TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-640
miRNA Sequence: AUGAUCCAGGAACCUGCCUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000093chr931893 1552 684 ----2935 551
NM_000489chrX125 --1771 12201
NM_000899chr1273231 3101 2905 1584 591 547 268 --23394 3341 --
NM_001001395chr1242820 2792 1743 229 ----12371
NM_001003652chr1877444 6371 5868 5695 5250 3203 1200 ----27023 593
NM_001005404chr1742937 1107 1022 945 --13056 23927 3339
NM_001024647chr1297226 6857 6400 6018 5992 2780 2656 2146 752 --26622 3034 --
NM_001042599chr277516 6661 6548 6480 5580 1132 1043 --16053 11495
NM_001106chr3109674 9576 9368 7534 7395 6228 6122 3053 186 37 --23161 192 12280
NM_001627chr3167 ----22402 1626
NM_002025chrX76856 6793 3425 3024 2977 2195 952 --23595 2444 13713
NM_002270chr585343 3835 3723 3692 2264 1763 1569 1045 --15600 --
NM_002356chr642603 2441 2353 425 ----22198 394
NM_002481chr166325 5528 5097 2901 1532 334 --12661 17736
NM_002610chr232098 1909 615 ----12817
NM_002655chr854192 3533 1551 1052 966 --14437 2864 465
NM_004171chr11119681 8661 8518 7431 3803 3597 2869 2209 1885 1797 508 18933 ----
NM_004586chrX23835 1096 15284 11540 23369 587
NM_005065chr1434597 3538 317 --185 11063
NM_005156chr964476 3542 1835 1670 1404 327 1308 24842 2146 --
NM_005359chr1866161 5772 5340 2348 2214 1610 --15946 1165
NM_007011chr1596668 6259 6125 4275 1731 1607 1281 670 98 11630 --16177
NM_014331chr467512 7444 7086 6601 2935 2069 --36661 1403 548 --
NM_014873chr164762 3721 3668 3283 758 175 --13828 1127
NM_015025chr232392 2275 1681 --22435 1795 1672
NM_015026chr1233375 1780 911 --33677 1327 1320 --
NM_015100chr121447 162 --11950 1172
NM_015313chr1141777 611 130 38 31852 725 454 --11769
NM_015906chr153460 3277 2988 1076 561 --1707 13017
NM_016083chr643595 3556 1193 881 --21050 797 11294
NM_020774chr1835160 2492 327 15788 --15365
NM_024947chr389560 9529 8321 8185 7570 3840 1893 1242 26684 6388 16655 11992
NM_033224chr7116728 6587 5146 1502 1478 1176 1034 884 729 639 484 17606 16464 12970
NM_145307chr1021038 163 --44322 3786 3637 1323 13800
NM_213589chr245239 3567 3378 345 --23837 945 15464