TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-642b-3p
miRNA Sequence: AGACACAUUUGGAGAGGGACCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000176chr543673 3303 3016 1288 13557 13294 12783
NM_000212chr1761833 212 202 189 181 159 32091 1786 817 1233 --
NM_000216chrX63380 3007 2969 1268 525 38 12837 12495 --
NM_000259chr1556349 5850 4733 4713 2011 46353 5137 545 196 1298 12323
NM_000314chr1053234 3187 3142 352 324 41313 233 212 98 --12933
NM_000337chr594246 1830 1228 1145 155 145 127 119 113 ------
NM_000362chr2273624 2540 2530 665 570 560 507 22760 2509 ----
NM_000813chr555609 5069 3957 3431 845 ----24575 4056
NM_000814chr1554011 3338 752 227 191 22806 2770 33579 2659 403 --
NM_000875chr1595759 5749 5521 4902 4275 2646 2557 2548 2534 ------
NM_000899chr1254313 4298 4292 3463 1209 --1866 1857
NM_000950chrX73635 3437 3312 809 573 295 273 22479 1435 ----
NM_001003652chr1887891 6915 3445 1693 470 383 305 66 38656 8101 2565 58362 8072 2739 1706 621 --
NM_001003674chr1865609 4542 1840 1829 558 502 15538 35745 2586 571 --
NM_001003675chr1865609 4542 1840 1829 558 502 15538 35745 2586 571 --
NM_001003712chr1231232 1026 926 22886 2822 1247 1210
NM_001004065chr9113999 3864 3788 3440 2823 1323 1301 1288 1260 1250 1168 ------
NM_001004329chr1241494 1098 295 271 --1282 --
NM_001005473chr576598 6395 5478 4495 2003 1982 1933 24294 810 11236 --
NM_001008220chr5133355 3125 2907 2802 1565 1485 1430 1359 1313 1256 1237 1220 1197 23803 1352 11415 33832 1456 1282
NM_001008408chr766349 6121 5736 4284 2051 636 36033 4743 1050 26384 1826 --
NM_001010891chr586155 6106 6087 4483 1562 1544 1353 64 22274 1566 22094 674 --
NM_001011666chr776327 5922 4879 4328 4167 3991 1852 16434 22462 1955 --
NM_001013620chr1288009 7503 6119 5886 2642 2169 1093 694 12151 18322 1455
NM_001014380chr1365862 4954 4049 3886 925 774 2794 422 25809 1336 --
NM_001018065chr984139 2285 2113 916 906 884 562 410 132 2927 708 --
NM_001018066chr984139 2285 2113 916 906 884 562 410 132 2927 708 --
NM_001018074chr543673 3303 3016 1288 13557 13294 12783
NM_001018075chr543673 3303 3016 1288 13557 13294 12783
NM_001018076chr543673 3303 3016 1288 13557 13294 12783
NM_001018077chr543673 3303 3016 1288 13557 13294 12783
NM_001024094chr543673 3303 3016 1288 13557 13294 12783
NM_001024401chr1672517 2488 2480 2472 2466 1139 576 --12821 12871
NM_001024647chr1287551 6124 4746 2247 1241 1119 284 169 1728 1673 --
NM_001024956chr1175759 5710 4583 4543 3556 1218 1032 15846 11893 14706
NM_001025076chr1066118 5913 2285 1126 1031 971 2779 671 56050 2421 1172 1025 423 --
NM_001025077chr1057476 7271 2484 2389 2329 22137 2029 47408 2530 2383 1781 --
NM_001025108chr293656 3634 3046 1235 1227 807 195 165 153 ------
NM_001025580chrX43417 2818 1515 1501 13421 --13515
NM_001032296chr1372623 2363 1940 1836 1103 1087 1073 ----12888
NM_001039569chr223282 2164 1207 2200 174 12211
NM_001039590chrX63901 3232 1488 1328 225 70 13638 --13004
NM_001039591chrX63901 3232 1488 1328 225 70 13638 --13004
NM_001039840chrX105381 5286 5274 4320 2225 1735 231 193 140 92 128 11757 14844
NM_001040110chr771840 1481 1220 320 296 286 270 --11503 --
NM_001040284chr1685965 4407 2389 2003 1545 924 724 500 --24378 1799 --
NM_001040429chr1332710 1115 1070 --42659 2417 1302 1001 --
NM_001042355chr1684861 4463 3928 1965 1087 554 216 164 11969 33434 1653 363 --
NM_001042412chr1684861 4463 3928 1965 1087 554 216 164 11969 33434 1653 363 --
NM_001042603chr12125105 4964 4950 4355 4292 4283 3857 3645 1558 1538 1511 1438 --13267 --
NM_001044385chr243884 2722 159 86 13432 --13274
NM_001100108chr1128351 8051 7796 7687 7678 6970 5228 3031 2533 266 110 71 18160 ----
NM_001106chr378947 8190 8055 7604 7566 1510 65 28992 2884 36255 3113 561 17013
NM_001690chr342414 1718 127 54 1131 11614 12358
NM_001695chr873175 2847 654 549 220 44 37 11393 33241 1464 862 --
NM_001858chr674984 4794 4331 1910 1811 1537 1030 14872 11845 --
NM_002006chr435827 827 89 14664 13899 15761
NM_002025chrX99119 9076 8291 8253 8174 7896 5655 3671 1146 12936 37081 6461 3302 --
NM_002069chr721541 1312 11876 1598 21662 1390
NM_002158chr223274 892 1831 1235 13044
NM_002270chr575112 4448 2121 1729 1674 1153 986 --25433 4763 --
NM_002285chr293656 3634 3046 1235 1227 807 195 165 153 ------
NM_002581chr944975 3895 3480 333 --15372 13779
NM_002594chr2071935 1927 1876 1864 1813 1805 227 ------
NM_002687chr1441268 849 831 375 --1879 11299
NM_002737chr17126683 6580 6401 6140 4850 4433 1851 1766 1758 1539 780 99 15192 ----
NM_002843chr1183244 3099 2631 1386 1041 1032 419 370 --23297 1026 --
NM_002886chr384438 1510 1502 1036 908 899 887 875 14223 ----
NM_003199chr1865672 4861 4384 3512 2161 964 15200 11978 14167
NM_003236chr273497 2881 2744 2390 954 314 284 --1705 13420
NM_003262chr321854 426 24375 3412 --15245
NM_003298chr396130 4885 4102 4094 1319 1244 998 441 351 14571 24058 2046 --
NM_003574chr1895473 5233 4990 3833 1505 1344 881 628 114 25237 1538 ----
NM_003576chr1372623 2363 1940 1836 1103 1087 1073 ----12888
NM_003829chr9190 --11098 2930 870
NM_003924chr451470 1331 373 356 338 ----11618
NM_003994chr1254313 4298 4292 3463 1209 --1866 1857
NM_004124chr1432709 2657 907 12713 13116 1785
NM_004293chr943875 560 479 125 --13436 1605
NM_004338chr1865609 4542 1840 1829 558 502 15538 35745 2586 571 --
NM_004430chr892736 1039 887 605 572 546 532 522 506 ------
NM_004744chr473639 879 791 619 306 111 24 --12658 --
NM_004815chr164237 4032 3374 3236 1556 1187 31669 1227 40 --13603
NM_004904chr776327 5922 4879 4328 4167 3991 1852 16434 22462 1955 --
NM_004992chrX118285 7547 7167 7057 6964 6904 6502 5996 3259 2197 2056 15298 27395 2447 --
NM_004992chrX118285 7547 7167 7057 6964 6904 6502 5996 3259 2197 2056 15298 27395 2447 --
NM_005011chr771840 1481 1220 320 296 286 270 --11503 --
NM_005056chr12125349 5208 5194 4599 4536 4527 4101 3889 1802 1782 1755 1682 --13511 --
NM_005188chr11137559 7350 6499 6255 5925 2376 2370 1632 1422 723 525 428 368 26776 432 43303 3277 978 397 18082
NM_005197chr14105687 5228 5062 4986 4822 4526 4099 1798 1729 900 15626 25182 4039 --
NM_005238chr1163279 2251 2236 2228 2216 824 1565 1297 --
NM_005400chr273068 2757 2231 1905 1055 638 63 11016 12056 --
NM_005436chr1083642 3632 3609 2956 1339 1270 884 139 1591 --1807
NM_005497chr1745842 4565 530 238 12284 11221 15032
NM_005504chr1224673 375 35597 5516 5347 14406 1132
NM_005587chr154223 165 157 151 2169 33 ----
NM_005668chr554350 4032 4003 2842 1145 24085 1530 13529 --
NM_005746chr762078 2038 73 61 28 21 32461 2311 544 ----
NM_005828chr1794697 4197 3979 1943 1431 459 330 302 275 ----14486
NM_005832chr351466 1176 964 342 203 --2919 901 --
NM_005840chrX107087 6182 5666 5099 4853 2792 2694 1967 824 812 13019 15892 --
NM_005901chr1887891 6915 3445 1693 470 383 305 66 38656 8101 2565 58362 8072 2739 1706 621 --
NM_005937chr17103778 3181 2860 1572 1508 1492 1405 778 762 754 ------
NM_005955chr195039 4986 4729 4258 3736 3632 1281 716 403 21289 1263 23519 428 --
NM_006060chr783558 3491 2873 2805 2747 1475 1278 115 ----14422
NM_006095chr464393 3687 2938 1042 1015 504 ----14444
NM_006212chr185406 4834 4196 4053 1970 1691 451 41 --35391 4555 164 --
NM_006252chr187038 6852 6633 5954 2966 2238 1564 412 57116 1829 1607 1547 920 ----
NM_006420chr2033224 1067 557 23004 465 --12110
NM_006504chr1062958 2759 2673 2540 641 621 --12636 --
NM_006544chr1445837 5823 4847 3797 14101 --12233
NM_006561chr1066118 5913 2285 1126 1031 971 2779 671 56050 2421 1172 1025 423 --
NM_006599chr1677733 5344 2279 1939 1481 1407 109 11292 27831 1497 --
NM_006650chr5133355 3125 2907 2802 1565 1485 1430 1359 1313 1256 1237 1220 1197 23803 1352 11415 33832 1456 1282
NM_006717chr993286 3183 3150 2871 2579 2567 1327 981 415 ----12391
NM_006729chrX75514 1825 1116 1106 349 259 240 --1218 --
NM_006738chr15114552 4108 3165 3006 1730 1634 1627 1343 1095 927 686 ------
NM_006750chr1688049 7939 7367 7297 5048 3007 2566 387 12446 26150 2784 --
NM_006918chr1175759 5710 4583 4543 3556 1218 1032 15846 11893 14706
NM_006981chr962944 1937 881 731 208 197 12948 1425 --
NM_007007chr12104707 4102 3548 3367 3106 1641 845 784 490 440 21795 1500 11268 --
NM_007038chr2186060 5932 4378 4109 1041 878 840 795 15011 ----
NM_007146chr1762537 1982 798 754 457 174 ----1979
NM_007173chr113403 395 94 --1583 12170
NM_007200chr15114552 4108 3165 3006 1730 1634 1627 1343 1095 927 686 ------
NM_007203chr9113999 3864 3788 3440 2823 1323 1301 1288 1260 1250 1168 ------
NM_007249chr13108487 8389 8308 8115 7954 3674 3630 3280 1949 263 --28882 6355 --
NM_012081chr593448 3355 2527 1044 766 749 544 302 219 --22503 367 --
NM_012214chr266388 6043 5263 4727 2450 804 11792 --15757
NM_012252chr754787 4703 4670 4082 71 14128 25275 115 --
NM_012287chr333231 738 475 11269 44278 547 488 428 --
NM_012382chr584420 4348 4177 3719 890 599 553 377 --13037 --
NM_013255chr758421 8011 7338 6700 562 1584 --18770
NM_013261chr472376 1313 362 336 327 311 299 --43420 2724 2707 1038 --
NM_014048chr1675305 5213 3985 1586 1550 575 175 ----23786 1262
NM_014155chr1177285 5777 5698 2742 2400 2278 2187 24937 1053 11172 --
NM_014372chr121835 316 11862 32029 1339 772 1721
NM_014423chr5105495 3861 3682 3573 2226 2000 1797 1077 953 702 35585 706 48 2664 132 --
NM_014739chr664169 3638 3097 1316 1199 715 23697 1324 13861 --
NM_014767chr1073395 2406 1153 211 203 191 147 --22801 243 --
NM_014862chr1594176 1607 1465 954 690 640 630 251 136 --1618 --
NM_014877chr1746569 1733 878 752 --36418 6286 589 1198
NM_014936chr662876 2847 2362 790 782 152 ----12251
NM_014951chr1032301 1945 458 --12667 12180
NM_015192chr2032567 2502 2347 12805 22653 1074 1182
NM_015216chr51562 1585 178 11433
NM_015247chr1684861 4463 3928 1965 1087 554 216 164 11969 33434 1653 363 --
NM_015310chr898273 6306 5602 3217 1027 959 942 932 916 --25728 2130 --
NM_015365chrX43417 2818 1515 1501 13421 --13515
NM_015455chr532968 307 219 --24097 2670 1565
NM_015458chr8145242 4834 4661 2068 1941 1392 1110 939 925 919 473 319 284 45 --1784 11054
NM_015460chr311779 21739 1558 --11565
NM_015550chr753348 1268 1097 271 73 11286 --11245
NM_015569chr174249 4241 4207 3309 3244 3154 95 14540 23105 634 --
NM_015879chr1858595 6995 3130 3124 2609 --1605 28140 1815
NM_016009chr144526 3870 1781 1335 24830 1504 1811 198
NM_016083chr682446 1506 1097 1089 1069 959 550 450 ----1901
NM_016132chr1522905 927 --12747 12218
NM_016206chr358323 8065 6120 2350 2076 19014 13322 38869 7992 6306
NM_016260chr267437 7425 7417 7394 6988 6782 14773 46893 6493 5117 448 16174
NM_016376chr1773611 2992 2947 1585 1538 1477 184 1190 12776 22765 1379
NM_016531chr444145 2677 692 665 12681 --12914
NM_016613chr442694 2687 978 586 --22605 2402 1246
NM_016946chr173104 2839 2264 1084 1042 1008 596 12424 32991 1129 140 --
NM_016953chr235756 5744 5730 14838 25662 631 11123
NM_017415chr5104327 4285 3975 3323 3085 1544 1109 1093 370 300 23631 415 ----
NM_017447chr2184134 4022 3133 3027 2792 1708 505 465 14247 ----
NM_017633chr693258 2982 2916 2810 1144 1036 1019 1013 303 13475 1107 --
NM_017637chr9108918 8633 7845 3298 3049 2962 2613 1569 847 94 12482 13039 --
NM_017709chr183947 3827 3807 3210 2668 2656 1105 398 13556 11457 14271
NM_017813chr875576 4801 2269 685 651 645 192 24706 1217 13731 --
NM_017848chrX114421 3160 1873 1035 1023 1013 935 890 880 838 135 ------
NM_017902chr10154708 4698 3913 1726 1539 952 934 912 875 865 853 336 328 300 263 25226 3994 13511 12034
NM_018374chr734362 4155 1994 24772 175 34863 4546 4129 --
NM_018388chrX51100 930 528 480 470 1491 ----
NM_018482chr832373 143 77 2967 393 22531 992 12564
NM_018638chr1224319 1886 --25535 4096 1220
NM_018650chr132041 1639 423 --42177 2126 1981 1831 --
NM_018975chr161783 1743 1233 1708
NM_020718chr1676331 2028 1570 1231 1000 147 123 25772 651 --16447
NM_020727chr2123184 2895 11461 23046 1351 166
NM_020734chr1282717 2344 2284 1119 1101 1095 392 272 13197 11126 --
NM_020769chrX1673 ----2968 353
NM_020772chr17117817 7804 6333 3191 3145 3111 2239 2132 2124 1336 1119 27216 3412 ----
NM_020841chr1231232 1026 926 22886 2822 1247 1210
NM_020935chr294652 4566 4032 3928 3314 2967 516 439 282 ------
NM_021911chr555609 5069 3957 3431 845 ----24575 4056
NM_021912chr1554011 3338 752 227 191 22806 2770 33579 2659 403 --
NM_021961chr11137304 7132 6869 6823 6191 5868 5375 5249 5242 2834 1207 1197 894 37373 6878 5269 21312 180 --
NM_022336chr241755 1554 930 766 --1745 1921
NM_022456chr1287551 6124 4746 2247 1241 1119 284 169 1728 1673 --
NM_022459chr1384867 2462 2420 2383 1955 1945 1902 1078 11577 14823 11535
NM_022763chr352465 2173 574 550 419 --12947 1945
NM_024345chr975933 5725 4365 4224 1246 1139 352 24406 2086 14350 1936
NM_024713chr152447 417 11082 --1576
NM_024947chr3109365 9335 6437 3671 3154 3000 2909 2313 1672 539 ----23530 277
NM_024949chr4104906 4727 4721 3881 1888 1114 885 382 318 73 14566 23352 1210 --
NM_024989chr2118150 8083 8061 7975 7963 6424 5707 5142 5010 2664 1289 --21978 38 17743
NM_025090chr1717982 377 357 348 297 279 270 256 241 227 212 185 159 145 108 79 64 --2393 322 --
NM_025134chr1622462 973 --12339 1759
NM_025160chr154339 4129 4019 3862 3845 ----13025
NM_025248chr17153148 2834 2707 2683 2661 2645 2634 2579 2545 2538 2526 2435 2388 2359 2147 12914 ----
NM_030647chr795933 5922 2318 2279 1740 1216 787 472 99 1478 22437 626 --
NM_030806chr189404 8710 7396 7031 6463 5787 2890 264 13300 28259 1339 26780 6387
NM_031427chr1414567 25996 24 34857 4123 802 25542 4962
NM_032116chr1365862 4954 4049 3886 925 774 2794 422 25809 1336 --
NM_032208chr232757 1107 683 22634 2496 --12782
NM_032373chr103759 225 80 11444 14998 11486
NM_032539chrX179 1537 1613 1657
NM_032810chr1051550 391 373 232 44 1529 11354 11327
NM_032826chr794237 3586 1720 1695 1675 1533 1405 1299 1292 --34229 4180 1955 --
NM_033181chr682446 1506 1097 1089 1069 959 550 450 ----1901
NM_033224chr737471 6486 4948 16069 27406 2799 26560 5057
NM_033512chr843036 2946 915 247 12381 52684 2438 926 670 653 --
NM_052832chr822647 294 --1232 12699
NM_053016chr977710 5736 2844 2628 366 236 184 ----12585
NM_053043chr766349 6121 5736 4284 2051 636 36033 4743 1050 26384 1826 --
NM_130435chr1062958 2759 2673 2540 641 621 --12636 --
NM_133334chr486268 5856 5470 4506 1778 1159 886 93 26194 1281 15589 --
NM_138426chr7102510 2468 2237 1709 917 809 356 279 272 207 1211 --12284
NM_138459chr683666 3103 2694 2402 1115 513 381 161 --12247 --
NM_138713chr1677733 5344 2279 1939 1481 1407 109 11292 27831 1497 --
NM_138714chr1677733 5344 2279 1939 1481 1407 109 11292 27831 1497 --
NM_144571chr476456 6005 4332 2464 1535 1361 1355 25722 2580 2996 125 --
NM_144599chr1532123 1020 704 21266 446 55520 1852 1660 1577 433 15402
NM_144767chr15114552 4108 3165 3006 1730 1634 1627 1343 1095 927 686 ------
NM_144973chr1284988 4262 3842 2079 1992 1483 1010 218 15100 1697 1211
NM_145307chr1054571 3723 1461 732 77 13294 --1359
NM_145320chr753348 1268 1097 271 73 11286 --11245
NM_145321chr753348 1268 1097 271 73 11286 --11245
NM_145322chr753348 1268 1097 271 73 11286 --11245
NM_147128chr721637 1387 ----21254 1191
NM_147150chr9113999 3864 3788 3440 2823 1323 1301 1288 1260 1250 1168 ------
NM_152388chr243884 2722 159 86 13432 --13274
NM_152624chr565509 5050 2217 1668 1574 1279 27425 5996 25135 1879 11069
NM_152695chrX1259 --2691 438 2752 491
NM_152734chr674776 3693 3656 1819 1109 819 132 14372 35404 4365 2016 1942
NM_152758chr832823 2678 2192 --11048 11204
NM_152903chr132992 856 11043 22313 1977 1462
NM_153188chr575112 4448 2121 1729 1674 1153 986 --25433 4763 --
NM_170665chr1283993 3552 1258 1113 1103 1097 404 365 23977 3617 ----
NM_173198chr962944 1937 881 731 208 197 12948 1425 --
NM_173200chr962944 1937 881 731 208 197 12948 1425 --
NM_173214chr1677733 5344 2279 1939 1481 1407 109 11292 27831 1497 --
NM_173582chr11106275 6146 5206 4875 4725 2343 2218 2189 1775 567 2924 80 ----
NM_175623chr1287551 6124 4746 2247 1241 1119 284 169 1728 1673 --
NM_175624chr1287646 6219 4841 2342 1336 1214 379 264 1823 1768 --
NM_175625chr1287646 6219 4841 2342 1336 1214 379 264 1823 1768 --
NM_181358chr1143798 3609 3166 3154 3073 2807 2795 2711 2674 1586 1562 1370 1337 678 2647 400 ----
NM_181361chr351466 1176 964 342 203 --2919 901 --
NM_181481chr1865609 4542 1840 1829 558 502 15538 35745 2586 571 --
NM_181482chr1865609 4542 1840 1829 558 502 15538 35745 2586 571 --
NM_181483chr1865609 4542 1840 1829 558 502 15538 35745 2586 571 --
NM_181504chr573858 3836 3770 3327 3255 3154 3052 --23343 2987 --
NM_181523chr573858 3836 3770 3327 3255 3154 3052 --23343 2987 --
NM_181524chr573858 3836 3770 3327 3255 3154 3052 --23343 2987 --
NM_181782chr632258 2221 724 --22048 530 1557
NM_181787chr823799 3712 13321 31414 1350 889 11177
NM_181836chr542540 2068 1810 1067 ----1378
NM_182898chr776327 5922 4879 4328 4167 3991 1852 16434 22462 1955 --
NM_182899chr776327 5922 4879 4328 4167 3991 1852 16434 22462 1955 --
NM_182920chr36186 134 124 105 89 83 --11433 --
NM_194247chr264466 3051 2988 819 646 635 1795 --11130
NM_194314chr185506 4819 4246 4233 4018 1453 969 530 15637 23924 146 1744
NM_194434chr1895473 5233 4990 3833 1505 1344 881 628 114 25237 1538 ----
NM_198181chr1582857 2752 1133 680 223 193 135 105 --11865 --
NM_198268chr1143798 3609 3166 3154 3073 2807 2795 2711 2674 1586 1562 1370 1337 678 2647 400 ----
NM_198269chr1143798 3609 3166 3154 3073 2807 2795 2711 2674 1586 1562 1370 1337 678 2647 400 ----
NM_199229chr23540 518 175 21399 657 --11364
NM_206909chr898273 6306 5602 3217 1027 959 942 932 916 --25728 2130 --
NM_207577chr1161169 1109 858 603 594 552 1376 1408 12359
NM_213589chr2104093 1904 516 403 312 208 202 174 135 129 ------