TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-638
miRNA Sequence: AGGGAUCGCGGGCGGGUGGCGGCCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000555chrX76617 5801 5016 1943 781 614 191 1454 ----
NM_000826chr41162 21827 736 --1679
NM_001008408chr766189 5873 4628 4255 4148 2135 1160 11517 --
NM_001040152chr794357 3849 3646 1702 1382 1174 407 133 39 1384 ----
NM_002126chr17--33341 613 432 --13636
NM_003137chr621663 175 ----12145
NM_003342chr1752186 2095 1212 429 278 1765 12689 --
NM_004985chr1224348 1387 ----12784
NM_005168chr21366 ----11512
NM_006306chrX64338 1892 1523 724 633 34 31063 842 434 ----
NM_006380chr1753543 3115 2907 1193 142 2785 41 ----
NM_012482chr11581 ----190
NM_013255chr768674 8598 7472 7162 3086 1339 38752 6649 1472 11753 --
NM_016376chr1742973 2668 1716 498 63646 2986 1108 826 167 152 ----
NM_020443chr196328 6041 5837 4810 4719 4603 2655 2225 1986 11460 15798 --
NM_032900chr1012896 1317 --23883 3061
NM_130387chr3------11246
NM_152622chr51690 13315 2477 471 --
NM_178864chr111121 ----1210