TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-631
miRNA Sequence: AGACCUGGCCCAGACCUCAGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000217chr1254496 3842 2035 762 293 15250 11291 14923
NM_000259chr1594636 4581 4481 4369 2478 1663 1377 1005 231 25628 1111 --12489
NM_000332chr657078 7070 6365 4650 2705 1894 11738 --
NM_000555chrX55890 2185 1409 904 530 15372 15006 15459
NM_000719chr1255644 5150 4244 1864 675 11589 14332 16010
NM_000875chr1575190 2742 2071 1325 1039 804 754 25104 1643 24322 2175 --
NM_001005404chr1744002 3407 1060 699 14377 --22862 584
NM_001008408chr786094 5775 5357 4633 1776 1756 1498 96 1427 25802 4122 --
NM_001010867chr176077 5792 5383 1903 1413 577 526 11471 36227 2074 266 --
NM_001010888chrX54075 3656 2821 1287 536 11086 14023 --
NM_001011666chr734895 4836 1470 --15186 16510
NM_001018050chr2242937 1376 1079 966 13289 11036 21339 957
NM_001025580chrX53117 2813 1092 522 300 ------
NM_001039690chr1641920 951 846 501 --1459 2674 437
NM_001040429chr1323129 2460 ----13599
NM_001046chr532163 2046 1092 1556 12510 --
NM_001071775chr1311585 --1339 1639
NM_001396chr2122017 778 12306 12735 11991
NM_001432chr453295 1520 1292 582 516 1101 --21428 315
NM_001656chr521936 1468 1679 --1764
NM_001695chr862638 1034 765 452 208 123 ------
NM_003099chr1544688 2303 481 448 26411 391 11288 --
NM_003298chr354364 4023 2102 1315 730 --25971 4927 12324
NM_003374chr5----1247 1127
NM_003559chr1713342 13742 1375 3868 668 265
NM_004229chrX1378 --12136 1522
NM_004272chr521826 1668 ----1336
NM_004397chr1123563 586 ----12713
NM_004738chr2041861 1675 972 114 --11058 22266 1613
NM_004742chr31323 ----1640
NM_005296chrX3819 254 21 1176 --1897
NM_005339chr453767 3247 2741 723 673 --1855 --
NM_005477chr1541847 253 153 59 ----1679
NM_005996chr1231449 1029 618 ----11072
NM_006047chr2033055 2542 992 ----184
NM_006166chr1232502 2412 2035 12424 --11648
NM_006380chr1743779 3532 3015 2837 11272 --24068 1156
NM_006565chr1621152 496 ----1958
NM_006599chr1636329 5287 5104 25695 2620 --16883
NM_006750chr16107437 7310 7247 5737 2337 2136 2052 823 480 434 17201 --11699
NM_007011chr1576328 5813 2661 1697 1419 1011 71 12640 45765 1737 1036 639 --
NM_007050chr2087555 7524 6689 6158 5486 3176 2738 1820 37952 7021 5387 --16858
NM_007249chr1347741 5928 3569 1436 12010 12054 --
NM_014155chr1176247 6125 5931 5908 2032 370 110 12309 ----
NM_014388chr155602 4292 4231 4209 3923 45647 5555 1138 155 11214 --
NM_014877chr1767401 7168 6543 2778 1522 1463 26935 6296 ----
NM_014906chr1754090 3889 3020 2925 851 12850 11112 --
NM_015074chr153844 3773 3617 1490 371 ----11760
NM_015576chr322395 939 --31995 1845 691 --
NM_016206chr357478 6291 5950 2795 583 18033 --11960
NM_018364chr153516 3446 2971 1072 423 ------
NM_019593chr2072854 2284 1073 820 799 356 180 ------
NM_020443chr166618 6213 5967 5091 2664 151 11940 25827 2756 --
NM_020772chr1768414 5399 3269 2862 2781 2220 11466 27838 1836 --
NM_021116chr7108889 8029 7690 5954 2966 2719 2653 695 455 314 18389 1325 --
NM_022719chr2283543 2950 1441 928 632 406 367 255 11216 22412 558 11302
NM_025235chr101743 --11795 1231
NM_030791chr1431435 720 68 ----180
NM_030806chr1149375 9132 8573 8517 8241 8141 6498 6488 3563 3361 3153 1870 623 269 17447 11417 --
NM_032373chr1024388 4028 14382 --25644 1929
NM_033224chr757939 1628 1581 1202 548 35156 5146 590 1490 --
NM_101395chr2132685 2323 558 22974 108 13403 12659
NM_101395chr2132685 2323 558 22974 108 13403 12659
NM_153605chr3--1429 --11573
NM_173468chr476037 5360 5072 2150 1228 665 103 1776 ----
NM_182526chr1452413 2323 1126 435 179 12896 12181 11053
NM_203463chr254794 4403 3742 3734 539 --1890 --