TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-629-5p
miRNA Sequence: UGGGUUUACGUUGGGAGAACU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr551761 1600 1303 377 368 ------
NM_000051chr1183291 2434 2412 2394 1362 515 444 348 11127 1698 --
NM_000084chrX136792 6563 6326 5650 4747 4568 4482 4403 1578 1494 1004 848 434 --16018 16936
NM_000091chr2102751 2557 2399 2293 2150 2071 1953 1831 432 389 32248 2111 256 ----
NM_000092chr2114357 4337 4076 3720 3547 3355 3179 2779 1831 1641 1125 33882 1599 1479 ----
NM_000108chr741757 1725 1505 469 ----11851
NM_000109chrX72580 2445 2438 1752 444 405 175 22183 2071 ----
NM_000110chr121188 1085 ----11035
NM_000112chr5105385 4951 4288 3827 3441 1990 1901 1302 1228 860 11021 --14019
NM_000115chr1351790 1714 772 449 358 21722 628 1915 --
NM_000125chr6104305 3947 3100 2695 1661 1435 1168 830 409 216 23868 347 14213 --
NM_000138chr1552623 2534 2419 636 367 --12351 --
NM_000163chr582298 1786 888 708 692 475 325 70 --188 --
NM_000176chr5133802 3155 2979 2855 1427 1126 1108 985 876 451 309 260 62 --23362 643 11404
NM_000208chr1954638 4395 3478 3299 203 32967 1435 77 ----
NM_000216chrX104118 3588 3375 3017 904 881 608 554 393 336 13299 ----
NM_000217chr12124945 4269 3771 3257 1978 1629 818 570 493 208 176 29 51914 1837 1361 368 73 24502 1820 --
NM_000232chr493154 2605 2243 1035 971 941 872 461 342 11049 13056 21264 369
NM_000245chr732228 2096 720 31748 738 355 ----
NM_000255chr63358 342 313 2437 419 ----
NM_000259chr1585721 5374 5294 1758 1700 1148 512 494 36164 1579 55 31656 1245 326 --
NM_000264chr932911 2887 44 11141 11209 --
NM_000267chr1763306 3259 2508 1399 1149 834 23421 738 12422 1122
NM_000304chr172857 98 3739 188 106 ----
NM_000314chr1042771 733 53 43 --13270 --
NM_000332chr6105502 5359 4928 4626 4585 2629 2237 2086 1759 786 34438 1932 535 56429 5495 1960 1660 1196 26539 5569
NM_000337chr5116457 5872 5425 4493 4433 2484 1991 1916 1075 931 748 35750 5404 712 --15564
NM_000338chr1551169 755 308 102 80 1265 ----
NM_000346chr1761935 1855 1843 633 541 355 --1300 --
NM_000361chr2071735 1594 659 539 488 463 104 --12119 11677
NM_000368chr9124688 4572 4340 4323 3656 3343 3270 1868 1630 797 412 318 21797 1301 1910 --
NM_000376chr1282933 2517 2393 2347 2261 2084 969 715 3604 588 246 --12192
NM_000393chr251941 1835 1373 294 277 ------
NM_000401chr1131114 1033 847 ----1285
NM_000408chr272927 2583 2495 2388 2153 1162 653 12765 12277 --
NM_000411chr21103320 3306 3039 3004 2952 2218 2155 2138 881 227 --12118 12352
NM_000430chr17123793 3525 3132 3031 2787 1258 1010 651 515 465 299 231 ------
NM_000439chr552287 2086 2041 340 142 12001 ----
NM_000448chr1162841 2506 989 970 755 316 --22348 2258 --
NM_000449chr161284 1252 1120 595 313 213 1325 ----
NM_000461chr3104529 4497 4350 4125 3328 3204 2958 1706 1505 1450 22847 830 23537 3352 14632
NM_000486chr1282776 2750 2348 2267 2067 980 358 314 1941 23166 560 --
NM_000527chr19102437 2249 2099 1874 1573 925 556 422 416 35 1622 11912 1431
NM_000555chrX127617 7602 6722 6457 6230 2374 2152 2138 1926 1010 987 576 46000 1802 403 38 26176 2010 21997 1975
NM_000579chr321456 273 11658 --1183
NM_000598chr741590 437 186 133 11271 1445 --
NM_000599chr274391 3991 3711 3610 2913 1840 991 33273 2819 1112 11326 11185
NM_000610chr11102845 2532 2442 2302 1223 809 727 658 560 492 1829 1590 --
NM_000611chr11126974 6163 5513 5049 4817 4498 1905 1236 1139 431 192 30 26518 2365 --35004 4776 2595
NM_000612chr1173805 3699 2891 2326 655 564 309 33393 3362 785 12451 --
NM_000618chr12126323 6160 6089 5956 5514 5237 5110 4723 4174 1769 885 75 15691 --14516
NM_000618chr12126323 6160 6089 5956 5514 5237 5110 4723 4174 1769 885 75 15691 --14516
NM_000633chr18105222 3511 3296 1981 1649 1522 1416 702 300 284 --44770 3677 1954 787 14757
NM_000635chr1961533 1084 1044 413 302 286 31393 646 184 ----
NM_000663chr1683093 2490 2321 1905 769 739 646 31 22622 870 --1227
NM_000726chr231118 365 62 1493 --11245
NM_000788chr441182 1046 391 280 197 21268 976 --
NM_000793chr1485142 4526 4357 3808 1794 980 503 222 44586 4488 4331 4007 --1467
NM_000800chr531550 1398 507 --31327 638 374 --
NM_000806chr551720 785 510 323 149 11763 ----
NM_000809chr4128475 8437 8234 7240 6668 6657 6549 6005 3468 834 132 101 15901 29238 5690 16648
NM_000813chr565558 4490 3640 3528 2001 1931 --25212 3841 --
NM_000814chr1523613 1539 2704 475 12877 14111
NM_000824chr41290 3906 746 642 ----
NM_000826chr452570 2468 905 637 431 ------
NM_000827chr572629 2378 1882 915 587 280 61 11003 ----
NM_000829chr1191977 1815 1436 694 517 482 337 96 35 4458 215 193 187 ----
NM_000831chr1105998 5992 5881 5323 4764 4412 1877 1655 1281 953 44646 1172 845 277 1934 --
NM_000868chrX62367 2347 2159 2024 1617 813 11705 --11655
NM_000875chr15136859 6625 6327 6305 5963 5061 2500 1319 1174 837 597 387 221 35367 4308 1638 ----
NM_000891chr1773375 3326 2695 831 813 773 701 --11183 --
NM_000899chr1284125 3985 3652 3501 3083 1277 838 619 32888 1609 495 --13133
NM_000901chr451992 1766 1027 924 75 11880 12567 --
NM_000902chr3113068 2949 2941 1968 1007 897 889 841 479 334 322 12611 --22531 535
NM_000926chr11209484 9298 9280 8393 8370 8056 6598 6464 5870 3205 2643 2528 2274 2253 2143 1969 1735 1548 428 264 37394 3533 3235 47846 5879 3104 1645 28085 7238
NM_000933chr2051432 1291 1200 418 57 2608 203 ----
NM_000950chrX83056 3026 2827 2730 2261 1123 936 354 1336 23668 2570 --
NM_000956chr1441132 867 408 328 1202 --21108 1051
NM_000961chr2084030 3512 3210 1585 1352 1136 841 490 --12552 11450
NM_000963chr1102406 2163 1816 1805 961 768 650 611 229 36 --2734 79 --
NM_001001344chrX82586 2408 2242 2042 1958 1648 999 978 1168 ----
NM_001001389chr11102845 2532 2442 2302 1223 809 727 658 560 492 1829 1590 --
NM_001001390chr11102845 2532 2442 2302 1223 809 727 658 560 492 1829 1590 --
NM_001001391chr11102845 2532 2442 2302 1223 809 727 658 560 492 1829 1590 --
NM_001001392chr1192891 2578 2488 2348 855 773 704 606 538 1875 1636 --
NM_001001396chr1184355 3837 3810 3581 3499 3012 1738 1664 1475 1454 967 934 832 735 505 414 132 28 24497 3610 --12993
NM_001001419chr5105252 4720 4591 4206 3572 3458 1779 1496 1400 264 13278 25244 3861 --
NM_001001420chr5105252 4720 4591 4206 3572 3458 1779 1496 1400 264 13278 25244 3861 --
NM_001001549chr772805 2793 2741 2405 2181 1980 264 1594 22529 1930 1190
NM_001001550chr772805 2793 2741 2405 2181 1980 264 1594 22529 1930 1190
NM_001001555chr772805 2793 2741 2405 2181 1980 264 1594 22529 1930 1190
NM_001001556chr1531544 1440 354 ----11530
NM_001001664chr283645 3264 2743 2574 1304 1293 1169 499 13423 ----
NM_001001701chr41903 1695 31472 655 216 --
NM_001001890chr21114080 3906 3838 2844 2692 2641 2634 1491 1432 1269 82 1192 1970 14279
NM_001001928chr22148361 7836 7736 7560 6341 5712 5152 2623 2449 2045 1086 1023 790 694 26736 5519 --22143 1132
NM_001001974chr1032395 582 145 1211 --1465
NM_001001995chrX41204 495 172 157 ------
NM_001002233chr852151 1927 1357 806 769 11466 --1528
NM_001002257chr283030 2776 2692 1400 1375 638 558 517 42897 1195 487 29 157 11138
NM_001002814chr863229 1357 1116 1001 806 769 11466 --1528
NM_001002860chr14114423 4030 3842 3314 3244 1581 1465 1103 930 570 346 ------
NM_001003652chr18138289 7931 7884 6609 6037 5287 2111 2078 1428 722 693 605 414 46589 6564 6457 2124 1570 27671 7574
NM_001003674chr18136955 6586 6248 5855 5726 5554 5331 1913 1821 1425 1327 1277 758 21395 303 --16376
NM_001003675chr18136955 6586 6248 5855 5726 5554 5331 1913 1821 1425 1327 1277 758 21395 303 --16376
NM_001003681chr2262087 1878 1524 855 274 27 21919 391 ----
NM_001003712chr1233322 3308 3222 23591 115 --1270
NM_001003800chr943190 2954 902 195 43583 2352 582 324 1302 --
NM_001003927chr174597 447 172 111 1625 1635 --
NM_001004065chr963670 3520 3066 2755 1234 127 43993 2647 612 109 13634 --
NM_001004304chr1273187 3003 2220 2063 807 417 96 22522 1214 ----
NM_001004308chrX91469 1304 1157 986 960 561 371 261 30 21196 187 --11528
NM_001004342chr1116062 4987 4978 4822 4723 4183 2425 2352 1404 1078 1042 45536 5117 4042 553 --1918
NM_001004419chr1253742 3384 2872 986 90 44263 3546 2932 1732 --12838
NM_001004441chr551311 541 480 431 91 11328 ----
NM_001005375chrY71875 1812 1643 1514 426 184 82 1633 ----
NM_001005473chr576135 5390 2587 2196 2164 847 823 46549 6340 6127 5079 ----
NM_001005502chr12113926 3913 3685 3291 3185 1984 1486 1387 944 516 107 11864 1605 13788
NM_001005609chrX93792 3772 3364 3082 1511 1089 708 693 524 --22672 1412 --
NM_001005746chr231118 365 62 1493 --11245
NM_001005747chr231118 365 62 1493 --11245
NM_001005753chr231820 885 391 1244 21769 1529 --
NM_001006600chr562224 2195 2157 1809 907 259 1838 ----
NM_001007023chr1485142 4526 4357 3808 1794 980 503 222 44586 4488 4331 4007 --1467
NM_001007094chr10123861 3451 3394 2839 1756 1515 1419 1169 467 411 383 292 --13813 --
NM_001007097chr994865 4688 3893 3812 3334 3152 1611 1589 304 ------
NM_001007102chr651236 442 426 397 251 1104 ----
NM_001007214chr171948 1851 1723 1615 1490 681 396 11423 ----
NM_001007237chr152448 992 794 676 87 --1357 --
NM_001007246chr2141519 599 377 96 11253 21916 330 --
NM_001007278chr1365289 4984 4568 3994 865 189 34113 1597 1140 ----
NM_001007466chr694853 4476 4005 3740 3619 1849 1519 1380 222 11534 13863 --
NM_001007559chr1841977 625 487 116 --1716 --
NM_001008239chr1873834 3195 3011 1397 895 838 291 1126 ----
NM_001008392chr3103109 2682 2608 2246 1232 1096 942 904 896 423 23178 2599 ----
NM_001008408chr786428 5076 5041 3903 2529 1508 1327 81 --24576 4500 25528 4118
NM_001008660chr1151150 995 310 95 57 176 1105 --
NM_001008738chr542638 2562 1156 430 22439 524 --1958
NM_001008801chr19102086 1938 1818 713 686 435 212 206 164 80 2562 334 ----
NM_001008925chr443533 2787 2632 2324 43242 3217 2295 618 ----
NM_001009554chr464132 4043 3845 3049 339 85 11699 13713 12895
NM_001009554chr464132 4043 3845 3049 339 85 11699 13713 12895
NM_001009899chr376539 6429 6263 5460 5261 1645 336 25448 1676 25816 1743 15472
NM_001009959chr252091 911 476 449 433 12302 --1682
NM_001010000chr1872888 2800 2657 2379 969 386 324 11338 ----
NM_001010853chr6113106 2934 2620 2249 1144 1067 448 395 350 186 25 --1339 --
NM_001010861chr12369 349 12213 12175 --
NM_001010862chrX62015 851 661 620 163 41 2948 458 --12864
NM_001010888chrX54662 4388 4018 633 352 21435 324 --21733 272
NM_001010891chr596373 5779 5019 4519 4207 1789 733 397 113 34850 1635 1283 16004 14398
NM_001010986chrX92534 2280 2222 2056 940 877 791 666 71 --1648 --
NM_001011513chr453103 1550 1242 630 369 23629 3540 1727 11339
NM_001011537chr352212 2077 2005 1580 804 --1373 --
NM_001011657chrX41125 1058 1038 241 1180 --1484
NM_001011666chr7156018 5694 5639 5285 5076 4539 4152 2074 1703 1300 1156 954 740 345 267 45343 2626 1232 1051 ----
NM_001011713chr1431495 401 199 11353 11321 --
NM_001012393chr1174642 4532 4143 3752 3593 3206 1965 21774 670 ----
NM_001012398chr1651118 696 350 306 164 11092 ----
NM_001012420chr1572611 2534 2145 1954 1158 1015 871 1305 --11922
NM_001012423chr1572611 2534 2145 1954 1158 1015 871 1305 --11922
NM_001012426chr6102496 2370 1368 1136 1107 637 354 254 242 36 1385 --13387
NM_001012427chr6102496 2370 1368 1136 1107 637 354 254 242 36 1385 --13387
NM_001012753chr1991266 1098 981 953 869 431 245 163 79 2415 63 ----
NM_001012754chr1381978 1917 1867 1820 1774 1404 1388 745 1777 ----
NM_001012755chrX95004 4289 4086 3749 3490 1082 782 549 40 53371 3298 1599 1102 170 1951 23263 118
NM_001012761chr552625 2414 1758 907 691 11860 21865 977 --
NM_001013031chr1092955 2921 2896 2665 2596 1162 825 439 149 170 23355 2301 --
NM_001013398chr741590 437 186 133 11271 1445 --
NM_001013406chr731307 1196 193 11599 --1289
NM_001014797chr10107933 7910 7817 5723 3084 2442 2387 2191 1592 1373 47800 6726 5675 41 --2625 83
NM_001017368chr17122477 2309 1954 1887 1791 1101 926 903 577 569 316 218 22790 193 11857 1501
NM_001017395chr393378 2444 799 764 701 582 447 359 276 33505 2572 339 11045 1384
NM_001017424chr121906 1706 11802 --11680
NM_001017425chr121906 1706 11802 --11680
NM_001017440chr7127926 7437 7367 6602 6592 6435 3258 2368 2244 2222 528 245 56499 6399 2539 1002 140 ----
NM_001017535chr1282933 2517 2393 2347 2261 2084 969 715 3604 588 246 --12192
NM_001017923chr1431446 1049 584 1371 1638 --
NM_001017926chr871813 1758 1346 718 521 489 171 ------
NM_001017970chr1482659 2361 2317 944 665 615 226 42 --1316 --
NM_001018064chr961824 1461 1396 673 583 485 22038 1414 12080 --
NM_001018065chr9105923 5641 4421 3985 3901 2005 1861 1846 670 519 24327 391 --2236 60
NM_001018066chr9105923 5641 4421 3985 3901 2005 1861 1846 670 519 24327 391 --2236 60
NM_001018067chr1144812 4702 3744 3558 2098 1819 1653 1167 1159 922 803 771 610 480 23882 3298 34168 1882 39 --
NM_001018068chr1144812 4702 3744 3558 2098 1819 1653 1167 1159 922 803 771 610 480 23882 3298 34168 1882 39 --
NM_001018069chr1144812 4702 3744 3558 2098 1819 1653 1167 1159 922 803 771 610 480 23882 3298 34168 1882 39 --
NM_001018074chr5133802 3155 2979 2855 1427 1126 1108 985 876 451 309 260 62 --23362 643 11404
NM_001018075chr5133802 3155 2979 2855 1427 1126 1108 985 876 451 309 260 62 --23362 643 11404
NM_001018076chr5133802 3155 2979 2855 1427 1126 1108 985 876 451 309 260 62 --23362 643 11404
NM_001018077chr5133802 3155 2979 2855 1427 1126 1108 985 876 451 309 260 62 --23362 643 11404
NM_001018111chr764042 3432 2877 2664 765 463 21146 1020 1687 --
NM_001018115chr32609 73 ----1540
NM_001020658chr121602 485 2152 60 ----
NM_001020658chr121602 485 2152 60 ----
NM_001023567chr1551975 1749 1603 874 632 1305 --11943
NM_001024094chr5133802 3155 2979 2855 1427 1126 1108 985 876 451 309 260 62 --23362 643 11404
NM_001024647chr12227382 6886 6877 6479 5860 5584 5556 5507 5406 5240 5081 4897 2564 2483 2356 2202 1989 1794 1531 1513 255 154 67746 5807 5439 5433 5337 1672 26752 5973 32928 1071 1038
NM_001024660chr361643 1139 535 331 184 46 11610 21331 135 --
NM_001024668chr122979 200 ----1958
NM_001024680chr251661 1269 703 540 363 --21758 619 11509
NM_001024808chr1252348 1977 1812 798 205 52536 1011 770 146 136 ----
NM_001024847chr352197 1774 768 744 716 --1803 --
NM_001024948chr183365 2988 2510 2187 2173 1215 855 610 --13465 --
NM_001024956chr11115688 5311 5292 5222 4817 4698 3908 3626 1518 1123 884 25350 3956 13738 --
NM_001025076chr1094747 4463 4361 3935 2170 1637 1406 773 312 21999 950 21742 1184 --
NM_001025077chr1096105 5821 5719 5293 2995 2764 2131 1670 1029 12308 22542 1023 --
NM_001025079chr384190 3860 3558 2930 2899 724 426 140 21657 1163 12952 --
NM_001025108chr252945 2804 571 377 79 44017 3500 3087 857 ----
NM_001025266chr3104341 4080 4048 3994 3273 3247 1426 1398 1048 937 1811 ----
NM_001025580chrX84091 3774 3654 3618 3496 3440 1697 57 --12699 --
NM_001025603chr161284 1252 1120 595 313 213 1325 ----
NM_001025616chr441885 1783 308 246 21702 1302 ----
NM_001025780chr93596 365 73 --21386 493 --
NM_001029863chr663106 2534 2293 1218 67 31 23024 1048 11125 21116 566
NM_001029875chr582966 2778 2499 1900 1126 864 76 53 1462 12438 12113
NM_001030006chr1732324 792 610 1843 11817 12701
NM_001030007chr1633254 1359 1057 --11610 1922
NM_001030055chr1481827 1809 1696 1545 1166 960 947 618 41139 1030 466 348 1588 --
NM_001031681chr1732156 1571 645 1791 --22369 1502
NM_001031695chr2264781 4028 3311 933 839 255 14334 25391 3468 --
NM_001031732chr463621 3110 2689 2462 1447 875 2197 180 ----
NM_001031804chr1674285 3686 2945 773 764 244 158 22903 872 24090 3591 --
NM_001032280chr621155 547 11623 1323 11512
NM_001032380chr1051721 1523 1255 267 229 1777 1754 --
NM_001032999chr20145320 4897 4568 4500 4419 4240 3870 2138 2037 1802 1227 1069 301 76 24200 3585 ----
NM_001033045chr2133721 3708 3356 3283 3161 3046 2834 2814 1486 1441 1297 849 452 34145 3622 1521 13259 --
NM_001033059chr652027 1959 676 265 122 ----11595
NM_001033087chr2073212 3182 3146 2814 2538 2432 1098 11147 ----
NM_001033117chr3114528 4391 3336 1877 1441 1166 1025 875 804 779 765 34122 1580 1004 23594 934 --
NM_001033518chr782616 2573 2456 2144 1825 676 280 271 --1201 --
NM_001033519chr782616 2573 2456 2144 1825 676 280 271 --1201 --
NM_001033520chr782616 2573 2456 2144 1825 676 280 271 --1201 --
NM_001033561chr175310 165 143 107 78 1279 1760 --
NM_001033566chr172907 790 --1923 1937
NM_001033568chr172907 790 --1923 1937
NM_001033659chr1761597 1435 1226 379 343 149 --11123 1247
NM_001033723chr882659 2596 2330 2065 847 600 315 118 32258 326 212 21739 644 --
NM_001034845chr42975 311 --1289 1967
NM_001034850chr561581 1256 1207 1159 1061 314 ------
NM_001034954chr1073266 2649 2642 739 536 411 58 42024 1306 394 150 ----
NM_001034955chr1073266 2649 2642 739 536 411 58 42024 1306 394 150 ----
NM_001034956chr1073266 2649 2642 739 536 411 58 42024 1306 394 150 ----
NM_001034957chr1073266 2649 2642 739 536 411 58 42024 1306 394 150 ----
NM_001035003chr421292 977 ----11414
NM_001035004chr421292 977 ----11414
NM_001035260chr1051584 1245 535 194 120 --31381 1068 452 11090
NM_001037131chr25949 499 464 238 164 1895 1229 --
NM_001037174chr241785 1738 109 99 21885 1464 --11622
NM_001037277chr161628 1600 1551 1527 605 156 ----11683
NM_001037278chr161628 1600 1551 1527 605 156 ----11683
NM_001037317chr12369 349 12213 12175 --
NM_001037535chrX61582 1463 621 586 304 185 ------
NM_001037536chrX61582 1463 621 586 304 185 ------
NM_001037540chrX61582 1463 621 586 304 185 ------
NM_001037954chr1153075 2576 543 471 203 31102 813 521 ----
NM_001038707chr15544 269 260 92 36 1885 2364 356 --
NM_001038707chr15544 269 260 92 36 1885 2364 356 --
NM_001039199chr20164790 4445 4420 4323 4193 4050 3735 3569 1674 1362 1339 488 476 426 162 108 1688 11209 23668 1460
NM_001039348chr23764 734 224 --1873 --
NM_001039349chr23764 734 224 --1873 --
NM_001039538chr253247 2862 1447 428 95 23436 348 ----
NM_001039547chr3198003 7742 7479 7068 6643 5798 5584 5442 5330 3192 2834 2157 1895 1631 1554 1326 807 187 167 --25956 5681 27578 5858
NM_001039570chr22114251 3942 3278 3124 2939 2924 1456 865 656 231 131 64450 3764 3711 3195 2882 1073 23578 1554 1963
NM_001039571chr22114251 3942 3278 3124 2939 2924 1456 865 656 231 131 64450 3764 3711 3195 2882 1073 23578 1554 1963
NM_001039585chr173624 3544 3373 1068 661 276 24 12910 13380 --
NM_001039618chr1185949 5167 4106 1854 1776 1747 597 199 11728 15075 25474 4294
NM_001039690chr1642263 946 661 628 52118 1505 905 245 203 1388 --
NM_001039709chr20145320 4897 4568 4500 4419 4240 3870 2138 2037 1802 1227 1069 301 76 24200 3585 ----
NM_001039840chrX96089 5118 4906 4254 4160 2230 2075 1550 270 25958 1582 41482 1034 544 350 14747
NM_001039937chr1363494 1514 1492 1306 656 309 33596 3424 981 11033 --
NM_001040001chr631961 1472 763 11807 --11680
NM_001040113chr163993 788 354 3608 238 210 --1268
NM_001040114chr163852 647 213 297 69 --1127
NM_001040144chr1642263 946 661 628 52118 1505 905 245 203 1388 --
NM_001040146chr1642263 946 661 628 52118 1505 905 245 203 1388 --
NM_001040152chr774991 4850 4064 1811 1741 1633 1477 23262 271 35035 4792 1985 --
NM_001040181chr33393 369 215 1881 1973 --
NM_001040182chr33393 369 215 1881 1973 --
NM_001040183chr33393 369 215 1881 1973 --
NM_001040199chr33393 369 215 1881 1973 --
NM_001040200chr33393 369 215 1881 1973 --
NM_001040202chr462585 2488 957 950 605 183 --11941 --
NM_001040214chr662270 2226 1813 1707 1583 1573 --12031 21459 885
NM_001040272chr931511 297 23 --1941 11890
NM_001040284chr1695350 4959 4322 4144 3707 3597 1833 1164 717 33781 1816 1454 --12057
NM_001040402chr482906 2750 2321 2304 2077 2040 878 377 12766 22339 743 --
NM_001040429chr1321404 632 33194 3085 2372 1413 --
NM_001040441chr1175385 5113 4999 4825 4559 3952 3864 3832 3676 1903 1737 1617 1353 1322 1049 978 882 --24656 3912 11834
NM_001040446chr532610 768 505 --22668 124 --
NM_001040450chr1562751 2109 1944 1914 1138 896 22375 1817 --12849
NM_001040453chr1562751 2109 1944 1914 1138 896 22375 1817 --12849
NM_001040458chr5101879 1678 1560 1544 1393 1232 459 413 339 311 11834 --1225
NM_001040619chr12513 410 21195 1158 --1101
NM_001040624chr862713 2687 2503 2116 1793 391 52162 1810 1776 699 333 ----
NM_001040625chr862713 2687 2503 2116 1793 391 52162 1810 1776 699 333 ----
NM_001040626chr862713 2687 2503 2116 1793 391 52162 1810 1776 699 333 ----
NM_001040627chr862713 2687 2503 2116 1793 391 52162 1810 1776 699 333 ----
NM_001040628chr862713 2687 2503 2116 1793 391 52162 1810 1776 699 333 ----
NM_001040629chr862713 2687 2503 2116 1793 391 52162 1810 1776 699 333 ----
NM_001040630chr862713 2687 2503 2116 1793 391 52162 1810 1776 699 333 ----
NM_001040665chr794888 4619 4609 4191 3709 3309 1753 1551 1277 23939 1347 1599 13764
NM_001040712chr932747 1119 558 1732 --13071
NM_001042383chr362818 2706 2611 2484 1004 221 22675 2220 1936 --
NM_001042404chr141354 1311 427 316 --21466 362 1736
NM_001042413chr953819 3622 3504 509 365 21017 471 ----
NM_001042424chr443066 2689 2312 388 12714 22864 2810 22613 875
NM_001042425chr621155 547 11623 1323 11512
NM_001042453chrX3587 514 142 155 --11141
NM_001042492chr1763306 3259 2508 1399 1149 834 23421 738 12422 1122
NM_001042533chr353105 3052 2548 1094 394 2596 442 13200 --
NM_001042543chr451579 1152 405 376 263 11424 ----
NM_001042555chr1284805 4359 4316 4103 1792 1463 1439 756 --14537 --
NM_001042599chr2117114 7056 6899 6640 6537 5570 2613 2595 2317 2252 1953 36106 5813 1891 27135 5333 22170 1932
NM_001042601chr342290 1045 1022 287 23305 2254 --11070
NM_001042603chr1255298 4810 4168 3259 1329 21928 1285 11600 11115
NM_001042604chr3114718 3860 3318 3010 1878 1762 1369 1315 834 557 233 --44121 1636 1605 258 11916
NM_001042669chr441885 1783 308 246 21702 1302 ----
NM_001042681chr162323 2309 2295 1930 576 34 22370 133 12142 --
NM_001042682chr162323 2309 2295 1930 576 34 22370 133 12142 --
NM_001042682chr162323 2309 2295 1930 576 34 22370 133 12142 --
NM_001042683chr631413 347 44 31808 1234 84 ----
NM_001042749chrX22040 554 1615 --21897 1700
NM_001042750chrX22040 554 1615 --21897 1700
NM_001042751chrX22040 554 1615 --21897 1700
NM_001046chr53719 651 380 ----13046
NM_001048183chr1113415 2811 2558 2346 1370 1271 831 458 447 275 215 33659 427 392 11120 22444 905
NM_001083620chr452568 2466 904 636 430 ------
NM_001092chr1762560 2541 2504 2221 2161 90 199 12116 --
NM_001100108chr1168279 8011 7915 7860 7648 7211 6860 6157 5515 3223 2787 2448 2245 1998 774 668 26726 1030 37359 7059 1359 36249 5614 1119
NM_001106chr3169686 9075 8916 8017 7472 7437 7022 6931 6691 6326 6178 1952 1928 1202 414 80 58555 7738 3498 401 380 12634 --
NM_001113490chrX43464 2861 2454 789 23043 1114 13146 13640
NM_001121chr1041922 1848 651 609 ----11343
NM_001128chr1633254 1359 1057 --11610 1922
NM_001146chr872164 2023 1931 677 628 229 43 22057 465 ----
NM_001160chr1272757 2509 2184 1922 1796 410 68 11743 ----
NM_001167chrX176212 6118 5964 5886 5588 5281 5197 4516 4490 4319 4290 4124 2075 1612 1518 1218 1100 11677 12225 14221
NM_001173chr1481827 1809 1696 1545 1166 960 947 618 41139 1030 466 348 1588 --
NM_001186chr2123144 2998 31082 243 213 1233 --
NM_001204chr2177622 7390 6891 5993 5806 5766 5156 4926 4807 2784 1840 1459 1294 1120 816 784 748 56329 6094 5911 2905 1266 22981 2463 17678
NM_001206chr963086 2808 2270 2008 1209 718 12623 32465 754 236 12437
NM_001241chr232234 2057 1546 1332 1734 --
NM_001241chr232234 2057 1546 1332 1734 --
NM_001256chr1752819 2658 2402 534 352 22989 2689 ----
NM_001270chr541111 1089 916 55 --11016 --
NM_001271chr1583124 2928 2710 2650 2470 1271 601 85 22944 2814 --11262
NM_001282chr1732324 792 610 1843 11817 12701
NM_001304chr1762619 2483 2421 1430 1220 870 3796 764 432 1192 --
NM_001310chr1272830 2528 2370 686 661 524 124 1739 --12200
NM_001329chr1051535 1435 1370 608 388 --11655 --
NM_001343chr541740 1607 390 195 1438 2278 232 --
NM_001351chr371794 1766 1616 1249 707 153 96 1328 --1538
NM_001356chrX82380 2358 2068 2000 1832 1627 664 422 --11978 --
NM_001364chr1184186 3913 3798 3701 1527 1510 675 252 --11663 --
NM_001386chr832178 2085 1519 1598 1722 --
NM_001387chr5103124 2936 2866 2768 2675 2311 2171 1254 733 122 1662 23198 2019 12598
NM_001390chr1863600 3337 935 696 432 179 32717 617 367 22316 413 13234
NM_001391chr185778 763 449 440 300 2820 366 1478 --
NM_001396chr2162725 2587 2372 2100 653 111 32403 2133 200 ----
NM_001399chrX93792 3772 3364 3082 1511 1089 708 693 524 --22672 1412 --
NM_001402chr641408 590 298 133 21974 274 ----
NM_001412chrX73637 2923 2609 2525 2428 1453 1269 13496 21374 360 1196
NM_001419chr19134380 4149 3830 3664 3245 1451 1385 1049 948 697 294 194 180 24477 3227 --1657
NM_001420chr1962457 2061 1137 594 456 392 33066 2792 893 ----
NM_001423chr1291891 1449 1319 1254 648 617 430 174 137 ------
NM_001427chr71409 21891 172 21816 1765 --
NM_001431chr641098 841 415 160 --2927 43 --
NM_001438chr153376 2817 2503 633 425 --12981 156
NM_001453chr691464 1229 569 254 247 185 107 31 25 293 58 --11495
NM_001455chr694202 3946 3888 3722 1927 581 564 70 38 11063 13579 13819
NM_001460chr173348 2890 2613 2481 741 581 139 12846 ----
NM_001498chr661337 1188 1030 1004 473 160 1994 ----
NM_001530chr141231 ----1829
NM_001542chr152448 992 794 676 87 --1357 --
NM_001609chr10113920 3481 3432 3167 3010 2815 1549 675 210 127 96 13225 --11561
NM_001616chr2123458 3447 3064 2517 2231 1242 847 653 387 222 213 132 12908 --12180
NM_001621chr782704 2517 2454 2234 2174 2078 1097 430 --22493 2369 1664
NM_001621chr782704 2517 2454 2234 2174 2078 1097 430 --22493 2369 1664
NM_001634chr652027 1959 676 265 122 ----11595
NM_001635chr73193 120 60 --21088 48 --
NM_001642chr1141295 1281 1159 286 --1219 --
NM_001650chr1874044 3949 3542 1366 1277 677 405 43617 1471 649 181 33206 2984 1611 --
NM_001663chr1492627 2415 2204 2192 2174 1849 878 614 487 2757 47 12422 --
NM_001684chr1164072 3554 3527 3298 3216 2729 1455 1381 1192 1171 684 651 549 452 222 131 34214 3327 1674 --12710
NM_001690chr33554 268 84 ----12113
NM_001742chr761349 1247 1237 1151 501 142 11183 ----
NM_001753chr741718 1605 1152 460 1211 21451 1359 --
NM_001754chr21114080 3906 3838 2844 2692 2641 2634 1491 1432 1269 82 1192 1970 14279
NM_001759chr12134625 4606 4379 4370 4274 4258 3607 3591 1867 1202 953 522 290 1789 13645 15332
NM_001777chr384190 3860 3558 2930 2899 724 426 140 21657 1163 12952 --
NM_001830chrX93838 3537 3476 2974 2794 1490 1083 624 149 23690 1461 ----
NM_001854chr121215 1127 ----11535
NM_001858chr6105088 5027 3486 3212 3148 1818 1594 271 124 72 11066 13848 14564
NM_001874chr12113926 3913 3685 3291 3185 1984 1486 1387 944 516 107 11864 1605 13788
NM_001918chr1118528 8016 7760 6837 6172 2462 1719 1476 872 496 400 47897 3644 3586 1331 35817 5639 53 26714 2559
NM_001941chr1883694 2649 2606 2570 2467 802 213 205 --21184 1027 11179
NM_001969chr1443630 3521 2682 818 13753 11385 21338 159
NM_001977chr451585 1399 1337 634 307 --1508 --
NM_001995chr431469 542 310 1570 2989 505 --
NM_001999chr531342 1288 32 3518 455 259 --11073
NM_002006chr4115202 5049 4933 4593 4215 4021 2013 1484 993 551 510 15357 ----
NM_002009chr1532766 1113 982 --3913 770 527 12226
NM_002015chr1372783 2377 2358 996 626 460 136 22096 275 ----
NM_002025chrX179007 8874 8779 8659 7628 7617 7373 6641 6025 5924 2220 2185 2172 1963 1261 1254 417 48522 5681 2142 517 1761 21874 300
NM_002035chr1893790 3458 3230 3114 3000 2527 1564 1281 1213 21252 629 1404 13337
NM_002040chr2162125 935 734 630 534 274 12288 ----
NM_002044chr1531544 1440 354 ----11530
NM_002048chr921289 253 11112 1913 11046
NM_002061chr1101900 1805 1781 1542 1519 1330 658 289 210 188 --21633 1426 --
NM_002092chr4134726 3721 3651 3489 1478 1136 1100 849 757 722 644 236 211 ------
NM_002114chr6161 --1409 198
NM_002126chr1774169 4135 3377 3367 3221 1409 1388 23605 2691 11631 --
NM_002128chr1342373 2304 2078 121 12150 ----
NM_002137chr741869 931 363 107 ------
NM_002139chrX2482 28 ----1530
NM_002158chr2133688 3463 3441 3291 3073 2772 2543 1317 1044 394 302 286 267 ------
NM_002166chr24625 601 576 483 ----1712
NM_002182chr372790 2131 2080 1910 1838 646 110 ------
NM_002190chr631035 400 70 11292 --1108
NM_002210chr273237 2257 1371 1262 1111 695 67 32641 2311 91 11271 1648
NM_002214chr7105551 5309 5243 4384 3595 2299 2042 1383 885 830 23708 2149 14792 --
NM_002223chr1241526 1486 1139 330 33847 3492 1014 1784 --
NM_002232chr141364 1045 917 263 ----1518
NM_002242chr231983 1954 1830 1398 --1597
NM_002252chr21457 --167 1416
NM_002264chr3104456 3274 3056 1758 890 604 446 396 244 169 11771 31673 1574 496 --
NM_002267chr1352036 2003 1693 726 210 ----12366
NM_002270chr585393 5250 4156 4010 3939 3709 1897 114 21706 418 11638 --
NM_002271chr1322374 213 32140 2035 682 --1463
NM_002285chr252945 2804 571 377 79 44017 3500 3087 857 ----
NM_002294chrX1159 1185 --1429
NM_002296chr131279 1111 72 --1456 --
NM_002310chr565771 5566 4805 4153 1177 319 2804 214 24396 2430 --
NM_002336chr12114995 4752 4318 3966 3955 3383 1998 1715 1270 1035 831 23297 595 15020 34675 3922 292
NM_002356chr672774 2478 2105 2097 1998 660 342 ----22141 927
NM_002359chr1754033 3744 3028 942 928 --14325 --
NM_002374chr253247 2862 1447 428 95 23436 348 ----
NM_002387chr555123 4886 4375 3655 42 ------
NM_002397chr592190 1862 1773 1392 861 762 639 512 439 12180 ----
NM_002427chr1131070 445 374 11189 130 --
NM_002474chr163852 647 213 297 69 --1127
NM_002499chr1552264 2056 1941 1691 30 12485 12435 --
NM_002508chr172020 1917 1586 1465 726 571 217 41772 1416 611 114 11816 --
NM_002519chr1161401 1151 308 286 137 53 140 --11343
NM_002522chr1793694 3347 2924 2769 2612 1163 507 197 101 33633 3021 1230 ----
NM_002524chr121107 711 ----1977
NM_002526chr661735 1693 1488 1201 508 282 --11651 11214
NM_002545chr1174642 4532 4143 3752 3593 3206 1965 21774 670 ----
NM_002547chrX2991 74 --31420 1152 936 11706
NM_002577chr364072 3364 3209 2858 1123 737 13437 1190 --
NM_002581chr9125427 5393 5142 4809 2086 1730 1664 1533 1108 1081 992 173 23612 1776 12264 1420
NM_002594chr2041789 1716 1574 738 --1488 --
NM_002610chr242838 2802 2473 2305 126 1161 --
NM_002612chr761854 1522 1496 270 256 116 1641 179 --
NM_002641chrX61811 1688 1495 465 262 227 11532 1566 --
NM_002645chr11102503 2457 1071 1054 1038 869 806 764 258 252 22702 451 12939 --
NM_002655chr884385 3248 1336 623 294 283 160 131 34670 4171 1423 13651 --
NM_002662chr31837 1289 22060 1758 11917
NM_002709chr273553 3301 3128 3001 2924 314 296 13094 23620 3480 1221
NM_002716chr11123703 3175 2861 2262 1284 1186 1112 1009 627 215 203 93 11396 1457 --
NM_002718chr362612 2191 1774 735 387 198 ------
NM_002731chr183025 2941 2411 2002 927 491 438 222 --1830 21967 616
NM_002737chr1796426 5869 5344 4036 2543 1169 773 629 583 --36453 4899 1267 1555
NM_002740chr372736 2434 2343 1988 697 384 57 --1354 1795
NM_002742chr144636 613 488 121 --1272 1571
NM_002747chr1881932 1650 1616 1364 633 458 159 41 ------
NM_002753chr44829 766 280 69 1155 --1713
NM_002787chr75629 527 480 152 113 123 1143 2663 162
NM_002822chr1251664 1649 1151 1135 326 --11201 --
NM_002839chr932747 1119 558 1732 --13071
NM_002843chr1173314 2416 2336 2257 1310 886 31 1554 12275 --
NM_002858chr141283 371 313 256 11389 1862 --
NM_002859chr1241801 1453 1208 112 --31172 590 95 21201 487
NM_002892chr1421136 58 --21428 50 --
NM_002902chr154642 477 460 448 ------
NM_002912chr64915 688 328 56 ------
NM_002959chr174381 4318 3893 3843 3182 994 179 24353 4226 22720 928 12831
NM_002977chr262831 2442 983 271 89 63 --1907 --
NM_002998chr882226 1750 899 534 442 267 240 130 1746 11921 --
NM_003010chr1782458 2114 2107 1836 1554 418 372 327 ------
NM_003012chr832586 181 72 32788 1192 526 --12312
NM_003013chr43841 686 556 1216 --1729
NM_003016chr1741873 705 527 212 11433 --11496
NM_003017chr611429 1502 2299 291 1950
NM_003030chr321676 1656 --11945 1795
NM_003034chr12157759 6637 5608 2816 2805 2569 2372 1860 1829 1707 1550 937 772 513 28 24968 1748 26938 4988 22304 747
NM_003038chr252623 2535 2110 1935 1926 32680 1912 1639 ----
NM_003042chr342047 1867 749 377 31892 1686 584 2346 160 --
NM_003043chr3124068 3558 1616 1571 1541 1388 1227 792 751 650 612 517 43690 3597 570 228 ----
NM_003051chr151804 1656 1491 1399 329 11275 11641 --
NM_003079chr173929 906 883 --1366 1687
NM_003081chr2031105 1069 750 ------
NM_003108chr2117145 6849 5330 4546 4455 4428 2721 1595 1574 1249 890 --12931 --
NM_003112chr753154 2831 2427 838 684 22445 750 ----
NM_003144chr631643 784 208 32248 671 361 21973 1518 --
NM_003161chr1753451 2849 2804 2790 2257 12543 ----
NM_003199chr1895367 4585 2256 1764 1604 1037 619 413 338 24487 2137 --21816 74
NM_003220chr621155 547 11623 1323 11512
NM_003221chr6104089 3725 3596 3589 3252 3030 2965 1082 764 454 ------
NM_003236chr273008 2523 1263 673 529 490 155 21090 908 13301 1976
NM_003242chr352197 1774 768 744 716 --1803 --
NM_003262chr3105111 4066 4059 3989 3663 1430 1203 1002 369 103 1599 --1433
NM_003275chr991542 1208 1163 1054 1029 996 487 243 102 ------
NM_003286chr202903 63 --2430 142 --
NM_003298chr376073 5979 5735 5020 4966 4184 1553 25071 530 ----
NM_003339chr531521 1290 1185 --1513 1406
NM_003342chr1743270 2725 942 528 22893 2623 2511 492 --
NM_003369chr1142725 2492 2413 888 32782 2461 1883 2902 562 --
NM_003387chr242388 2223 815 417 22545 682 ----
NM_003392chr384376 4272 4197 3275 3183 3006 725 508 11013 ----
NM_003405chr223570 506 163 ----196
NM_003410chrX62644 2549 2328 2188 2152 678 --12486 13111
NM_003412chr373166 2170 1008 809 109 79 29 ----1145
NM_003421chr10123861 3451 3394 2839 1756 1515 1419 1169 467 411 383 292 --13813 --
NM_003423chr1961889 816 618 488 432 102 --1983 --
NM_003430chr196618 546 537 312 285 201 11705 187 --
NM_003431chr13527 483 426 1223 2500 141 --
NM_003439chr793411 3181 3127 2512 2348 2193 2168 735 408 --11066 12446
NM_003442chr112272 70 162 --1662
NM_003452chr93993 914 234 1625 --2963 257
NM_003458chr373531 2933 1477 1164 340 327 125 --11377 --
NM_003463chr683315 2582 2091 892 637 426 404 295 --12251 --
NM_003466chr262484 2358 2233 1748 844 155 12250 --21787 1729
NM_003468chr263277 3229 3208 3024 1720 235 24101 3366 --23979 950
NM_003471chr321608 899 3363 194 178 ----
NM_003477chr113742 290 279 --2729 199 --
NM_003478chr1121180 1123 22440 32 12828 13024
NM_003482chr1282529 2314 2286 2067 1725 733 722 662 32328 828 171 --1960
NM_003489chr2132655 406 308 1452 32947 934 633 --
NM_003566chr12103501 3411 3065 2577 2480 2426 665 274 162 113 --1764 13351
NM_003574chr1865450 4524 1881 1686 1568 707 14172 15169 --
NM_003590chr274039 3828 2682 1482 1118 124 69 1521 ----
NM_003615chr383920 3229 2943 1370 620 611 329 298 13865 33596 2621 2444 --
NM_003629chr183354 3147 2992 2131 1182 941 562 543 32665 2340 1191 ----
NM_003633chr542475 2277 631 244 1463 11743 --
NM_003644chr17126449 6249 6217 2633 2559 2269 1909 1679 1229 419 341 231 31466 606 198 ----
NM_003663chr363238 2491 2279 1151 769 240 21210 209 ----
NM_003664chr51561 ----1448
NM_003679chr173384 2696 1345 1233 1092 847 123 --13311 --
NM_003714chr562108 1959 1088 952 319 171 21884 1077 12905 12408
NM_003722chr342037 1837 597 193 12068 12467 12154
NM_003758chr1531025 571 223 1238 1601 --
NM_003758chr1531025 571 223 1238 1601 --
NM_003759chr4113324 3215 2766 2698 2607 1162 1051 557 420 360 90 43617 2628 1428 1407 24185 647 --
NM_003783chr151134 1081 791 763 262 1101 ----
NM_003822chr152706 1218 819 621 341 ----22661 1993
NM_003861chr1432481 472 292 --12518 22923 1930
NM_003885chr1732386 2151 62 32140 2087 195 12323 --
NM_003887chr2161 2497 140 11615 1306
NM_003913chr683501 3075 2938 1478 1345 786 543 81 --11048 11425
NM_003934chr93955 847 86 154 ----
NM_003947chr31943 1463 11046 11285
NM_003966chr5117213 6946 6911 6668 5768 5115 4882 2544 2257 1566 351 37406 730 564 47850 5100 2495 32 --
NM_003983chr16104420 4263 4189 3685 3220 2794 1125 911 711 52 23864 1079 ----
NM_003994chr1284125 3985 3652 3501 3083 1277 838 619 32888 1609 495 --13133
NM_004006chrX72580 2445 2438 1752 444 405 175 22183 2071 ----
NM_004007chrX72580 2445 2438 1752 444 405 175 22183 2071 ----
NM_004009chrX72580 2445 2438 1752 444 405 175 22183 2071 ----
NM_004010chrX72580 2445 2438 1752 444 405 175 22183 2071 ----
NM_004011chrX72580 2445 2438 1752 444 405 175 22183 2071 ----
NM_004012chrX72580 2445 2438 1752 444 405 175 22183 2071 ----
NM_004013chrX72580 2445 2438 1752 444 405 175 22183 2071 ----
NM_004014chrX72580 2445 2438 1752 444 405 175 22183 2071 ----
NM_004015chrX72580 2445 2438 1752 444 405 175 22183 2071 ----
NM_004016chrX72494 2359 2352 1666 358 319 89 22097 1985 ----
NM_004017chrX72580 2445 2438 1752 444 405 175 22183 2071 ----
NM_004018chrX72494 2359 2352 1666 358 319 89 22097 1985 ----
NM_004020chrX72580 2445 2438 1752 444 405 175 22183 2071 ----
NM_004021chrX72494 2359 2352 1666 358 319 89 22097 1985 ----
NM_004022chrX72494 2359 2352 1666 358 319 89 22097 1985 ----
NM_004023chrX72494 2359 2352 1666 358 319 89 22097 1985 ----
NM_004024chr12422 319 21104 1067 --1101
NM_004028chr1874044 3949 3542 1366 1277 677 405 43617 1471 649 181 33206 2984 1611 --
NM_004050chr1442666 2274 1970 938 22771 1684 --12385
NM_004067chr741218 306 298 203 21237 1019 --11282
NM_004075chr121516 --1529 2540 253
NM_004079chr172522 2355 1866 1115 648 602 247 12749 --22898 345
NM_004081chrY71875 1812 1643 1514 426 184 82 1633 ----
NM_004100chr692671 2565 2154 2057 1951 1848 740 191 168 12427 11945 --
NM_004105chr23764 734 224 --1873 --
NM_004113chr361680 547 342 283 256 176 ----2415 82
NM_004117chr641796 1740 1683 380 21589 515 21491 1467 12233
NM_004124chr1463273 3178 2908 2770 2269 1156 ------
NM_004133chr882710 2683 723 704 441 317 265 86 11062 12326 --
NM_004170chr941690 1431 725 459 11451 21494 1229 --
NM_004171chr11199076 8757 8729 7915 7243 6947 6893 6595 6229 6068 5865 3764 3409 3074 2791 2487 1715 1398 1219 67212 3819 3792 3252 3203 2732 37270 1774 34 16851
NM_004180chr22198 79 1521 --1472
NM_004229chrX51602 413 233 125 102 --1567 12004
NM_004232chr1883585 3390 3308 3069 2986 2918 1202 1129 33094 2582 801 1771 --
NM_004235chr91808 --1237 1883
NM_004273chr1053692 1676 1200 892 316 34252 1776 218 11570 25029 1895
NM_004274chr1462484 2449 1227 1132 942 651 ----1951
NM_004296chr1463492 3274 1569 1159 1132 1006 ----34053 3912 3721
NM_004319chr152945 2035 678 661 106 22788 1252 --1387
NM_004331chr871923 1846 1743 608 579 339 162 --32564 1768 997 --
NM_004337chr852213 1818 1689 697 645 --1459 --
NM_004338chr18136955 6586 6248 5855 5726 5554 5331 1913 1821 1425 1327 1277 758 21395 303 --16376
NM_004342chr741830 1791 666 368 21748 231 --21539 138
NM_004363chr1941357 1099 924 165 --21199 262 2863 848
NM_004370chr671900 1894 1658 1360 885 392 51 11688 11954 --
NM_004371chr161231 571 472 264 169 156 1128 21093 598 --
NM_004380chr1682538 2529 2236 2043 884 813 778 694 21837 60 --12296
NM_004397chr1163732 3710 3525 1604 426 311 44329 3771 3102 643 ----
NM_004437chr152859 2720 478 370 117 12379 11146 13319
NM_004447chr1231058 198 136 1127 123 --
NM_004454chr372213 1818 860 799 652 599 28 2428 129 11764 --
NM_004457chr271733 1469 1354 1242 289 108 90 ------
NM_004458chrX42114 904 887 70 11998 1924 12681
NM_004485chr163974 3839 3421 2693 775 73 34199 3126 1766 ----
NM_004500chr1472043 1828 1781 1469 750 680 655 11551 ----
NM_004501chr193882 3622 2839 2772 2515 1401 1101 526 42 ----1796
NM_004514chr1742719 2108 262 197 61178 978 744 182 132 125 --12269
NM_004571chr2193251 3150 2550 2519 1095 997 732 565 327 12981 ----
NM_004580chr1561893 1540 594 583 264 128 21603 1502 ----
NM_004586chrX135230 4612 4601 4336 3932 3861 1842 1825 1684 1587 1102 946 562 25177 1926 --13545
NM_004598chr5113166 2670 2410 2393 2204 1291 1011 930 915 737 353 13222 12803 --
NM_004600chr151310 1169 469 431 189 1459 ----
NM_004612chr994707 3857 3756 3647 3607 1079 849 509 429 1712 ----
NM_004622chr272311 2151 878 805 796 585 507 ------
NM_004655chr1751137 468 426 324 102 2978 318 ----
NM_004660chrY72248 1925 1904 1762 660 420 402 --1229 --
NM_004673chr161466 1422 1264 535 448 305 31341 971 627 ----
NM_004685chr1332976 2864 952 --11176 --
NM_004725chr1021525 334 --11490 21440 1182
NM_004726chrX55117 5090 4339 2281 355 11237 11733 2928 71
NM_004734chr1363292 3073 2025 1225 364 115 11104 ----
NM_004741chr1071584 1564 1111 1005 489 319 73 ------
NM_004744chr473526 2641 2521 2426 736 436 222 31484 1138 1123 13390 1163
NM_004745chr8106885 6192 5898 5300 2655 2560 2419 1988 1909 1795 35420 5223 326 27054 4255 1671
NM_004755chr1431124 966 139 1951 --11104
NM_004760chr741528 903 611 355 1322 --12276
NM_004772chr52293 87 41239 1002 496 413 1984 --
NM_004774chr1783173 2740 2354 2282 2132 1192 643 167 1742 12208 1373
NM_004775chr1872317 1972 1826 575 549 49 29 1463 ----
NM_004779chr51926 21241 1159 --1175
NM_004788chr1162622 2314 2186 1888 888 445 21790 1701 21985 1922 --
NM_004796chr1441737 1493 974 870 2660 539 ----
NM_004797chr343493 2684 1293 535 21429 404 22855 1162 --
NM_004798chr2053647 2930 2237 723 473 32946 2697 93 23265 2865 --
NM_004808chr1063383 3011 2160 914 818 182 ----13109
NM_004824chr641410 1324 1012 570 1522 ----
NM_004834chr22722 212 ----1878
NM_004837chr161628 1600 1551 1527 605 156 ----11683
NM_004849chr61282 11590 1214 1500
NM_004859chr1772513 2256 2032 413 341 168 146 ------
NM_004863chr14155340 5305 5170 4762 4574 4468 4400 4372 4231 3946 1620 1382 1253 1002 199 --34075 2023 1027 34861 4335 1719
NM_004866chr5154800 4554 4492 4474 4301 4200 3926 3909 3868 3319 1486 1465 1425 1049 389 --25059 3590 14948
NM_004896chr1051499 1160 450 109 35 --31296 983 367 11005
NM_004904chr7156018 5694 5639 5285 5076 4539 4152 2074 1703 1300 1156 954 740 345 267 45343 2626 1232 1051 ----
NM_004912chr731307 1196 193 11599 --1289
NM_004921chr151979 1768 559 338 155 21896 281 ----
NM_004926chr1461611 671 652 472 315 226 11244 21856 692 --
NM_004932chr541201 1116 556 453 51600 1395 1178 643 564 ----
NM_004937chr1742521 1936 1769 1010 ----22734 1867
NM_004951chr13135 ----2402 155
NM_004956chr764611 3643 3563 937 841 480 34626 2826 783 11051 11739
NM_004973chr641618 1105 240 156 1187 ----
NM_004976chr1185177 5058 4970 4880 4254 3215 1957 623 34778 1967 1089 --13730
NM_004985chr1294290 3385 2845 2819 2793 1611 1207 1016 888 23824 725 ----
NM_004992chrX138255 8177 7881 7156 5179 2488 2083 1763 1170 704 337 256 135 16297 18461 15513
NM_004992chrX138255 8177 7881 7156 5179 2488 2083 1763 1170 704 337 256 135 16297 18461 15513
NM_004999chr6114362 3933 3590 3235 2973 1260 1106 1009 979 420 222 --14251 --
NM_005023chr551535 1390 1157 298 200 --21491 543 --
NM_005028chr1052128 1987 1559 330 112 2577 81 ----
NM_005036chr22148361 7836 7736 7560 6341 5712 5152 2623 2449 2045 1086 1023 790 694 26736 5519 --22143 1132
NM_005054chr271629 1609 1536 1286 1218 453 370 ------
NM_005056chr1265542 5054 4412 3503 1573 143 22172 1529 11844 11359
NM_005065chr1494476 4272 3966 1626 1313 1091 717 529 191 33787 1043 419 25314 4194 23778 1068
NM_005082chr1783713 3600 3588 3088 1284 1161 763 48 21213 333 1482 12453
NM_005093chr20145320 4897 4568 4500 4419 4240 3870 2138 2037 1802 1227 1069 301 76 24200 3585 ----
NM_005095chr172166 2000 1762 759 691 400 343 2789 482 1140 11638
NM_005109chr352405 2399 552 223 105 31847 858 94 --176
NM_005121chr1763528 2897 2886 2470 1333 1001 12410 ----
NM_005124chr631024 705 156 --1787 1812
NM_005126chr392309 2035 1991 1820 1650 863 685 230 206 1916 11767 --
NM_005156chr944429 847 422 51 13723 1573 1359
NM_005164chr1242677 2014 1887 355 --2672 483 --
NM_005197chr14105854 5439 4827 4745 3890 2146 791 639 506 323 43897 2487 2371 530 21426 631 26005 5450
NM_005207chr2293645 3615 1269 1160 956 793 472 441 234 11344 ----
NM_005233chr382501 2071 1940 899 822 788 301 160 22056 1709 ----
NM_005235chr2117114 7056 6899 6640 6537 5570 2613 2595 2317 2252 1953 36106 5813 1891 27135 5333 22170 1932
NM_005254chr1551280 1219 319 280 133 1937 1430 --
NM_005259chr241355 1268 1132 141 1377 ----
NM_005296chrX3970 213 63 1107 ----
NM_005311chr772805 2793 2741 2405 2181 1980 264 1594 22529 1930 1190
NM_005313chr1571375 1241 1027 995 324 315 153 ------
NM_005328chr82753 638 1189 1582 --
NM_005329chr1672259 1928 1900 1706 1534 1517 312 11819 1821 --
NM_005333chrX51021 819 503 57 30 --21216 1092 --
NM_005336chr252301 2007 669 221 21 146 --11548
NM_005342chrX62079 906 858 674 434 373 ------
NM_005359chr18156274 5846 5832 5780 5033 4822 4774 4457 2052 1743 1543 1075 942 926 639 12033 11164 --
NM_005397chr764042 3432 2877 2664 765 463 21146 1020 1687 --
NM_005399chr1103555 2701 1626 1492 1164 934 551 428 356 64 33698 3463 3075 --13635
NM_005400chr222272 653 11987 --12528
NM_005402chr751862 1222 571 505 430 ------
NM_005410chr56831 732 726 290 85 69 --1741 --
NM_005433chr1872606 2305 1929 860 599 300 118 1845 1173 --
NM_005455chr141869 578 288 199 1136 11885 1394
NM_005461chr2071901 1846 1751 1456 1378 777 374 21930 1410 11275 --
NM_005465chr141623 1509 1264 811 1657 21793 1664 --
NM_005475chr1292870 2838 2714 2485 2454 2185 2079 1128 691 1410 1994 --
NM_005487chr2262087 1878 1524 855 274 27 21919 391 ----
NM_005497chr17165786 5327 5231 4977 4916 4491 4327 2186 1449 1178 938 923 903 824 670 273 ----45670 4556 2042 1069
NM_005502chr983177 2864 2681 2221 1109 428 265 113 2884 279 12631 12434
NM_005504chr1294709 4573 2258 2092 1401 1144 800 463 247 12292 26309 2277 35938 5834 5065
NM_005506chr452765 2463 2307 2258 68 2952 578 1250 --
NM_005511chr941067 949 775 208 ----1268
NM_005544chr241032 817 266 51 --1735 --
NM_005570chr1841085 960 885 196 --1150 --
NM_005578chr384880 4713 3693 3679 3536 1818 1441 1412 1589 ----
NM_005596chr996323 6313 6135 4135 3955 2482 1592 1029 240 45667 5062 1214 1153 15334 --
NM_005603chr1881984 1754 1532 650 605 407 312 138 ------
NM_005627chr641003 980 890 865 ------
NM_005637chr1841977 625 487 116 --1716 --
NM_005668chr573349 1038 608 575 441 392 358 43936 3925 3000 1258 1992 --
NM_005670chr662030 1875 1508 1489 472 365 11914 ----
NM_005725chr13872 829 566 21516 619 --12380
NM_005730chr1283666 3132 2761 2331 2299 895 709 501 22405 2255 --12994
NM_005732chr521269 378 --11191 21502 503
NM_005737chr232512 2412 98 42246 2108 2034 1999 ----
NM_005739chr1561821 1770 1712 881 478 57 ----21694 1663
NM_005748chr1273470 3460 3112 2863 2177 982 544 23154 2474 11390 --
NM_005756chrX51347 988 595 549 530 ------
NM_005759chr264806 4713 4480 3166 1705 873 21375 1170 ----
NM_005779chr5123652 3571 3418 3323 3230 3214 2408 2278 836 475 299 234 --33080 2659 2349 --
NM_005786chr181919 ----21285 1257
NM_005795chr273053 3032 2437 2002 457 309 189 12075 12086 12045
NM_005797chr1151408 1354 647 463 44 --21801 493 --
NM_005798chr1365289 4984 4568 3994 865 189 34113 1597 1140 ----
NM_005808chr3103109 2682 2608 2246 1232 1096 942 904 896 423 23178 2599 ----
NM_005819chr172228 1203 1073 431 385 237 41 32806 2793 2520 ----
NM_005828chr1744745 4122 3156 1922 13624 44633 4069 1267 954 35004 4340 3280
NM_005840chrX106465 6283 6062 5660 5561 4786 3083 1556 980 94 --35641 2977 1747 12281
NM_005843chr261959 1946 1306 330 274 132 11878 --11521
NM_005859chr561571 1172 1114 1056 547 129 ------
NM_005868chr742435 2270 2245 146 1799 12518 --
NM_005880chr1641439 1394 619 168 --1342 --
NM_005901chr18138289 7931 7884 6609 6037 5287 2111 2078 1428 722 693 605 414 46589 6564 6457 2124 1570 27671 7574
NM_005902chr15114621 4277 4271 3928 3648 3200 3038 1860 1046 1019 964 41843 1058 693 166 ----
NM_005903chr5105252 4720 4591 4206 3572 3458 1779 1496 1400 264 13278 25244 3861 --
NM_005906chr631373 301 239 --11700 1291
NM_005920chr143856 2859 580 461 33022 2407 443 ----
NM_005935chr4124376 4106 3799 3254 1956 1939 1923 1356 1309 526 313 97 11206 23687 146 13490
NM_005941chr823948 1271 51354 522 490 408 135 1818 --
NM_005955chr1115564 5542 5456 5368 5256 4889 4709 4046 1539 469 115 35377 4906 1422 14298 --
NM_006007chr984067 3285 2896 2724 1523 1386 552 443 --1777 --
NM_006011chr1594130 4087 3845 3621 3416 3266 2751 892 253 24059 245 14339 --
NM_006016chr652318 2142 1536 874 174 12124 1768 --
NM_006037chr284552 3821 3727 3196 1638 944 530 457 11861 ----
NM_006052chr2172105 1955 1642 1595 369 135 65 21391 48 ----
NM_006055chr262757 2519 2214 1088 949 894 32473 355 57 ----
NM_006060chr754220 3400 1462 1425 28 43008 1184 1126 1010 ----
NM_006079chr64527 140 133 34 ------
NM_006080chr742052 1991 554 22 ----1157
NM_006085chr131274 954 125 1319 1289 1540
NM_006095chr474527 4476 4041 3970 3761 1781 376 13326 ----
NM_006106chr1172781 2391 2096 1084 900 74 28 13104 ----
NM_006108chr1111928 11517 32390 1684 806 12407
NM_006139chr272918 2689 2044 1019 923 675 147 12356 --12093
NM_006180chr961824 1461 1396 673 583 485 22038 1414 12080 --
NM_006203chr543994 3625 1307 860 21990 1023 --14021
NM_006206chr462149 2076 1171 981 515 459 --11019 --
NM_006210chr194920 900 268 27 ----1142
NM_006241chr352150 1982 1762 644 144 11991 144 --
NM_006251chr543383 3016 2410 1004 --12940 --
NM_006252chr1126655 6321 6218 5533 5351 5087 5062 4966 1122 753 502 372 37525 7213 1992 37360 5793 2420 --
NM_006258chr1061564 1181 1083 1077 202 69 21259 1051 --11149
NM_006267chr251849 1687 1491 1424 281 ----21821 1395
NM_006281chr831174 749 401 21058 299 1289 --
NM_006281chr831174 749 401 21058 299 1289 --
NM_006282chr2054760 4033 3858 1863 1616 13654 1252 --
NM_006298chr642375 2283 1020 943 1595 --11253
NM_006313chr1211630 21287 616 2256 126 --
NM_006352chr152071 1650 1349 451 240 ----1468
NM_006353chr651351 1283 1268 383 67 21294 442 ----
NM_006361chr1771978 1654 1569 1320 754 423 193 21715 72 11738 --
NM_006371chr3125301 5175 4734 4687 4471 4429 3722 3632 3579 1255 732 127 24570 3621 --14287
NM_006379chr721766 1588 1410 --11906
NM_006380chr1794330 4184 3674 2939 2670 1262 1120 636 127 11743 ----
NM_006393chr1074373 4081 3923 3145 1264 860 419 148 1272 14075
NM_006420chr2093122 2809 2349 2317 2297 1028 305 261 189 --1905 --
NM_006434chr1073266 2649 2642 739 536 411 58 42024 1306 394 150 ----
NM_006457chr453103 1550 1242 630 369 23629 3540 1727 11339
NM_006459chr102719 233 11514 11872 1675
NM_006460chr1781684 1572 1529 1205 1196 1163 294 121 --11453 --
NM_006464chr254394 4198 3368 1826 121 11863 14042 --
NM_006504chr1082972 2912 2110 2051 1998 1133 986 155 11805 22934 1866 --
NM_006524chr781043 882 798 714 378 294 210 126 ------
NM_006526chr2031760 854 542 --21802 431 --
NM_006529chr461570 1143 676 396 367 254 11415 ----
NM_006534chr2063136 2867 2638 1342 895 170 22502 907 12168 --
NM_006544chr14105223 5150 4331 1403 1286 1202 1133 928 721 606 --24421 1194 --
NM_006549chr1272936 2420 2201 812 776 388 302 52115 974 252 246 93 11062 --
NM_006557chr951679 1432 1418 1311 277 31777 288 193 ----
NM_006561chr1094747 4463 4361 3935 2170 1637 1406 773 312 21999 950 21742 1184 --
NM_006572chr17103519 3378 3367 3321 3019 2709 2604 2543 849 256 23501 2918 1889 --
NM_006595chr1131631 1490 804 --21638 1299 11831
NM_006599chr16157746 7644 7099 6806 6322 6286 5407 5328 5251 3039 2546 2060 555 119 28 32718 2477 2324 15132 --
NM_006603chrX22040 554 1615 --21897 1700
NM_006614chr363322 2974 2867 2742 2388 246 12666 --1275
NM_006628chr15114441 3242 3222 3125 1602 1115 1068 836 828 221 33 --23259 524 14044
NM_006629chr1892126 1848 1015 814 582 549 447 348 205 11891 1879 --
NM_006654chr1284805 4359 4316 4103 1792 1463 1439 756 --14537 --
NM_006717chr963333 2904 2356 692 600 193 2852 112 13406 12982
NM_006729chrX124477 4408 4228 4031 2143 1503 967 833 801 720 681 612 ----13719
NM_006738chr1554626 4530 1856 1680 353 14479 24449 3334 1590
NM_006746chrX61582 1463 621 586 304 185 ------
NM_006750chr16187832 7694 7622 6678 6528 5839 5613 5353 5185 5009 3080 2710 2598 2463 829 812 136 81 37911 5665 5602 22353 1021 37230 5938 1929
NM_006763chr171971 1640 1428 856 742 288 172 11796 ----
NM_006766chr85651 615 541 439 154 42286 1018 835 454 ----
NM_006807chr1761328 1311 1181 1113 977 836 ------
NM_006827chr1453267 2995 2793 2477 2121 1933 --12222
NM_006838chr1241178 749 536 494 11298 --11611
NM_006851chr1252360 2354 788 737 257 22329 25 --2511 172
NM_006852chr1762651 2450 640 413 182 104 12326 --12841
NM_006873chr273574 2620 1214 897 691 425 147 22349 255 ----
NM_006884chr321676 1656 --11945 1795
NM_006885chr1633125 925 233 11552 23661 325 --
NM_006888chr1493433 3421 3007 2694 2371 1346 742 734 513 21188 390 23508 2569 --
NM_006918chr11115688 5311 5292 5222 4817 4698 3908 3626 1518 1123 884 25350 3956 13738 --
NM_006920chr251983 821 743 711 298 1700 ----
NM_006922chr262538 2518 2488 2090 989 474 21637 244 12420 22329 787
NM_006924chr1773378 1345 1310 1142 1109 998 858 44425 3929 3029 30 34478 2801 639 1824
NM_006939chr1431192 979 923 --2420 270 --
NM_006954chr1093338 3015 2911 2682 2618 2460 2134 1060 891 22596 1024 13268 154
NM_006956chr761766 1702 1690 1600 55 30 ----1494
NM_006974chr1093338 3015 2911 2682 2618 2460 2134 1060 891 22596 1024 13268 154
NM_006999chr542089 1889 1746 380 ----11827
NM_007005chr941490 1460 1169 188 ------
NM_007006chr1643375 3087 1329 278 23235 3137 --12219
NM_007007chr12164790 4415 4257 4066 4018 3579 1519 1222 1132 982 895 828 739 420 221 98 ------
NM_007010chr1741814 662 604 154 11748 --11549
NM_007011chr1576099 5486 2477 2094 1470 416 285 21057 483 25800 4390 25584 1233
NM_007038chr2146130 6071 5097 2300 11969 45710 5472 4359 717 15684
NM_007039chr1452303 2219 1548 527 369 11787 ----
NM_007043chr1241707 1557 1316 440 11759 11326 1245
NM_007050chr20157859 7134 6637 6538 5965 5588 5149 2936 2754 2694 1768 1533 1465 1376 52 87309 6203 6141 4895 2483 2087 1440 1172 17551 37264 6853 5692
NM_007064chr361643 1139 535 331 184 46 11610 21331 135 --
NM_007073chr684028 3155 3129 2586 1062 1050 1005 646 24132 3709 13180 11121
NM_007106chr1372615 2197 956 824 581 338 66 ------
NM_007107chr332097 1599 405 31789 203 124 --11697
NM_007114chr3113268 3216 2800 2525 2317 1306 1185 692 596 526 504 12307 11118 1888
NM_007129chr134981 430 286 280 1265 ----
NM_007137chrX85566 5211 5094 1756 999 914 436 167 22099 1900 --14696
NM_007166chr1151150 995 310 95 57 176 1105 --
NM_007172chr2272972 2535 1005 986 474 265 153 --22980 800 --
NM_007175chr843130 2794 2245 235 11179 --21063 142
NM_007195chr1873336 2591 1113 934 868 418 113 --12749 --
NM_007200chr1554626 4530 1856 1680 353 14479 24449 3334 1590
NM_007203chr963670 3520 3066 2755 1234 127 43993 2647 612 109 13634 --
NM_007214chr63511 200 74 11080 1250 --
NM_007218chr84759 620 608 594 ------
NM_007222chr871813 1758 1346 718 521 489 171 ------
NM_007249chr13129404 9157 8895 8854 8525 5861 3448 3105 2650 1534 1420 1334 1961 49460 9327 6009 2312 11471
NM_007287chr3113068 2949 2941 1968 1007 897 889 841 479 334 322 12611 --22531 535
NM_007288chr3113068 2949 2941 1968 1007 897 889 841 479 334 322 12611 --22531 535
NM_007289chr3113068 2949 2941 1968 1007 897 889 841 479 334 322 12611 --22531 535
NM_007331chr432029 1965 1941 1666 --12593
NM_007347chr1573077 2170 1050 1024 681 245 55 2734 706 --12147
NM_007350chr12123829 3670 3655 3025 1552 1350 1334 988 788 543 368 231 33331 1370 404 --11198
NM_007375chr172808 2734 2530 2429 1759 784 257 22099 1962 1394 159
NM_012081chr593322 2873 2562 2454 1261 451 422 123 33 12434 23435 601 --
NM_012082chr83820 813 613 --1701 1828
NM_012089chr121201 87 2506 65 21174 1026 --
NM_012095chr10103385 3102 2946 2848 1208 1000 917 866 364 185 --13199 --
NM_012096chr372997 2894 2473 2446 2344 440 228 --11260 --
NM_012097chr241785 1738 109 99 21885 1464 --11622
NM_012102chr162323 2309 2295 1930 576 34 22370 133 12142 --
NM_012104chr1173675 3522 2837 1543 889 680 293 33420 3328 3239 22856 2445 13813
NM_012104chr1173675 3522 2837 1543 889 680 293 33420 3328 3239 22856 2445 13813
NM_012120chr663022 2599 2562 2215 1081 616 32514 2087 988 1452 --
NM_012129chr742490 2476 1734 736 12421 ----
NM_012137chr132409 1898 1787 22286 529 --21143 784
NM_012141chr1363494 1514 1492 1306 656 309 33596 3424 981 11033 --
NM_012158chr1351278 1164 700 671 374 2295 152 ----
NM_012164chr9127060 6589 6006 5922 5758 5252 4594 2154 2007 1453 512 87 55313 1435 1390 1259 561 24611 599 35537 4785 1132
NM_012193chr1165416 4449 4332 3373 1418 1396 23611 3469 14793 --
NM_012199chr184439 4254 3526 3287 1301 1216 892 48 53137 988 884 515 72 ----
NM_012215chr1041552 779 676 199 1142 ----
NM_012219chr3103201 2550 2077 2043 1193 1175 1063 850 683 666 1584 ----
NM_012234chr373024 2295 1412 1024 982 397 53 11191 11140 --
NM_012242chr102140 55 ----1774
NM_012249chr273550 2693 2519 1326 1104 699 123 ------
NM_012262chr174073 3837 3593 3277 1889 801 607 13886 ----
NM_012281chr762431 2012 674 638 546 309 1437 1628 11845
NM_012287chr364086 1125 976 772 723 648 12981 ----
NM_012288chr684663 4638 3522 3505 1769 1556 1463 121 34610 4031 838 15425 12220
NM_012297chr452628 1768 724 249 204 --1625 --
NM_012300chr552475 1808 917 328 236 11985 21878 1654 --
NM_012301chr72205 192 21788 1696 22024 1932 --
NM_012309chr1174749 4201 3953 3383 1886 1861 175 24875 1264 --24382 4003
NM_012316chr1115658 5135 5068 5031 4715 4206 4080 3919 2128 2003 1828 54914 1983 1791 1493 497 35463 5232 4466 24814 638
NM_012323chr2261490 1324 1219 1162 588 369 2998 522 --11422
NM_012328chr73381 358 323 ----126
NM_012334chr574526 4418 4180 3293 2897 1202 896 23933 756 --24276 616
NM_012382chr584565 4207 3689 3648 3524 3067 862 243 14387 ----
NM_012384chr2042118 2089 1960 485 ----21636 473
NM_012388chr15102857 2801 2591 2229 1207 1086 348 288 255 112 12623 22396 485 11184
NM_012463chr1231542 1339 342 --11750 --
NM_012464chr492504 1111 818 804 736 459 394 169 117 22264 779 ----
NM_012465chr1063273 3132 2938 2691 2258 506 22345 123 ----
NM_012479chr712767 22011 121 1479 1806
NM_013229chr1272757 2509 2184 1922 1796 410 68 11743 ----
NM_013230chrY51497 1467 1438 217 31 ----150
NM_013249chr112432 176 1479 263 54 --
NM_013255chr7128029 7027 6613 5903 5583 3388 2889 1808 1098 763 757 652 25876 1241 16579 18224
NM_013269chr1243669 3311 2799 913 44190 3473 2859 1659 --12765
NM_013281chr2041355 545 285 69 ----147
NM_013309chr1572629 2464 2455 2347 2188 1618 373 32044 1973 73 11000 21958 753
NM_013372chr1563225 2767 1009 922 597 108 3857 788 272 --23413 92
NM_013374chr373017 2859 2281 2222 2027 1002 450 --42511 1149 272 76 --
NM_013381chr1282189 1874 1816 1486 939 780 698 226 11846 ----
NM_013943chr163094 2692 2157 1311 1305 193 12117 12761 12913
NM_013951chr262484 2358 2233 1748 844 155 12250 --21787 1729
NM_013952chr262561 2435 2310 1825 921 232 12327 --21864 1806
NM_013953chr262561 2435 2310 1825 921 232 12327 --21864 1806
NM_013989chr1485142 4526 4357 3808 1794 980 503 222 44586 4488 4331 4007 --1467
NM_013992chr262561 2435 2310 1825 921 232 12327 --21864 1806
NM_013995chrX42558 2322 2093 1964 ------
NM_014011chr242244 830 597 441 22055 1037 22156 963 11744
NM_014016chr321389 1057 1340 --11419
NM_014021chr162834 2772 2363 2204 1099 161 12184 --13114
NM_014043chr351428 1405 1081 309 50 ------
NM_014048chr1674499 4090 1842 1785 570 378 359 33620 946 151 22015 1434 --
NM_014106chr1532363 1191 97 ----1279
NM_014109chr851277 942 220 137 88 11064 ----
NM_014112chr885496 4968 3819 3575 853 829 457 237 24724 420 ----
NM_014141chr7135255 4569 4345 3730 3675 3594 1223 1204 1125 994 760 323 178 --12086 --
NM_014155chr11177432 7406 7175 6799 6242 5957 5625 5007 4930 2475 2040 1762 1756 1713 1478 789 36 15209 25192 967 14658
NM_014181chr2102670 2636 2304 2227 2150 970 748 724 703 595 ------
NM_014190chr471322 1164 460 358 147 84 54 2193 132 1139 --
NM_014210chr174597 447 172 111 1625 1635 --
NM_014217chr121906 1706 11802 --11680
NM_014231chr1231994 396 275 ----21416 784
NM_014243chr461907 1811 1798 1382 863 39 ------
NM_014250chr2262087 1878 1524 855 274 27 21919 391 ----
NM_014296chr331327 188 108 21370 1289 1447 --
NM_014309chr2264771 4018 3301 923 829 245 14324 25381 3458 --
NM_014335chr1521248 1199 1378 1955 1550
NM_014418chr1462026 1268 587 492 450 123 31900 1695 188 ----
NM_014423chr575195 5038 4596 4218 1545 1427 216 23962 3929 24317 4227 11146
NM_014456chr1071701 1632 1537 744 694 606 404 21847 1266 --1137
NM_014608chr15154 --1342 1499
NM_014615chr1683373 2729 2710 2579 2433 2293 1274 958 21228 405 33535 3459 1403 --
NM_014635chr271607 1587 1508 1249 1181 417 334 ------
NM_014636chr9104150 4110 3844 3272 3220 3022 1742 1329 1194 247 42939 1576 110 45 13479 --
NM_014647chr1652289 2148 1525 604 100 1327 ----
NM_014674chr363809 3776 3453 1452 1036 30 151 ----
NM_014676chr121602 485 2152 60 ----
NM_014679chr1161382 1232 902 872 409 211 ------
NM_014702chr663386 3261 3228 2198 2169 1129 12370 11135 13161
NM_014711chr1662120 1716 1623 1579 1563 270 11740 ----
NM_014721chr6117137 6695 5929 5656 5635 4833 1321 1178 868 68 52 34594 2831 1488 ----
NM_014737chr2083931 3731 2991 2629 735 637 105 56 ----21269 664
NM_014746chr273718 3333 2666 1666 1441 539 479 23961 3906 23822 1647 --
NM_014747chr185538 4606 4460 3810 2136 1863 1342 557 24192 298 --15522
NM_014755chr263740 3604 3171 2628 1405 36 34183 1499 1096 12679 --
NM_014765chr152559 2194 580 408 282 22456 1640 --1813
NM_014772chr1863556 2988 2607 2538 194 167 31187 814 304 23029 995 13611
NM_014774chr173140 2704 2651 2419 2362 345 263 12112 12519 --
NM_014787chr182601 2528 2263 2065 603 116 90 82 11051 1796 11121
NM_014810chr153700 3337 2718 2548 870 --43495 1085 636 449 --
NM_014812chr141354 1311 427 316 --21466 362 1736
NM_014819chr592481 1737 1706 1518 745 636 593 150 41 22418 1875 ----
NM_014829chr532027 912 631 ----1236
NM_014830chr1293833 3663 3639 3345 3160 2980 2860 2574 2417 13439 33548 656 296 --
NM_014832chr1361904 1873 1558 763 338 177 1318 ----
NM_014836chr1051721 1523 1255 267 229 1777 1754 --
NM_014839chr142250 1935 1737 496 1366 1488 --
NM_014841chr631025 397 390 21358 107 ----
NM_014846chr8--184 --1284
NM_014848chr1542865 2293 1742 697 2981 888 12793 --
NM_014850chr3114528 4391 3336 1877 1441 1166 1025 875 804 779 765 34122 1580 1004 23594 934 --
NM_014864chr182729 2704 1556 1491 1158 589 484 355 24061 644 --11595
NM_014867chr873854 3794 3712 3058 1396 1120 342 2649 214 --1970
NM_014873chr173336 3103 1808 542 519 496 434 11881 13635 14888
NM_014876chr2282279 2115 1932 1907 790 492 430 235 11947 ----
NM_014877chr1777299 5506 4789 2747 1820 1792 1385 44750 4698 1987 1256 27128 6536 37065 7039 1432
NM_014891chr741507 1341 683 613 --11143 --
NM_014897chr1752683 2416 1209 663 199 1224 --13215
NM_014899chr532966 2098 1922 1398 23175 285 12536
NM_014903chr12102407 2326 2294 2203 1962 1517 873 691 156 74 21762 506 1867 --
NM_014904chr10104079 3533 3345 3032 2738 1613 1606 1099 927 190 13105 ----
NM_014906chr1784132 3839 3383 2873 2620 559 479 459 1151 13878 23438 2808
NM_014912chr1053406 3016 2849 1294 549 21107 764 12558 --
NM_014914chr25949 499 464 238 164 1895 1229 --
NM_014923chr1362315 2140 2037 2031 1614 801 32354 2167 779 ----
NM_014924chr1483217 3193 2622 2443 2335 2297 1209 679 22914 2504 ----
NM_014935chr133627 2997 2950 32686 2554 544 --13907
NM_014939chr1861505 1470 1445 1172 1145 380 127 2265 203 11516
NM_014946chr273138 2975 2704 1894 585 262 147 ------
NM_014950chr1471543 1414 1386 1216 655 418 236 31327 165 69 1667 --
NM_014961chr492229 1920 1733 1513 1481 727 486 427 239 22110 1696 ----
NM_014962chr2062220 2062 2035 868 774 253 --32363 759 429 --
NM_014982chr14105252 4456 3842 1907 1801 1458 1390 335 321 312 34019 3477 1772 11358 15096
NM_014989chr641585 333 59 33 ----1271
NM_014991chr4102491 2357 2288 1079 824 746 669 494 392 288 11272 33020 572 40 --
NM_014996chr34908 268 227 110 1882 ----
NM_015000chr1282966 2909 2742 2688 2625 2526 2449 905 ------
NM_015008chr393378 2444 799 764 701 582 447 359 276 33505 2572 339 11045 1384
NM_015020chr1653308 2735 2674 492 423 22417 1574 ----
NM_015025chr272530 2325 1784 1053 872 806 24 1406 ----
NM_015035chr20136704 6427 6348 5652 5537 5371 4804 2668 1895 1565 820 528 69 14776 25468 1378 --
NM_015040chr293248 3227 1272 1175 800 675 558 475 163 --1831 13430
NM_015049chr272645 1184 1088 1076 985 952 899 1374 ----
NM_015051chr982817 1176 892 721 269 245 198 25 11083 13299 169
NM_015059chr1573163 2998 1540 1037 953 925 476 2786 613 24008 3132 --
NM_015068chr783843 3702 2916 950 663 593 485 329 --33887 3644 837 --
NM_015071chr5126355 6282 5537 5355 5050 4121 4098 2621 2580 2309 1686 381 36075 5862 1324 15544 13960
NM_015074chr174723 4042 3946 3204 1177 1033 305 14697 11440 11274
NM_015076chr654231 4058 3848 3794 128 23788 108 ----
NM_015077chr1754376 3538 3469 2872 1115 24737 756 14608 34705 1500 1246
NM_015082chr541886 984 530 102 32490 453 373 12603 12515
NM_015090chr196165 5580 5371 5052 1951 1827 1642 1074 170 65007 4696 4385 1885 977 396 25365 2382 --
NM_015092chr1674571 4223 3985 3827 3221 1616 396 21441 129 --11717
NM_015093chr641837 1760 1680 1665 ----11674
NM_015094chr22133973 3949 3679 3514 2881 2861 1879 1834 1371 1209 795 640 92 23006 50 ----
NM_015110chr962527 2507 2308 2277 964 115 --12431 --
NM_015115chr482906 2750 2321 2304 2077 2040 878 377 12766 22339 743 --
NM_015138chr1572491 2346 2024 839 162 146 123 2897 736 ----
NM_015144chr16103655 1498 1305 719 713 549 525 182 164 33 12859 ----
NM_015155chr1093286 2882 2620 1303 631 608 537 306 203 12168 ----
NM_015156chr1443383 3273 3048 623 13801 --13464
NM_015170chr862375 2131 847 375 347 335 1280 12078 --
NM_015176chr12589 126 11503 --1332
NM_015208chr1893906 3552 3182 3066 1069 852 547 384 34 23307 1355 12502 --
NM_015215chr162929 2234 2022 911 722 136 11975 ----
NM_015226chr1673467 3343 3222 2842 2545 1159 158 12707 ----
NM_015230chr441514 1165 402 208 --11783 --
NM_015251chr1632209 2137 389 31780 316 293 11770 --
NM_015265chr272606 1850 1722 1656 1062 790 572 ------
NM_015267chr12112047 1721 1708 1646 1605 820 647 544 324 293 286 11948 ----
NM_015271chr483562 2935 2729 1303 710 280 203 46 21427 436 --13867
NM_015275chr122289 75 2807 277 ----
NM_015291chr143539 2259 2185 917 ------
NM_015299chr1463844 2513 1186 1167 967 721 13002 12447 --
NM_015310chr8138172 7952 6152 5427 3294 3127 2813 2067 2044 1823 1623 1437 340 27592 855 18179 18426
NM_015314chr752355 2054 2017 891 166 22588 1767 --12414
NM_015317chr231996 470 372 12204 32851 2458 1143 12105
NM_015323chr651384 1272 1152 475 161 --21367 555 --
NM_015326chr162931 2661 2004 553 162 148 12972 --12273
NM_015332chr7123625 3535 3468 3347 2608 1287 976 735 729 501 134 22 ------
NM_015335chr1252219 1968 1765 557 397 21924 683 ----
NM_015336chr1252623 2361 2153 729 308 ----12333
NM_015346chr1451437 1417 1320 386 335 --1584 11539
NM_015347chr1252636 2609 1926 759 728 22916 1867 --1743
NM_015355chr1741901 1833 1802 316 --11555 1262
NM_015365chrX84091 3774 3654 3618 3496 3440 1697 57 --12699 --
NM_015385chr1073266 2649 2642 739 536 411 58 42024 1306 394 150 ----
NM_015387chr241702 1678 1654 694 1314 --11303
NM_015393chr473610 3425 2960 2617 2404 1455 382 --22355 106 --
NM_015416chr122979 200 ----1958
NM_015436chr443352 2606 2451 2143 43061 3036 2114 437 ----
NM_015455chr573945 3609 2785 851 693 528 41 23525 877 1552 12709
NM_015458chr8145020 4981 4761 4745 4416 4378 4358 2062 1653 1636 868 810 459 178 14010 44430 4106 1374 1118 --
NM_015526chr19131288 1280 1222 1215 1114 1091 963 917 566 518 368 189 115 41457 1013 990 594 ----
NM_015535chr273419 3357 1394 1347 1097 767 101 32992 2945 1560 22839 2663 --
NM_015550chr793505 3356 3251 3065 2941 2383 1345 236 68 12582 ----
NM_015553chr655026 4239 1387 1381 1349 43572 3225 929 99 ----
NM_015564chr5133600 3164 3092 2662 2456 2398 2378 2182 1065 804 793 610 98 13275 31033 833 286 13102
NM_015565chr2182003 1662 1624 705 583 563 440 293 1625 --1352
NM_015569chr1134408 3947 3581 3332 2947 1743 1417 1023 554 383 377 171 77 14272 11721 --
NM_015570chr771845 1567 1334 636 262 108 37 1666 1595 --
NM_015571chr632525 2451 461 11650 --1557
NM_015575chr263362 1279 1240 1216 1210 943 13100 ----
NM_015610chr782616 2573 2456 2144 1825 676 280 271 --1201 --
NM_015630chr21746 ----2392 139
NM_015640chr1144812 4702 3744 3558 2098 1819 1653 1167 1159 922 803 771 610 480 23882 3298 34168 1882 39 --
NM_015713chr873539 3018 2479 1420 1235 30 22 2131 124 1326 12224
NM_015850chr821808 658 11592 1388 1857
NM_015852chr7203385 3063 2890 1369 1310 1260 1221 1140 1103 1056 888 851 720 636 552 468 300 263 216 48 --1431 --
NM_015878chr8102025 2012 1818 1611 1565 1556 896 835 742 316 22129 293 --1217
NM_015879chr18148633 7443 6951 6870 6784 2874 2571 2293 2157 1663 1315 973 293 78 48411 5706 3355 2384 11720 17522
NM_015886chr8105711 5686 5120 5107 4294 4123 3485 1054 903 214 21783 1458 25696 4940 11763
NM_015888chr183392 2567 2286 2199 2190 2063 1361 722 ----11185
NM_015891chr641986 1935 1455 821 ----11295
NM_015901chr105839 825 808 644 585 ------
NM_015906chr144383 1906 1388 906 33484 475 71 34803 1302 1211 11348
NM_015913chr15780 694 267 106 93 1681 ----
NM_015981chr562983 2875 2785 2330 472 151 22864 2858 ----
NM_016003chr782616 2573 2456 2144 1825 676 280 271 --1201 --
NM_016009chr1134896 4242 4102 4075 3688 3460 3005 1676 1561 1042 509 418 339 23045 1928 23557 452 --
NM_016018chr872769 2664 2562 2358 2153 507 384 1808 ----
NM_016021chr6112734 2527 2519 2311 2270 2195 1983 1846 969 931 448 --12792 --
NM_016025chr1631607 1346 491 31885 713 195 ----
NM_016026chr145960 525 251 114 91 1150 ----
NM_016045chr2051791 1765 1366 1316 497 --11641 --
NM_016057chr1251287 1147 1038 801 123 --1490 --
NM_016061chr23530 394 376 ----1410
NM_016072chr1242109 1477 493 257 2300 234 ----
NM_016076chr142369 570 229 118 --32536 1194 941 --
NM_016079chr231820 885 391 1244 21769 1529 --
NM_016083chr683896 3651 3578 2511 2467 1161 267 179 1298 1600 23866 3109
NM_016089chr35738 611 570 150 107 11483 11638 --
NM_016131chr252378 2192 2150 595 65 21752 299 --11943
NM_016132chr1593018 2332 1299 1243 1095 807 631 251 118 13224 ----
NM_016133chr231462 611 196 --1208 --
NM_016206chr3127666 6021 5945 3303 3211 2961 2585 2059 1227 1099 831 338 27224 3520 28622 3158 38129 2208 40
NM_016217chr672580 1097 850 652 377 348 318 21112 762 ----
NM_016221chr551921 900 588 402 324 1890 2234 49 --
NM_016234chr1051008 835 730 181 164 --2620 117 --
NM_016248chr13103983 3362 2911 2850 2762 2661 1434 1110 1019 240 2986 789 ----
NM_016260chr2127649 6606 6166 4936 4930 2773 2679 2032 1396 1031 623 462 26334 1020 47033 6533 2434 1213 --
NM_016264chr191211 --166 1491
NM_016271chr1871916 1868 1820 1550 1466 789 707 ------
NM_016275chr392794 2198 2113 1775 936 555 384 152 25 1909 1648 --
NM_016277chr621139 463 21033 55 2664 457 --
NM_016287chr162058 1573 1382 555 239 143 11701 ----
NM_016297chr282869 2515 1506 852 388 343 247 87 22735 1009 22612 819 --
NM_016315chr23587 514 436 ----11872
NM_016322chr983250 2503 374 285 226 208 156 123 ----12261
NM_016340chr521346 151 1916 --1287
NM_016353chr832268 965 346 ----1292
NM_016356chr642876 2348 1944 754 22680 541 1427 --
NM_016395chr1551908 1544 1331 695 71 21462 765 11377 --
NM_016422chr1172478 2237 2185 2030 1050 208 160 1100 1372 11144
NM_016442chr562130 1991 1966 1760 681 432 ------
NM_016485chr651997 1672 1469 489 238 11584 21480 258 --
NM_016507chr1762330 2040 2019 1208 1164 1007 12625 ----
NM_016530chr1594036 3910 3877 3484 2711 2646 1147 1019 125 11243 ----
NM_016531chr484160 3847 3477 3419 1627 1113 303 255 14045 14092 --
NM_016542chrX3587 514 142 155 --11141
NM_016559chr331024 611 94 --1507 --
NM_016577chr3114533 4487 4274 4227 4211 4189 2816 540 415 366 282 1931 11466 --
NM_016591chr53966 851 414 11189 --192
NM_016626chr1841493 1213 143 78 11403 --2231 175
NM_016631chr212801 81 122 --1687
NM_016654chr1551280 1219 319 280 133 1937 1430 --
NM_016824chr1041922 1848 651 609 ----11343
NM_016952chr1164086 4035 3620 3594 3034 2636 --24047 3153 --
NM_016953chr2146107 5213 4606 4019 2398 2280 2179 2075 1769 1454 1396 1303 1049 552 55311 5193 5087 4183 3767 11472 --
NM_017412chr851247 515 495 348 300 ----1276
NM_017415chr561718 1492 1469 1270 325 290 23848 1071 23952 1631 --
NM_017420chr14123853 3625 3188 2968 2917 2800 2762 2436 1433 1100 615 57 33160 2880 2521 23400 2699 --
NM_017423chr451739 213 150 113 73 11966 ----
NM_017447chr2174165 3783 3558 1113 1061 990 333 21657 1354 --11136
NM_017489chr851173 1015 982 279 254 --1223 --
NM_017540chr563080 2762 2063 2057 2050 827 22852 1195 12402 --
NM_017548chr371864 1835 1812 661 457 421 269 --11531 --
NM_017596chr1104695 4451 4419 4378 4348 3400 2842 1322 877 385 2471 297 24629 3303 --
NM_017626chr1051245 709 311 209 42 --1550 --
NM_017628chr465274 5254 3454 2074 2065 1695 24234 3514 11308 --
NM_017633chr623013 2397 11403 11481 23129 1205
NM_017637chr9129110 8283 8131 7836 7310 6632 3765 2698 1660 1487 1342 878 58909 7765 6727 6350 1252 28549 808 --
NM_017643chr1782850 2741 2306 2095 1930 1217 710 396 12191 12520 12000
NM_017644chr375008 4579 3173 1753 1715 469 59 33555 3442 823 14753 14046
NM_017658chr1464375 3849 3461 1863 1760 191 34148 3604 81 22989 1556 --
NM_017660chr1993309 2678 2556 2280 972 743 557 547 412 1796 12407 11111
NM_017709chr183846 3566 3503 3247 2941 1609 588 34 34029 1603 986 ----
NM_017719chr361603 1560 911 553 393 256 22549 927 11829 --
NM_017737chr152074 1697 882 791 663 --12174 1380
NM_017741chr4102815 2268 1877 1114 1020 869 602 276 143 99 12174 --1374
NM_017744chr192026 1963 1787 1763 1737 920 518 394 170 ------
NM_017754chr675072 5041 4818 4499 1089 989 751 11053 23671 2013 --
NM_017762chr1562405 950 877 721 640 403 11668 --11567
NM_017769chr1442962 2359 2230 462 11117 21175 245 --
NM_017770chr6102605 2386 2331 2189 1900 897 552 260 118 95 11127 ----
NM_017776chrX9528 487 405 350 322 238 154 116 98 ------
NM_017791chr1441168 1147 629 591 31616 423 154 11581 --
NM_017799chr1461873 1850 1737 1447 306 22 ----1717
NM_017801chr342570 1940 269 98 ----22633 2366
NM_017811chr952587 2134 2075 1945 612 32425 452 95 --1272
NM_017813chr8105795 5289 4700 4587 4434 4156 1544 1522 1304 1090 --15407 13844
NM_017824chr1042635 2125 1041 233 --22509 255 12010
NM_017845chr42571 82 ----1764
NM_017848chrX43974 3610 3058 1250 13300 11297 1412
NM_017873chr963185 3174 3149 2897 2802 881 1641 12743 --
NM_017919chr9175770 5291 4827 4647 4450 4008 3731 3611 2148 2032 1982 1870 1603 1219 672 505 284 45238 5204 4557 1619 45678 5514 2262 1923 --
NM_017943chr143868 822 272 2671 279 2213 148 --
NM_017944chr1153078 2926 1102 634 301 ----1466
NM_018003chr1551992 1734 1638 998 778 --1264 --
NM_018017chr1072539 2062 1102 996 877 508 306 ------
NM_018023chr352027 1645 1478 1239 176 1703 11346 11578
NM_018027chr1072977 2787 2722 1116 825 259 90 11307 ----
NM_018030chr1831000 975 784 ----152
NM_018045chr192926 2684 2621 2319 2081 1917 1024 327 271 52728 1961 959 589 41 21904 578 --
NM_018046chr53405 188 24 --21728 1354 --
NM_018047chr54686 375 60 50 ------
NM_018048chr1271870 1573 1309 1268 504 260 118 ------
NM_018084chr232443 622 182 2949 633 12922 1454
NM_018092chr1671402 1389 1192 1082 440 379 178 1563 ----
NM_018121chr1082842 1099 766 587 535 513 318 29 ------
NM_018126chr431574 567 165 --11167 --
NM_018131chr102850 716 ----1728
NM_018133chr352201 2184 1854 1433 550 1418 1674 21826 22
NM_018179chr12--2457 89 --1162
NM_018184chr3112185 2118 2018 1711 1671 1328 853 466 299 274 241 --21820 98 --
NM_018196chrX3935 391 84 21108 867 1253 --
NM_018200chr1542564 2248 1726 887 21844 1690 1378 11752
NM_018227chr443191 2703 2207 113 22416 922 32433 1952 805 11142
NM_018243chr463925 3786 2677 2552 481 383 --1983 11432
NM_018257chr2052162 2120 1966 593 564 22348 872 ----
NM_018293chr362934 2283 2130 1058 399 201 12713 --22252 1965
NM_018307chr172907 790 --1923 1937
NM_018317chr43337 103 68 ----1137
NM_018323chr441797 1417 101 71 21494 628 ----
NM_018339chr921557 125 1587 1571 1172
NM_018340chr1685069 3601 3136 1635 1432 1122 972 138 --13766 --
NM_018351chr1283577 1811 1378 1253 1062 964 487 118 23674 3206 --11476
NM_018364chr183986 3157 2519 1547 1468 909 844 826 33300 2919 627 13812 --
NM_018373chr1493943 2197 1478 1382 1204 1121 999 823 129 25784 4785 46179 1632 1169 751 --
NM_018374chr754893 1058 739 639 595 31101 850 103 13613 11663
NM_018398chr3372 65 54 1297 ----
NM_018403chr333211 2853 507 33189 2823 1321 33178 2950 772 --
NM_018425chr1082519 2383 2275 1833 445 417 393 310 ------
NM_018429chr522340 2233 12278 12508 12517
NM_018439chr1852596 1719 1067 1006 893 21635 549 ----
NM_018440chr8137913 7471 7260 6442 6341 6242 6107 5691 3440 3025 2664 1988 785 36055 5910 84 47794 5412 1449 1315 27783 846
NM_018444chr832170 2126 1790 1502 ----
NM_018452chr6_random103297 2779 2650 1377 1349 1209 1145 1039 356 121 33246 1294 773 ----
NM_018482chr852254 1969 1679 875 588 32190 508 108 11665 12247
NM_018489chr142107 1718 897 149 2846 398 --1868
NM_018490chr1181741 1722 1482 1371 1292 1228 592 584 21344 1305 160 --
NM_018566chr174573 3959 528 406 299 204 109 --11249 --
NM_018638chr12125543 5194 4771 4309 4299 3950 3489 1726 1670 302 224 63 24729 4694 1644 --
NM_018695chr562224 2195 2157 1809 907 259 1838 ----
NM_018698chrX31894 1879 1636 1773 --1280
NM_018841chr183498 3249 2976 2705 817 730 715 379 ------
NM_018898chr572133 1642 936 863 641 569 545 22178 247 ----
NM_018899chr572133 1642 936 863 641 569 545 22178 247 ----
NM_018900chr572133 1642 936 863 641 569 545 22178 247 ----
NM_018901chr572133 1642 936 863 641 569 545 22178 247 ----
NM_018902chr572133 1642 936 863 641 569 545 22178 247 ----
NM_018903chr572133 1642 936 863 641 569 545 22178 247 ----
NM_018904chr572133 1642 936 863 641 569 545 22178 247 ----
NM_018905chr572133 1642 936 863 641 569 545 22178 247 ----
NM_018906chr572133 1642 936 863 641 569 545 22178 247 ----
NM_018907chr572133 1642 936 863 641 569 545 22178 247 ----
NM_018908chr572133 1642 936 863 641 569 545 22178 247 ----
NM_018909chr572133 1642 936 863 641 569 545 22178 247 ----
NM_018910chr572133 1642 936 863 641 569 545 22178 247 ----
NM_018911chr572133 1642 936 863 641 569 545 22178 247 ----
NM_018945chr6113585 3577 3334 3070 2974 2878 2616 2257 1331 1191 517 --11010 12565
NM_018948chr161289 1111 311 292 173 85 ----1375
NM_018951chr741212 1065 998 911 1372 ----
NM_018958chr1573486 2700 2603 1376 1200 883 555 12965 ----
NM_018963chr2171531 1411 1333 1261 1247 959 54 11272 ----
NM_018976chr122611 276 125 --156
NM_018977chrX2258 223 21090 1029 1213 --
NM_018999chr1073542 3525 1755 1509 1377 711 275 --23020 1580 --
NM_019000chr561581 1256 1207 1159 1061 314 ------
NM_019001chr3114718 3860 3318 3010 1878 1762 1369 1315 834 557 233 --44121 1636 1605 258 11916
NM_019004chr782433 1964 1889 1746 1655 614 347 107 --1436 1803
NM_019022chr1863241 3003 2707 1184 1146 991 --13209 --
NM_019041chr662284 2000 1740 935 462 414 --1349 2395 232
NM_019050chr492293 2005 1890 1592 1442 1408 832 456 425 1166 21733 1393 175
NM_019063chr272155 1737 1535 884 852 738 327 ------
NM_019072chr574247 3188 2712 890 779 162 135 2196 22 ----
NM_019084chr103645 215 71 11940 --1508
NM_019094chr1263714 3073 1455 1164 1097 193 32410 449 405 ----
NM_019098chr851780 1289 698 526 121 11486 ----
NM_019117chrX72998 2379 1386 1181 962 470 243 ------
NM_019593chr2082777 2479 1949 616 595 544 259 246 22962 2158 13131 --
NM_019596chr2182991 2455 2422 2361 795 741 623 530 12538 11816 --
NM_019610chr141539 490 240 28 ----1538
NM_019885chr2112977 2646 2602 2486 2476 2061 2041 1060 707 145 65 22117 902 ----
NM_019895chr33393 369 215 1881 1973 --
NM_019903chr1041922 1848 651 609 ----11343
NM_020116chr491717 1537 1390 1127 657 573 538 301 284 11218 11838 --
NM_020122chr2116051 5397 4801 4601 4447 4335 4008 3691 2288 1604 757 44999 4691 1710 465 25980 4897 --
NM_020141chr162408 2047 1976 795 305 224 1155 22422 2328 174
NM_020144chr741818 1653 489 275 2189 75 11669 --
NM_020177chr583027 2945 2840 2627 2600 2573 546 481 ----12857
NM_020180chr1821129 82 21102 879 ----
NM_020182chr2073474 3036 2815 1211 981 900 372 33094 2629 2410 ----
NM_020193chr1141021 442 60 31 1178 1967 --
NM_020198chr1771467 1350 1005 499 425 388 122 ------
NM_020205chr162907 2883 2679 1153 1038 640 23080 942 23194 598 --
NM_020239chr15544 269 260 92 36 1885 2364 356 --
NM_020245chr694759 4382 3911 3646 3525 1755 1425 1286 128 11440 13769 --
NM_020310chr1772826 2673 2593 1844 1114 1108 670 21091 677 12814 --
NM_020337chr473063 2989 2496 2451 2030 926 645 --13136 --
NM_020341chr2041856 1370 285 103 ----11757
NM_020342chr282502 1934 1865 862 632 564 361 237 --1620 --
NM_020357chr351682 1281 601 534 387 ----11430
NM_020390chr3144835 4409 3910 3416 3394 3126 2975 1723 1691 1484 718 479 339 326 24717 4282 ----
NM_020420chrY71875 1812 1643 1514 426 184 82 1633 ----
NM_020424chr163145 113 57 ----1648
NM_020443chr1126676 5712 5259 5029 4940 4303 2567 1878 1697 545 451 308 36085 1731 1104 46256 4978 2413 811 --
NM_020453chr452101 2048 1903 1483 480 11544 ----
NM_020463chr211495 ----1387
NM_020465chr1671782 1407 1272 1257 1251 642 427 ------
NM_020466chr6115029 4960 4830 4108 3255 1393 1210 1146 684 402 279 21081 82 1860 1501
NM_020473chrX61811 1688 1495 465 262 227 11532 1566 --
NM_020546chr533034 2778 596 11114 --22997 1216
NM_020638chr123503 249 236 31983 1697 676 ----
NM_020644chr112772 255 ----1817
NM_020666chr51942 ----1806
NM_020673chr20127742 7592 7544 7234 6814 6265 5553 4761 4754 2778 1173 734 ------
NM_020676chr35836 319 234 182 125 1212 --1655
NM_020686chr1683093 2490 2321 1905 769 739 646 31 22622 870 --1227
NM_020698chr1263135 3119 2191 886 754 54 12962 32562 992 279 --
NM_020699chr175172 5068 4743 4266 3587 3566 1511 1737 34930 406 311 --
NM_020711chr252091 911 476 449 433 12302 --1682
NM_020717chrX114883 4786 4709 4246 4220 3909 3857 3657 3490 1802 176 34401 1380 1327 13510 --
NM_020718chr16166188 5679 5536 5229 4895 2416 2368 2128 1295 918 741 500 353 346 202 54 24931 4104 34078 1768 1521 14741
NM_020724chr492620 2517 2223 1894 1877 704 674 655 639 11808 21627 668 --
NM_020727chr2183685 3424 1620 1420 626 595 492 399 --1672 --
NM_020742chrX52731 2592 2018 1840 174 31830 920 367 ----
NM_020752chr1072681 2655 2549 2353 328 319 34 12856 --22161 1144
NM_020766chrX43462 1546 1362 563 13506 --12870
NM_020768chr552918 2561 2419 1145 595 22935 2101 --1175
NM_020769chrX5996 375 330 309 80 --2619 93 --
NM_020772chr17138055 7517 6991 6168 6152 6132 5957 5270 3383 3049 2714 1887 992 32436 460 399 33280 1101 524 16282
NM_020774chr18115968 5610 5144 4737 4476 4261 4242 1993 1458 1141 156 15491 12382 25237 4581
NM_020776chr1873085 2782 2093 1999 666 389 373 22229 635 ----
NM_020783chr1842201 830 778 145 1845 --1437
NM_020787chr1751521 967 177 156 55 --1319 --
NM_020796chr553043 2435 2083 952 793 42859 1191 810 779 12805 --
NM_020802chr1132365 2230 389 31278 1255 944 1403 23230 2461
NM_020810chr1453475 2587 2449 1330 146 --22738 101 23244 936
NM_020825chr1683793 3594 3321 3225 936 903 445 28 13453 13052 159
NM_020841chr1233322 3308 3222 23591 115 --1270
NM_020859chr443335 1009 590 462 12603 ----
NM_020861chr62893 26 --1178 2464 242
NM_020871chrX22481 1669 ----1221
NM_020872chr33346 255 201 --1158 --
NM_020873chr3------1283
NM_020899chr1732547 953 854 1768 2422 49 2998 364
NM_020918chr1063671 3501 3382 2939 887 808 --23356 1175 12682
NM_020921chr1482836 2811 2449 1089 970 919 393 83 32688 1457 553 1151 12823
NM_020925chr151480 1439 1416 1308 230 2920 81 ----
NM_020948chr163010 1448 770 569 507 297 1402 13568 --
NM_020956chr19114596 3890 2986 1873 1795 1717 1639 1148 335 198 97 24199 122 14461 --
NM_020964chr1844840 3690 3593 3184 2958 27 23356 420 13346
NM_020993chr1252348 1977 1812 798 205 52536 1011 770 146 136 ----
NM_021005chr153913 886 217 1732 ----
NM_021020chr8113497 3186 2368 1226 1064 833 774 605 534 281 87 22222 122 22153 782 --
NM_021032chr361680 547 342 283 256 176 ----2415 82
NM_021033chr1393277 2882 2784 2545 924 861 752 745 59 32673 1345 640 13447 --
NM_021061chr884243 3725 3464 3406 2795 1657 943 531 ------
NM_021072chr5102670 2469 2321 2057 1892 1801 835 489 247 43 1879 ----
NM_021083chrX62584 2341 1141 872 677 183 33289 3114 2424 ----
NM_021097chr262440 2280 2149 743 639 449 12485 2817 265 --
NM_021101chr332280 2208 944 1143 1630 12072
NM_021136chr141130 ----1564
NM_021148chr762068 1644 428 371 253 80 ------
NM_021159chr451302 1206 353 330 290 1505 --1167
NM_021163chr763541 3292 1474 811 428 27 23093 2394 --13468
NM_021167chr742486 1873 729 424 11068 --2827 522
NM_021183chrX21726 1705 3365 232 44 1116 --
NM_021205chr172552 1943 1820 1157 535 461 261 --1879 --
NM_021238chr1272107 1940 1652 1608 578 392 233 11728 --11479
NM_021252chr1031402 549 142 1288 164 --
NM_021255chr1453581 1355 463 334 227 33588 3308 796 --13879
NM_021622chr1032395 582 145 1211 --1465
NM_021627chr321139 844 --2880 838 --
NM_021629chr374997 4988 3733 3292 3165 1820 142 --21917 1073 14550
NM_021638chr485040 4904 4255 4096 3099 1436 1063 376 ------
NM_021647chr464132 4043 3845 3049 339 85 11699 13713 12895
NM_021813chr6105878 5346 5121 4133 4003 3983 3632 2215 1643 339 1881 --13901
NM_021814chr631388 1136 147 11543 ----
NM_021911chr565558 4490 3640 3528 2001 1931 --25212 3841 --
NM_021912chr1523613 1539 2704 475 12877 14111
NM_021954chr1333623 2871 2670 22684 573 23168 2920 --
NM_021960chr172806 2530 2190 1977 981 830 458 12297 11951 --
NM_021961chr11166805 6758 6285 5689 4829 2975 2798 2634 2133 1863 953 870 606 574 291 149 --47091 5846 701 97 14783
NM_021962chr1762560 2541 2504 2221 2161 90 199 12116 --
NM_021964chr3126442 6016 5753 5498 5334 4990 4895 4284 4200 2338 1311 1075 14379 ----
NM_021977chr6103917 3073 2977 2949 2744 2462 2410 1513 805 322 ----13352
NM_021998chrX51174 1074 266 104 62 1384 ----
NM_022048chr15135771 5594 5230 4994 4976 4916 4390 4214 2508 2117 1295 943 683 75433 4897 4168 4054 1071 389 310 15872 --
NM_022103chr1951312 1086 959 802 335 1184 --1433
NM_022114chr1104795 4386 3430 3250 3159 738 680 604 586 82 33638 1013 158 ----
NM_022121chr641244 1008 925 114 1992 --185
NM_022166chr1685499 4490 2499 2273 1103 1054 981 560 63989 1257 956 934 501 395 174 --
NM_022170chr751779 1732 1649 1578 1259 ------
NM_022351chr8113794 3741 3305 3021 2572 2494 1376 416 391 269 253 22925 1223 11090 12665
NM_022368chrX1278 151 --1120
NM_022444chr751543 432 246 144 100 2547 221 11406 --
NM_022456chr12227382 6886 6877 6479 5860 5584 5556 5507 5406 5240 5081 4897 2564 2483 2356 2202 1989 1794 1531 1513 255 154 67746 5807 5439 5433 5337 1672 26752 5973 32928 1071 1038
NM_022458chr773028 2663 1925 915 343 116 36 --42323 1945 633 371 --
NM_022459chr13105289 5053 4589 2364 1486 1449 1379 992 580 471 46097 5548 4624 3933 ----
NM_022462chr19123281 3130 3116 2965 2530 2391 2308 1394 1280 1200 794 598 13766 13203 --
NM_022469chr162978 2789 1152 857 641 230 33003 2262 2193 2583 324 13058
NM_022474chr1462424 2248 1979 991 393 281 12497 22259 300 --
NM_022476chr1651118 696 350 306 164 11092 ----
NM_022482chr2062411 2027 1939 1926 346 189 1944 12591 --
NM_022491chr1283588 3276 2870 2669 1414 1376 973 312 --32466 2433 907 --
NM_022648chr2114668 4388 4270 3022 1748 1561 1525 1254 837 818 343 34362 530 258 14542 184
NM_022658chr1241024 988 923 855 11092 ----
NM_022716chr153054 2887 2743 2536 428 ----22630 2622
NM_022726chr631704 469 43 ----11171
NM_022735chr151833 1655 1289 1283 611 2470 401 ----
NM_022739chr1741108 943 253 239 1784 ----
NM_022745chr162872 2655 2335 631 481 463 21013 946 --11096
NM_022753chr152333 1793 1122 301 133 32418 2127 330 2993 597 --
NM_022758chr62778 103 1232 --32890 2693 172
NM_022763chr342282 565 187 81 32735 2154 1073 ----
NM_022780chr251853 1792 1570 1404 380 21893 1248 ----
NM_022781chr961318 1270 1180 1104 842 805 12127 ----
NM_022784chr153731 330 120 1390 --1131
NM_022802chr1051535 1435 1370 608 388 --11655 --
NM_022826chr22225 211 11126 1800 --
NM_022831chr141764 1697 1553 1238 21714 1160 ----
NM_022843chr1321299 294 --11129 11110
NM_022844chr163993 788 354 3608 238 210 --1268
NM_022893chr252832 1195 1055 777 357 --1814 --
NM_022894chr241570 1307 608 495 21464 1185 ----
NM_022898chr1484413 4076 1469 1090 1082 1064 762 170 33454 1922 1792 --11814
NM_022900chr72980 909 124 129 --
NM_022910chr1671782 1407 1272 1257 1251 642 427 ------
NM_022977chrX42114 904 887 70 11998 1924 12681
NM_023000chr1421136 58 --21428 50 --
NM_023001chr1421136 58 --21428 50 --
NM_023012chr122571 201 ----1188
NM_023016chr252150 1995 1780 1125 1026 22682 2446 11876 --
NM_023076chr1653026 1152 393 263 241 1255 12141 --
NM_023105chr821808 658 11592 1388 1857
NM_023106chr821808 658 11592 1388 1857
NM_023110chr821808 658 11592 1388 1857
NM_023111chr821808 658 11592 1388 1857
NM_023923chr1113415 2811 2558 2346 1370 1271 831 458 447 275 215 33659 427 392 11120 22444 905
NM_023929chr852170 2039 1961 557 353 --11744 --
NM_024007chr563011 2658 2084 933 768 325 2729 264 ----
NM_024086chr17103648 3235 2812 2716 2600 2446 1192 650 533 242 22919 130 1253 --
NM_024294chr62778 103 1232 --32890 2693 172
NM_024295chr852054 2019 1599 786 344 --1145 --
NM_024312chr1221399 602 156 11444 1499
NM_024332chrX160 41330 1286 635 194 1338 1206
NM_024345chr9105793 5685 5438 5211 5123 3939 2236 2158 1766 1388 44253 3810 442 417 11742 --
NM_024511chr483137 2848 2498 2416 1302 762 667 659 22931 1322 23223 1382 13496
NM_024590chr441434 1344 68 28 1734 11534 --
NM_024594chr541774 1287 1257 1187 --1209 --
NM_024596chr884836 3401 3369 2035 1891 1774 1396 1319 25415 1030 --33299 1465 1126
NM_024607chr8114456 3955 3276 3025 2951 1686 1455 1331 1176 1053 401 2729 165 12884 11783
NM_024639chr692960 2821 2065 941 756 717 482 449 282 41031 691 596 433 ----
NM_024646chr183744 3651 3326 2933 2837 2523 305 183 --11088 12433
NM_024665chr3104450 4346 3800 3722 3588 3470 3379 3029 1114 94 1689 11473 --
NM_024689chrX81865 1787 1604 1552 1311 449 232 129 ------
NM_024713chr1551197 1166 648 567 159 --21612 1347 --
NM_024715chr561936 1829 1565 688 371 162 ------
NM_024740chr11104001 3612 3534 3365 2569 1445 483 346 305 212 11266 23521 3150 --
NM_024744chr232422 2252 2114 11975 12458 --
NM_024749chr152298 2069 1927 917 783 11791 1208 --
NM_024770chr2135734 5321 5199 2520 2452 2445 2016 1933 1814 1734 988 748 371 32616 2373 461 24711 2116 --
NM_024817chr15105997 5890 5396 4839 4604 4210 1563 975 446 390 45718 4306 4027 848 ----
NM_024830chr552096 1822 1709 1663 428 11354 32043 879 528 --
NM_024834chr1051873 1473 1462 704 589 ----11380
NM_024838chr10152 1882 1441 1341
NM_024884chr14104526 4471 3658 3103 2887 1332 650 433 241 94 43701 1580 1438 623 14463 --
NM_024911chr12679 224 1866 2817 298 --
NM_024920chr421553 108 ----11202
NM_024941chr571305 1075 1011 984 976 529 503 --11069 --
NM_024942chr1021508 524 21367 63 --1167
NM_024946chr163691 217 91 --21810 552 --
NM_024949chr4105034 4452 4257 4219 4058 4009 1327 1198 854 619 74582 4429 4196 3779 3600 3240 1411 ----
NM_024953chr1272800 2485 2364 2172 459 262 187 1521 1752 --
NM_024989chr286858 6557 5641 2398 2095 1986 1310 895 --23042 1710 47526 7247 2738 1248
NM_024991chr1073266 2649 2642 739 536 411 58 42024 1306 394 150 ----
NM_025027chr1961211 424 354 231 148 54 --1238 --
NM_025057chr1431064 400 239 ----11018
NM_025106chr141889 1545 662 288 1516 1276 --
NM_025146chr342750 2712 1884 647 12019 1912 1849
NM_025151chr852151 1927 1357 806 769 11466 --1528
NM_025154chr711361 --1469 1413
NM_025160chr1113640 3291 3034 1376 1269 1257 1154 1141 738 568 137 23784 3176 11410 --
NM_025164chr1121878 611 22078 232 --157
NM_025179chr1104991 4985 3878 3774 1831 1807 1009 665 235 118 24716 323 1874 --
NM_025180chr362818 2706 2611 2484 1004 221 22675 2220 1936 --
NM_025191chr193121 2660 2516 2331 1409 866 782 626 47 23320 214 12219 --
NM_025196chr44791 656 114 102 ----133
NM_025208chr11112294 2232 2092 1847 885 852 834 686 359 69 28 --12052 12305
NM_025221chr421292 977 ----11414
NM_030621chr1474246 2782 1256 1207 677 256 66 23594 2665 21012 376 --
NM_030625chr1052304 2174 1754 564 516 11642 ----
NM_030627chr553162 1454 1286 1244 828 2876 839 1937 --
NM_030634chr12307 124 11835 --11934
NM_030647chr795575 4831 4552 4249 2207 1865 1353 1145 134 25955 5379 35348 4895 1895 --
NM_030648chr4154927 4793 4597 4509 4500 4044 3922 3629 3387 1793 1252 1150 1100 1086 276 ----13411
NM_030650chr254279 3156 3097 2737 949 33512 2727 227 --23172 1573
NM_030674chr12155718 5279 5155 5140 4777 4534 4200 3855 3716 3687 2328 1726 1190 1126 1084 21472 822 ----
NM_030751chr1041749 1310 288 214 --2458 199 --
NM_030751chr1041749 1310 288 214 --2458 199 --
NM_030761chr111855 42615 2411 715 662 --32164 2126 1690
NM_030773chr2031798 1576 579 21689 84 11732 --
NM_030799chr532179 497 274 11638 --1596
NM_030806chr1149076 8309 8274 7828 6770 5807 5686 3503 2256 1727 1650 1170 1007 389 39040 7849 2781 29240 1943 27331 6624
NM_030816chr1112893 1445 1407 1365 1104 875 768 580 492 425 51 53660 3482 3066 1434 863 12627 --
NM_030918chr1145274 5214 5177 4670 4354 4055 2049 1770 947 941 579 529 178 86 14626 25023 4344 11064
NM_030964chr583228 2994 2659 2309 1267 941 475 39 --22856 2338 --
NM_031243chr741869 931 363 107 ------
NM_031284chr154923 280 241 108 1229 ----
NM_031305chr441885 1783 308 246 21702 1302 ----
NM_031314chr1472043 1828 1781 1469 750 680 655 11551 ----
NM_031362chr2112677 2483 2325 2219 2076 1997 1879 1757 1109 358 315 32174 2037 182 ----
NM_031365chr2102813 2619 2461 2355 2212 2133 2015 1893 494 451 32310 2173 318 ----
NM_031366chr2102813 2619 2461 2355 2212 2133 2015 1893 494 451 32310 2173 318 ----
NM_031411chr572133 1642 936 863 641 569 545 22178 247 ----
NM_031422chr18123 ----1472
NM_031427chr14165913 5405 5319 5291 5151 5084 4984 4865 4237 2002 1951 1894 1628 1173 298 289 35236 3703 2356 24335 1725 15428
NM_031445chr263450 3089 2284 607 474 289 1589 --1365
NM_031468chr7127926 7437 7367 6602 6592 6435 3258 2368 2244 2222 528 245 56499 6399 2539 1002 140 ----
NM_031469chr6144143 4049 4018 3955 3844 3665 3478 3252 3101 2749 1549 620 580 182 --1958 1367
NM_031483chr2073585 3016 2992 2583 2480 844 400 13160 23285 2643 --
NM_031490chr1661688 1531 668 442 354 187 11246 1134 --
NM_031844chr193882 3622 2839 2772 2515 1401 1101 526 42 ----1796
NM_031845chr253247 2862 1447 428 95 23436 348 ----
NM_031847chr253247 2862 1447 428 95 23436 348 ----
NM_031849chr572133 1642 936 863 641 569 545 22178 247 ----
NM_031857chr572133 1642 936 863 641 569 545 22178 247 ----
NM_031860chr572133 1642 936 863 641 569 545 22178 247 ----
NM_031992chr751779 1732 1649 1578 1259 ------
NM_032012chr9125322 5000 4907 4465 3862 3597 3535 3236 1525 546 418 355 44960 3952 3200 106 22076 1338 13335
NM_032041chr862713 2687 2503 2116 1793 391 52162 1810 1776 699 333 ----
NM_032042chr562638 2167 2096 1034 919 693 --22145 1758 --
NM_032047chr342235 396 60 45 --1973 --
NM_032102chr1153119 2121 2009 1146 853 32350 1895 429 --12463
NM_032153chr362713 2228 2001 746 285 168 1317 --11963
NM_032160chr1874320 3113 2845 2650 1203 986 735 13072 --11447
NM_032189chr1384989 4921 4850 4262 4058 3920 1528 525 35099 1785 1417 ----
NM_032199chr1063576 3170 2862 2637 1053 430 13435 ----
NM_032208chr273683 3626 2951 2482 1396 883 806 53224 2619 752 530 94 23505 1277 --
NM_032217chr451298 908 531 352 310 ------
NM_032221chr2051912 1709 1658 1585 590 --21971 1852 --
NM_032229chr1351196 982 871 232 117 1152 1219 --
NM_032281chr1962457 2061 1137 594 456 392 33066 2792 893 ----
NM_032288chr352212 2077 2005 1580 804 --1373 --
NM_032291chr151707 1406 1341 538 321 ------
NM_032321chr263233 2250 1307 1063 907 754 --1509 1692
NM_032352chr1441055 1028 443 320 11383 ----
NM_032373chr10105612 5581 5081 4689 4395 3995 1594 1335 1307 203 24734 4356 11130 14093
NM_032438chr651236 442 426 397 251 1104 ----
NM_032439chr1031693 1218 436 11547 1679 --
NM_032441chrX41125 1058 1038 241 1180 --1484
NM_032445chr1542561 960 350 196 21770 986 ----
NM_032446chr593891 3824 3198 2400 1497 1428 933 128 33 13205 --12760
NM_032457chr463569 3065 2896 2574 2405 64 12824 --1930
NM_032491chr121174 ----162
NM_032499chr1561704 1653 1456 1409 636 402 2497 457 11714 11128
NM_032509chr892618 2542 1900 1862 1585 992 649 578 516 ------
NM_032558chr921411 1302 3592 547 271 ----
NM_032682chr383329 3301 2727 2590 1350 948 304 168 ------
NM_032711chr1754033 3744 3028 942 928 --14325 --
NM_032778chr353105 3052 2548 1094 394 2596 442 13200 --
NM_032801chr1152302 804 671 633 60 22571 442 ----
NM_032811chr1172090 1376 1312 525 270 160 55 1792 12021 1810
NM_032826chr7135080 4458 4218 3853 2026 1928 1728 1315 1304 850 502 184 23 24138 1076 1947 --
NM_032828chr1984824 4680 4306 4219 3826 3203 468 354 13921 1496 --
NM_032833chr131069 998 868 2661 358 12343 12092
NM_032837chr1742121 1599 398 337 1271 ----
NM_032859chr1373817 3188 3152 1303 849 351 110 21214 1044 2965 559 --
NM_032870chr61141 ----196
NM_032873chr1153613 3266 842 529 249 21473 76 24444 4296 --
NM_032876chr146742 574 525 506 419 183 1143 11865 --
NM_032968chrX164002 3649 3400 3082 2837 2678 1654 1629 1508 1176 1069 944 827 657 415 131 1965 1144 --
NM_032969chrX164002 3649 3400 3082 2837 2678 1654 1629 1508 1176 1069 944 827 657 415 131 1965 1144 --
NM_032973chrY143994 3641 3396 3077 1648 1628 1508 1176 1069 944 827 657 415 131 1965 1144 --
NM_032975chr1863600 3337 935 696 432 179 32717 617 367 22316 413 13234
NM_032978chr185778 763 449 440 300 2820 366 1478 --
NM_032979chr185778 763 449 440 300 2820 366 1478 --
NM_032980chr1863600 3337 935 696 432 179 32717 617 367 22316 413 13234
NM_032981chr185778 763 449 440 300 2820 366 1478 --
NM_033020chr144383 1906 1388 906 33484 475 71 34803 1302 1211 11348
NM_033083chr393020 2854 2827 2509 1255 996 979 429 223 13200 1351 --
NM_033103chr1931057 169 104 ----1128
NM_033132chr1382079 2025 1930 1465 607 541 146 91 ------
NM_033135chr11112294 2232 2092 1847 885 852 834 686 359 69 28 --12052 12305
NM_033136chr531731 1579 688 --21508 555 --
NM_033137chr531731 1579 688 --21508 555 --
NM_033138chr741830 1791 666 368 21748 231 --21539 138
NM_033139chr741830 1791 666 368 21748 231 --21539 138
NM_033140chr741830 1791 666 368 21748 231 --21539 138
NM_033143chr463973 3704 3627 3602 1854 1645 13932 21066 148 --
NM_033157chr741830 1791 666 368 21748 231 --21539 138
NM_033181chr683896 3651 3578 2511 2467 1161 267 179 1298 1600 23866 3109
NM_033211chr551856 1479 1448 782 23 160 ----
NM_033221chr922410 798 21914 1769 2347 106 22514 1844
NM_033222chr951425 1405 398 240 132 2936 222 1348 11054
NM_033224chr7137463 7011 5179 4888 3021 2761 2738 2709 2383 1702 1576 1088 1041 47980 5965 5569 1334 16538 25277 298
NM_033274chr582886 2799 2404 1063 853 603 336 71 43390 2552 1175 184 ----
NM_033290chrX103741 3454 3442 2995 2610 2426 1269 878 626 473 ------
NM_033360chr1294411 3506 2966 2940 2914 1732 1328 1137 1009 23945 846 ----
NM_033389chr1764299 3072 3050 3022 1481 238 1684 --24469 3428
NM_033425chr1153075 2576 543 471 203 31102 813 521 ----
NM_033426chr1482968 2200 2182 975 652 418 109 103 ----12413
NM_033505chr2126682 5213 5115 5015 4592 4217 1762 1162 1131 874 236 178 24500 426 36776 5614 1301 --
NM_033644chr552475 1808 917 328 236 11985 21878 1654 --
NM_033645chr552475 1808 917 328 236 11985 21878 1654 --
NM_033656chr2184683 4553 4427 3821 1711 1516 653 141 21998 1897 45391 2170 1914 711 --
NM_052811chr1365289 4984 4568 3994 865 189 34113 1597 1140 ----
NM_052818chr1352003 1823 1447 768 631 --21552 723 --
NM_052847chr19113152 2569 2489 2344 1378 1033 606 339 307 146 127 --2595 575 --
NM_052879chr1242865 810 685 46 13449 13693 --
NM_052885chr1244624 4217 3178 1763 11788 11178 --
NM_052886chr841587 659 428 344 --21748 410 1714
NM_052898chr871866 1840 1558 1251 712 577 252 2599 559 ----
NM_052900chr861513 1452 1265 329 274 154 ------
NM_052905chr241908 1570 1395 478 --11269 1296
NM_052907chr1274062 3352 3005 2906 2898 2805 367 41258 1178 1139 894 23731 279 12975
NM_052917chr2103347 2988 2497 1164 1076 1059 823 651 584 103 ----21041 404
NM_052918chr10103154 3120 3095 2864 2795 1361 1024 638 348 179 1269 23554 2500 --
NM_052932chr1151960 796 719 533 209 1593 12447 --
NM_052937chr872708 2558 1880 1714 933 558 202 --1280 --
NM_052996chr16101771 1502 1470 1361 1322 1228 674 532 325 58 ------
NM_053016chr9158033 7214 6570 6557 5861 5748 4922 4883 3191 3090 2097 2009 1953 1676 59 26402 627 2715 225 22115 335
NM_053043chr786428 5076 5041 3903 2529 1508 1327 81 --24576 4500 25528 4118
NM_053064chr1473037 2573 2208 1982 855 292 124 --1717 11196
NM_057175chr452200 1033 934 737 283 2590 525 12018 --
NM_057178chr17122477 2309 1954 1887 1791 1101 926 903 577 569 316 218 22790 193 11857 1501
NM_057749chr851330 1261 986 475 325 11127 ----
NM_058170chr141565 1063 543 62 --152 --
NM_058241chr232134 1957 1446 1232 1634 --
NM_058241chr232134 1957 1446 1232 1634 --
NM_078487chr9103027 2769 1196 988 920 911 797 621 416 116 12559 12197 23297 764
NM_080597chr1831000 975 784 ----152
NM_080629chr121215 1127 ----11535
NM_080630chr121215 1127 ----11535
NM_080645chr671900 1894 1658 1360 885 392 51 11688 11954 --
NM_080676chr2073212 3182 3146 2814 2538 2432 1098 11147 ----
NM_080743chr672603 2294 2110 1890 1034 456 279 --150 --
NM_080792chr2082277 1599 1412 737 657 532 388 330 1541 22162 1943 11768
NM_080836chr2084566 4529 3154 1887 1616 877 251 35 11895 11271 --
NM_080867chr14115122 4903 4404 3555 3427 3343 3228 1493 925 783 765 14845 --23472 142
NM_080927chr353011 2653 2221 1119 355 ----11140
NM_130391chr932747 1119 558 1732 --13071
NM_130392chr932747 1119 558 1732 --13071
NM_130393chr932747 1119 558 1732 --13071
NM_130435chr1082972 2912 2110 2051 1998 1133 986 155 11805 22934 1866 --
NM_130436chr2162725 2587 2372 2100 653 111 32403 2133 200 ----
NM_130438chr2173302 3164 2949 2677 2200 1230 688 42980 2710 777 30 ----
NM_130811chr2031105 1069 750 ------
NM_130830chr3103777 3641 3260 2707 2571 2532 1262 1252 289 231 23549 1035 13369 11029
NM_130847chr1185923 5830 4945 4827 4287 3753 2218 1397 12302 --1347
NM_133170chr20157859 7134 6637 6538 5965 5588 5149 2936 2754 2694 1768 1533 1465 1376 52 87309 6203 6141 4895 2483 2087 1440 1172 17551 37264 6853 5692
NM_133264chr17143168 3114 3023 2868 2853 2492 1041 880 871 679 245 218 123 81 23663 3419 1740 --
NM_133265chrX43464 2861 2454 789 23043 1114 13146 13640
NM_133330chr443066 2689 2312 388 12714 22864 2810 22613 875
NM_133331chr443066 2689 2312 388 12714 22864 2810 22613 875
NM_133334chr476388 6243 4154 1578 1337 929 608 15464 --11131
NM_133335chr443066 2689 2312 388 12714 22864 2810 22613 875
NM_133367chr663459 2940 2681 1351 1193 34 32105 1105 1000 ----
NM_133370chr463621 3110 2689 2462 1447 875 2197 180 ----
NM_133372chr542638 2562 1156 430 22439 524 --1958
NM_133443chr1661785 1679 1633 1489 747 425 2399 393 ----
NM_133445chr973517 3193 2792 1505 1331 1003 995 33429 2316 1387 ----
NM_133477chr482486 2459 2252 2024 862 680 336 71 ------
NM_133478chr292299 1849 1615 1606 1027 847 832 722 615 22028 97 22366 1596 1930
NM_133482chr521269 378 --11191 21502 503
NM_133496chr174369 4133 3686 3546 1771 1307 576 23677 3386 12847 14068
NM_133499chrX6745 291 230 155 97 89 1167 2988 252 --
NM_133646chr274267 3891 3603 2170 1440 1289 198 45524 4403 4136 715 13988 --
NM_138286chr19143720 3596 3489 3058 2980 2878 1713 1328 1187 656 461 423 289 25 181 14271 12682
NM_138292chr1183291 2434 2412 2394 1362 515 444 348 11127 1698 --
NM_138333chr952277 2090 1866 629 371 ------
NM_138348chr5136631 6103 5917 5907 5542 5501 5238 5197 1457 1348 355 339 108 36339 1569 296 15157 12559
NM_138444chr13224764 4678 4602 4405 4013 3957 3937 3897 3533 3045 1706 1437 1429 1385 1363 1219 773 711 605 239 219 183 21403 230 33123 1728 1312 --
NM_138457chr6102496 2370 1368 1136 1107 637 354 254 242 36 1385 --13387
NM_138459chr673620 3403 2650 1343 255 216 86 13347 22328 1098 --
NM_138468chr274690 4161 4007 2290 1461 662 347 34462 795 749 45798 5027 3921 1559 22388 702
NM_138473chr1265181 4886 4646 1959 1034 835 34824 4238 845 ----
NM_138554chr922674 546 21871 241 32637 1779 986 12181
NM_138576chr1484413 4076 1469 1090 1082 1064 762 170 33454 1922 1792 --11814
NM_138635chr752519 781 751 276 88 32654 1149 884 32931 2562 1167 --
NM_138713chr16157746 7644 7099 6806 6322 6286 5407 5328 5251 3039 2546 2060 555 119 28 32718 2477 2324 15132 --
NM_138714chr16157746 7644 7099 6806 6322 6286 5407 5328 5251 3039 2546 2060 555 119 28 32718 2477 2324 15132 --
NM_138727chr192026 1963 1787 1763 1737 920 518 394 170 ------
NM_138728chr192026 1963 1787 1763 1737 920 518 394 170 ------
NM_138731chr14134286 4272 3991 3815 3355 2960 2612 1541 1491 1419 1399 947 288 54230 3771 3454 2927 819 ----
NM_138782chr552228 2037 1644 139 41 12145 ----
NM_138959chr1116831 6818 6542 6052 5994 5532 5331 5109 2485 1455 270 34674 1738 620 ----
NM_138970chr1441737 1493 974 870 2660 539 ----
NM_138971chr1173675 3522 2837 1543 889 680 293 33420 3328 3239 22856 2445 13813
NM_138971chr1173675 3522 2837 1543 889 680 293 33420 3328 3239 22856 2445 13813
NM_138972chr1173675 3522 2837 1543 889 680 293 33420 3328 3239 22856 2445 13813
NM_138972chr1173675 3522 2837 1543 889 680 293 33420 3328 3239 22856 2445 13813
NM_138973chr1173675 3522 2837 1543 889 680 293 33420 3328 3239 22856 2445 13813
NM_138973chr1173675 3522 2837 1543 889 680 293 33420 3328 3239 22856 2445 13813
NM_138980chr43698 635 149 124 --1582
NM_138981chr44829 766 280 69 1155 --1713
NM_138982chr43698 635 149 124 --1582
NM_139182chr441514 1165 402 208 --11783 --
NM_139279chr293507 3351 3252 2956 2297 2287 430 420 119 33244 887 703 ----
NM_139283chr1242592 1696 798 355 32538 1020 616 1516 --
NM_139316chr73193 120 60 --21088 48 --
NM_139321chr2084056 3347 1596 1439 835 697 636 117 23553 2633 ----
NM_144563chr22315 302 ----1150
NM_144563chr22315 302 ----1150
NM_144567chr182847 2637 2564 2281 1104 626 427 137 --1257 --
NM_144570chr1683041 2588 2410 2262 2111 1971 651 164 22198 40 --1468
NM_144571chr4136839 6440 5097 4694 2769 2324 1617 1427 722 530 441 411 59 --14828 --
NM_144578chr14175311 5097 4857 4674 3972 3956 2215 1423 1399 1368 996 885 820 526 411 294 207 --2837 485 --
NM_144590chr1062903 2539 2257 1172 400 368 32552 2217 416 ----
NM_144632chr252316 905 662 655 383 ------
NM_144642chr341072 514 336 114 --21299 1005 --
NM_144664chr1152491 2298 2151 1746 66 --1426 --
NM_144710chr251498 1355 579 454 176 2462 229 11048 --
NM_144767chr1554626 4530 1856 1680 353 14479 24449 3334 1590
NM_144778chr1322638 2441 31085 938 891 --11969
NM_144949chr242244 830 597 441 22055 1037 22156 963 11744
NM_144963chr852721 2120 1734 568 355 --12297 21796 917
NM_144973chr12115110 4889 4673 3957 3788 3390 1735 1712 881 174 32 31926 1624 427 44713 1821 1085 644 --
NM_145055chr1873834 3195 3011 1397 895 838 291 1126 ----
NM_145115chr71320 12328 22341 1498 12376
NM_145117chr1192877 2337 2165 2131 1314 604 588 459 131 22049 349 12184 --
NM_145119chrX1278 151 --1120
NM_145176chr643371 1188 733 596 11171 12809 12818
NM_145206chr1073226 3127 2937 2517 2174 1005 710 12873 ----
NM_145212chr241836 1203 1187 204 11234 2414 300 --
NM_145251chr1451439 1067 1050 607 260 ------
NM_145259chr2177082 6759 6688 5698 5320 4577 4508 2506 1620 1586 1395 1164 1137 634 626 495 329 36887 5733 5124 --14457
NM_145261chr34563 344 164 116 --1828 --
NM_145284chrX52289 2177 1824 743 231 11658 ----
NM_145307chr1074345 4175 4051 3448 1632 1619 369 34120 3407 1094 32965 1222 295 13035
NM_145320chr793505 3356 3251 3065 2941 2383 1345 236 68 12582 ----
NM_145321chr793505 3356 3251 3065 2941 2383 1345 236 68 12582 ----
NM_145322chr793505 3356 3251 3065 2941 2383 1345 236 68 12582 ----
NM_145341chr1071701 1632 1537 744 694 606 404 21847 1266 --1137
NM_145658chr15--1198 --126
NM_145686chr22722 212 ----1878
NM_145687chr22722 212 ----1878
NM_145753chr351633 1314 312 276 183 188 11502 11708
NM_145799chrX43022 2507 665 181 22706 33 2901 758 12212
NM_145808chr7103152 2762 2483 2304 1154 838 790 424 231 145 1971 22186 2060 12657
NM_147147chr684028 3155 3129 2586 1062 1050 1005 646 24132 3709 13180 11121
NM_147150chr963670 3520 3066 2755 1234 127 43993 2647 612 109 13634 --
NM_147175chrX51756 1525 651 467 236 1391 12106 --
NM_147181chr421292 977 ----11414
NM_147182chr421292 977 ----11414
NM_147183chr421292 977 ----11414
NM_148174chr8102025 2012 1818 1611 1565 1556 896 835 742 316 22129 293 --1217
NM_148957chr1372066 1715 574 527 189 122 116 2392 43 12144 12297
NM_152261chr1262435 2159 1862 1713 398 109 ------
NM_152262chr195745 576 245 161 79 ------
NM_152263chr1136080 5894 5776 5715 5455 4937 4832 4112 3751 2443 1064 471 193 22072 56 24210 725 2621 356
NM_152275chr252301 2127 2037 550 477 --1559 --
NM_152278chrX2603 466 --2565 530 --
NM_152280chr182655 2582 2560 893 806 585 576 89 13511 12315 --
NM_152300chr1741814 662 604 154 11748 --11549
NM_152313chr113530 180 102 1776 --1170
NM_152332chr1472803 2734 2728 2214 2133 496 357 22286 679 ----
NM_152381chr231458 377 36 1110 21375 85 1413
NM_152400chr43667 508 220 --21407 163 --
NM_152407chr543284 2575 283 67 12907 ----
NM_152409chr563117 2899 1001 728 361 233 11391 --11099
NM_152424chrX94754 4733 4081 1458 1228 1190 506 126 107 14326 33834 3813 466 --
NM_152437chr1252038 1840 660 539 59 21514 35 ----
NM_152442chr1241232 1162 329 132 21421 252 1506 1203
NM_152470chr1874178 4144 3598 3225 3021 2969 951 31658 1011 292 33607 2961 1607 --
NM_152519chr241686 707 353 58 31637 1438 838 --11461
NM_152529chr2133721 3708 3356 3283 3161 3046 2834 2814 1486 1441 1297 849 452 34145 3622 1521 13259 --
NM_152542chr441928 877 684 117 21651 703 --1806
NM_152546chr571404 1307 1151 1068 544 326 125 1339 21012 237 --
NM_152556chr762199 1030 767 343 92 41 22111 960 ----
NM_152581chrX71518 1231 1156 565 337 163 70 ------
NM_152594chr1541960 746 549 455 ----11855
NM_152622chr573107 1226 708 542 343 92 44 22161 1176 13120 --
NM_152624chr577275 6987 5656 5360 2301 1415 1313 17223 2978 695 --
NM_152629chr953819 3622 3504 509 365 21017 471 ----
NM_152636chr1132884 2668 1109 12416 --1794
NM_152678chr342184 1712 976 880 22425 369 12600 --
NM_152680chr442256 966 471 380 --1645 12197
NM_152688chr621001 915 --1243 1828
NM_152695chrX--1144 21449 347 11813
NM_152699chr343776 3127 1166 583 31350 1292 473 22985 2498 --
NM_152737chr672049 1967 1612 828 780 550 120 21763 1457 11686 --
NM_152754chr743307 1421 313 179 21448 885 --12558
NM_152756chr583984 3951 3435 3284 2657 1491 866 693 21730 1333 ----
NM_152758chr831028 827 519 23029 2607 ----
NM_152787chrX93971 3813 3381 3132 2784 2634 2480 945 65 1909 ----
NM_152793chr7175214 4818 4684 4538 4491 4351 4153 4016 3902 3436 1897 1832 899 863 828 763 497 14267 35106 4742 1455 11313
NM_152835chr12970 882 --1548 1157
NM_152878chr2261490 1324 1219 1162 588 369 2998 522 --11422
NM_152903chr1341996 1062 726 629 --22062 1111 --
NM_152924chr1576099 5486 2477 2094 1470 416 285 21057 483 25800 4390 25584 1233
NM_152999chr794888 4619 4609 4191 3709 3309 1753 1551 1277 23939 1347 1599 13764
NM_153018chr1753008 2422 2109 2052 368 195 --23195 2790
NM_153182chr353105 3052 2548 1094 394 2596 442 13200 --
NM_153188chr585393 5250 4156 4010 3939 3709 1897 114 21706 418 11638 --
NM_153207chr12123938 3800 3564 3426 3344 3139 3092 3086 2647 1621 1582 777 ----1128
NM_153261chr1651514 1278 587 533 284 ------
NM_153262chr192910 2870 2350 2299 2217 1253 1022 590 236 13161 12982 --
NM_153321chr172857 98 3739 188 106 ----
NM_153322chr172857 98 3739 188 106 ----
NM_153367chr1083855 3059 1431 1292 1272 1085 466 388 3822 566 279 1558 --
NM_153456chr13166345 5697 5548 5446 4670 4356 2163 1555 1490 1483 1241 1080 878 650 630 541 64569 4513 3836 1842 615 337 14632 25593 2510
NM_153499chr1273034 2518 2299 910 874 486 400 52213 1072 350 344 191 11160 --
NM_153500chr1273034 2518 2299 910 874 486 400 52213 1072 350 344 191 11160 --
NM_153605chr331639 503 489 11240 11231 --
NM_153607chr583189 2988 2753 2706 654 621 342 193 22065 844 12784 13166
NM_153619chr15123593 3427 3232 2931 1364 1203 1166 1005 547 432 369 226 12410 --2965 285
NM_153645chr2272972 2535 1005 986 474 265 153 --22980 800 --
NM_153687chr1271530 1472 1464 1137 646 603 26 1394 11032 --
NM_153712chr283814 3769 3101 2829 2789 1116 863 664 23156 3028 ----
NM_153715chr741212 1065 998 911 1372 ----
NM_153810chr1095127 5004 4351 4240 3795 3664 3122 740 646 34332 3184 1221 --1677
NM_170672chr23393 284 63 ----1346
NM_170751chr641410 1324 1012 570 1522 ----
NM_170752chr641410 1324 1012 570 1522 ----
NM_170774chr2083931 3731 2991 2629 735 637 105 56 ----21269 664
NM_171825chr562983 2875 2785 2330 472 151 22864 2858 ----
NM_171998chrX22384 994 ----12191
NM_172037chr841468 1394 120 98 1230 1385 --
NM_172069chr262141 1917 1710 379 365 114 12389 22091 1826 --
NM_172070chr262256 2014 1783 1412 909 615 1279 --12064
NM_172071chr1187063 7048 6702 6291 5629 5502 5348 5195 4891 4882 2714 2557 2048 1257 908 459 163 82 1112 15582 --
NM_172103chr692671 2565 2154 2057 1951 1848 740 191 168 12427 11945 --
NM_172105chr692671 2565 2154 2057 1951 1848 740 191 168 12427 11945 --
NM_172159chr321608 899 3363 194 178 ----
NM_172160chr321608 899 3363 194 178 ----
NM_172216chr1272936 2420 2201 812 776 388 302 52115 974 252 246 93 11062 --
NM_172226chr1273034 2518 2299 910 874 486 400 52213 1072 350 344 191 11160 --
NM_173083chr171295 1267 830 376 258 158 116 1850 --11039
NM_173214chr16157746 7644 7099 6806 6322 6286 5407 5328 5251 3039 2546 2060 555 119 28 32718 2477 2324 15132 --
NM_173468chr484327 3828 3688 1842 1812 1493 981 237 36065 5845 1465 ----
NM_173469chr1581551 1417 1405 1387 1211 960 530 449 21121 511 ----
NM_173470chrX52583 1848 902 875 855 1246 ----
NM_173473chr1032160 647 629 11863 32537 2260 696 11960
NM_173495chrX72365 2304 2278 2263 1968 1642 293 2877 378 ----
NM_173496chr1052734 891 235 228 83 ------
NM_173510chr2272170 1974 1914 1865 492 317 296 12237 --2818 687
NM_173552chr331852 117 57 --11993 --
NM_173562chr643187 3012 2066 1239 1728 33286 2862 2769 22923 1158
NM_173576chr1052351 2167 713 401 103 1177 1813 --
NM_173582chr11145469 5366 5200 4664 4524 4281 4201 3891 1956 1436 1340 936 326 72 24035 2017 16071 15297
NM_173602chr1273405 3047 2957 1373 1258 1023 766 ------
NM_173642chr1168849 8700 8520 8150 8115 7339 7075 6214 3414 3148 2885 1593 1022 109 34 28 36868 5831 316 48381 6378 5885 680 18293
NM_173667chr542223 1995 969 524 170 --2358 287
NM_173683chr84522 455 297 255 --1687 --
NM_173694chrX92600 2346 2288 2122 1006 943 857 732 137 --1714 --
NM_173808chr1104453 4055 3948 3737 3325 1792 1652 717 698 672 24089 3469 14292 13696
NM_173829chr596199 6053 4934 4243 4077 859 505 191 98 23784 1067 15055 --
NM_174911chr893999 3955 3919 3801 3771 3639 3329 765 633 --31502 908 297 --
NM_174916chr1551929 1731 944 905 807 11846 --1564
NM_175061chr742207 1600 616 30 11438 11576 --
NM_175623chr12227382 6886 6877 6479 5860 5584 5556 5507 5406 5240 5081 4897 2564 2483 2356 2202 1989 1794 1531 1513 255 154 67746 5807 5439 5433 5337 1672 26752 5973 32928 1071 1038
NM_175624chr12227477 6981 6972 6574 5955 5679 5651 5602 5501 5335 5176 4992 2659 2578 2451 2297 2084 1889 1626 1608 350 249 67841 5902 5534 5528 5432 1767 26847 6068 33023 1166 1133
NM_175625chr12227477 6981 6972 6574 5955 5679 5651 5602 5501 5335 5176 4992 2659 2578 2451 2297 2084 1889 1626 1608 350 249 67841 5902 5534 5528 5432 1767 26847 6068 33023 1166 1133
NM_175736chr1277805 6234 5045 2648 2142 1599 1339 57444 6694 6288 5739 5311 1845 --
NM_175854chr1332498 2112 933 12154 1654 11003
NM_175907chr1862411 2294 1763 1150 503 22 ------
NM_175910chr19101604 948 750 703 646 619 490 367 283 115 1537 ----
NM_175921chr5124290 3870 3638 3190 3051 2971 2874 2808 1358 1239 1120 370 33990 225 44 23166 1371 1182
NM_176801chr471322 1164 460 358 147 84 54 2193 132 1139 --
NM_177438chr1474246 2782 1256 1207 677 256 66 23594 2665 21012 376 --
NM_177538chr2278233 6780 6615 5714 5619 3422 3223 3131 2960 2889 2794 2590 2534 2512 2493 2050 1953 1716 1607 1475 1307 1000 897 761 624 488 85 11786 16893 16712
NM_177968chr232001 1887 1767 --1630 12099
NM_177985chr241785 1738 109 99 21885 1464 --11622
NM_177990chr2041856 1370 285 103 ----11757
NM_177999chr993748 3737 3712 3460 3365 1444 492 317 112 22300 1204 13306 --
NM_178011chr1053287 2175 2002 502 109 2270 134 --12304
NM_178013chr1452858 2480 2304 1898 415 42438 2390 1230 878 1734 12129
NM_178140chr592501 2284 2168 1973 966 844 724 328 67 ----12733
NM_178151chrX127617 7602 6722 6457 6230 2374 2152 2138 1926 1010 987 576 46000 1802 403 38 26176 2010 21997 1975
NM_178152chrX127617 7602 6722 6457 6230 2374 2152 2138 1926 1010 987 576 46000 1802 403 38 26176 2010 21997 1975
NM_178153chrX127617 7602 6722 6457 6230 2374 2152 2138 1926 1010 987 576 46000 1802 403 38 26176 2010 21997 1975
NM_178505chr1043429 2820 939 131 11288 1784 22650 2290
NM_178509chr1743848 1478 1201 565 11105 33074 880 550 --
NM_178539chr1241996 1982 1968 631 21699 1500 --11351
NM_178566chr921427 1178 51655 1349 1311 467 100 --1264
NM_178584chr251498 1355 579 454 176 2462 229 11048 --
NM_178585chr4102491 2357 2288 1079 824 746 669 494 392 288 11272 33020 572 40 --
NM_178815chr1072445 1798 1696 811 751 466 110 1721 12174 --
NM_180989chr1352087 1855 1528 845 394 ------
NM_181054chr141377 1101 --1975
NM_181077chr1551969 1747 1601 874 632 21941 305 12117 --
NM_181332chrX52731 2592 2018 1840 174 31830 920 367 ----
NM_181358chr193961 3785 2955 1695 1537 1427 1049 558 378 13146 13011 1492
NM_181443chr2062220 2062 2035 868 774 253 --32363 759 429 --
NM_181453chr271607 1587 1508 1249 1181 417 334 ------
NM_181481chr18136955 6586 6248 5855 5726 5554 5331 1913 1821 1425 1327 1277 758 21395 303 --16376
NM_181482chr18136955 6586 6248 5855 5726 5554 5331 1913 1821 1425 1327 1277 758 21395 303 --16376
NM_181483chr18136955 6586 6248 5855 5726 5554 5331 1913 1821 1425 1327 1277 758 21395 303 --16376
NM_181489chr3146792 6656 6147 5715 5470 5065 4966 4628 2644 2143 1299 1034 755 56 46732 6609 4095 729 --16198
NM_181521chr16117002 6677 6666 5741 4750 2727 2387 1402 1316 1125 844 15723 1650 --
NM_181581chr72214 80 1719 --2189 41
NM_181659chr2063136 2867 2638 1342 895 170 22502 907 12168 --
NM_181659chr2063136 2867 2638 1342 895 170 22502 907 12168 --
NM_181670chr122983 607 ----11388
NM_181705chr595465 4121 4086 3920 2112 1943 1919 1540 647 14699 35546 4016 1637 12043
NM_181706chr1132337 1706 844 12147 12360 --
NM_181714chr621931 1517 ----11838
NM_181836chr552502 588 485 446 285 --1101 --
NM_181838chr531521 1290 1185 --1513 1406
NM_181861chr1272757 2509 2184 1922 1796 410 68 11743 ----
NM_181868chr1272757 2509 2184 1922 1796 410 68 11743 ----
NM_181869chr1272842 2594 2269 2007 1881 495 153 11828 ----
NM_181897chr362612 2191 1774 735 387 198 ------
NM_182481chr2141222 925 889 500 ----11020
NM_182482chr2141222 925 889 500 ----11020
NM_182485chr473756 3642 1422 1171 707 481 180 43550 2766 1228 1217 22984 1277 13098
NM_182503chr675141 4885 4079 3878 3778 1414 631 24904 342 14817 --
NM_182515chr19196736 6419 6357 5772 5743 4813 4650 4121 4103 2460 1935 1450 1205 898 414 369 330 166 43 26313 2680 --24747 4202
NM_182551chr283030 2776 2692 1400 1375 638 558 517 42897 1195 487 29 157 11138
NM_182646chr473756 3642 1422 1171 707 481 180 43550 2766 1228 1217 22984 1277 13098
NM_182664chr141946 1895 1885 124 31724 813 51 22248 604 12224
NM_182700chr741756 1431 1268 265 21726 639 1249 11998
NM_182757chr693457 3440 3158 3111 2799 1078 473 436 63 --12143 --
NM_182762chr796035 5247 4825 2082 2005 1823 1586 653 420 1589 12180 16225
NM_182763chr172795 2519 2179 1966 970 819 447 12286 11940 --
NM_182765chr102904 761 ----21661 347
NM_182797chr2051452 1311 1220 438 77 3628 223 33 ----
NM_182830chr1462143 2063 1930 1425 428 338 1407 32032 1510 694 --
NM_182898chr7156018 5694 5639 5285 5076 4539 4152 2074 1703 1300 1156 954 740 345 267 45343 2626 1232 1051 ----
NM_182899chr7156018 5694 5639 5285 5076 4539 4152 2074 1703 1300 1156 954 740 345 267 45343 2626 1232 1051 ----
NM_182948chr183025 2941 2411 2002 927 491 438 222 --1830 21967 616
NM_182964chr1192877 2337 2165 2131 1314 604 588 459 131 22049 349 12184 --
NM_182970chr20103424 3273 3166 3127 3014 2700 1356 913 807 688 44064 2763 1046 375 ----
NM_183004chr1443630 3521 2682 818 13753 11385 21338 159
NM_183227chr621139 463 21033 55 2664 457 --
NM_183234chr1561893 1540 594 583 264 128 21603 1502 ----
NM_183235chr1561893 1540 594 583 264 128 21603 1502 ----
NM_183236chr1561893 1540 594 583 264 128 21603 1502 ----
NM_183376chr1572448 2120 2016 1777 1741 923 623 --12610 --
NM_183397chr20114745 4494 4368 4352 3595 1910 1814 1641 1007 377 276 44399 3806 3721 861 --139
NM_183421chr86939 776 753 711 217 101 --1829 --
NM_194071chr7105296 5281 4385 3714 3305 2039 1404 1067 637 380 24070 3468 14449 24204 1618
NM_194247chr2104226 4064 3800 3687 2769 1452 1368 1063 996 176 13808 22899 1138 13003
NM_194282chr4102716 2692 2452 2350 2108 1886 1223 635 189 178 12607 ----
NM_194285chr1172810 2592 2249 2190 903 436 75 22490 1135 --13292
NM_194286chr12105534 5323 5058 5011 4086 2341 2072 1970 1139 1071 34249 1912 1231 45566 5117 1777 1382 --
NM_194291chr842962 1968 1173 33 --11954 --
NM_194292chr171743 1723 1639 1234 534 350 343 144 ----
NM_194314chr194926 4906 3775 3696 3445 1460 1372 1196 940 13418 ----
NM_194318chr1392415 2345 2278 1826 931 714 576 562 470 12354 ----
NM_194328chr961318 1270 1180 1104 842 805 12127 ----
NM_194329chr961318 1270 1180 1104 842 805 12127 ----
NM_194330chr961318 1270 1180 1104 842 805 12127 ----
NM_194332chr961318 1270 1180 1104 842 805 12127 ----
NM_194434chr1865450 4524 1881 1686 1568 707 14172 15169 --
NM_194442chr131279 1111 72 --1456 --
NM_194454chr731307 1196 193 11599 --1289
NM_194455chr731307 1196 193 11599 --1289
NM_194456chr731307 1196 193 11599 --1289
NM_197941chr562642 2462 2448 1036 658 549 --12739 2727 297
NM_197977chr93993 914 234 1625 --2963 257
NM_198086chr146742 574 525 506 419 183 1143 11865 --
NM_198123chr861513 1452 1265 329 274 154 ------
NM_198124chr861513 1452 1265 329 274 154 ------
NM_198128chr1871916 1868 1820 1550 1466 789 707 ------
NM_198181chr1572379 2014 1889 1179 1032 883 642 1391 12303 --
NM_198196chr362420 2290 2000 1902 687 403 31741 995 664 1390 1801
NM_198225chr1051721 1523 1255 267 229 1777 1754 --
NM_198261chr122571 201 ----1188
NM_198262chr122571 201 ----1188
NM_198268chr193961 3785 2955 1695 1537 1427 1049 558 378 13146 13011 1492
NM_198269chr193961 3785 2955 1695 1537 1427 1049 558 378 13146 13011 1492
NM_198270chrX82467 2262 1276 1083 884 665 344 38 32708 2210 1100 33448 1045 646 --
NM_198271chr342197 1644 1428 654 --22026 709 --
NM_198273chr563043 2741 843 693 593 194 --1399 1912
NM_198281chr443304 2978 2676 379 22750 1222 22543 628 1730
NM_198320chr12113926 3913 3685 3291 3185 1984 1486 1387 944 516 107 11864 1605 13788
NM_198321chr563080 2762 2063 2057 2050 827 22852 1195 12402 --
NM_198391chr2041355 545 285 69 ----147
NM_198465chrX102828 2525 2372 2086 1962 1137 690 664 585 326 ----22236 114
NM_198468chr684252 4219 4189 3988 3381 866 535 248 31498 1030 1013 13014 --
NM_198485chr352515 1928 1793 557 183 11684 --12474
NM_198581chr296759 6303 5687 2762 2698 2661 1969 1754 1085 27190 869 12903 16961
NM_198595chr485040 4904 4255 4096 3099 1436 1063 376 ------
NM_198686chr1482426 1983 1872 1715 700 586 132 104 11795 ----
NM_198715chr1105437 4911 4640 4461 4427 2281 2263 2087 1051 152 --156 11210
NM_198793chr384186 3856 3554 2926 2895 720 422 136 21653 1159 12948 --
NM_198859chr375159 4967 4088 4041 2015 1761 1512 --14807 34902 4754 673
NM_198889chr451298 908 531 352 310 ------
NM_198900chr1277805 6234 5045 2648 2142 1599 1339 57444 6694 6288 5739 5311 1845 --
NM_198904chr562096 1813 1671 299 216 128 ------
NM_198935chr2063261 3004 2969 2149 1995 1182 12164 11115 1874
NM_198947chr1121026 118 ----11080
NM_198956chr741756 1431 1268 265 21726 639 1249 11998
NM_198992chr122934 431 --1472 11020
NM_199000chr742134 372 358 169 32051 1689 245 ----
NM_199040chr1263714 3073 1455 1164 1097 193 32410 449 405 ----
NM_199044chr182954 2749 2661 1140 594 552 351 343 --1489 --
NM_199072chr762959 2339 2128 1179 974 525 1797 1622 11021
NM_199132chr19102086 1938 1818 713 686 435 212 206 164 80 2562 334 ----
NM_199168chr1041064 1021 361 55 --1175 135
NM_199169chr2073474 3036 2815 1211 981 900 372 33094 2629 2410 ----
NM_199170chr2073474 3036 2815 1211 981 900 372 33094 2629 2410 ----
NM_199171chr2073474 3036 2815 1211 981 900 372 33094 2629 2410 ----
NM_199188chr1242865 810 685 46 13449 13693 --
NM_199190chr1242865 810 685 46 13449 13693 --
NM_199192chr2146 ----1350
NM_199193chr2146 ----1350
NM_199320chr482564 2211 1932 397 305 247 158 25 42292 2258 352 87 ----
NM_199320chr482564 2211 1932 397 305 247 158 25 42292 2258 352 87 ----
NM_199421chr14115122 4903 4404 3555 3427 3343 3228 1493 925 783 765 14845 --23472 142
NM_199436chr273138 2975 2704 1894 585 262 147 ------
NM_199454chr1104795 4386 3430 3250 3159 738 680 604 586 82 33638 1013 158 ----
NM_199461chr1063017 2676 2343 1218 583 198 32732 1200 1004 11249 11309
NM_199482chr241702 1678 1654 694 1314 --11303
NM_201432chr17126449 6249 6217 2633 2559 2269 1909 1679 1229 419 341 231 31466 606 198 ----
NM_201433chr17126449 6249 6217 2633 2559 2269 1909 1679 1229 419 341 231 31466 606 198 ----
NM_201559chr694202 3946 3888 3722 1927 581 564 70 38 11063 13579 13819
NM_201634chr551599 1353 1239 468 431 21233 376 11696 11472
NM_203329chr11126974 6163 5513 5049 4817 4498 1905 1236 1139 431 192 30 26518 2365 --35004 4776 2595
NM_203330chr11126974 6163 5513 5049 4817 4498 1905 1236 1139 431 192 30 26518 2365 --35004 4776 2595
NM_203331chr11126974 6163 5513 5049 4817 4498 1905 1236 1139 431 192 30 26518 2365 --35004 4776 2595
NM_203342chr152859 2720 478 370 117 12379 11146 13319
NM_203343chr152859 2720 478 370 117 12379 11146 13319
NM_203346chr252301 2007 669 221 21 146 --11548
NM_203349chr154826 663 74 40 12171 ----
NM_203350chr141764 473 183 94 131 11780 1289
NM_203372chr271733 1469 1354 1242 289 108 90 ------
NM_203379chr1051008 835 730 181 164 --2620 117 --
NM_203380chr1051008 835 730 181 164 --2620 117 --
NM_203394chr1262681 2398 2192 927 816 380 ------
NM_203446chr2172946 2668 2615 2085 2072 989 302 41133 336 273 144 ----
NM_203463chr2124473 4267 3686 3384 3258 2997 1451 1424 1414 1038 526 278 1429 ----
NM_203504chr452628 1768 724 249 204 --1625 --
NM_203505chr452628 1768 724 249 204 --1625 --
NM_205768chr152071 1650 1349 451 240 ----1468
NM_205860chr152706 1218 819 621 341 ----22661 1993
NM_206594chr153376 2817 2503 633 425 --12981 156
NM_206595chr153376 2817 2503 633 425 --12981 156
NM_206852chr141130 ----1564
NM_206853chr673503 3374 3347 3297 1509 1035 640 22728 668 4681 352 335 28 12819
NM_206854chr674764 4635 4608 4558 3300 1901 389 23989 1929 63347 1942 1613 1596 1289 263 14080
NM_206855chr685729 5600 5573 5523 4265 1354 380 211 14954 34312 2254 1228 15045
NM_206857chr141130 ----1564
NM_206866chr2123144 2998 31082 243 213 1233 --
NM_206876chr273553 3301 3128 3001 2924 314 296 13094 23620 3480 1221
NM_206907chr543383 3016 2410 1004 --12940 --
NM_206909chr8138172 7952 6152 5427 3294 3127 2813 2067 2044 1823 1623 1437 340 27592 855 18179 18426
NM_207012chr10103385 3102 2946 2848 1208 1000 917 866 364 185 --13199 --
NM_207015chr362425 2313 2144 877 703 493 21663 952 --21899 1503
NM_207032chr201262 31612 1560 1477 11242 --
NM_207033chr201170 31520 1468 1385 11150 --
NM_207034chr201170 31520 1468 1385 11150 --
NM_207043chr131828 919 867 12308 --22348 2334
NM_207044chr131828 919 867 12308 --22348 2334
NM_207047chr131828 919 867 12308 --22348 2334
NM_207122chr1131114 1033 847 ----1285
NM_207303chr1034128 3403 312 23668 551 13393 --
NM_207304chr1322525 2328 3972 825 778 --11856
NM_207306chr164458 4115 3999 3971 3289 1552 44309 3468 3139 1496 11816 --
NM_207361chr1355944 2496 674 304 80 36332 5923 3822 --1904
NM_207404chr342217 887 667 50 1328 11450 11383
NM_207406chr435051 765 308 36188 5398 146 1743 24154 1434
NM_207429chr1172268 1951 737 383 165 116 39 1768 11673 --
NM_207445chr1521473 304 249 36 11835 1452
NM_212558chr944242 3171 2660 330 33858 3407 3138 3995 696 523 2710 47
NM_213589chr2115590 5505 4766 4388 4114 3880 3763 3502 3494 3475 593 34464 3676 3519 14419 13774
NM_213590chr1365289 4984 4568 3994 865 189 34113 1597 1140 ----
NM_213594chr121174 ----162