1578 1140
NM_007050chr20117704 6397 5882 2155 2029 961 720 399 365 189 122 56519 4968 1940 1386 1068 22919 2142 25858 3044
NM_007249chr1399154 7797 6240 6096 2582 2497 1364 1247 518 67429 7119 3526 2835 1002 885 ----
NM_012199chr1134222 4175 3892 3447 2860 1738 1593 1395 867 833 157 94 88 24474 3420 3852 442 108 14094
NM_012288chr6145627 5327 5289 5028 5008 4000 3978 1545 1531 1399 1084 757 405 138 ----25012 1795
NM_012316chr1145124 5110 4967 4801 4787 4654 3893 2094 739 674 481 474 307 23 21143 991 33833 3448 794 1493
NM_012334chr594249 3862 3781 1443 1062 482 475 371 136 13816 --21066 266
NM_012479chr792558 2476 2109 2098 1896 1053 1041 96 84 ----21879 117
NM_013255chr748178 7671 6642 3450 78856 8428 7918 6349 5420 2021 864 16814 1355
NM_013269chr1263495 3169 1631 903 348 281 44012 3549 1701 1347 13863 13701
NM_013372chr1533281 2687 661 33094 2888 805 1614 22104 2058
NM_013382chr1482214 2093 1995 1715 1702 1479 215 47 32302 592 173 31828 888 261 2765 184
NM_014155chr1186736 6184 5752 2292 951 514 376 59 --15468 26826 1722
NM_014309chr2285395 3672 3538 3478 3402 2117 569 426 64302 3650 3532 1095 344 337 12162 21975 1899
NM_014333chr113945 936 521 ----21835 952
NM_014747chr185717 4187 3934 3530 2121 1850 656 38 25767 3873 45364 5319 4083 2007 11546
NM_015035chr20136646 6092 5719 5474 5456 5317 5307 4769 4587 2603 2270 2106 1718 36253 4834 4387 25907 124 14997
NM_015039chr193350 2984 2716 1595 1467 1458 416 338 139 11254 24189 246 23666 3456
NM_015049chr233226 1197 750 32732 172 137 22824 129 22916 226
NM_015068chr793663 3500 3308 3079 2427 1186 494 439 428 21143 1136 --13714
NM_015071chr575650 4589 4079 3947 1810 1415 226 25415 2576 --24593 1803
NM_015090chr1155900 5832 4891 4792 4779 4559 4467 4284 4207 3880 1614 1427 729 471 58 --75588 2374 1314 687 218 51 43 --
NM_015310chr877617 7475 5956 5696 5256 2987 235 26961 6275 --33181 2561 2055
NM_015332chr7123454 3271 3205 3081 2540 2351 1433 1374 841 823 250 37 2930 641 23115 924 12635
NM_015375chr1154647 4306 3941 3931 3581 1942 1924 1910 1640 1560 1256 899 881 733 630 44001 3704 3419 3233 23099 68 --
NM_015686chrX91899 1700 1660 1613 752 678 552 88 67 52156 2016 830 692 217 51667 1010 681 392 123 2284 115
NM_015852chr712681 141135 1051 967 883 799 715 631 547 463 379 295 211 127 43 ----
NM_016089chr3102064 1835 815 718 669 501 298 274 249 214 41968 860 733 481 4818 650 398 230 21901 313
NM_016260chr231628 1011 839 37064 6668 2676 11670 36077 1594 1015
NM_016448chr11652 1643 --21644 1446
NM_016531chr484203 2992 2942 2907 1606 735 714 630 --11450 11682
NM_016834chr17134031 3490 3420 3377 2905 1099 1038 616 539 529 367 343 34 21498 40 5758 646 597 570 337 13388
NM_016835chr17134031 3490 3420 3377 2905 1099 1038 616 539 529 367 343 34 21498 40 5758 646 597 570 337 13388
NM_016841chr17134031 3490 3420 3377 2905 1099 1038 616 539 529 367 343 34 21498 40 5758 646 597 570 337 13388
NM_017413chrX72214 1920 1900 1883 1616 887 733 1482 1610 21892 1567
NM_017637chr938781 8541 7833 57641 7236 6156 1865 1643 28883 8597 27899 2323
NM_017776chrX11467 31257 400 233 1318 2484 151
NM_017848chrX82937 2915 1840 1429 1422 666 197 80 44552 1541 1469 1412 ----
NM_018027chr1052527 2510 2180 673 632 12423 1625 23103 449
NM_018373chr14105892 4939 4745 4070 1716 1491 1467 1320 779 557 25149 2178 25895 730 22476 1653
NM_018660chr862967 2851 1954 1247 1074 982 21118 226 11238 32892 2177 972
NM_018948chr12251 238 1386 1244 --
NM_019008chr2283425 3378 3237 3221 3191 2310 2292 1221 12761 11268 23741 1358
NM_020205chr1113308 3302 2991 2971 2853 2159 1120 887 453 344 320 1253 33185 3103 897 3624 367 92
NM_020443chr1136624 6263 6112 5752 5597 5214 4768 2557 992 418 409 326 111 36245 622 260 44648 2564 1094 126 --
NM_020699chr1165160 5130 5118 5044 4879 4616 4463 3950 3932 3690 3679 3672 2026 1626 1441 590 45374 1093 849 711 64653 2058 1598 812 725 302 24563 1778
NM_020772chr17108254 7901 6844 6628 5826 5594 1039 680 456 59 47333 6319 6115 632 18320 11545
NM_020899chr1772270 2083 1645 1591 1577 898 678 21810 371 12140 11793
NM_021813chr644672 4191 1943 1893 22015 1816 --35713 1478 1168
NM_021949chrX62046 2015 1972 595 561 549 3589 541 25 2564 528 --
NM_021964chr356598 5600 2618 2179 2151 24072 2576 16592 24663 495
NM_022048chr1552444 2193 847 481 98 36031 5973 458 --36140 5323 1233
NM_022121chr631065 902 404 ----2145 23
NM_022456chr1295310 5176 2824 2777 2763 2636 2323 2129 1815 55643 5325 5237 1643 840 37106 2276 2263 15958
NM_022497chr382581 1004 812 753 687 586 396 50 21487 706 33424 1152 163 12393
NM_022648chr2154168 4025 3731 3440 3190 3114 2922 1217 853 734 213 163 93 52 36 2416 118 42971 430 371 140 34432 3218 169
NM_022758chr673201 3015 2703 2459 2148 1258 1152 12916 11138 2320 301
NM_024007chr542420 2410 2394 231 11157 --32921 2426 2005
NM_024294chr673201 3015 2703 2459 2148 1258 1152 12916 11138 2320 301
NM_024607chr881770 1756 1158 1140 1126 991 827 321 14440 34016 3703 87 11450
NM_024639chr642737 2527 561 359 --2918 445 22693 1092
NM_024947chr366972 3633 3246 2918 2438 754 29050 1617 37881 3198 2702 12765
NM_025160chr144146 3110 2934 2724 13168 11713 23474 1689
NM_025179chr1134121 4112 3959 3371 3179 3037 1955 1945 1729 1698 1264 1258 604 31025 545 343 3248 139 132 1193
NM_030674chr1254427 3948 3804 1815 1353 1817 35458 5392 1818 23955 918
NM_030806chr1119086 9023 8864 8525 6655 5744 3228 2673 1526 1382 1187 57789 6682 6032 2667 1312 36796 6199 1847 26920 5773
NM_031468chr7177502 7202 6448 6201 5533 5453 5409 5101 2566 2449 2359 2115 1840 1806 1748 1286 937 87679 6962 6952 6494 3193 2555 1137 548 37744 6378 5631 47299 3185 2433 1216
NM_032105chr177633 7474 2753 2388 2370 1198 390 47438 5392 1407 1183 37927 6360 2694 --
NM_032960chr151282 1187 491 195 187 1206 41448 1366 178 29 --
NM_033503chr15103283 2924 2660 2643 1526 1470 1277 1140 636 232 12450 22743 2665 23749 2787
NM_052906chr22174481 4347 4131 4088 3906 3767 3424 3367 3309 3241 3107 2041 1467 1152 1064 318 111 25071 3525 74643 1906 1050 827 820 431 58 2521 322
NM_053016chr9127674 7479 7414 6780 6766 6637 5780 4861 3198 3180 3166 2685 13087 12496 12133
NM_053023chr1122781 713 12969 --33179 2333 920
NM_080669chr17184455 4441 4086 3825 3355 3290 3241 3233 3144 3042 1913 1685 1621 1170 1036 545 484 311 63773 3757 1835 1138 959 517 43435 3248 1039 1027 --
NM_130838chr1511542 11846 --21546 639
NM_130839chr1511542 11846 --21546 639
NM_133170chr20117704 6397 5882 2155 2029 961 720 399 365 189 122 56519 4968 1940 1386 1068 22919 2142 25858 3044
NM_138473chr1274689 3960 3579 3284 2021 920 135 34402 3866 1478 1477 23874 1488
NM_139012chr631624 182 45 2621 447 --21557 1486
NM_152414chr861273 425 363 220 205 139 1526 2428 214 1558
NM_152429chr107375 335 319 178 46 35 23 --1101 1301
NM_152470chr18143180 3128 3061 2914 2560 2545 1553 1419 1295 958 776 680 673 288 1232 52933 873 782 179 162 21423 1206
NM_153810chr1044461 1742 1440 657 44164 2042 1892 1352 24422 1458 11939
NM_170706chr193350 2984 2716 1595 1467 1458 416 338 139 11254 24189 246 23666 3456
NM_173582chr11135284 5270 5168 5136 3842 2180 1879 1643 1629 1503 1425 1411 1278 25778 5197 14824 --
NM_173595chr12194644 4577 4518 4463 4287 4156 4083 4061 3992 3893 3575 1726 1614 980 889 794 537 121 92 --44662 4456 3378 540 11241
NM_173632chr1942876 559 253 85 62717 2151 884 401 233 149 --22732 939
NM_173642chr1118305 8122 7185 7131 7016 6437 3485 2874 2860 2747 1076 78629 8370 7857 6225 3573 3491 2337 38100 6601 6418 11200
NM_175623chr1295310 5176 2824 2777 2763 2636 2323 2129 1815 55643 5325 5237 1643 840 37106 2276 2263 15958
NM_175624chr12105405 5271 2919 2872 2858 2731 2418 2224 1910 33 55738 5420 5332 1738 935 37201 2371 2358 16053
NM_175625chr12105405 5271 2919 2872 2858 2731 2418 2224 1910 33 55738 5420 5332 1738 935 37201 2371 2358 16053
NM_175709chr2282912 2668 2560 2266 1976 1943 1937 1142 2504 204 42974 2285 569 127 22387 491
NM_175736chr1283064 2718 2674 2005 1841 1026 996 87 116493 5799 5749 2733 2556 2165 1219 1020 647 523 338 --12440
NM_175907chr1842513 2142 1876 754 --2537 393 2177 32
NM_178151chrX56894 6139 2124 1669 468 37102 2811 1133 25382 1798 26763 570
NM_178152chrX56894 6139 2124 1669 468 37102 2811 1133 25382 1798 26763 570
NM_178153chrX56894 6139 2124 1669 468 37102 2811 1133 25382 1798 26763 570
NM_182503chr653628 1903 1396 786 753 35574 3634 1729 --22059 235
NM_182515chr1974734 4720 2109 1001 982 50 32 35481 577 242 25520 1006 --
NM_182970chr20164229 4044 3924 3213 3196 1416 1270 1131 983 910 848 780 663 131 117 92 23594 1097 43338 3199 3038 1217 12775
NM_194286chr12115736 5485 4742 4280 2228 1865 1531 1354 617 140 132 15716 11161 35593 1491 1133
NM_198320chr12114584 4428 3760 3621 1735 1493 1475 1461 1323 593 451 34041 3775 104 25189 4578 34588 3542 790
NM_198560chr3173520 3457 3201 3022 2736 2655 2647 2502 2378 2341 1354 1277 949 690 202 174 149 --53417 2411 589 320 177 --
NM_198859chr373999 3181 1978 1403 1203 1148 106 34544 1736 894 127 1110
NM_198900chr1283064 2718 2674 2005 1841 1026 996 87 116493 5799 5749 2733 2556 2165 1219 1020 647 523 338 --12440
NM_199462chr1154647 4306 3941 3931 3581 1942 1924 1910 1640 1560 1256 899 881 733 630 44001 3704 3419 3233 23099 68 --
NM_205860chr142314 402 58 49 11181 21248 63 --
NM_206909chr877617 7475 5956 5696 5256 2987 235 26961 6275 --33181 2561 2055
NM_213589chr265040 4759 3872 3488 3375 1217 1644 23469 1673 24763 2196