TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-633
miRNA Sequence: CUAAUAGUAUCUACCACAAUAAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr55841 683 626 344 290 31612 1504 785 ----
NM_000052chrX73431 3254 2181 787 765 680 509 --33471 2337 939 --
NM_000067chr8----1501 --
NM_000081chr151850 1756 1615 1567 518 ------
NM_000084chrX96263 5925 5454 2252 2206 2129 1416 541 409 --1559 --
NM_000091chr282889 2883 2560 2486 568 233 69 28 ----12651
NM_000092chr274153 3918 3423 2905 1377 1241 808 --14320 --
NM_000097chr321223 1064 ----11227
NM_000109chrX62570 2401 1932 1802 1004 236 --12639 11891
NM_000127chr81269 ----1322
NM_000129chr621318 181 --11488 11492
NM_000134chr451687 1433 701 322 67 --1704 --
NM_000138chr1552483 1938 1669 610 133 1683 --12620
NM_000161chr1471916 1787 1409 775 620 383 142 1495 11993 11986
NM_000165chr631336 1125 1054 ----11252
NM_000176chr593646 3395 2808 1466 1340 1330 988 508 232 ----13629
NM_000176chr593646 3395 2808 1466 1340 1330 988 508 232 ----13629
NM_000189chr2--1184 22384 1547 22388 1697
NM_000214chr2041428 1338 1283 474 31503 640 615 ----
NM_000216chrX144067 3984 3649 3580 3351 2912 2792 2712 2529 1187 963 746 712 426 1291 --23070 891
NM_000217chr12115146 4991 4980 4573 3516 3462 3300 1527 1023 673 211 33288 1012 224 ----
NM_000248chr361139 940 913 886 701 541 12829 ----
NM_000259chr1576378 5736 4024 2158 865 850 60 41847 1826 1765 1027 21743 1683 15930
NM_000264chr963176 3060 2847 2391 420 154 ----1495
NM_000267chr1753185 3126 2653 2130 1247 12548 --12177
NM_000276chrX62238 2139 1970 801 553 97 --1683 --
NM_000304chr172837 705 --1841 --
NM_000314chr1042039 1204 959 573 33078 884 609 22263 1252 12926
NM_000321chr1371764 1705 1601 1490 1417 1159 718 1390 2576 524 --
NM_000325chr41633 --3521 518 515 --
NM_000332chr6127088 5932 5662 5445 4866 4576 4496 2549 1848 1145 1133 1007 11861 27097 2460 --
NM_000340chr311187 --1972 --
NM_000346chr1731999 1309 384 ----11313
NM_000353chr1611256 11176 11144 --
NM_000390chrX83388 2920 2828 2620 2443 2384 626 76 53329 2851 2799 2496 2168 12291 --
NM_000393chr231792 1319 72 ----12084
NM_000397chrX61962 1778 1722 816 561 214 12340 1493 12529
NM_000408chr273478 3396 3288 3109 2574 2445 274 62676 1321 487 470 419 402 2876 779 13047
NM_000421chr17128 ----1100
NM_000430chr1773151 2714 1454 1076 869 409 113 32617 1471 137 1796 23798 336
NM_000435chr192920 396 --4402 399 332 329 --
NM_000461chr373793 3678 2829 1801 1769 1453 104 14286 1182 --
NM_000462chr1561604 1568 751 349 248 234 --41741 1148 240 237 --
NM_000484chr212336 302 ----1232
NM_000489chrX63230 3006 2795 2690 2607 2416 --13439 11192
NM_000575chr21399 --41083 1001 228 85 --
NM_000586chr43260 208 98 --2211 107 --
NM_000615chr11----11162 --
NM_000618chr12106537 5187 4949 4922 4635 4604 4587 2478 2256 910 36423 6013 72 16452 --
NM_000619chr122164 65 2151 51 ----
NM_000633chr1864902 4375 3444 1872 1719 201 13597 13990 24721 242
NM_000668chr431268 1231 162 11050 ----
NM_000676chr171451 --1340 --
NM_000719chr1296491 6381 6219 5563 5512 1878 1844 894 78 --36645 4863 4860 --
NM_000758chr5----1297 1301
NM_000792chr12420 195 ----11073
NM_000793chr1484513 3452 3420 3210 2054 1516 578 92 23171 1036 11665 --
NM_000806chr591733 1725 1381 1356 1296 1228 612 594 466 ------
NM_000809chr4249124 9054 8971 8616 7941 7849 6913 6906 6344 6165 6094 6043 5879 5818 3649 2576 2437 2209 2186 2100 1966 408 275 200 35796 5635 474 48911 8000 7852 2422 29250 2426
NM_000813chr575542 5260 4665 4359 1743 706 503 --24160 1893 25477 1509
NM_000814chr1594151 4033 3087 2909 2709 1457 1354 1160 1121 14226 ----
NM_000826chr442378 2002 1598 851 22502 762 22349 450 --
NM_000838chr672550 2363 2198 2143 1931 1824 1087 --12569 --
NM_000840chr72193 132 --140 1197
NM_000844chr34976 776 436 339 ----1860
NM_000868chrX42508 2293 1805 191 42640 2631 2623 936 22459 745 --
NM_000891chr1793691 3636 3593 3187 3111 2953 2709 2683 2662 23240 518 ----
NM_000899chr1264246 4230 3677 3163 1464 1199 --2884 24 13982
NM_000902chr343039 1249 883 260 --53248 2256 1983 789 786 23046 764
NM_000910chr431705 773 273 21539 1375 21875 1821 --
NM_000933chr202435 218 21567 1153 ----
NM_000961chr2083967 3674 3135 2545 2508 1601 1416 295 24027 1609 13145 --
NM_000963chr162514 2352 2345 1785 940 57 52384 787 608 194 47 11771 2752 471
NM_001001132chr214942 397 338 211 1447 ----
NM_001001395chr1272328 1931 1766 892 440 244 195 --21955 288 1199
NM_001001433chr2052977 2941 2070 1202 353 --13163 21008 578
NM_001001481chr863376 3142 2641 934 505 204 22760 889 --12467
NM_001001485chr32509 497 ----1489
NM_001001556chr1531277 380 116 ----1207
NM_001001557chr821833 322 11843 12050 12212
NM_001001664chr2123960 3483 3248 2734 2629 1573 1330 1296 1039 671 367 98 --13827 --
NM_001001668chr1953862 3601 2808 1387 113 ----12908
NM_001001933chr12537 51 2610 173 --186
NM_001001971chr1041341 1051 566 355 11407 --11193
NM_001001995chrX41674 1582 1241 738 21406 492 --1645
NM_001002026chr331888 728 633 --12501 --
NM_001002257chr263333 1379 1367 567 379 118 22891 797 --1254
NM_001002838chrX41336 425 268 45 ----11774
NM_001002860chr1494368 3978 3903 3790 1838 1595 1531 709 149 --14654 --
NM_001003674chr18126751 6721 6699 6639 6498 6447 4526 1905 1099 773 620 415 15198 1406 16596
NM_001003681chr2231928 362 66 --11994 12133
NM_001003688chr471224 896 470 314 228 186 127 21127 1032 --135
NM_001003712chr12134002 3994 3980 3951 3667 3655 3525 3490 3214 2997 2488 1173 1110 33554 2517 83 --2503 194
NM_001003800chr922894 2487 --22394 2391 13162
NM_001003927chr171166 ----1581
NM_001004317chr664421 3481 2884 1434 1406 747 23147 787 2485 113 --
NM_001004360chr231257 464 287 11842 1467 1541
NM_001005463chr1021856 1729 1736 1789 22536 164
NM_001005474chr321333 630 21326 333 1136 1321
NM_001006612chrX154 1108 1430 --
NM_001006945chr12528 250 ------
NM_001007097chr923297 3164 24330 386 --1600
NM_001007102chr651366 1307 372 297 128 --1469 --
NM_001007245chr72538 23 ----2175 152
NM_001007246chr2171974 682 673 665 531 519 150 11934 140 --
NM_001007257chr171526 1472 1281 1237 1132 1062 942 ------
NM_001007559chr1882090 2053 1495 1369 744 638 598 35 1495 1295 --
NM_001008225chr74648 568 238 197 ------
NM_001008239chr1883837 3700 3312 3175 3023 957 248 31 ------
NM_001008388chr42119 86 --166 --
NM_001008392chr382813 2612 2261 1274 1044 1037 746 172 --22568 757 --
NM_001008408chr7106343 5442 5345 4413 4225 4060 1227 1195 614 125 --14994 --
NM_001008541chr1052133 1961 913 538 425 1484 1541 --
NM_001008564chr1352243 1926 1713 847 291 --12246 --
NM_001008783chr65940 700 660 600 174 ----1593
NM_001008925chr473330 2984 1422 1065 923 715 88 23448 1391 21321 841 22823 612
NM_001009185chr51190 ------
NM_001009569chr10----11247 --
NM_001009571chr741592 1424 1182 503 11234 11104 --
NM_001009899chr3106497 6254 6216 6123 5687 5378 5298 2387 700 670 15467 11075 15942
NM_001009923chr202739 685 ------
NM_001009958chr71244 ----1611
NM_001009993chr284466 3945 3544 3089 2811 878 416 44 13045 13314 --
NM_001009994chr6------1106
NM_001010853chr632698 2166 2156 12002 22169 2028 --
NM_001010862chrX82485 2393 2237 2216 2106 1127 561 551 --13162 13086
NM_001010888chrX114665 4373 4300 4266 3414 3153 2959 1779 953 847 447 33026 1757 1238 21485 957 --
NM_001010891chr5136929 6609 6133 4978 4748 4625 4191 2403 2296 2222 2078 1615 1005 24813 380 41590 155 152 149 11103
NM_001010895chr922068 158 21501 1343 21791 1788 11677
NM_001010924chr101173 1842 --11135
NM_001011513chr463411 3382 2678 830 418 198 34005 3819 3594 23000 201 1267
NM_001011537chr371916 1901 1683 1632 867 823 306 --1898 --
NM_001011663chr103926 854 182 ------
NM_001011666chr7126499 5628 5502 5399 5120 4484 4199 2248 1640 1365 647 139 24071 4044 ----
NM_001011708chr222811 128 --11981 1808
NM_001012393chr1194171 3730 3609 3161 1223 910 456 444 108 --1501 --
NM_001012398chr162863 236 11041 --1975
NM_001012423chr1562906 494 422 324 310 118 --1723 22947 2677
NM_001012507chr6------199
NM_001012732chr41989 21289 1117 21170 193 11278
NM_001012761chr572264 2035 706 624 599 384 260 --12705 --
NM_001012968chrX112757 2717 2541 2383 2141 2103 2078 1904 1776 50 37 32668 2210 988 11961 --
NM_001013406chr731387 1268 503 11440 21571 428 --
NM_001014434chr13621 75 49 --367 64 52 1538
NM_001014797chr10107536 7227 6765 5738 5263 1470 975 394 383 152 --26266 1316 1576
NM_001015877chrX73103 3031 2531 2356 940 70 56 32808 2682 560 --1245
NM_001017371chr261397 1172 1141 523 433 350 ------
NM_001017395chr373687 3323 2653 2561 2384 847 838 --2853 850 --
NM_001017440chr788246 7732 7130 5812 5157 5075 5044 265 28021 6432 26063 3287 18134
NM_001017926chr831373 670 499 1715 1680 21723 1456
NM_001018037chr931126 532 266 11400 --11249
NM_001018064chr941738 1321 667 546 11948 3751 552 549 1341
NM_001018067chr1105353 4805 4778 4383 3312 1607 1198 1175 925 593 54452 4433 1589 1313 666 --11778
NM_001023567chr1542298 497 324 118 12501 11689 12339
NM_001024465chr61129 ----1178
NM_001024601chr1166 ----179
NM_001024649chr562782 2655 2631 2621 877 533 22793 2720 12404 --
NM_001024924chr4179 ----1115
NM_001024934chr61502 ----1662
NM_001024948chr1113328 3247 3230 3090 3044 2801 2762 2310 983 781 188 12656 22946 2133 --
NM_001024956chr11115638 5273 4500 4339 3545 2287 1605 1087 751 634 315 44945 4787 3691 364 35866 4289 736 --
NM_001025076chr10156136 5902 5854 5298 4795 4524 4474 4021 2461 2273 1665 1166 1015 742 284 15987 1287 14569
NM_001025079chr3114011 4004 3991 3874 3766 3626 2914 2633 1064 742 94 34059 3679 3613 ----
NM_001025201chr23460 241 85 3699 691 636 1643 --
NM_001025356chr1252876 1960 1191 331 136 --1116 22967 2279
NM_001025580chrX84296 3757 3695 1465 1026 777 710 202 12731 24290 4157 --
NM_001029858chr683229 3172 2457 755 543 317 290 283 13114 4372 323 308 305 --
NM_001029875chr552302 1833 520 304 121 12101 1805 12255
NM_001030007chr1663866 2856 2710 1047 403 194 22916 879 ----
NM_001030055chr14114689 3983 3824 3511 3318 3016 1830 1743 1647 1638 1343 13304 23575 1783 21489 748
NM_001031623chr631204 581 495 11559 2460 97 11640
NM_001031684chr221486 375 --21303 49 --
NM_001031695chr2265445 5364 5269 3727 1523 57 22077 868 25272 1968 --
NM_001031702chr3------1928
NM_001031716chr23984 794 240 ----1165
NM_001031748chr12--1573 --1172
NM_001031804chr1683304 2753 1654 1502 1392 1339 1013 934 --54370 4367 4364 1617 893 --
NM_001031812chr521584 1537 --1532 --
NM_001032280chr611708 ----11712
NM_001032282chr831103 975 493 11009 21060 453 --
NM_001032393chrX1254 ------
NM_001032999chr2064602 4004 885 835 586 69 ----15331
NM_001033045chr253664 3555 1717 1532 977 33803 3382 1008 22892 1620 23826 3415
NM_001033047chr442655 2591 1977 926 2665 595 12675 --
NM_001033057chr372111 2104 1576 1445 1399 237 71 --1572 22115 1813
NM_001033059chr651635 1295 616 605 417 1424 1167 1699
NM_001033117chr364621 3187 1729 1599 1557 1069 ----12975
NM_001033503chr5------1126
NM_001033578chr872255 1601 946 910 482 338 242 22316 288 ----
NM_001033602chr134868 704 616 473 12716 1680 --
NM_001033925chr1051879 1866 1661 857 318 ----1679
NM_001034837chr51812 ----1554
NM_001034845chr431358 1285 532 41442 1202 914 346 ----
NM_001035003chr441155 551 299 44 ------
NM_001035chr141333 1282 929 855 ------
NM_001037132chr741682 804 627 274 --2607 528 12245
NM_001037334chr1882183 2114 615 550 375 368 257 243 2868 854 --11628
NM_001037339chr1----21831 1828 --
NM_001037535chrX91406 1314 1252 995 593 530 515 400 254 --11222 --
NM_001037954chr1163235 3226 2790 1166 380 329 --33383 1225 710 --
NM_001038493chr241320 1305 1298 986 --21311 1308 --
NM_001038628chr351689 697 655 530 168 --1533 --
NM_001038702chr571782 1036 980 531 329 74 55 1821 --12303
NM_001039372chr73666 441 126 1431 --1617
NM_001039538chr273594 2352 1191 1056 578 367 239 43161 2492 1325 527 33547 1194 273 --
NM_001039547chr3148031 7813 6903 6418 6323 6218 6170 6040 5177 4935 2431 1348 1334 429 37197 7043 878 27206 1740 21551 1508
NM_001039590chrX113463 3428 3065 2869 2720 1431 1172 1006 575 540 100 ----1267
NM_001039618chr1184434 4276 4080 3970 3920 2252 1876 1193 44978 4289 1229 500 --1196
NM_001039693chr263733 3274 2782 1608 1090 750 21341 277 23256 937 --
NM_001039762chr1052075 1909 1860 758 365 12382 32357 2195 945 --
NM_001040108chr1452589 2326 2285 924 906 12165 12251 1600
NM_001040110chr7----11700 --
NM_001040142chr262157 1734 665 526 462 108 12115 21642 450 --
NM_001040152chr765122 3764 3708 3383 3272 505 21761 1657 --14657
NM_001040214chr622242 1923 1642 --11951
NM_001040272chr942125 2087 1777 372 21857 1791 21903 1842 --
NM_001040284chr16155931 5862 5488 5223 5164 4618 4503 3816 2036 1428 1183 874 674 579 99 21558 1274 25196 1616 14240
NM_001040402chr4103042 3030 2671 2582 1984 1180 585 470 315 106 1142 43153 2243 434 34 --
NM_001040441chr194868 4291 4235 4062 2123 1530 1517 1465 1133 23551 500 ----
NM_001040450chr1562289 2035 1868 1801 777 326 1945 ----
NM_001040665chr7164982 4154 4112 3753 3687 3539 3266 3145 1910 1675 1583 1282 1005 409 211 51 34327 3095 1685 21268 437 --
NM_001040712chr962820 2646 2343 2335 1022 157 13038 52630 1253 831 666 128 11257
NM_001042388chr182830 698 1867 1195 --
NM_001042404chr131959 1584 182 --21304 622 --
NM_001042413chr983336 3242 2948 2826 2640 1341 862 279 23655 2940 1700 --
NM_001042473chr1051858 1757 1707 853 388 ----2599 285
NM_001042494chr1583881 3230 3078 2426 2399 737 650 469 2944 794 13059 --
NM_001042510chr842064 761 365 93 12182 21993 1888 --
NM_001042543chr481520 1439 1405 1348 1336 520 429 211 1373 ----
NM_001042555chr1264631 4300 3848 3207 1890 1561 34470 3091 1877 23767 1015 24089 1743
NM_001042599chr2107815 6300 6016 5996 5678 4882 2240 1542 1536 1401 36654 5724 1862 37415 4959 1622 26670 2771
NM_001042603chr1265151 4596 1606 1194 1178 530 34184 3998 561 21247 469 --
NM_001042604chr3134573 3471 3409 3378 1666 1623 1519 1126 1117 1053 1002 842 93 14627 --24198 3108
NM_001042683chr681830 1725 1693 1525 1206 632 182 105 --11422 --
NM_001042749chrX81972 1842 1826 1543 1391 1358 272 250 11550 ----
NM_001042762chr7----1782 1811
NM_001043318chr1433843 3640 1561 14160 13962 --
NM_001046chr5102786 2694 2413 2201 2000 1106 703 687 526 411 --2706 691 12749
NM_001049chr1422010 1523 ----12181
NM_001079874chr142131 1499 757 399 --11595 --
NM_001084chr7------1258
NM_001099678chr3126406 5638 5383 5374 5158 4605 4378 4125 2288 1290 523 193 21313 656 2683 629 11234
NM_001106chr3139763 9355 9177 8893 8120 6392 6002 1490 1242 1233 177 136 117 18648 98349 3764 442 166 163 154 145 142 139 1170
NM_001107chr14151 --172 155
NM_001109977chr41841 --1764 --
NM_001121chr1041632 638 402 311 --41790 250 26 23 --
NM_001153chr23360 315 75 --2706 152 --
NM_001160chr1242048 1756 361 266 --32331 2265 367 11829
NM_001177chr1242385 2353 304 105 2492 287 12430 --
NM_001186chr21103001 2638 2591 2213 2092 1224 1096 1004 287 98 22983 2198 12006 --
NM_001198chr62372 342 --1326 --
NM_001200chr203872 220 155 --1321 --
NM_001201chr473959 3010 1256 1149 760 274 119 13326 23743 287 12647
NM_001219chr752299 1709 1658 856 658 --189 11911
NM_001233chr792284 2195 2144 1987 1600 758 677 75 54 ----1115
NM_001241chr252362 1774 556 440 416 22446 980 --177
NM_001253chr6------1205
NM_001259chr773963 3871 1965 1614 1068 831 168 --24918 1397 11860
NM_001270chr53829 309 149 --21115 263 --
NM_001304chr1733138 1308 264 --11057 12830
NM_001305chr71802 --2822 819 --
NM_001351chr341817 1668 1514 156 --2129 71 --
NM_001387chr552697 2341 2060 1956 1088 23207 648 --13189
NM_001390chr1883603 3195 3135 2443 2410 521 465 378 33523 3210 2830 13499 --
NM_001391chr1841179 1036 960 942 ------
NM_001401chr911196 --21276 1222 --
NM_001419chr1944355 3464 2953 816 34678 1129 1040 ----
NM_001420chr1953160 3098 2952 2184 2138 ----12314
NM_001423chr1232004 1557 1442 --11645 --
NM_001426chr21720 ------
NM_001429chr2261096 1089 1007 375 332 37 ----11073
NM_001430chr251935 1631 684 179 104 12022 1687 --
NM_001431chr63889 210 89 11114 11230 --
NM_001438chr163292 3244 3194 2710 2672 2643 22295 1088 23638 2350 --
NM_001448chrX31780 508 289 21802 463 1565 1569
NM_001453chr651382 1353 1198 410 257 2694 290 ----
NM_001463chr25784 592 290 256 103 141 2137 86 --
NM_001482chr154856 704 219 150 ------
NM_001514chr11497 --1134 1510
NM_001527chr694676 4667 4355 4050 3725 1406 465 362 246 2326 269 33506 807 503 --
NM_001530chr1421028 318 1975 ----
NM_001537chr162451 213 1357 --1222
NM_001543chr524602 4541 --14605 13240
NM_001616chr243412 3199 1083 376 --22293 465 12297
NM_001650chr1873899 3517 3163 3003 1451 1280 184 43996 2568 704 402 --21607 1026
NM_001656chr582031 1824 1804 1604 1531 1485 1328 1266 1607 ----
NM_001664chr31358 155 --1162
NM_001695chr873181 2853 2750 1143 1091 404 373 23852 3718 1324 --
NM_001755chr1662008 1946 1871 1474 577 306 32138 1417 645 ----
NM_001781chr124868 788 337 293 --2389 30 --
NM_001854chr141075 986 605 384 --21174 407 --
NM_001875chr211071 ----31115 972 29
NM_001880chr2--1235 1225 --
NM_001896chr162442 292 --1422 --
NM_001918chr1187774 7482 6825 6396 6371 6220 3466 3423 2820 2689 2266 2260 2222 1605 729 535 153 147 32928 2474 916 15876 12188
NM_001920chr123641 497 126 --1538 --
NM_001931chr111111 21298 72 11146 --
NM_001935chr2--2814 35 2972 192 --
NM_001938chr12667 151 21537 138 11474 2404 190
NM_001946chr1231191 1182 1143 --1720 11170
NM_001949chr612692 12502 ----
NM_001955chr61886 ------
NM_001966chr3----11517 --
NM_001969chr1473832 3406 2831 2740 1492 1358 133 1154 1741 --
NM_002015chr1343333 2637 2170 594 13356 12608 12278
NM_002025chrX149296 9010 8938 8368 7459 6673 5841 5791 5734 2633 2124 1219 747 196 28516 1206 27151 1085 23105 1651
NM_002035chr1893928 3860 3468 3088 2950 2944 2797 1226 28 13455 --1185
NM_002061chr14747 688 632 395 --1214 --
NM_002126chr1784149 3546 2981 2919 1534 860 738 606 24125 4057 --21406 684
NM_002128chr1332464 2236 462 22533 366 2757 554 --
NM_002137chr732395 399 196 11482 ----
NM_002147chr171193 --3218 215 212 --
NM_002148chr21259 ------
NM_002154chr51218 122 134 --
NM_002158chr283604 2780 2723 1418 1294 1230 667 168 33460 315 155 13542 13768
NM_002160chr92470 385 ----1501
NM_002189chr102658 636 ------
NM_002203chr574122 4093 3719 3403 2714 1163 374 13369 23436 974 --
NM_002211chr1051134 809 741 464 150 21153 356 --1269
NM_002214chr7125460 5246 4739 4456 4442 4100 3851 3743 2191 560 319 211 55602 5137 4933 4871 4783 14716 --
NM_002235chr1241464 1354 1107 434 ----11398
NM_002239chr22862 24 1203 ----
NM_002242chr231882 1553 1460 --31961 1947 1637 --
NM_002253chr451368 1179 1154 1147 1120 11440 11101 --
NM_002264chr374180 3298 3218 1654 1629 574 114 --23102 1949 --
NM_002293chr152612 2514 882 630 585 --12602 --
NM_002310chr5196488 6383 6114 6037 5909 5633 5233 5196 4646 4543 4493 4480 4156 1903 871 752 723 499 332 46530 4451 4382 2319 25326 4457 --
NM_002336chr1294206 3306 1873 1756 1387 1342 1221 928 86 13389 25035 4458 11493
NM_002356chr672861 2547 2483 2033 1154 959 527 32771 2536 211 22494 813 --
NM_002397chr551666 1624 899 399 266 32144 660 585 ----
NM_002398chr231544 1260 551 --1560 11413
NM_002399chr1541353 949 435 368 21202 1096 1952 --
NM_002402chr741139 1006 281 255 11215 1787 11130
NM_002408chr142240 221 1288 2820 544 --
NM_002444chrX31647 716 322 11868 11650 11560
NM_002480chr1231488 1140 583 --11211 --
NM_002499chr1552197 2152 2071 666 655 1598 --1676
NM_002500chr231162 437 199 1968 1909 --
NM_002509chr202813 92 --5113 110 101 98 95 --
NM_002515chr1452024 1945 1725 804 285 21315 99 21823 368 11753
NM_002546chr85812 669 525 243 63 ----1797
NM_002577chr353993 2892 2649 1474 132 --32906 1376 71 --
NM_002581chr985648 5577 5230 5094 4849 4416 3722 1971 25438 3879 35109 2217 1205 --
NM_002583chr123631 400 166 1225 ----
NM_002612chr731663 1370 681 ----12058
NM_002618chr23186 110 57 ----1139
NM_002628chr341075 993 987 914 11021 1972 11219
NM_002645chr1172731 2681 2625 2169 1169 460 367 13085 ----
NM_002655chr8105184 5055 4984 4034 3699 3253 2056 1823 667 599 33493 2076 1585 24335 273 13229
NM_002657chr2073709 2417 1075 658 629 238 39 13928 ----
NM_002687chr142390 138 ----21342 992
NM_002709chr262917 2486 2237 751 378 200 23616 3432 21408 500 --
NM_002731chr182967 2758 2216 2046 2035 1104 838 572 --22080 453 --
NM_002740chr362409 2268 939 911 517 451 1544 1152 --
NM_002745chr22104543 3841 3634 3590 3096 1452 1137 647 501 271 13679 11386 --
NM_002747chr18--11919 11871 11929
NM_002822chr1241492 1452 1206 235 --11657 11661
NM_002828chr181851 ------
NM_002829chr9----11289 --
NM_002843chr1143334 3182 944 335 --11298 --
NM_002869chr1172076 852 760 565 420 195 157 ------
NM_002886chr385090 4432 3468 1584 1376 1311 1202 1115 34384 4035 1793 34487 3968 1494 23830 704
NM_002897chr23697 154 96 ------
NM_002906chr1132247 1957 1865 21687 1670 ----
NM_002941chr331651 1360 312 11657 --11015
NM_002942chr331079 1038 337 --11041 1107
NM_002977chr2113268 3260 3134 2539 2466 846 768 626 393 382 224 33082 2416 2173 1492 --
NM_002995chr13695 175 111 1566 --1184
NM_002998chr8----1659 --
NM_003010chr1732134 2049 1853 12151 12101 --
NM_003016chr1731240 242 215 31748 1640 228 1450 --
NM_003032chr312642 --12371 12375
NM_003034chr12167687 7630 7610 7590 7315 7139 7103 5943 3128 2509 1982 1893 1482 1044 829 671 37811 5459 424 36718 2101 464 13132
NM_003045chr1364730 4643 4403 4088 3097 376 14464 --34710 4505 4456
NM_003071chr342098 1973 1852 635 --11976 --
NM_003100chr51178 ------
NM_003106chr32987 264 ----1765
NM_003108chr2127112 6922 6641 6188 6018 5467 5448 5219 4602 1261 361 329 14444 1515 16769
NM_003112chr783038 2751 2696 2498 2418 2250 1263 593 ------
NM_003114chr82268 179 --1721 --
NM_003156chr11--1180 1172 --
NM_003161chr17103580 3518 3157 2934 2837 2682 2663 1125 596 328 12379 13455 --
NM_003162chr22886 161 ----11051
NM_003175chr11175 ----1184
NM_003178chr331822 753 702 --22054 512 1757
NM_003185chr2051313 1011 927 455 329 21353 1070 11193 --
NM_003205chr1532249 2023 527 11569 ----
NM_003211chr1221465 92 --11522 --
NM_003246chr1562049 1958 1804 1755 1405 326 --2560 516 --
NM_003262chr395206 3287 2029 1979 1714 1485 775 579 520 11427 41733 1126 330 176 --
NM_003269chr621194 506 ----1520
NM_003291chr131338 1736 --1122
NM_003298chr376203 5823 5630 5371 4721 4509 2491 46179 5295 1278 138 --26247 5546
NM_003338chr1071641 1524 733 305 228 88 81 11968 21792 1618 11622
NM_003342chr17113307 2777 2353 2262 1330 1025 934 297 228 90 65 ------
NM_003344chr731756 1593 96 --134 --
NM_003350chr83889 814 762 ------
NM_003359chr43924 429 134 176 1524 21201 838
NM_003390chr112348 221 11115 1854 --
NM_003392chr3114325 3660 3209 2639 1567 1342 1316 860 755 164 138 14358 32925 1275 182 1168
NM_003407chr19----2652 614 --
NM_003410chrX53029 2972 1952 719 640 12887 22731 126 --
NM_003412chr382329 2313 971 768 632 536 394 202 1995 1376 --
NM_003418chr34850 689 622 49 ------
NM_003442chr113878 825 704 1561 --1882
NM_003453chr133225 171 67 1661 1228 --
NM_003463chr642963 2852 1105 591 1778 12095 --
NM_003468chr264043 3918 3858 3128 1546 1486 --13968 --
NM_003472chr6--21259 953 1366 --
NM_003474chr1012185 11783 --21898 199
NM_003557chr141576 1494 1452 1431 21565 1478 --1293
NM_003574chr18105397 4799 3633 2171 2114 2061 1803 641 369 182 23557 753 25079 4540 1598
NM_003583chr1263878 3393 2565 1541 1355 770 13895 --1878
NM_003590chr293552 3498 3205 2859 2740 2506 1400 1387 1143 1102 --1997
NM_003615chr373990 3672 3365 1155 393 229 211 22836 959 21483 879 --
NM_003618chr21470 --1459 1884
NM_003620chr174921 857 811 328 1369 1748 1428
NM_003622chr1242053 1818 1718 98 --22229 1806 --
NM_003626chr1141361 1344 1271 137 11286 ----
NM_003644chr1776507 6442 5789 2548 2188 1850 555 35066 1958 1590 16599 --
NM_003645chr152248 208 --1185 --
NM_003672chr171557 1547 1326 1302 687 357 299 21704 510 1302 --
NM_003676chr12619 292 2677 655 --169
NM_003692chr93162 119 47 ----1985
NM_003702chr83784 114 22 --1686 126
NM_003722chr372678 2550 2181 1951 1787 989 626 22605 1065 ----
NM_003749chr1342456 2272 149 73 22205 1770 1711 --
NM_003750chr102922 229 1389 163 --
NM_003772chr1141337 1285 1117 1109 --1454 --
NM_003773chr31271 --3280 277 274 --
NM_003809chr172491 484 --1494 --
NM_003822chr183010 2963 2402 2095 2089 2063 1948 836 32105 650 381 11280 --
NM_003873chr1012329 12181 12387 --
NM_003884chr33709 697 266 11412 --1233
NM_003885chr1742510 2430 2357 55 ----159
NM_003893chr10------1512
NM_003895chr2141979 1604 1512 129 32013 1849 1585 --11993
NM_003899chr1342607 2586 881 827 ----12597
NM_003913chr6154364 4274 4198 3677 3266 2894 1565 1515 1467 1163 1012 942 759 286 208 53509 2947 1447 768 69 11407 13606
NM_003927chr182381 177 ----11104
NM_003934chr941089 872 202 103 --1527 11204
NM_003943chr4----21090 290 --
NM_003948chr452416 1642 651 532 249 32191 1745 862 3906 314 217 --
NM_003953chr1----12842 --
NM_003981chr1511050 --1907 --
NM_004080chr741475 1292 1255 158 1506 1382 --
NM_004109chr1132227 482 119 --2340 54 22396 1755
NM_004124chr1453231 2563 2415 773 295 --2620 94 --
NM_004136chr15103283 3158 2870 2660 2339 1227 1063 980 783 376 21045 199 12623 --
NM_004162chr341175 997 864 139 --1979 --
NM_004171chr11158156 7433 7007 6911 6313 6118 2985 2531 2305 955 911 873 705 638 125 23445 454 26244 230 --
NM_004180chr23563 437 122 ------
NM_004232chr1852816 2632 2408 606 105 23529 2777 22840 818 1822
NM_004274chr1493222 3043 2874 2866 2506 2253 2195 997 130 22855 772 --2670 567
NM_004293chr963647 2672 1246 827 739 271 23220 1040 23820 3403 --
NM_004302chr1232822 2274 1981 ----12952
NM_004319chr163209 3158 3014 2225 1008 578 23056 352 --12744
NM_004337chr852333 2000 1506 655 302 ------
NM_004342chr742353 2136 1614 1429 --41971 936 756 590 1541
NM_004365chr51343 ------
NM_004388chr12282 74 ------
NM_004392chr1352505 1769 1075 794 519 --22631 1685 --
NM_004405chr231093 1080 1031 --1763 --
NM_004420chr1122279 1702 --21719 1705 11723
NM_004457chr231275 627 516 --1112 --
NM_004458chrX52167 1932 1740 721 234 22577 146 21723 85 --
NM_004459chr1761906 1870 1602 1492 451 57 --1234 --
NM_004472chr51641 --1631 --
NM_004496chr143536 179 121 11041 21146 171 --
NM_004505chr1731248 536 115 21975 1792 11981 21804 1453
NM_004529chr961404 1364 1013 982 412 392 --2888 33 --
NM_004571chr2163001 1162 1089 816 606 590 1688 ----
NM_004575chr43655 644 408 21647 1518 1648 --
NM_004586chrX94987 4735 4460 4390 1130 1011 750 537 320 12132 35123 1371 540 35354 559 544
NM_004612chr973685 3381 3186 1932 1822 467 377 23442 255 2887 584 --
NM_004654chrY41392 1357 1125 332 1968 --1270
NM_004666chr61350 1172 --11536
NM_004686chr82644 214 --11332 11501
NM_004694chr171834 ----1843
NM_004725chr1041494 586 493 73 1531 --180
NM_004738chr2012552 1243 1687 --
NM_004742chr351794 1578 353 259 87 ----1534
NM_004744chr473670 1518 1154 862 699 335 82 ----13779
NM_004775chr1852327 2031 1921 1472 924 --22409 553 --
NM_004795chr1321691 1263 41813 1682 1463 60 11715 11622
NM_004824chr631185 222 146 --11188 11000
NM_004834chr233396 2861 1304 --12972 13258
NM_004852chr182714040 13910 13706 13643 13011 12740 12569 12530 12352 11647 11119 10888 10751 10319 10104 9862 9855 9834 9234 5689 4391 3957 3024 2677 2572 840 246 513458 11947 11478 5592 5065 414194 13498 9081 4861 28791 953
NM_004857chr14114670 4357 3994 3473 3412 3287 3021 1785 1468 1122 628 12921 23354 3212 14799
NM_004869chr1821693 1366 51674 1619 431 185 172 --21771 1472
NM_004926chr1441832 1442 1434 1343 --11741 --
NM_004932chr571768 1654 1442 1407 548 511 54 ------
NM_004953chr3------1429
NM_004969chr101517 --1102 --
NM_004972chr92734 453 --4325 95 80 77 --
NM_004985chr1294521 4273 4232 3574 3119 971 950 564 532 1715 53364 745 650 123 72 --
NM_004992chrX48529 8338 7718 976 28434 5554 27478 6894 1987
NM_004995chr1411533 --11542 --
NM_005028chr1042160 2030 2018 200 --21640 544 --
NM_005063chr1042685 2520 2417 194 53823 3440 2378 1478 67 11119 --
NM_005065chr1464346 3754 2142 1113 1103 332 13972 33404 1917 1028 11202
NM_005121chr1783850 3181 3161 3116 1148 610 170 119 22425 188 23731 1079 12644
NM_005126chr372321 1655 725 654 643 422 406 ----11779
NM_005154chr151271 ------
NM_005156chr9134689 4568 4515 4461 4189 3738 3270 1616 1061 1049 752 656 529 33813 721 442 35329 3945 3852 24012 3298
NM_005164chr1272202 1901 1827 964 762 463 59 --133 --
NM_005171chr1231082 982 853 1958 11282 --
NM_005178chr191418 ----1383
NM_005203chr101280 ----2424 113
NM_005233chr372406 2160 2033 2014 893 863 506 12174 ----
NM_005245chr42633 310 ----1791
NM_005256chr112153 91 2801 188 1239 --
NM_005259chr241491 1335 1284 528 --11380 --
NM_005261chr86979 895 765 714 670 216 --1898 --
NM_005313chr155426 378 222 172 156 1139 191 --
NM_005339chr4104094 3963 3894 3855 3655 3047 1185 847 409 62 23832 1038 21649 1234 11559
NM_005384chr92250 235 ------
NM_005387chr111199 1690 1516 --
NM_005388chr93258 225 115 11096 11565 21224 1064
NM_005392chr921751 1197 21803 1447 41757 1754 1203 1200 --
NM_005400chr222241 994 1692 12000 12621
NM_005402chr721683 345 --21140 453 --
NM_005406chr182564 498 11453 1211 11234
NM_005433chr1862829 2700 2188 1979 469 350 22814 2683 ----
NM_005461chr2021938 1578 11977 11581 --
NM_005475chr1252946 2128 662 641 153 11045 --1118
NM_005476chr921404 192 11307 11346 --
NM_005502chr993011 2903 2297 1145 969 498 386 270 134 12590 --12735
NM_005509chr551775 1624 1315 405 30 --21766 693 --
NM_005515chr7----1610 --
NM_005529chr1----278 66 170
NM_005570chr181119 ----197
NM_005578chr394845 3925 3722 1731 1629 1300 1133 1009 777 33685 1345 115 ----
NM_005596chr986433 4844 4351 2150 1985 1897 1580 496 35848 1778 651 16353 --
NM_005599chr111158 --11134 --
NM_005604chr642559 2396 2120 715 11717 1117 --
NM_005611chr1631151 1032 111 21105 956 11114 --
NM_005630chr311978 22012 462 11721 11990
NM_005639chr1241748 1386 272 255 1535 11406 --
NM_005665chr1124871 4739 4660 4538 4421 3334 3207 1852 1507 1256 1034 855 33767 3153 1416 --14664
NM_005668chr584597 4562 3958 3900 3472 3253 1207 621 11217 13373 41631 1467 1438 1192
NM_005688chr341351 451 255 175 ------
NM_005715chr612608 --22712 2709 --
NM_005717chr11343 1450 ----
NM_005737chr242955 2405 1932 910 --22487 880 22317 2234
NM_005739chr1571794 943 884 719 229 169 128 1616 --1936
NM_005746chr762785 2187 1848 993 684 99 21057 1006 12000 --
NM_005748chr1292638 2390 1174 950 731 702 579 383 241 53001 2904 2403 1004 524 2441 324 --
NM_005759chr273606 3419 1817 1780 1153 961 514 11052 --24346 2931
NM_005786chr1821262 286 ----11192
NM_005822chr652291 1797 784 504 205 1244 1613 --
NM_005835chr61466 1520 ----
NM_005841chr451091 1062 1047 998 403 11019 ----
NM_005842chr131639 ----199
NM_005859chr561299 1135 1007 959 563 379 31178 1160 134 1383 1387
NM_005870chr1351413 1252 1004 152 79 ----1243
NM_005871chr1051059 781 271 170 81 21087 1026 ----
NM_005880chr1631492 649 202 --21049 261 --
NM_005893chr9138 ------
NM_005898chr1182196 1260 580 413 189 166 123 78 ------
NM_005904chr1841320 1131 1090 925 11242 11283 --
NM_005920chr153330 2729 1337 1216 1168 --6171 168 165 162 159 151 13892
NM_005924chr721089 807 1178 --1113
NM_005935chr4114765 4631 4025 3338 3332 2022 1777 1591 1410 861 37 ----14848
NM_005941chr853942 1467 774 633 72 11257 13221 13715
NM_005966chr261808 1750 1496 931 769 294 ----21641 903
NM_005977chr133710 125 27 ----1839
NM_006016chr651780 1583 843 604 98 1455 --21556 790
NM_006033chr1862269 2257 2118 1838 861 839 21505 626 --11669
NM_006047chr2073545 3359 2569 2434 1090 616 150 22408 2181 22936 2933 --
NM_006060chr743698 1110 594 131 --13410 --
NM_006063chr21107 ------
NM_006067chr1621016 903 1291 ----
NM_006080chr782982 2835 2636 2490 2422 2132 1945 724 1639 --11115
NM_006085chr141286 1108 1056 454 ----11279
NM_006094chr832436 2230 937 21636 657 21871 1689 11875
NM_006106chr1163419 2906 1140 650 534 257 3819 247 173 ----
NM_006107chr173474 163 43 --3172 169 166 1176
NM_006139chr272779 2383 2010 2001 1163 1142 809 --12680 --
NM_006141chr1612335 12558 --12316
NM_006153chr33644 490 141 ------
NM_006164chr21338 --2466 47 1476
NM_006197chr851961 1887 1795 577 423 31948 883 592 12052 12264
NM_006200chr9------157
NM_006242chr2061763 1728 1676 1667 386 379 ----1610
NM_006251chr562681 1217 1180 1059 1012 271 --1334 --
NM_006256chr152175 1725 1009 592 416 1687 ----
NM_006259chr46654 646 308 217 201 72 1933 ----
NM_006265chr831340 1293 1080 1473 11119 11084
NM_006267chr251904 1291 1248 655 61 --1439 1293
NM_006275chr203788 633 381 22161 1672 128 1520
NM_006281chr84418 378 307 29 --21164 260 --
NM_006283chr8125004 4994 4914 4680 4236 3788 3619 3311 1579 1509 718 450 14214 14941 --
NM_006306chrX75207 5106 4282 1971 1818 1802 1069 13954 --14252
NM_006330chr871588 1240 1157 1091 626 517 305 --11557 --
NM_006352chr121672 399 11837 22048 692 --
NM_006379chr741955 1731 1582 801 12081 --21983 1554
NM_006380chr1784397 4076 3759 1667 1652 1351 363 333 44091 4054 1605 1445 22991 773 14327
NM_006393chr1094325 4046 4002 3747 3543 1787 1760 825 96 34571 4220 268 ----
NM_006415chr921131 277 ------
NM_006420chr2052598 2157 2123 1184 192 12869 1385 13444
NM_006469chr151575 1451 1361 1347 466 1480 --1139
NM_006480chr5----3515 512 497 --
NM_006526chr2062180 1928 1391 1369 584 500 21360 186 11986 11585
NM_006544chr14174690 4307 4107 4071 3931 3792 1928 1892 1830 1675 1432 1184 811 694 627 477 280 --24441 1630 11446
NM_006572chr1763311 2857 1080 1065 478 300 --13287 --
NM_006575chr1421269 1156 1480 1104 --
NM_006577chr22895 390 --41212 1196 1127 933 --
NM_006599chr16198232 7630 7623 7364 7190 7010 5888 5234 5069 2591 2421 2403 2063 1999 1991 384 344 336 272 25806 1564 45755 3278 1008 74 22425 903
NM_006609chr242674 2491 2275 1878 --12608 --
NM_006614chr362981 2266 1223 1011 519 319 1483 --13023
NM_006620chr684820 4785 4158 4081 4005 1095 1071 604 173 14266 14510
NM_006624chr1052049 596 472 390 216 11327 1631 11981
NM_006628chr15124699 4487 3002 2910 1801 1531 1423 1408 695 374 139 41 11609 11426 --
NM_006646chr1372745 2546 2432 2305 2120 1929 1054 12168 --13004
NM_006653chr62432 418 ----1422
NM_006691chr1131087 973 929 ----11091
NM_006700chr12----1761 1774
NM_006713chr54288 254 95 33 2792 191 --1156
NM_006717chr952995 2556 1089 714 49 13339 23089 1095 --
NM_006729chrX125249 5198 5115 4726 1771 1438 1392 1303 914 847 788 180 --22074 158 --
NM_006750chr1686681 5558 5113 4938 2882 1640 894 885 47664 7348 6175 6103 11202 27269 2377
NM_006756chr831211 572 348 1362 1541 --
NM_006763chr192047 1986 1667 1386 466 277 226 117 104 12010 ----
NM_006764chr3----1419 --
NM_006775chr673060 2917 2723 2682 2183 788 679 33114 3046 2561 ----
NM_006805chr51261 --1264 --
NM_006814chr2042682 1784 692 356 1532 --1360
NM_006873chr293262 3213 2432 2172 911 857 811 661 323 1249 23078 267 --
NM_006885chr16103589 3310 3275 2638 2579 1296 1237 1174 552 244 --1271 --
NM_006912chr132366 1808 1743 31834 260 180 ----
NM_006914chr941539 1363 287 130 --1512 --
NM_006915chrX122227 2188 2032 1688 987 965 802 661 630 297 269 214 22434 2196 61717 1714 1711 1708 1705 1702 32408 2021 891
NM_006920chr281636 723 448 436 400 355 215 107 11392 12020 --
NM_006940chr1231771 689 665 --31161 115 103 --
NM_006965chr1831029 902 335 1103 --11033
NM_006981chr942650 2493 870 336 22861 648 --12298
NM_007009chr7----175 --
NM_007011chr1586190 5873 4663 4367 1990 1903 1323 181 26766 309 ----
NM_007038chr21185963 5915 5790 5537 5439 4961 4203 3916 2306 1672 1636 1597 1415 1264 1209 1110 494 384 1436 ----
NM_007084chr1331124 1060 577 --11324 --
NM_007085chr351766 1730 767 716 652 12375 1703 22652 1621
NM_007114chr351144 800 270 208 173 33043 2550 516 --1501
NM_007115chr24458 441 377 95 --175 182
NM_007124chr631489 791 205 11846 ----
NM_007125chrY31017 88 31 21400 1076 1438 --
NM_007159chr371727 1436 1406 1103 546 520 307 11089 1599 --
NM_007172chr2252714 2684 2603 463 27 1262 12194 12081
NM_007195chr1863556 2724 2461 2284 116 45 33333 439 66 13355 --
NM_007212chr151991 1881 521 194 140 ----11654
NM_007231chrX72332 2104 1954 889 770 347 191 --32338 2335 968 1370
NM_007236chr1552334 2041 1858 857 455 ----22150 603
NM_007245chr162920 802 ------
NM_007246chr43771 320 163 1950 ----
NM_007249chr13129189 9022 8027 7719 7415 6698 6420 6205 5773 3770 3155 474 49443 9034 6429 3325 17400 --
NM_007285chr162101 72 ----1474
NM_007332chr831187 1012 254 --11330 1325
NM_007345chr1842120 2092 1995 1851 ------
NM_007347chr1593238 3164 3148 2905 2531 2045 1152 1116 592 --31004 605 110 11209
NM_007353chr712589 23043 2550 12861 12528
NM_007373chr1061835 1580 1458 1387 1317 28 1285 11729 --
NM_007375chr132737 2352 1825 12658 12469 --
NM_012081chr553603 3412 2537 1107 310 22621 967 ----
NM_012090chr141145 836 351 159 1297 11226 --
NM_012095chr1053501 3388 2860 1275 712 23414 759 21121 64 --
NM_012120chr652405 2165 547 380 315 32156 1852 369 32757 2288 1113 1812
NM_012129chr772323 2239 2134 1000 682 567 251 22526 1584 11632 --
NM_012154chr81125 1250 1835 --
NM_012186chr11725 --1728 --
NM_012207chr101128 11115 1303 --
NM_012214chr2156362 6292 5848 5747 2545 2502 1947 1834 1163 1146 1000 849 832 455 252 1236 21068 373 15637
NM_012224chr461227 1151 1140 919 840 93 21217 240 ----
NM_012238chr1091752 1686 1620 1602 1372 659 501 469 169 11766 ----
NM_012249chr283603 3190 3027 3006 2662 1348 554 208 23283 2563 1557 13300
NM_012257chr711063 2723 405 ----
NM_012262chr1104774 4019 3783 3358 2056 1741 1148 1062 895 443 24135 3258 21722 1636 34070 1568 1092
NM_012281chr752315 2190 985 762 196 1385 3889 733 418 22270 2182
NM_012294chr734105 2659 1208 12887 13647 1635
NM_012297chr462177 1759 1752 350 161 40 32035 906 362 42449 2393 1883 720 --
NM_012300chr512385 22359 674 --12368
NM_012307chr183978 734 366 --1369 1373
NM_012309chr1184291 3938 3301 3093 3056 1823 1543 718 --23430 1546 --
NM_012328chr741421 1083 195 81 1128 1291 --
NM_012329chr1741184 385 204 34 21378 624 ----
NM_012338chr73824 435 132 --1765 11138
NM_012382chr5134538 3759 3635 1827 1808 1690 1533 1330 1236 1225 1018 154 21 34503 4056 3894 33060 1263 1184 13064
NM_012395chr7113407 3280 2946 2885 2473 2434 2093 1094 940 831 682 12443 13293 --
NM_012416chr991247 1179 930 795 483 281 91 74 33 --21022 295 --
NM_012420chr1081875 1846 1593 810 393 245 93 73 21620 648 31602 1599 1596 --
NM_012446chr52448 73 --1417 --
NM_012479chr742675 2643 2619 238 12221 12545 1822
NM_013231chr1461065 1033 927 908 806 462 --24060 1768 --
NM_013254chr124696 661 597 494 --1450 2589 559
NM_013261chr453611 2701 2669 2394 1240 --23336 76 12654
NM_013262chr631443 937 90 --150 161
NM_013281chr2011217 1161 --1513
NM_013316chr72299 225 2755 183 ----
NM_013322chr771651 1595 1472 1274 1057 239 145 ----21426 1284
NM_013357chr82545 108 ----1246
NM_013372chr1511077 23171 2539 32757 2487 1225 --
NM_013381chr1251709 1642 1615 945 826 --1860 12123
NM_013390chr941618 562 369 147 11608 --184
NM_013437chr861278 996 495 185 120 54 11284 2932 123 --
NM_013995chrX62375 2309 2162 914 738 26 12239 32385 558 207 --
NM_014011chr252188 908 381 175 147 11748 --2590 336
NM_014016chr361524 1176 395 373 355 219 21451 289 2420 189 --
NM_014034chr651181 355 251 177 54 137 1560 21464 1407
NM_014106chr15102884 2298 2059 1835 1143 879 564 415 329 61 11988 12733 --
NM_014112chr8115486 5163 4398 3734 3578 2141 1947 1668 1661 1547 1290 33843 242 86 55075 4943 4241 3854 371 14857
NM_014117chr162513 106 --1682 1686
NM_014154chr351461 1311 1292 340 33 21539 321 21132 195 11635
NM_014155chr1197443 7103 6447 5545 5365 2165 1775 824 608 35493 1630 1226 22455 768 21733 268
NM_014181chr292595 2232 2187 2024 1074 871 849 272 53 1912 12618 --
NM_014211chr51559 ------
NM_014240chr324080 1028 --24131 3201 14186
NM_014243chr42759 507 11305 1229 11816
NM_014253chrX82457 1983 667 549 465 388 368 341 1794 22497 2494 --
NM_014263chr1031441 1399 182 1275 11115 --
NM_014290chr9----1205 --
NM_014319chr1281996 1950 1815 1486 1465 1213 436 194 21963 265 21833 30 11861
NM_014323chr221724 --3715 712 709 --
NM_014331chr4207591 6135 6039 5968 5732 5625 5478 5224 5172 4919 4888 4867 3054 2890 2858 2460 1002 676 623 255 21515 1067 46890 5600 5178 1799 22496 1915
NM_014372chr131462 785 607 41743 1705 739 436 21465 557 --
NM_014393chr872270 2177 2171 2103 1721 499 447 ------
NM_014421chr41256 32129 2085 1740 21984 1926 1261
NM_014423chr5125061 4122 4093 3615 3604 1880 1708 1590 683 561 440 200 35377 3621 846 35158 4539 3896 14266
NM_014445chr32801 431 1301 --11773
NM_014461chr3------1131
NM_014547chr15------1732
NM_014553chr2113380 3128 2819 2609 2456 2437 2196 2110 781 584 256 ------
NM_014572chr1361815 1678 1486 1133 676 336 --11764 11819
NM_014613chr531231 1165 1097 --52154 119 116 113 110 --
NM_014615chr1663579 2552 830 652 276 56 --22518 842 --
NM_014616chr343457 588 448 377 23158 69 22209 790 23236 802
NM_014620chr122742 539 ----1209
NM_014630chr1533845 3629 217 --23479 3171 11592
NM_014635chr221737 559 21753 26 ----
NM_014646chr1812455 --23122 2245 --
NM_014647chr1632169 810 218 --1283 --
NM_014666chr511328 11285 11251 --
NM_014671chr751548 1472 1451 1364 165 ----1474
NM_014682chr892266 2024 1928 1859 1828 758 425 318 62 21546 389 31615 1606 211 --
NM_014701chr1563372 3291 3082 3031 952 546 --21194 1143 12291
NM_014702chr6103425 3415 2879 2594 2481 2373 1327 982 737 451 12184 ----
NM_014707chr742276 2196 2017 199 11441 1301 1456
NM_014720chr102547 290 --1329 11203
NM_014729chr842082 813 177 94 --12320 11938
NM_014742chr20----11743 --
NM_014751chr842051 1650 641 36 --11641 --
NM_014752chr114781 545 458 229 21969 646 11738 1361
NM_014757chr52614 427 12301 ----
NM_014779chr34754 458 445 319 1238 ----
NM_014795chr261371 1173 917 868 491 405 --2411 408 11311
NM_014803chr1062715 2611 2502 2252 1030 992 ------
NM_014810chr13967 910 547 23002 2452 11296 11027
NM_014820chr331549 804 782 1581 21996 1646 --
NM_014827chr141656 638 609 64 --1641 --
NM_014828chr1452089 1564 822 697 545 12068 --1342
NM_014839chr132518 827 307 1554 1465 --
NM_014847chr11383 --1386 --
NM_014899chr562819 2662 2329 1253 135 36 1375 23003 39 --
NM_014903chr1232484 2380 1946 --22460 732 --
NM_014906chr1783763 3419 3263 3120 1245 1012 739 712 24074 3007 23722 3103 12625
NM_014910chr191303 1290 ----
NM_014912chr1093315 2970 2961 2939 2802 1236 1171 854 139 22711 700 4151 148 145 142 1714
NM_014920chr683425 3365 3197 3167 1365 520 239 213 --23459 604 --
NM_014932chr341999 1489 91 23 2807 477 21744 1644 --
NM_014937chr1031296 503 480 ----11339
NM_014946chr262428 2278 950 849 636 438 11098 --21018 811
NM_014947chr183063 3053 3008 2275 2241 807 456 236 --3910 907 412 --
NM_014961chr432113 1723 252 1833 ----
NM_014969chr161186 1101 1062 1049 947 125 ----1389
NM_014977chr141532 ----1536
NM_014978chr1021771 1267 11547 369 66 60 --
NM_014982chr1494732 3960 3314 1876 1531 1152 1096 714 635 1262 24444 1099 --
NM_014989chr641826 1419 688 498 --11834 --
NM_014990chr1431028 912 520 ----1878
NM_015000chr12163127 2670 2520 2400 2133 2002 1929 1070 1059 965 908 827 599 489 225 207 32619 1197 902 ----
NM_015008chr363323 2653 2561 2384 847 838 13689 2853 850 --
NM_015009chr3--1302 1858 --
NM_015020chr1673897 3731 3407 3209 2572 2378 657 ----23430 3372
NM_015025chr2102533 2458 2437 2061 2008 1938 1710 1041 1034 930 12510 12381 --
NM_015026chr12154716 4642 4405 4158 3283 3252 3001 1655 1571 1554 1430 1399 1267 592 373 13455 33861 3472 706 1596
NM_015042chr1544338 3990 3050 1281 --1261 --
NM_015045chr1051823 1428 652 375 344 31707 767 234 1839 --
NM_015051chr963050 2487 2346 2193 1201 791 ----1651
NM_015054chr123513 505 143 1478 1408 --
NM_015071chr586368 6275 5993 5671 5293 1266 897 545 26236 5952 --16299
NM_015076chr674103 3164 2937 1562 1527 1110 488 --44072 3174 544 520 24492 1656
NM_015092chr1693704 3661 3629 3294 3055 3022 1336 1289 1081 21277 766 --13099
NM_015097chr362301 2280 2187 1966 1590 647 1826 1104 22322 1555
NM_015132chr7184 21604 1557 1788 1126
NM_015137chr852057 923 852 520 466 1893 --1277
NM_015153chr62604 571 1266 1113 142
NM_015155chr1053381 2033 1265 1122 690 1303 13290 --
NM_015185chrX72727 2556 2066 1965 1194 702 83 --1411 --
NM_015199chr382522 2470 1892 1188 904 893 831 683 --52354 2159 1839 709 323 --
NM_015205chr1324551 2049 --1901 15022
NM_015213chr111772 --1775 1779
NM_015215chr182870 2448 2305 1168 1122 725 557 50 12415 12546 --
NM_015265chr252669 2279 2161 1805 602 ----11798
NM_015271chr473663 3531 3480 3019 2775 1565 398 23775 1721 ----
NM_015275chr1241771 1695 1379 791 11622 11507 180
NM_015291chr143542 3117 2980 931 13067 11053 --
NM_015310chr8108159 7812 7713 7536 5899 5789 5130 1693 1662 132 58123 6112 5562 1699 1293 23315 1739 1337
NM_015315chr573415 3373 2291 1276 1173 1043 308 12754 --1712
NM_015317chr241878 1079 620 118 1784 --1510
NM_015323chr651702 1328 1123 1077 257 --21265 547 11269
NM_015347chr1252902 2865 2534 1011 250 12028 1157 22906 946
NM_015349chr632783 2598 477 22672 655 31058 483 480 23005 905
NM_015350chr11523 1447 1418 1493
NM_015355chr1751681 1653 1402 499 303 --1110 --
NM_015358chr2141341 1085 1059 867 11003 ----
NM_015375chr154750 4549 3916 3048 1451 14232 1644 --
NM_015397chr931955 1745 227 --11851 11749
NM_015423chr1171783 1547 1474 671 451 418 36 11638 ----
NM_015429chr361034 934 292 280 140 82 2986 393 1143 --
NM_015446chr141332 491 417 101 1234 --21094 63
NM_015455chr563969 3643 3178 2835 1024 129 --13042 13070
NM_015458chr8115232 4724 4421 3855 3474 1167 837 608 592 379 198 21794 1036 14912 --
NM_015460chr311944 1452 21731 426 11906
NM_015530chr21865 ------
NM_015548chr63948 614 41 ------
NM_015564chr542188 786 347 312 --22754 1164 13269
NM_015565chr21122248 2140 1842 1772 1616 1580 777 673 491 450 342 131 3815 521 249 --11993
NM_015568chr2063764 3529 3131 3059 2741 1100 14319 --14342
NM_015569chr1104822 4497 4200 4040 3910 3851 3626 1395 1343 600 --2898 895 21845 1556
NM_015601chr106996 834 809 390 185 47 1707 197 1178
NM_015630chr251137 882 348 221 214 ------
NM_015638chr20--1688 --1721
NM_015660chr73289 134 21 ------
NM_015691chrX32928 1174 1105 21865 103 ----
NM_015714chr11332 --2345 335 1339
NM_015855chr112902 617 --1620 --
NM_015878chr852001 1766 643 569 135 11627 1123 --
NM_015888chr153331 2446 1342 1300 351 23205 985 ----
NM_015891chr652016 1897 1449 466 350 1213 --167
NM_015906chr161928 1835 1655 1555 1182 709 54841 4420 3299 411 321 104540 4525 4522 4519 3222 3005 1838 1729 1461 913 22997 1845
NM_015962chr1421679 128 --1585 --
NM_016009chr1114902 4782 4153 3743 3156 1777 1317 737 372 344 286 34893 1440 931 24707 992 1912
NM_016018chr852854 2508 2484 2366 57 --22283 1989 --
NM_016019chr73892 864 379 --155 1827
NM_016040chr152305 2270 2168 1999 355 11879 2909 60 --
NM_016073chr154889 880 814 139 1976 1867 --
NM_016083chr673937 3367 873 737 669 571 71 33793 3315 472 23662 1118 13901
NM_016100chr203431 83 55 ----1374
NM_016107chr541236 1150 243 166 31088 320 300 11025 --
NM_016129chr4----1140 --
NM_016132chr15133390 3124 2930 2853 2703 2627 2473 2241 1196 1169 656 584 235 52384 2372 1233 1092 934 23451 3238 2904 551
NM_016133chr221537 474 11669 11540 --
NM_016141chr32314 188 1681 ----
NM_016206chr3208492 8409 7960 7937 7836 7769 7071 6863 6046 5937 5821 5752 5477 3407 3266 3030 2894 994 558 441 36524 5679 3068 18287 13283
NM_016217chr6103200 3151 2821 2407 1127 1030 810 796 51 28 --2560 43 --
NM_016230chr61375 2474 443 --1409
NM_016231chr1731473 1174 254 ----21431 1356
NM_016248chr1383944 3645 2517 1497 772 646 561 533 ----22611 796
NM_016271chr1872289 795 631 546 423 346 283 --2426 302 --
NM_016279chr5151 --1426 --
NM_016281chr1231024 854 468 ------
NM_016289chr241546 1430 53 47 21691 109 22161 855 --
NM_016315chr271677 701 610 490 454 86 61 2707 346 267 64 1160
NM_016322chr983235 2697 2619 2120 974 947 702 396 32778 2060 1173 11090 --
NM_016340chr531234 445 335 --1356 --
NM_016353chr862383 989 929 839 714 441 2248 221 11798 31902 868 390
NM_016395chr1561662 732 702 593 448 375 21953 422 2596 159 --
NM_016436chr2062636 2388 2119 1908 1899 1013 --11753 --
NM_016441chr292245 2203 1974 1858 966 944 875 854 412 21880 650 22206 1861 --
NM_016519chr4186 1418 ----
NM_016520chr91837 --2843 666 2853 563
NM_016530chr1573880 3792 3662 2830 1499 739 255 22609 1491 23347 795 --
NM_016531chr463365 3072 2620 1443 1378 1231 23020 1132 33446 2757 1353 --
NM_016577chr364443 4172 3954 207 193 59 23856 242 12820 1261
NM_016578chr111263 167 2575 498 --
NM_016588chr63905 752 299 --1302 1306
NM_016626chr1841527 1164 1149 194 --2212 103 --
NM_016644chr53422 416 181 ----1463
NM_016952chr1151609 1058 618 174 111 ----12590
NM_017420chr1473544 3234 2988 1351 1170 745 185 33488 1278 851 13678 --
NM_017423chr462164 2006 1377 476 287 188 21840 93 186 --
NM_017435chr123695 314 226 --1730 1615
NM_017508chr1172524 2264 2118 2112 979 431 352 167 --11652
NM_017545chr20131 ----1237
NM_017548chr331600 1341 133 11359 --1406
NM_017580chr1052192 1991 1976 416 341 42125 1806 531 231 --12176
NM_017599chr1241633 1449 1293 412 ----11443
NM_017628chr4115014 4950 4917 4746 4488 4148 4116 3969 3909 3889 3383 21315 268 34674 4101 379 14678
NM_017634chr831567 1552 298 ------
NM_017635chr1171372 1326 1203 526 505 100 65 --21613 126 --
NM_017637chr9139316 8937 7937 6983 5953 2114 2038 1815 1650 1124 727 619 402 16383 1882 27776 2095
NM_017643chr1752621 2564 2486 535 152 1366 22627 2624 12631
NM_017644chr384504 4236 4139 4084 1953 1535 1452 334 11620 25194 581 11157
NM_017650chr786060 5577 5385 4152 3913 2237 2039 646 45408 4549 3893 1894 --11958
NM_017651chr621053 353 1366 41091 1041 386 223 --
NM_017658chr14113997 3472 3392 3256 3172 3156 3048 1488 1458 668 622 11050 34653 1651 1491 --
NM_017680chr93747 393 212 175 1672 1179
NM_017684chr1531920 1797 1685 11763 --11381
NM_017688chr9------11066
NM_017703chr192590 162 ----1600
NM_017730chr31520 2720 505 ----
NM_017742chr1811662 ----11713
NM_017752chrX61696 1543 863 650 397 375 11836 21761 1683 1534
NM_017762chr1552529 2229 1967 1751 247 --21754 954 31873 1634 609
NM_017769chr1462768 2572 1070 985 400 322 32959 2300 46 12184 12487
NM_017770chr622734 152 32582 2499 167 --22472 1855
NM_017813chr8154252 4215 4201 4038 3828 3721 3701 3692 2316 1942 1824 1537 901 724 222 14283 25605 338 11064
NM_017817chr13198 ----1577
NM_017822chr121233 2816 591 ----
NM_017826chr131788 ----1792
NM_017841chr11------1642
NM_017847chr122214 1576 --32020 909 255 --
NM_017905chr131577 3691 675 421 ----
NM_017922chr142224 183 --151 1493
NM_017944chr1163141 1168 799 605 273 169 ------
NM_017945chr31270 --11339 11415
NM_018013chr642849 2012 1982 1077 --11971 --
NM_018027chr1043062 2897 2793 2604 13311 11002 22924 2155
NM_018043chr1141322 1088 1077 958 11018 1998 --
NM_018046chr511216 11662 21763 1627 11724
NM_018053chr1----1864 --
NM_018061chr131349 1086 455 ------
NM_018084chr253242 3183 1207 878 587 23046 976 23089 1023 1268
NM_018120chr831364 1356 1024 11222 --1277
NM_018121chr1042483 2421 2250 1123 23200 239 178 --
NM_018124chr164939 475 262 182 1953 --12503
NM_018126chr421453 1132 --143 --
NM_018157chr1222917 2611 12338 --23146 1027
NM_018198chr1----2112 109 --
NM_018206chr162181 55 1792 ----
NM_018237chr10------1196
NM_018243chr453510 3472 3332 574 285 24014 3284 23489 133 22869 137
NM_018252chr1------1233
NM_018293chr392876 2695 2226 2088 2003 1066 1034 846 82 22205 972 --1357
NM_018298chr15679 315 303 224 141 --4902 236 233 101 --
NM_018312chr1151488 753 728 624 352 --1381 --
NM_018325chr941450 674 304 251 11618 21581 550 --
NM_018362chr1171474 1277 1218 1199 831 743 232 13883 ----
NM_018364chr1144061 3910 3033 2530 1638 1603 1384 1158 1026 912 773 726 616 321 23141 1230 11011 1841
NM_018371chr841340 1325 1266 470 --11398 --
NM_018373chr14146325 6165 6112 5865 5264 4985 4733 4239 4224 2524 1472 934 410 65 21054 707 --14250
NM_018374chr7195187 5045 4815 4764 4750 4510 4097 4025 3635 3459 3280 2098 2060 1543 1457 1215 1030 403 295 23217 40 45211 5121 4648 983 34843 4075 1658
NM_018375chr14------11519
NM_018416chr1252465 2368 880 836 225 --5251 248 245 242 228 --
NM_018439chr1832608 2533 2081 --12501 32505 1694 393
NM_018440chr8177755 7060 6908 5827 5794 5530 5442 3393 2737 2686 2005 1773 1707 1548 1219 1135 141 --18410 18378
NM_018490chr1151666 1416 1233 626 521 1354 --21890 1510
NM_018557chr221058 409 ----21553 171
NM_018566chr163734 3639 3179 1766 1404 1205 11503 44111 3758 3737 3692 --
NM_018569chr461394 1139 1027 495 466 133 ------
NM_018638chr12125055 4312 4302 4256 4049 3939 2026 1275 950 774 323 291 15606 35027 3768 2091 25427 863
NM_018685chr71267 --1805 21039 937
NM_018847chr941914 1737 1346 91 ----21838 1792
NM_018898chr542380 2364 2312 1998 22231 788 11495 --
NM_018945chr653080 2718 2383 1395 631 2936 623 3946 887 502 --
NM_018951chr721171 1120 --11123 --
NM_018970chr793054 2859 2389 1951 1199 1033 937 620 514 13076 1444 --
NM_018976chr1242122 1043 832 733 --22814 433 --
NM_018979chr1252468 2389 2380 2316 921 11726 --12487
NM_019022chr1852834 2236 2083 1231 975 1758 12678 144
NM_019035chr482063 2010 691 605 488 318 300 177 --2744 374 --
NM_019045chrX3766 661 351 ----1948
NM_019049chr14769 500 94 69 ------
NM_019080chr1341502 1463 1428 1383 --41431 1230 554 511 --
NM_019084chr1042271 1884 1724 205 12134 12225 --
NM_019098chr831159 481 310 ----1187
NM_019114chr952510 721 608 389 202 2823 295 ----
NM_019555chr361553 1461 1388 1312 1302 317 --1203 11846
NM_019556chrX71409 1291 1001 959 420 224 179 --11056 2963 103
NM_019593chr2073106 2936 2559 2407 937 928 162 --1795 --
NM_019885chr272748 2661 2588 1890 950 718 583 12709 22650 2449 --
NM_019886chrX------2651 454
NM_019891chr14944 369 359 300 --1164 1112
NM_020122chr2165713 5240 4476 4172 2409 2338 2240 2179 1966 1835 1579 935 862 714 640 485 14113 --22354 1131
NM_020144chr762101 2005 618 455 199 130 11936 1423 1692
NM_020159chr471722 1399 1248 1196 502 451 328 11148 ----
NM_020177chr5113134 2732 2229 2058 1230 768 688 610 554 210 69 12677 12958 128
NM_020198chr172237 228 21612 1398 --11010
NM_020199chr53379 339 263 --21297 239 --
NM_020207chr95524 225 118 77 46 2489 112 1527 --
NM_020337chr473122 2230 2177 2067 2002 506 424 12055 23105 1929 --
NM_020341chr2021567 1469 11406 32030 1879 236 --
NM_020342chr251668 590 302 163 21 --1706 --
NM_020346chr1121491 301 1444 1529 --
NM_020357chr341583 1317 604 379 --1306 1461
NM_020363chrY41838 1695 1540 251 --2217 159 --
NM_020381chr621688 1455 --3534 531 24 --
NM_020390chr3124418 4350 4255 3983 3314 3287 3169 1558 1492 645 561 27 34901 3947 1265 44697 4590 1580 1383 14883
NM_020403chr1371789 1274 1260 1156 547 474 252 1483 --1552
NM_020432chr772278 2142 1877 1738 911 765 472 12022 11899 --
NM_020456chr1342350 2097 2057 862 ----139
NM_020525chr121389 1428 2395 392 --
NM_020647chr82919 421 21944 1462 ----
NM_020648chr1852654 2460 2340 2260 177 12861 32488 1051 400 --
NM_020666chr51102 1825 ----
NM_020673chr20127748 7334 4956 4781 2443 2331 1602 1350 866 478 409 193 12350 27385 418 22809 2627
NM_020699chr144026 3514 2093 917 --24000 353 --
NM_020708chr2032538 2326 2312 --32333 2330 2318 --
NM_020718chr16146623 6480 6460 6034 5690 5505 4690 4069 4023 2503 1907 1744 1167 1139 ------
NM_020728chr752517 1013 625 357 305 1439 --21222 540
NM_020734chr1263314 3243 2868 2795 2686 2195 2782 484 12458 --
NM_020742chrX52656 2023 1752 994 526 22401 250 12082 1530
NM_020752chr1062336 2249 2194 1950 785 623 1884 52845 1091 1085 1082 723 --
NM_020760chr221700 656 11417 ----
NM_020774chr18155614 5538 5417 5178 5070 5011 4963 2323 2227 2101 2068 1754 1539 1135 797 1752 14982 24793 4776
NM_020783chr1872194 2149 2049 739 616 546 191 1476 ----
NM_020784chr1411182 --11582 1252
NM_020792chr342370 2145 1011 964 --22619 659 --
NM_020794chr161598 1536 1260 1239 1018 965 11580 ----
NM_020810chr1492353 1032 970 953 558 403 207 183 63 --11148 23576 97
NM_020820chr2021606 544 --11609 11613
NM_020860chr44967 463 410 214 --149 --
NM_020871chrX102342 2332 2297 2202 1957 1864 1612 867 827 261 --11601 --
NM_020873chr31247 --2255 235 --
NM_020935chr2124580 4478 4371 3918 3056 2943 1788 1478 1461 1063 525 171 44674 3845 3034 2892 1815 --
NM_020937chr141326 3557 240 221 --1157
NM_020962chr1582516 2406 2254 2239 1690 1668 398 161 ----11761
NM_020975chr1021883 370 11972 --11712
NM_021005chr1531181 1116 988 181 --1387
NM_021033chr1353523 3334 2583 763 583 13274 1313 12887
NM_021038chr383339 2878 2170 1027 921 698 376 195 --23342 3252 --
NM_021072chr582512 1981 1826 889 851 746 592 281 22099 2071 12215 22648 2128
NM_021097chr262877 2856 2209 1234 1153 1079 --12859 --
NM_021101chr342151 1569 723 344 2626 322 ----
NM_021140chrX41082 852 768 40 1821 ----
NM_021144chr91346 1393 --1174
NM_021145chr741045 1035 878 783 ----148
NM_021183chrX62400 2331 2285 1947 502 126 1352 ----
NM_021189chr11251 --1254 --
NM_021215chr2032399 2060 1588 --11991 11655
NM_021255chr1463986 3319 3223 3212 1222 761 32959 2803 31 14068 14121
NM_021572chr61873 ----1902
NM_021619chr9----11237 --
NM_021629chr375024 4845 4748 4217 3849 1405 110 64855 4466 3802 2033 1704 1583 --1588
NM_021637chrX61313 1263 1221 946 876 138 --1916 1257
NM_021813chr644601 3572 142 72 23989 3677 25773 4174 22074 603
NM_021814chr641478 1467 449 274 --2602 245 1691
NM_021908chr7------1919
NM_021914chr1451501 928 606 391 183 1642 1194 --
NM_021961chr1197364 7342 6620 5237 4971 1986 1788 807 559 1933 36119 4603 1791 --
NM_021964chr3146486 6137 5138 5044 4613 4425 4382 1964 1729 1696 689 625 365 249 46271 5763 5106 1858 36489 5899 5802 --
NM_021998chrX2936 28 1583 21477 1464 1562
NM_022037chr21880 ----1289
NM_022048chr1565814 5672 5282 5096 1699 322 --15680 --
NM_022051chr1150 ----2629 479
NM_022058chr211757 ----1148
NM_022059chr174934 919 607 52 --1922 --
NM_022064chr3----1215 --
NM_022075chr11212 1750 1914 1840
NM_022121chr63491 189 63 1391 11184 1111
NM_022130chr571312 1225 938 922 564 490 439 --2572 252 --
NM_022133chr851902 1208 245 64 34 41807 1602 1225 684 31825 1610 284 --
NM_022143chr731465 1426 1324 1480 11128 --
NM_022145chr54695 151 87 69 1663 1631 1580
NM_022351chr862795 2725 1392 731 677 327 13876 23187 2914 13651
NM_022444chr7101956 1884 1707 1617 1582 1551 1271 558 361 151 11723 1772 11689
NM_022459chr1386288 5910 5593 4845 4641 4284 2158 1137 64661 2468 2049 1581 1483 188 24433 1174 --
NM_022461chr341285 1041 518 69 --1956 --
NM_022469chr163196 2422 1348 1044 872 754 63348 3092 2949 2182 1237 842 12821 23269 2440
NM_022483chr591821 1424 1370 753 636 252 177 113 104 --11305 21613 668
NM_022728chr73692 577 305 1543 1135 --
NM_022763chr3103083 3006 2564 2510 2064 2013 955 846 836 765 12652 12547 --
NM_022824chr561603 1422 1313 710 312 278 --11451 --
NM_022826chr25982 909 767 749 430 147 ----
NM_022841chr1562460 2422 2162 817 465 269 12748 11840 194
NM_022893chr263110 2957 2427 2316 1281 388 1741 1287 --
NM_022898chr1494641 4587 4522 4510 3771 3036 922 580 277 --1280 11348
NM_023016chr24952 883 840 613 ----21023 711
NM_023072chr19------197
NM_024015chr1721019 1002 --41043 1040 1025 1022 --
NM_024080chr232105 762 732 1635 --12029
NM_024090chr431824 1813 1759 21425 330 ----
NM_024334chr321630 1522 11857 ----
NM_024345chr9146078 5059 4708 4073 2312 2141 2098 1969 1895 1192 1070 912 811 563 1617 24828 527 --
NM_024511chr493242 3156 2536 2508 1349 1097 987 48 27 1616 2251 129 --
NM_024524chr363216 2781 2681 2317 2272 1984 1756 ----
NM_024525chr13585 470 97 ------
NM_024541chr10------11906
NM_024574chr44488 395 306 300 1462 --1446
NM_024586chr11629 --1587 1591
NM_024624chr251523 1344 1110 1072 661 --1194 --
NM_024632chr5193 ----185
NM_024639chr642710 1084 824 38 ----12936
NM_024665chr3134510 4435 4323 3702 3656 3514 3417 3169 2871 1858 1794 1689 1673 --23474 965 --
NM_024713chr1541616 1538 456 116 1424 --1561
NM_024761chr944889 4590 4383 4245 34577 2055 905 --13306
NM_024763chr111125 1389 1315 --
NM_024817chr1565870 5842 5496 5149 5057 522 --15766 --
NM_024824chr1431337 394 175 1252 --11066
NM_024884chr1493942 3921 3661 3211 2935 1791 1592 1445 1322 --14257 --
NM_024885chrX----4885 762 251 248 1255
NM_024947chr3168389 7724 7167 6813 3416 3110 3092 2955 2433 2226 2038 1763 1253 975 846 402 38862 8565 8022 25954 3701 39425 9000 3771
NM_024948chr103777 749 159 ----1639
NM_024949chr494633 3627 3581 3454 3395 1738 1337 324 22 11159 --11130
NM_024989chr2257787 7425 7275 7227 6827 6634 6354 6116 5800 5238 3178 3047 2921 2895 2868 2567 2116 1989 1821 1565 1480 1124 762 665 340 57123 5324 2059 734 430 38004 6935 2985 31014 989 718
NM_025054chr894035 3887 3799 2944 1675 1135 706 483 216 22815 691 ----
NM_025133chr211190 ------
NM_025134chr1652575 2368 1610 821 585 22584 2529 ----
NM_025154chr741254 1119 1043 1027 21536 408 ----
NM_025160chr144302 3735 3237 229 12856 23240 1107 --
NM_025179chr184947 4896 4884 3381 1664 1220 1167 844 33358 1854 417 11223 --
NM_025181chr21612 --1688 1844
NM_025184chrX2695 235 1252 1192 --
NM_025235chr1032269 1655 882 --12198 --
NM_025244chr21263 1300 --1255
NM_030621chr14104081 3685 3608 3467 3083 1267 803 743 721 60 11176 --13757
NM_030625chr1032026 681 674 21656 62 22336 445 --
NM_030627chr5134101 3928 3678 3617 3569 3144 2909 2865 2639 1529 1372 1222 354 54081 3964 3340 1499 389 --13488
NM_030647chr775860 5246 4881 640 575 459 390 11644 26139 678 --
NM_030648chr475243 4138 4013 3449 1573 733 674 14195 33881 721 677 13528
NM_030650chr241584 1238 763 137 41700 1474 1369 822 33329 2827 1294 2424 236
NM_030759chr10----1613 --
NM_030777chr2052505 2348 1980 1692 1666 --22351 1672 --
NM_030791chr14121824 1632 1521 1316 1277 1258 1207 694 668 192 173 119 1445 ----
NM_030799chr582218 2184 2081 2066 2001 1949 242 118 ----11914
NM_030806chr1119303 7837 7202 5949 5820 3481 1779 1756 762 562 309 49447 8717 1697 1394 1204 --
NM_030960chr61146 --157 --
NM_031216chr1831451 1440 204 --12110 1818
NM_031296chr482674 2450 2312 2203 2051 1927 1757 591 42659 1887 1104 571 42745 2212 2209 744 --
NM_031435chr1242516 1322 1296 86 32942 2319 2255 12132 1282
NM_031438chr531360 76 28 1753 31852 1648 674 --
NM_031439chr871876 1755 1716 1655 1619 684 629 ------
NM_031442chrX93032 3020 3002 2703 1179 1024 807 333 78 --1402 22813 2204
NM_031483chr2083573 3465 3147 2878 2283 1411 1347 1030 22649 397 1509 11372
NM_031892chrX3351 309 29 ----1975
NM_031911chr452677 703 489 443 352 3323 277 189 ----
NM_032025chr351921 682 346 339 153 3377 169 57 1757 --
NM_032102chr1163139 3026 2621 2500 1253 297 43146 729 621 104 11107 1959
NM_032124chr1831005 930 889 2863 775 11132 --
NM_032128chr4--1839 3845 273 270 --
NM_032160chr1883952 2904 1733 1724 1632 1384 1126 708 24358 2948 11387 --
NM_032199chr1063799 3650 3485 2759 2533 567 1653 --2522 495
NM_032208chr242728 2691 2581 2221 43371 2742 1161 842 12838 --
NM_032217chr42996 937 1978 --1536
NM_032228chr1152669 2203 1301 1144 643 13550 2966 740 --
NM_032239chr441242 1150 931 248 11010 ----
NM_032373chr10165848 4975 4712 4430 4221 3719 2119 1873 1852 981 881 863 569 446 170 42 45928 5667 3742 1677 31907 1161 1027 --
NM_032437chr13154 54 37 162 --1158
NM_032440chr1072910 2857 2620 1844 640 572 460 ----1616
NM_032445chr1562513 2444 486 453 432 116 11736 22345 1641 --
NM_032446chr583479 3300 3041 2455 1217 755 651 221 33631 3590 1047 12879 --
NM_032457chr463845 3781 3286 2735 2504 1409 --33726 808 163 1812
NM_032458chrX83433 3361 2861 2686 1270 400 386 103 33138 3012 890 --1575
NM_032466chr821301 405 21703 452 1386 --
NM_032471chr621005 293 1191 --11162
NM_032505chr362226 1825 997 532 498 333 --1535 12265
NM_032521chr2083219 3151 2894 2801 2725 2427 2196 1968 32912 2751 2143 --22356 139
NM_032582chr1721267 547 11804 --21816 1476
NM_032601chr22274 177 ----1252
NM_032632chr1442004 1917 482 225 11812 3501 196 193 --
NM_032663chr12173 --11905 1429
NM_032787chr31146 --1149 --
NM_032810chr1061536 1370 1185 1001 613 175 --11060 --
NM_032832chr631749 348 137 162 --11753
NM_032838chr1931044 858 448 --11068 11193
NM_032846chr1431079 614 537 --2617 540 11549
NM_032873chr1164391 4344 4300 3178 1326 936 --23652 482 --
NM_032905chr1051293 1137 835 376 236 --1239 --
NM_032961chr461269 1069 433 403 393 378 1868 --11402
NM_032967chrX------1944
NM_032968chrX133675 3657 3578 3446 3254 2787 2682 1374 1339 1006 950 747 268 24260 1572 34172 3587 842 12985
NM_032971chrY------1971
NM_032973chrY123667 3649 3574 3249 2782 2677 1374 1339 1006 950 747 268 24252 1571 34164 3583 842 12980
NM_033030chr261662 1450 550 470 383 203 --1556 11640
NM_033049chr341239 1182 230 52 --11242 11260
NM_033055chr171035 978 816 711 253 243 216 11131 ----
NM_033119chr163115 99 88 2107 76 167 --
NM_033132chr1392354 2183 2163 2155 2084 2011 691 651 374 --11567 --
NM_033211chr562034 1886 1798 1765 1505 1282 1666 1236 --
NM_033215chrX1393 1330 1396 --
NM_033224chr7147677 7258 7119 5684 5578 5532 2328 2281 1979 1777 1759 1013 874 439 13065 --13054
NM_033225chr853080 2785 865 747 703 13111 --12950
NM_033389chr1774822 4804 4175 3640 1641 650 117 14675 14629 11119
NM_033394chr231185 353 89 --11092 11642
NM_033407chr16682 540 435 256 204 70 --1105 --
NM_033504chr1------1193
NM_033505chr2136740 6728 6611 6447 5523 5333 4980 2197 1824 1722 1514 1375 592 14839 ----
NM_033656chr21115501 5431 3710 2348 2097 2088 1484 1369 1118 681 74 55251 4422 4062 3759 67 1151 --
NM_052832chr872379 2324 1884 1076 852 309 287 --13050 22491 2156
NM_052879chr1253857 3128 2526 1402 71 --24000 3718 24134 3495
NM_052885chr12114439 4009 3285 3149 3028 1313 1104 1053 926 488 440 21972 1450 31963 1136 331 13550
NM_052905chr241923 1911 767 713 31815 1768 291 ----
NM_052910chr1342202 2169 1869 681 11482 ----
NM_052917chr252884 2862 2598 927 53 23411 2672 --1225
NM_052937chr862731 1776 1695 474 447 86 32705 2617 2202 --21719 680
NM_052965chr11910 11121 1526 11144
NM_053002chr341173 1135 1116 821 --11026 --
NM_057175chr432672 511 310 22366 1829 --12193
NM_057749chr841348 1087 541 179 21048 197 --1912
NM_080671chr241877 1517 1508 409 22158 600 11520 --
NM_080743chr642142 1625 885 803 32597 2393 46 --1325
NM_080832chrX51789 1608 1431 1168 686 --1464 --
NM_080867chr14144951 4230 4101 3911 3306 3236 2019 1649 1524 1086 1016 935 896 368 34186 1898 1570 21625 830 --
NM_080923chr1285 68 2783 191 --172
NM_130809chr5112738 2625 2519 2441 2380 1142 1010 782 766 575 333 ----23041 359
NM_133264chr1722732 1475 23768 3339 1332 22752 2718
NM_133265chrX53680 3234 3215 3072 2436 12868 --1270
NM_133334chr484346 4034 3860 1215 830 601 549 329 15204 16209 --
NM_133433chr53782 700 673 1311 ----
NM_133468chr772017 1716 970 913 812 590 560 --2999 188 1983
NM_133496chr184408 4328 3923 3778 3551 3502 1234 777 --11044 33533 1794 1518
NM_133509chr14------11185
NM_134266chr82373 270 --2424 421 1428
NM_138288chr1441990 388 379 278 11776 1737 2805 590
NM_138333chr932517 972 93 12500 --1326
NM_138357chr1021644 600 1729 --11785
NM_138400chr743266 3160 2727 1023 1117 12783 22731 1239
NM_138423chr1542214 2049 1458 1428 ----11602
NM_138444chr1395001 4904 4453 4419 3169 1872 1330 1205 330 23634 1379 14409 14461
NM_138468chr295745 5659 5627 4474 2068 1177 1133 998 842 15794 --1659
NM_138473chr1284872 4202 3945 3759 3567 2054 1736 719 --1416 --
NM_138731chr1494279 4009 3963 3760 3347 3328 2900 653 260 43253 3063 1416 823 23601 2787 44202 3114 3070 678
NM_139136chr1241007 969 909 61 --1702 --
NM_139207chr1252050 1677 1563 1451 551 --1530 21635 303
NM_139242chr152435 29 21190 48 1417 --
NM_139321chr2084059 4022 3007 1620 1024 596 477 324 ------
NM_144563chr21777 2751 173 --1219
NM_144571chr496675 6503 6366 6214 1860 1639 1573 1446 1289 35062 4824 2345 ----
NM_144578chr14115247 3568 3551 3506 1823 1441 1068 654 539 365 333 --44299 3653 2157 92 15308
NM_144599chr1575224 4877 3467 2035 1243 1200 309 35508 5486 4052 15268 1682
NM_144641chr311195 ----11199
NM_144642chr32494 202 ----21048 90
NM_144664chr1152551 1877 1635 589 214 22497 514 --22522 2376
NM_144672chr16------1171
NM_144721chr452776 1974 1875 974 758 --22745 242 --
NM_144722chr581222 922 909 840 489 273 171 163 --11145 11149
NM_144778chr1372393 2374 2112 1857 1093 909 753 --12099 --
NM_144963chr852692 2640 2217 624 168 --1288 --
NM_144975chr1751379 1245 596 565 339 198 ----
NM_145010chr102879 754 2808 450 --130
NM_145178chr10------1571
NM_145307chr10134324 3551 3432 3100 3042 1798 1718 1671 1398 644 608 509 126 23606 3106 34028 3492 1337 14073
NM_145313chr101142 ----1310
NM_145756chr1821513 1090 11243 --148
NM_145913chr121341 11007 ----
NM_147156chr1061551 1452 990 600 360 95 1128 ----
NM_147188chr1551473 1407 1269 589 543 --1504 --
NM_152278chrX126 138 1614 --
NM_152292chr451597 1575 1542 706 375 21648 727 ----
NM_152347chr172135 47 --178 --
NM_152380chr1------11482
NM_152400chr461996 1976 1888 1680 604 465 --1607 --
NM_152409chr5103580 3200 3120 3104 2727 2635 2558 2373 731 345 ------
NM_152417chr831228 842 519 1280 ----
NM_152424chrX84389 4382 3920 2950 1784 1637 660 567 14362 14392 --
NM_152429chr10--1410 --11206
NM_152437chr1252447 2347 2211 701 513 --12217 --
NM_152450chr1551430 711 478 340 333 ------
NM_152556chr772343 1860 1834 1728 654 280 135 12577 1227 --
NM_152581chrX21406 214 --1406 --
NM_152594chr1562021 1901 1755 1532 463 352 12191 1538 11984
NM_152622chr583463 3413 3059 2932 2694 2620 2543 2458 12549 13258 11331
NM_152624chr5147089 6788 6654 6324 6281 6234 6184 5953 5200 2126 1857 1685 1443 354 22978 1518 --24687 419
NM_152636chr1142108 1208 1039 50 ------
NM_152641chr1251804 972 696 581 110 --159 --
NM_152653chr31607 2231 110 --1715
NM_152707chr103750 372 139 1925 1375 1379
NM_152723chr113812 154 92 1277 11027 1172
NM_152731chr6----1410 --
NM_152740chr73742 525 27 --2723 715 --
NM_152756chr563424 3119 1386 678 464 121 --23506 857 12958
NM_152774chr772298 2240 1930 1029 480 304 124 --1322 1831
NM_152787chrX83728 3598 3541 3357 2775 2767 1150 1065 23810 784 --11181
NM_152793chr795072 4453 3766 1668 1358 1236 1177 662 281 15198 ----
NM_152835chr14898 490 230 174 22860 2226 12763 --
NM_152888chr81212 --4235 232 229 201 2205 167
NM_153020chr671675 1517 1201 1100 606 139 122 --11432 --
NM_153207chr1232833 1426 788 23259 760 --32826 1300 663
NM_153235chr672362 2259 2234 2112 1826 474 165 22444 280 1564 --
NM_153262chr163033 2540 2236 1009 393 63 12905 12085 --
NM_153365chr482641 2592 2359 2133 1858 1852 1715 422 1626 32049 845 116 --
NM_153687chr123303 192 101 11549 ----
NM_153810chr1094389 4283 4091 4055 3753 3696 3206 3096 933 35011 3821 979 33799 3766 1526 12029
NM_153834chrX----1342 --
NM_170606chr771583 1440 1407 752 727 688 665 1465 ----
NM_170710chr472992 2939 2546 2495 2380 2348 739 ----22394 2046
NM_172037chr821290 284 21460 381 11398 --
NM_172069chr252290 2035 1853 1697 390 ----11497
NM_172070chr252111 1524 847 317 219 2671 563 11743 --
NM_172071chr1147314 7304 7257 5901 5705 2579 2167 2077 1651 1613 1284 1007 574 536 --65916 5913 5910 5907 5904 5877 35179 5109 1512
NM_172127chr432023 1657 263 2433 345 21705 376 --
NM_172373chr1351371 962 843 377 165 ----11375
NM_173083chr121166 198 --11271 --
NM_173156chr131706 467 449 --2473 470 --
NM_173468chr495474 5164 4650 3937 1726 1222 1126 607 169 11330 25185 1371 25234 1086
NM_173470chrX52729 2542 314 269 221 ----1155
NM_173475chr1651679 1262 1216 706 511 --1388 1554
NM_173494chrX5785 692 173 165 93 --3862 613 610 --
NM_173495chrX52613 2217 1992 1806 823 1320 --12260
NM_173508chr141108 1067 938 378 --11211 --
NM_173511chr283310 3294 3204 3181 3093 2950 2577 424 --13579 --
NM_173517chr72167 72 --690 87 84 81 78 75 --
NM_173536chr4105073 5000 3797 3387 1922 1795 996 846 269 134 15012 21115 940 34193 3683 423
NM_173552chr332306 541 289 --21557 560 22429 1002
NM_173560chr62389 65 ----1218
NM_173576chr1052009 774 694 490 335 --11820 --
NM_173582chr11126128 5596 5559 5420 4660 4334 4140 2431 943 677 311 235 15740 65981 5495 4132 2046 2032 1182 --
NM_173602chr1252938 1526 1508 1485 1381 33768 3290 2440 ----
NM_173644chr2051981 1935 1904 1853 1326 ------
NM_173647chr241015 765 121 111 --1247 --
NM_173648chr231021 954 287 --1677 11086
NM_173653chr361335 1271 589 452 190 177 ------
NM_173794chrX------1526
NM_173808chr1144426 4401 3978 3792 3742 3673 3505 3059 3040 1491 1444 1427 749 486 ----13982
NM_173822chr231807 1610 1402 --21538 102 1733
NM_174938chr92505 123 ------
NM_175709chr2232147 91 29 ----13086
NM_175736chr1287801 7282 6526 5920 5097 1954 745 347 16153 ----
NM_175856chr53232 90 78 --296 93 --
NM_175884chr72376 333 ----11109
NM_175907chr1852790 2753 2650 2487 565 12868 --11966
NM_175921chr572712 1266 913 620 548 362 299 23644 1486 24294 3131 --
NM_176814chr721510 540 --11370 --
NM_177538chr2138064 7651 6510 6500 5692 5517 3441 3009 2246 1872 1826 326 267 1773 --28927 3412
NM_178011chr10113252 3084 3063 2167 2054 958 803 714 548 474 433 --22595 2592 --
NM_178123chr22825 778 2810 338 --1873
NM_178454chr11170 ----1199
NM_178812chr821160 1059 11496 --11526
NM_178818chr1641988 983 963 906 22310 196 12479 --
NM_178826chr12----1518 --
NM_178863chr162511 483 1505 ----
NM_181354chr871646 1500 1488 1441 1244 1205 133 ------
NM_181358chr173454 1197 924 902 877 807 227 23922 1142 23628 880 1654
NM_181655chr171307 1762 ----
NM_181672chrX22002 1521 11287 --11563
NM_181714chr651617 1407 1386 634 63 1103 11992 11827
NM_181715chr11388 1397 1408 --
NM_181782chr661827 1775 1731 1635 503 396 12120 21897 815 --
NM_181783chr1232031 784 255 32016 1698 372 12034 --
NM_181784chr232413 2329 536 ----1277
NM_181787chr883861 3677 3119 1404 1340 586 386 301 43577 1107 702 132 --13443
NM_181836chr551987 1805 600 460 213 12390 22584 1980 11949
NM_182485chr4123704 3339 3269 3087 2949 2637 2487 1434 888 562 556 462 1636 --33761 2655 783
NM_182503chr664422 4267 3673 3585 1600 195 24727 145 --24479 3667
NM_182569chr171116 ------
NM_182663chr152057 1957 739 508 424 --158 152
NM_182765chr1032167 1572 1525 22158 2103 12092 --
NM_182830chr144894 612 564 529 --41605 1602 618 615 --
NM_182920chr32288 247 --1349 21427 523
NM_183376chr1562549 2324 2112 2045 1930 1747 22629 214 22640 1773 12553
NM_194247chr253941 3303 1522 1465 500 33527 1134 227 11341 --
NM_194272chr15------1817
NM_194286chr1265877 5347 4093 2315 2242 2152 35070 4840 3878 ----
NM_194291chr882640 2378 2349 2076 2001 964 775 602 32467 1946 530 1471 --
NM_194314chr1115493 4551 4196 3592 1853 1347 811 626 437 229 84 15264 31845 1350 273 --
NM_194356chr1252164 2080 1850 958 872 11558 164 --
NM_197941chr5102872 2851 2231 2215 1191 574 400 384 340 160 11923 --12906
NM_198077chr1182 --2612 441 --
NM_198215chr1051479 1341 1051 566 355 11407 --11193
NM_198273chr551110 940 853 810 441 1329 12989 --
NM_198281chr453436 3187 2385 330 308 2643 134 1413 --
NM_198485chr341936 841 98 74 22645 812 41771 798 764 252 --
NM_198503chr192431 2234 2222 2145 1979 1644 740 621 424 1187 --1309
NM_198513chr831817 1449 769 21805 1251 --1500
NM_198516chr111201 ----1262
NM_198531chr181605 --1614 --
NM_198566chr5------129
NM_198581chr2167541 7499 7410 7298 7245 7037 5966 2517 2508 2201 2118 2092 1885 1149 556 539 47417 2044 2020 1442 45955 5455 2392 892 --
NM_198844chr171225 ------
NM_198859chr3125081 5029 4482 4135 4125 3454 1990 1433 1162 374 194 67 --24468 667 --
NM_199072chr782792 2238 2100 1233 1141 1128 344 122 ----1113
NM_199320chr462904 2806 2448 1786 595 486 --32118 918 721 11118
NM_199328chr214295 162 143 99 --1438 1483
NM_199355chr1671786 1683 1645 1236 684 579 437 11669 1262 --
NM_203282chr1941721 1456 276 54 11268 21368 1208 --
NM_203364chr115498 385 352 250 178 31105 1018 49 ----
NM_203406chr5132904 2728 2378 2302 2167 2055 1111 923 835 805 722 405 58 31141 994 858 32232 808 107 --
NM_203458chr173600 3538 3239 2830 1391 958 936 1273 23399 2563 13519
NM_203459chr1122591 2483 2458 2359 2299 2156 1611 1597 1024 622 593 409 42106 1931 651 100 22420 2288 --
NM_205852chr1272025 1402 1344 849 679 625 387 --12070 11446
NM_206853chr6103358 3300 2860 2696 2665 2638 2622 1660 1043 241 41102 1032 689 153 11046 13563
NM_206854chr6174619 4561 4121 3957 3926 3899 3883 3752 3618 1502 1112 1086 1035 957 434 68 36 31950 1414 528 1868 14824
NM_207015chr392332 2219 2187 2015 1993 1730 782 283 124 32228 377 250 1128 1438
NM_207337chr126354 311 232 203 110 100 ------
NM_207435chr123886 873 143 3986 914 349 ----
NM_207645chr1131232 1030 960 1235 31353 1018 253 11034
NM_212558chr993714 3692 2648 1677 1562 1012 795 772 600 43309 3264 2911 1103 23359 96 13749
NM_213589chr2105293 4840 4042 3862 3460 3421 1593 988 836 462 --35509 5227 1489 15033
NM_213606chr1042489 2437 1694 933 --2118 115 --
NM_214711chr4133941 3780 3671 3446 3146 2959 2630 2490 1415 1062 692 620 92 1965 11447 13932