TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-634
miRNA Sequence: AACCAGCACCCCAACUUUGGAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr5------1344
NM_000084chrX66360 5678 5021 4367 4306 1182 1769 --1681
NM_000142chr411417 11165 157 --
NM_000163chr541769 1708 956 653 1611 ----
NM_000176chr553261 3029 2839 869 681 1981 1397 --
NM_000208chr1953901 3208 3036 1287 1098 11313 1361 --
NM_000214chr201506 --11387 1541
NM_000264chr933043 1233 924 --22980 757 --
NM_000280chr11----1332 --
NM_000368chr984289 3329 1206 894 779 482 260 39 11721 --1758
NM_000378chr111178 ----1850
NM_000408chr253021 2568 2508 2410 707 --2764 149 --
NM_000430chr171328 12690 1366 --
NM_000533chrX1216 11432 ----
NM_000601chr71281 --1344 --
NM_000721chr142578 700 628 231 ------
NM_000767chr1941233 1223 485 432 ------
NM_000801chr201378 --1920 --
NM_000813chr545600 3482 1600 124 --13853 --
NM_000814chr1523473 2896 --11357 --
NM_000828chrX----1561 --
NM_000829chr11----2725 41 --
NM_000857chr4----1461 --
NM_000859chr521665 1243 --1526 --
NM_000868chrX1653 --177 1600
NM_000875chr1596437 6070 5016 4769 4271 2145 2123 1448 668 --12358 --
NM_000891chr1722972 1009 --150 --
NM_000895chr12----1123 --
NM_000899chr121295 144 ----
NM_000964chr1731368 508 426 ------
NM_001001342chr1021399 365 --1116 --
NM_001001395chr1212789 --22091 1736 --
NM_001001549chr742169 2125 159 71 ------
NM_001001668chr1943982 1686 1543 1398 --34300 3891 3418 11578
NM_001001890chr2134041 3414 211 --23790 3261 --
NM_001002243chr21253 ----1125
NM_001002843chr15------1504
NM_001002860chr1411448 --23053 656 --
NM_001003406chr2233248 2779 2117 13240 ----
NM_001003652chr1858456 6244 5774 3060 818 ------
NM_001003688chr42853 129 ------
NM_001003800chr943063 1452 980 617 --13527 --
NM_001003810chr4----1565 --
NM_001003940chr1553483 3365 2861 2467 835 ------
NM_001004303chr1----1180 --
NM_001004316chr31253 ------
NM_001004317chr622977 1357 --23569 1565 --
NM_001004419chr1243958 3790 2801 737 ------
NM_001005386chr211687 ----12011
NM_001005404chr1734337 3509 622 11214 14504 --
NM_001005463chr101337 --21931 701 --
NM_001005476chr2--1650 1452 --
NM_001005505chr33727 345 252 --11426 --
NM_001006600chr51474 --1528 --
NM_001006656chr1921424 1147 --21690 1385 --
NM_001006665chr13774 575 526 --1207 --
NM_001007024chr1713096 --23493 3428 --
NM_001007097chr954210 3115 1077 790 88 --147 --
NM_001007102chr611481 11260 ----
NM_001007246chr21--11950 1622 11315
NM_001007271chr10181 1794 173 1716
NM_001007277chr1141113 932 899 750 ------
NM_001007466chr641668 1423 725 653 --24957 4925 --
NM_001007559chr1841883 1830 1820 780 ------
NM_001007565chr31157 --1132 --
NM_001008408chr735113 698 200 ----14649
NM_001008495chr812259 --21861 1756 --
NM_001008540chr21109 --1433 --
NM_001008701chr1962609 1929 1041 579 98 26 ------
NM_001008895chr13------1961
NM_001009566chr111038 ----1914
NM_001009899chr355270 5177 2314 2187 429 ----11130
NM_001009993chr2104217 3546 3351 2912 1734 1391 1377 646 188 62 --13398 11675
NM_001010898chr123642 1246 --22547 904 --
NM_001010983chr3--1278 1303 --
NM_001010989chr163553 389 24 ----1371
NM_001011545chr21----1452 --
NM_001011666chr721588 1552 --11814 --
NM_001012329chr132407 2203 434 ----11674
NM_001012423chr15----22916 333 --
NM_001012426chr663037 3016 2809 1038 698 575 --22747 1158 --
NM_001012761chr51179 --12403 --
NM_001013415chr421490 124 --11201 --
NM_001013620chr1275963 3089 3037 2131 1928 854 264 --38240 3393 612 --
NM_001013693chr172049 1126 908 579 468 383 296 11988 12360 --
NM_001014797chr1068054 7810 6973 2685 2665 1232 --18122 --
NM_001017371chr21368 --11221 1339
NM_001017424chr11602 ----173
NM_001017916chr171764 --22065 509 --
NM_001017977chr1----1328 --
NM_001018067chr125330 2026 11061 11662 1817
NM_001018108chr1521792 1704 22316 1629 1898 --
NM_001023567chr152980 333 --12308 --
NM_001024401chr1641029 1020 507 162 --22313 2275 --
NM_001024808chr1232594 968 673 ------
NM_001025068chr321758 148 --21273 208 --
NM_001025076chr1055549 5321 2433 1939 973 --33997 786 443 13981
NM_001025232chr12----1232 --
NM_001025580chrX--13808 1717 --
NM_001030006chr1721666 162 11971 12495 --
NM_001030007chr1653607 1426 1207 321 72 ------
NM_001030055chr1424237 1537 ----11189
NM_001031684chr231363 974 524 11414 21243 354 --
NM_001031695chr2225378 1100 --14288 --
NM_001031702chr33824 796 186 1665 ----
NM_001031748chr12----1565 --
NM_001032380chr1021949 1421 ----1640
NM_001033044chr111368 ------
NM_001033087chr2033198 1079 364 12703 12444 --
NM_001033117chr374670 4168 3915 3892 2961 1190 228 --24880 4751 --
NM_001033925chr1011588 --1629 --
NM_001034845chr431431 233 110 ------
NM_001035254chr972229 2052 1934 923 578 315 179 ------
NM_001037332chr512399 --1189 --
NM_001038640chr153401 249 95 ------
NM_001039538chr223624 3521 --11131 --
NM_001039574chr11719 --1926 --
NM_001039590chrX21037 948 1526 ----
NM_001039618chr1164264 4133 2212 1396 1369 757 --1455 --
NM_001039690chr1632358 1991 263 ------
NM_001039840chrX35816 5194 4493 14355 32289 282 143 --
NM_001040002chr1731398 1263 973 ------
NM_001040142chr2----12131 --
NM_001040284chr1625642 1056 ----1349
NM_001040402chr422973 892 --1130 --
NM_001040429chr1312811 ------
NM_001040708chr8----2738 150 --
NM_001040712chr912466 --1382 --
NM_001042355chr16----1219 12029
NM_001042440chr5151 --1821 --
NM_001042479chrX22150 1617 ----1266
NM_001042555chr12----2609 273 --
NM_001042599chr256724 2836 2368 925 236 ----17110
NM_001042603chr1275107 4984 1491 1461 1441 294 138 ------
NM_001042604chr321065 896 14189 --11362
NM_001044305chr6----1144 --
NM_001049chr1422040 594 --12077 --
NM_001079874chr111345 ----1175
NM_001160chr1231137 1084 773 --11969 1270
NM_001172chr14----1554 --
NM_001174chrX1160 --22290 230 --
NM_001174chrX1160 --22290 230 --
NM_001174chrX1160 --22290 230 --
NM_001197chr221133 --2399 312 --
NM_001198chr61598 --11477 --
NM_001204chr225273 478 --17421 --
NM_001219chr732154 1698 660 ------
NM_001222chr1021718 1233 --11589 11947
NM_001273chr121442 ------
NM_001351chr311718 --2354 38 --
NM_001364chr1123817 1544 --13851 --
NM_001396chr21--11715 22326 320 --
NM_001406chr1721551 1413 ------
NM_001407chr321592 535 --1672 --
NM_001420chr1922993 2450 ------
NM_001421chrX----1420 --
NM_001430chr211351 ----11804
NM_001431chr611020 1369 11057 --
NM_001438chr11959 --13274 --
NM_001440chr83745 302 118 --195 --
NM_001482chr15----1351 --
NM_001497chr942573 1823 78 72 --12494 --
NM_001518chr72243 202 ------
NM_001530chr141189 ----1853
NM_001663chr141216 --11910 12750
NM_001681chr121100 --1616 1733
NM_001730chr13----11014 --
NM_001753chr711307 --1384 --
NM_001800chr192469 205 --1140 --
NM_001826chr1------1144
NM_001858chr634841 4350 3369 --21625 1257 --
NM_001896chr16----1285 --
NM_001927chr25661 617 569 266 238 ------
NM_002006chr444430 1518 1244 515 15467 1593 --
NM_002017chr1121031 109 ----1158
NM_002025chrX69250 9242 9058 2945 2038 1569 1944 19141 11539
NM_002077chr9------1725
NM_002086chr1721894 1527 1368 ----
NM_002106chr4----163 --
NM_002128chr131993 --1272 --
NM_002137chr7----21998 620 --
NM_002140chr911091 --1303 --
NM_002202chr5134 ------
NM_002264chr311472 ----1815
NM_002270chr521562 196 14997 35052 1829 1497 --
NM_002356chr622598 56 --1751 --
NM_002359chr17114046 3649 3519 3188 1303 1295 968 625 552 288 206 --11202 --
NM_002384chr182888 202 --1684 --
NM_002401chr1742101 1927 1632 60 ------
NM_002480chr12----1189 --
NM_002500chr211080 ----11213
NM_002522chr1763311 2831 2652 1155 468 288 ------
NM_002537chr152388 351 ------
NM_002569chr1541462 1456 1441 319 --11510 --
NM_002609chr541731 626 594 495 ------
NM_002618chr2----1161 --
NM_002648chr62471 262 --11244 --
NM_002657chr2063373 2926 2387 1184 1101 436 ----12574
NM_002709chr212770 1807 11067 --
NM_002715chr511283 --2893 227 --
NM_002731chr112203 --2418 329 --
NM_002736chr72599 508 --11876 --
NM_002745chr2214204 --33593 3358 923 --
NM_002843chr1142853 2663 776 372 12806 13391 --
NM_002858chr1----1205 --
NM_002890chr51933 --1155 --
NM_002906chr1121846 601 ----1891
NM_002928chr141581 1511 255 200 --11398 --
NM_002941chr331463 523 225 ------
NM_002996chr1631847 1657 252 ------
NM_003016chr1711444 --11630 --
NM_003030chr31306 --11368 --
NM_003070chr9----1850 --
NM_003076chr12----1115 --
NM_003108chr245661 2176 1544 530 ----11088
NM_003110chr17----11068 --
NM_003112chr72724 73 ------
NM_003128chr21294 ----1322
NM_003150chr1741821 1710 1606 1590 1952 ----
NM_003156chr1131290 924 115 ------
NM_003161chr1721440 603 ------
NM_003164chr11129 --1508 --
NM_003205chr1512163 --12207 --
NM_003216chr2243181 3058 2299 2146 --13290 --
NM_003221chr633879 404 383 ------
NM_003246chr1531348 742 564 --11891 146
NM_003274chr2142872 2840 2217 330 --1223 --
NM_003275chr931316 604 89 --11549 --
NM_003319chr21971 ----1295
NM_003336chrX2416 400 ------
NM_003337chr5----1257 --
NM_003369chr11------12766
NM_003375chr102177 166 ------
NM_003392chr344301 2755 1687 1069 14167 ----
NM_003404chr201443 1164 ----
NM_003409chr18----11063 --
NM_003412chr311167 11924 12802 --
NM_003413chrX----1346 --
NM_003459chr2----1666 --
NM_003470chr1611184 --1116 --
NM_003478chr1143031 1246 488 75 --1634 --
NM_003482chr1262596 2439 2355 1959 1882 693 ------
NM_003483chr1212437 --12671 --
NM_003559chr1723347 2630 --13009 13152
NM_003566chr1212462 ----22527 2335
NM_003590chr242766 1325 882 330 ------
NM_003597chr21133 --1399 --
NM_003622chr1222507 622 --12639 --
NM_003633chr532319 1844 449 ----1586
NM_003692chr91121 --1878 --
NM_003787chr181660 11690 11563 --
NM_003806chr12292 62 ------
NM_003861chr1442773 2725 1166 508 --11918 --
NM_003872chr232555 1872 247 12262 ----
NM_003873chr1041874 1810 1781 359 --3810 241 216 --
NM_003885chr1751701 1668 697 676 286 --22481 929 --
NM_003913chr612742 ----11332
NM_004093chr1332658 981 86 --22892 2204 --
NM_004096chr101813 ----11317
NM_004100chr652348 2206 2072 1737 567 ----1252
NM_004103chr8----172 --
NM_004136chr15157 12737 1383 --
NM_004161chr231420 1092 288 --1225 --
NM_004202chrY----1221 --
NM_004228chr19------1152
NM_004274chr1442876 2492 1284 211 --1803 --
NM_004296chr1421533 1013 11498 --14025
NM_004302chr1231841 1827 169 --1715 --
NM_004389chr2------1853
NM_004392chr1322278 268 --2911 797 --
NM_004397chr1164218 3914 3305 3131 1720 1073 --1244 --
NM_004423chr322038 645 --32311 702 284 --
NM_004432chr922340 376 12297 1882 --
NM_004436chr1167 --1152 --
NM_004437chr132946 2819 397 ------
NM_004450chr14----1267 --
NM_004481chr132680 853 786 --12464 --
NM_004491chr1954127 3009 1152 1145 875 --21258 434 --
NM_004497chr192644 519 ------
NM_004586chrX34273 3407 599 1112 25221 4049 --
NM_004609chr201204 1569 ----
NM_004612chr933568 3140 317 --1288 --
NM_004666chr6----11517 --
NM_004687chr171256 ------
NM_004745chr845923 5069 4676 2467 --16624 --
NM_004772chr5------1643
NM_004774chr1732663 1993 933 --12454 --
NM_004781chr111244 --1528 --
NM_004783chr16----1681 --
NM_004788chr1122237 706 --1876 --
NM_004798chr202768 657 --21298 1171 --
NM_004814chr1173 ------
NM_004834chr252649 2523 386 232 133 11264 ----
NM_004849chr631620 1406 167 ------
NM_004852chr181213672 13402 11780 10450 10006 9756 9591 5426 5267 3283 3026 2269 --113205 14904
NM_004926chr1421471 1436 --11755 --
NM_004973chr61327 --11491 --
NM_004985chr12----24392 320 --
NM_004992chrX27643 6926 --15661 --
NM_004995chr1421472 302 1344 11067 --
NM_005045chr7----1625 --
NM_005067chr31882 --2962 198 --
NM_005109chr332377 2143 664 ------
NM_005119chr121240 58 --1265 --
NM_005153chr161835 --1516 --
NM_005254chr151406 --1364 --
NM_005297chr222819 165 --1271 --
NM_005339chr424025 2934 --21058 383 --
NM_005342chrX----1291 --
NM_005354chr191458 --1487 --
NM_005359chr1865708 2343 2290 2280 1499 794 11283 ----
NM_005375chr6----1875 --
NM_005376chr11746 ----153
NM_005378chr23247 195 163 --189 --
NM_005398chr103466 296 165 --1429 --
NM_005400chr252498 2387 1925 563 65 ------
NM_005415chr21652 ------
NM_005494chr72519 177 1590 1653 --
NM_005502chr92827 475 --13304 --
NM_005563chr1--1543 1211 --
NM_005576chr15----1223 --
NM_005596chr954690 4306 2488 2419 545 --25110 1088 --
NM_005665chr13761 708 698 --21259 999 --
NM_005678chr152676 199 ------
NM_005686chr121124 188 ----192
NM_005688chr31492 11211 21157 907 --
NM_005717chr121064 310 ----147
NM_005720chr7137 --1246 --
NM_005736chr1021094 1019 --11026 --
NM_005737chr242831 2200 962 679 --22091 504 --
NM_005746chr7--1934 1106 --
NM_005748chr12------23191 491
NM_005779chr522487 2336 13171 ----
NM_005832chr31921 --1206 --
NM_005850chr1----1174 --
NM_005859chr521437 1258 ------
NM_005860chr1921603 191 --11356 1367
NM_005862chr3----1187 --
NM_005871chr10----1950 --
NM_005880chr1621181 639 --1114 --
NM_005907chr6----1641 --
NM_005911chr251345 1311 1284 1006 32 ------
NM_005937chr1743265 1534 566 335 ------
NM_005941chr81635 --1148 --
NM_005966chr2----12377 --
NM_006049chr154161 155 148 23 ------
NM_006076chr763128 2131 1282 1234 1088 976 --1605 --
NM_006135chr1----1277 --
NM_006167chr81455 11714 11811 --
NM_006224chr1772425 2400 2309 2115 2102 954 883 ----11683
NM_006313chr1221561 1295 --2347 42 --
NM_006315chr434409 3718 1163 --43860 1010 937 772 --
NM_006352chr131666 492 445 --12058 --
NM_006371chr373875 3392 3316 1993 475 422 412 --14354 --
NM_006389chr112363 88 --11329 --
NM_006449chr231998 1888 101 ----1593
NM_006496chr111646 11860 --11693
NM_006516chr121123 471 ------
NM_006517chrX21763 558 ------
NM_006547chr731450 724 529 --11925 --
NM_006599chr1657366 7343 2693 2286 487 1837 11650 --
NM_006614chr333197 2622 99 --13279 --
NM_006618chr111121 --2626 572 --
NM_006624chr101449 --1492 --
NM_006675chr1242171 1264 1184 1004 --23322 970 --
NM_006690chr2032020 1460 545 --1452 --
NM_006699chr112682 ----1788
NM_006717chr9----12436 --
NM_006761chr17----1140 1580
NM_006775chr622433 2250 --1952 --
NM_006818chr1----1109 --
NM_006833chr71162 --1127 --
NM_006888chr1432549 440 181 --1615 --
NM_006902chr12676 240 --32894 2868 718 --
NM_006915chrX31922 1913 1575 ----1622
NM_006940chr1211262 ------
NM_006948chr2112014 1389 ----
NM_006999chr531443 1367 635 ------
NM_007107chr3----31949 1811 721 --
NM_007125chrY21116 372 ------
NM_007170chr12862 692 ------
NM_007185chr121019 294 --1676 --
NM_007249chr1348868 6301 1951 1667 17077 29262 2261 --
NM_007275chr33881 202 121 --1176 --
NM_007359chr1711524 --11643 --
NM_007375chr111002 125 --12230
NM_012092chr211627 --1122 --
NM_012096chr313181 --23236 404 --
NM_012104chr1143609 1481 438 224 ------
NM_012156chr2022284 214 ----1988
NM_012157chr3------1975
NM_012164chr952914 2471 2418 2408 1849 --1248 --
NM_012186chr12746 671 ------
NM_012197chr9----11609 1133
NM_012199chr184106 3773 3544 3263 2987 1767 763 381 ------
NM_012215chr1011798 --2750 583 --
NM_012231chr11315 --11772 --
NM_012234chr343553 3352 2631 537 ----12309
NM_012238chr10--1128 1250 --
NM_012244chr1421532 249 11725 ----
NM_012249chr232316 1175 1022 1840 13059 --
NM_012281chr712418 1120 12254 --
NM_012288chr633765 958 266 22066 472 25482 1065 --
NM_012296chr1133941 3627 3163 --23773 2404 --
NM_012297chr41368 ----1930
NM_012329chr1711492 --11263 --
NM_012383chr9------182
NM_012399chr22--1441 11253 --
NM_012459chr11----1121 --
NM_012479chr732554 1003 698 ----2896 202
NM_013261chr4----13614 --
NM_013354chr8----1921 --
NM_013374chr3----12141 13072
NM_013390chr93712 221 25 --11192 --
NM_014048chr1621449 750 --14821 --
NM_014079chr341007 435 412 299 ------
NM_014112chr835341 4002 1964 11085 1863 --
NM_014153chr161263 ----1670
NM_014232chr1731571 1320 1189 ------
NM_014292chr2211699 11751 11365 --
NM_014293chr2211557 --1611 --
NM_014423chr51123 14939 24765 4289 --
NM_014426chr20----1161 --
NM_014507chr222201 188 --1786 --
NM_014562chr2----1752 --
NM_014637chr81498 1482 ----
NM_014647chr1612266 ------
NM_014663chr11290 ----1369
NM_014665chr873427 3006 2700 822 579 117 66 ------
NM_014667chr332169 842 141 ----1950
NM_014671chr731404 1152 1075 --1328 --
NM_014682chr82663 447 ----1911
NM_014705chr711414 --12117 11335
NM_014729chr8----1252 --
NM_014730chr1234482 3756 742 --13209 1917
NM_014776chr1232494 2028 1177 --1209 --
NM_014803chr1022164 1080 ------
NM_014827chr121320 1258 --11071 --
NM_014828chr1421735 40 ----1308
NM_014830chr1272520 1248 1194 1134 852 283 258 --32587 542 70 --
NM_014839chr121895 565 ------
NM_014873chr184869 4750 4255 4173 2955 1466 1403 448 ----11622
NM_014876chr2252214 2045 1471 834 781 --1772 --
NM_014877chr1756167 6106 5602 1590 403 --1804 --
NM_014903chr121859 --1450 --
NM_014904chr1023487 370 ----1267
NM_014912chr10------13113
NM_014924chr1452225 2184 2075 2065 403 12826 2354 248 --
NM_014927chrX------138
NM_014952chr1541290 770 614 111 11893 ----
NM_014969chr11154 --1264 --
NM_014978chr102626 439 ------
NM_014989chr6188 --2455 220 --
NM_014991chr412386 12815 ----
NM_015027chr16----11386 --
NM_015042chr1534116 762 362 1217 13599 --
NM_015045chr1021459 37 ------
NM_015051chr932655 2204 1137 ----1392
NM_015079chr1553138 441 345 205 70 1577 ----
NM_015092chr1623608 1510 ------
NM_015100chr111808 --1646 --
NM_015101chr122257 2176 --12705 --
NM_015110chr922163 2112 1179 --12520
NM_015124chr2271968 1567 1527 934 870 691 26 ------
NM_015132chr72269 22 ------
NM_015155chr105989 487 217 131 87 1544 ----
NM_015161chr161397 --11066 --
NM_015170chr8----11491 --
NM_015172chr141314 1002 494 71 ------
NM_015199chr322651 2254 ------
NM_015206chr1513854 --1464 13553
NM_015213chr114608 282 254 233 ------
NM_015231chr111343 --1179 --
NM_015252chr21783 ----1388
NM_015271chr412953 --13534 --
NM_015277chr18--11422 21825 1184 --
NM_015278chr6----1783 --
NM_015299chr1461442 1174 960 617 299 113 13636 ----
NM_015310chr846627 2973 583 510 --26950 28 15732
NM_015313chr1134424 4127 35 --13613 11359
NM_015326chr132957 2769 931 ------
NM_015329chr1932842 2722 976 ------
NM_015332chr733251 828 402 --12396 --
NM_015335chr1212057 12552 ----
NM_015339chr202234 23 ------
NM_015344chr831850 1488 48 --1605 --
NM_015358chr2121266 198 ------
NM_015393chr411007 ----1119
NM_015460chr31393 --11622 --
NM_015465chr5----1269 --
NM_015483chr7------1467
NM_015493chr1921783 273 1315 ----
NM_015503chr163469 180 162 ------
NM_015509chr122594 152 --1659 --
NM_015511chr201422 --11107 --
NM_015550chr713350 12666 1510 --
NM_015576chr352456 2361 540 435 303 --1467 --
NM_015578chr1931685 1440 523 ------
NM_015652chr10----1620 --
NM_015690chr21681 --1216 1692
NM_015850chr862101 1991 1762 256 104 66 --21895 197 11709
NM_015872chr131347 1310 110 --11264 --
NM_015885chr11148 --1834 --
NM_015906chr133804 558 93 13027 14682 --
NM_015981chr531947 342 93 --23020 71 --
NM_015995chr1575162 2087 2062 1591 1314 956 427 --14112 --
NM_016037chr131048 426 416 ------
NM_016081chr422099 1502 --12198 --
NM_016083chr613301 13712 ----
NM_016221chr512049 11839 ----
NM_016248chr1333670 2877 1003 --11398 13053
NM_016263chr1943432 2624 2232 902 --12719 --
NM_016300chr31166 ----1123
NM_016322chr962713 1266 887 863 300 50 ------
NM_016396chr15--11017 --12547
NM_016424chr172642 459 --11297 1405
NM_016441chr221465 326 --1885 12073
NM_016530chr1531546 1106 944 --13338 --
NM_016531chr424192 114 ------
NM_016577chr353273 3174 1510 945 812 --14520 --
NM_016605chr542528 1073 542 199 ------
NM_016620chr1----1225 --
NM_017423chr4--12062 --1260
NM_017450chr1751127 536 267 139 88 11220 ----
NM_017508chr1112506 --22182 1000 --
NM_017580chr101717 ------
NM_017582chr12292 234 --1464 --
NM_017622chr172169 112 --1640 --
NM_017633chr633712 2498 593 12698 13332 --
NM_017637chr968790 3495 1709 1062 751 646 19203 18832 --
NM_017693chr13----11275 11398
NM_017799chr1411878 --11500 --
NM_017801chr322134 903 --1502 1641
NM_017811chr942434 1958 927 398 --12811 --
NM_017831chr1873866 3525 3003 2966 2956 1870 684 --14179 --
NM_017848chrX11775 --23830 3156 14051
NM_017964chr23716 665 655 ------
NM_017998chr9----21143 1017 --
NM_018011chr132532 416 ------
NM_018013chr631229 901 83 ------
NM_018028chr1931367 1140 931 11331 ----
NM_018061chr1----1310 --
NM_018110chr162478 32 ----11005
NM_018116chr11500 ----1514
NM_018133chr321535 456 --173 12157
NM_018293chr33901 384 173 ----13007
NM_018325chr921567 1169 147 ----
NM_018367chr1122111 171 --1313 --
NM_018383chr221523 1487 --11434 --
NM_018416chr1222347 1826 --12334 --
NM_018602chr1511243 21726 1610 ----
NM_018638chr12----1575 --
NM_018652chr152401 249 ------
NM_018689chr1582586 2083 996 926 716 386 226 216 ------
NM_018841chr132490 693 240 --23530 3513 --
NM_018948chr121159 191 --1996 --
NM_018951chr75399 346 155 93 44 --1197 --
NM_018976chr1232844 1763 123 ------
NM_018977chrX----1981 --
NM_018999chr1034939 4716 3012 --21546 1056 11564
NM_019072chr5----1431 1352
NM_019074chr152866 741 ------
NM_019106chr2243236 2857 2728 359 --12110 --
NM_019106chr2243236 2857 2728 359 --12110 --
NM_019116chr1643714 2916 2642 2331 --1822 --
NM_019843chr22176 ------
NM_020116chr431328 630 123 ------
NM_020159chr41271 ------
NM_020338chr1021477 506 --13161 --
NM_020342chr232261 722 150 ------
NM_020363chrY188 --1126 --
NM_020390chr351185 1132 647 575 134 --23157 1451 13173
NM_020429chr741994 1132 961 143 --22044 171 --
NM_020465chr162557 373 11499 11913 --
NM_020529chr14------1450
NM_020647chr832341 1905 249 --12027 12089
NM_020651chr2----1339 --
NM_020713chr2052361 2219 2029 907 417 --22697 2404 --
NM_020717chrX43222 1916 1460 730 --13208 --
NM_020728chr71189 --1380 --
NM_020734chr1233251 2934 394 --12347 --
NM_020742chrX1185 --12276 --
NM_020796chr542737 1849 1216 626 ------
NM_020801chr51866 ------
NM_020850chr1651281 1009 400 363 236 ------
NM_020858chr15----1217 11782
NM_020859chr473877 3462 3398 3114 1280 1189 203 --32935 2684 365 --
NM_020935chr214205 --1708 --
NM_020962chr15----21898 1768 --
NM_020981chr2------164
NM_021072chr512533 --11951 --
NM_021079chr1722844 2514 --173 --
NM_021097chr212512 --22461 2101 --
NM_021140chrX2388 98 ------
NM_021145chr721128 845 ------
NM_021151chr7154 167 --1333
NM_021155chr1952493 2026 836 782 200 --1773 11909
NM_021249chr1431544 1465 1398 11503 --11699
NM_021252chr1011364 ----1829
NM_021643chr211833 1461 ----
NM_021648chr63602 418 161 --1714 --
NM_021728chr14------1856
NM_021814chr6----11398 --
NM_021943chr63371 294 190 ------
NM_021960chr1----12748 --
NM_022041chr1642689 1673 240 100 ------
NM_022042chr41242 --1977 1404
NM_022044chr22----1118 --
NM_022075chr12709 200 ------
NM_022114chr12693 328 --14428 --
NM_022130chr5------1169
NM_022459chr1355825 968 673 498 438 ----14452
NM_022719chr2283859 3852 3484 3044 795 735 601 149 ------
NM_022726chr6----1608 --
NM_022730chr22685 341 ----1140
NM_022749chr811066 --11283 --
NM_022756chr111053 ------
NM_022766chr2242185 1913 1033 602 --22653 2436 --
NM_022781chr9----22642 427 23327 3036
NM_022826chr21190 --11188 --
NM_022828chr5------11719
NM_022918chr11--11650 11857 --
NM_023016chr21861 --12317 --
NM_023927chr521134 978 --192 --
NM_024007chr512915 --1201 --
NM_024050chr191204 ----1241
NM_024111chr15----2655 216 --
NM_024423chr1833503 502 109 14293 ----
NM_024496chr142682 225 ------
NM_024525chr1----1248 --
NM_024545chr23716 476 298 ------
NM_024551chr1242386 898 347 68 1886 ----
NM_024613chr8------11782
NM_024646chr111416 --1715 --
NM_024665chr333808 647 217 --1749 --
NM_024689chrX11626 --1631 --
NM_024698chr112428 298 --21199 1178 --
NM_024798chr1532306 724 671 ------
NM_024900chr452163 2110 1595 850 829 1133 32101 439 111 --
NM_024911chr12649 288 ------
NM_024947chr398391 8253 7565 7502 7346 7235 6447 6157 1266 11681 ----
NM_024949chr423844 777 ------
NM_024989chr266875 6503 2875 2441 2389 2379 --15138 --
NM_025076chr2----1576 --
NM_025133chr22924 290 ------
NM_025134chr161253 ----12343
NM_025146chr342312 1101 742 673 --21711 592 --
NM_025160chr142870 1499 985 211 --13341 --
NM_025179chr143818 3514 1796 893 ------
NM_025222chr331001 661 257 ------
NM_025248chr1722366 782 --33064 2667 171 --
NM_030627chr523288 248 --13511 --
NM_030629chr16----11414 --
NM_030631chr14----1580 --
NM_030647chr765871 5770 5113 1198 1106 1035 25186 4315 --1285
NM_030661chr71208 1164 1516 --
NM_030751chr1011781 --1392 --
NM_030806chr158181 7900 7476 6988 3143 --43236 2616 2450 312 --
NM_030927chr1021128 538 --1159 --
NM_030939chr6----2890 354 --
NM_030948chr6----1204 169
NM_030958chr8----133 --
NM_031445chr243019 2328 1138 974 --11060 1861
NM_031452chr151174 --174 --
NM_031459chr131405 536 500 ------
NM_031476chr1672316 2263 2253 1789 1774 611 226 --42620 675 532 333 --
NM_031483chr2021236 616 ----13322
NM_031936chr12728 487 --1528 --
NM_032102chr1122675 2372 --1611 --
NM_032120chr71365 ----194
NM_032193chr112446 418 --11963 --
NM_032199chr1053479 2450 1319 200 69 --13237 --
NM_032208chr243092 2232 505 364 --12891 --
NM_032268chr1653188 2816 2423 1261 551 12931 ----
NM_032348chr12820 105 --1872 --
NM_032433chr19----1380 --
NM_032446chr521080 267 --11409 --
NM_032457chr422706 430 ------
NM_032510chr1822033 467 --11847 --
NM_032552chr951485 1435 1267 491 29 --21907 612 --
NM_032560chr14------1769
NM_032664chr811460 --1456 --
NM_032682chr311228 --12604 --
NM_032810chr101280 --2343 178 --
NM_032884chr1------1303
NM_032959chr731110 1049 199 ------
NM_032983chr712269 --1678 --
NM_033030chr2--11214 1225 --
NM_033119chr16----1819 --
NM_033224chr766859 6806 6796 6345 2801 2482 --18013 --
NM_033394chr211314 --11067 --
NM_033449chr52725 607 1804 ----
NM_033656chr2155039 4892 4144 1095 606 --1172 1674
NM_052840chr1531234 229 132 ------
NM_052886chr8----12102 --
NM_052910chr1331669 431 282 --11515 --
NM_053023chr1122558 1046 ------
NM_053024chr3----1144 --
NM_057175chr421922 438 ------
NM_079834chr1921083 381 21434 295 ----
NM_080415chr171626 ----1395
NM_080621chr2031386 1107 945 ------
NM_080678chr22671 474 ------
NM_080836chr2064376 3981 3954 3934 855 823 24671 4605 ----
NM_130847chr1132174 1464 541 --15794 --
NM_133468chr71610 --12020 --
NM_138316chr103328 119 60 --1445 --
NM_138357chr101295 --1711 --
NM_138370chr21210 --1765 --
NM_138385chr421119 34 --1491 --
NM_138395chr22445 325 ------
NM_138396chr123896 666 67 --1650 --
NM_138473chr1214479 --1225 --
NM_138775chr111165 --154 --
NM_139057chr1532842 2697 2402 --1452 --
NM_139283chr1232505 932 71 ----1338
NM_144563chr21650 ----1335
NM_144571chr421219 633 16782 36042 1023 645 12550
NM_144578chr1411516 --23571 82 --
NM_144633chr331367 508 402 ------
NM_144664chr1111983 --1917 --
NM_144778chr13----11679 --
NM_144963chr811785 --11805 --
NM_145753chr3----11547 --
NM_145808chr732861 606 525 ----1799
NM_147156chr10----11138 --
NM_152253chr2223913 842 --11076 11308
NM_152263chr165818 5546 2347 2337 187 102 --15517 --
NM_152309chr102615 507 --1145 11967
NM_152409chr5----23123 1450 --
NM_152556chr712395 11961 22008 979 --
NM_152608chr121770 743 ------
NM_152622chr512741 12258 ----
NM_152641chr1232757 918 436 ------
NM_152756chr5----12649 1494
NM_152787chrX33096 2676 1406 12595 ----
NM_152793chr734925 3848 299 ----24366 2018
NM_152835chr11781 --22703 523 1370
NM_153184chr32573 45 --11275 --
NM_153334chr223612 530 204 ------
NM_153358chr19--1192 ----
NM_153607chr522715 1157 ------
NM_170606chr721802 450 ----11587
NM_170665chr1233935 1066 107 --24451 3687 14568
NM_173075chr431168 637 545 --1526 --
NM_173083chr1195 ----11220
NM_173470chrX--12087 1298 --
NM_173476chr1641486 543 333 286 --11919 --
NM_173496chr1032265 2212 834 --2339 131 --
NM_173576chr101696 --11898 --
NM_173595chr1255037 5014 4833 2081 691 --11787 --
NM_173698chrX31900 1533 119 1366 ----
NM_174934chr1143101 1207 858 270 --11325 --
NM_175069chr921005 240 161 ----
NM_175852chr132132 1093 25 11960 22474 609 --
NM_175854chr1342567 2281 623 393 --1866 --
NM_175856chr51764 --154 --
NM_177966chr32591 538 --11303 --
NM_177999chr962696 1181 926 805 627 39 --1189 1619
NM_178568chr1741674 1144 608 92 1112 ----
NM_178812chr8------1486
NM_180989chr1311004 --1891 --
NM_181358chr133219 2843 1449 --1414 1722
NM_181504chr544024 3392 3285 1096 --23456 1671 --
NM_181571chr102930 735 ------
NM_181782chr6----12051 --
NM_181844chr1731572 1487 460 --1193 --
NM_182487chr933114 2806 2743 --23351 558 14212
NM_182503chr635475 4869 1514 --23414 1181 --
NM_182526chr1483092 2557 621 528 414 184 163 65 1257 12541 --
NM_182557chr114427 214 161 77 --1605 --
NM_182580chr131989 835 115 --1276 --
NM_182663chr111515 ----12178
NM_182830chr141365 --11516 --
NM_182894chr1431344 1096 63 --11640 --
NM_182978chr181540 --1705 --
NM_183376chr15----147 --
NM_183397chr2034784 3709 85 --1596 --
NM_194249chr51140 --2467 351 --
NM_194314chr145100 3951 3546 3466 --14028 --
NM_198504chr3----168 --
NM_198581chr2107277 6675 6612 5731 5678 5668 5403 5340 5103 2683 --17096 11265
NM_198859chr321399 852 --21911 1436 --
NM_199000chr712287 ------
NM_199262chr1731726 641 381 --12138 --
NM_199355chr161530 ----11186
NM_201520chr1721657 1433 --1209 --
NM_201613chr12----1176 --
NM_206854chr625277 837 ----11161
NM_207371chr1031133 1080 214 --11515 --
NM_207406chr486543 6213 4661 4547 2559 2460 2389 31 --24383 2115 --
NM_207435chr121463 1101 1889 --
NM_212467chr1552684 2605 754 685 309 --184 --