TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-642b-5p
miRNA Sequence: GGUUCCCUCUCCAAAUGUGUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000208chr19104289 4234 4166 3745 3703 2949 1183 1125 859 707 44058 2939 1483 1089 14064 14296
NM_000332chr6116794 6724 5410 5049 4924 2045 1608 1205 840 782 255 15647 --15973
NM_000337chr5106560 5151 5110 1727 1487 1394 1365 848 445 432 45902 4061 2502 1868 14456 --
NM_000486chr12112534 2433 1016 839 648 613 513 380 310 288 263 23176 3028 3272 256 182 --
NM_000633chr18134875 4072 4027 3816 1604 1292 1238 1200 632 547 530 441 216 14669 ----
NM_000641chr1961456 1174 519 373 366 358 --2429 228 --
NM_000719chr12175843 5815 4517 4380 4368 4307 4284 2584 2431 2231 2066 1783 1490 1360 802 644 487 12465 26586 442 25574 1791
NM_000831chr1166087 5685 5173 3927 2398 2390 2109 2102 1850 1665 1571 1356 1123 617 468 98 --15441 15973
NM_000912chr832580 900 453 ----33265 2526 268
NM_000926chr1146811 1242 947 932 16318 28919 6385 47592 3579 2347 2201
NM_001001669chr5132436 2361 2308 2264 1783 884 873 684 677 556 540 101 68 22757 1786 1841 22174 767
NM_001004304chr12123131 2763 2653 2633 2517 2450 1091 694 356 274 234 207 13134 22811 2455 1151
NM_001005404chr1793269 1784 1363 1302 1004 894 414 388 382 13614 22747 1009 --
NM_001005473chr5146424 6029 1887 1781 1443 1058 1038 1014 973 961 949 706 410 137 16005 --1110
NM_001006657chr252727 776 367 359 352 22855 1103 ----
NM_001007471chr95316 254 245 239 206 ----1694
NM_001008220chr5143850 3722 3585 3381 3137 3024 2981 2747 1137 1118 466 458 220 94 33423 2750 835 13099 --
NM_001008701chr19152526 2306 2122 2065 2034 1967 990 561 376 347 281 269 234 76 42 1795 2154 47 32111 1974 475
NM_001010853chr6------22778 2485
NM_001010891chr556579 5620 4729 1502 235 15671 25746 2241 12464
NM_001014797chr10127173 6939 6919 6901 6773 6677 6645 6066 5293 5204 811 564 16299 --27959 646
NM_001031695chr22104563 3682 3547 3411 2170 2127 1668 1503 1104 1013 1438 12158 24448 2004
NM_001037165chr7208913 8056 7964 7772 7481 6795 6760 6698 5986 3540 3419 2940 2665 2602 2171 1650 1614 938 855 230 13067 12333 --
NM_001039844chr1082904 2897 972 622 442 427 395 71 --12458 22858 402
NM_001040284chr1674992 4765 2274 658 437 393 217 23900 1464 --22030 333
NM_001040712chr9103141 2976 2637 2561 1312 1083 861 469 463 280 --22996 475 --
NM_001042603chr1265005 4750 4495 3739 888 777 134 11615 15255
NM_001043318chr14102984 1557 1498 1195 1075 954 548 468 80 73 1636 11201 13808
NM_001044385chr263459 1352 1158 719 667 389 21567 722 1541 1219
NM_001100108chr1107333 6898 6396 1922 1366 1140 1009 449 50 43 11273 --58112 7428 6879 1347 261
NM_001106chr3158903 8498 8401 8220 3747 3588 3439 3278 2726 1607 1114 1046 1032 751 640 28338 6368 13343 --
NM_001113490chrX82539 2408 2317 1415 1405 531 194 107 --2783 601 21100 493
NM_001759chr12104722 4337 4241 4224 4108 4044 3600 2082 760 488 1332 1221 14136
NM_001830chrX83894 3415 3106 2887 2675 2640 2632 135 22985 101 --12554
NM_002373chr1591064 1037 346 302 210 129 106 93 85 1964 --1228
NM_002839chr9103141 2976 2637 2561 1312 1083 861 469 463 280 --22996 475 --
NM_002886chr3105129 5076 4613 3870 3579 3177 797 375 354 125 13252 13799 24652 1775
NM_003012chr872360 2170 1103 596 547 70 47 157 129 12904
NM_003099chr15166296 5497 5322 4975 4961 4763 4741 4388 4288 4281 3993 1400 1231 1102 618 443 76125 5196 4622 4537 2330 434 324 14901 --
NM_003108chr2206999 6885 6521 6035 5917 5232 4689 2864 2683 2380 2364 2298 2222 1917 1789 1687 659 525 420 138 46832 2729 2497 2098 1708 1994
NM_003221chr694010 3013 2715 2608 1541 1274 1245 669 542 13290 --11155
NM_003607chr174164 3980 3393 2881 1206 782 410 12764 24234 3761 13310
NM_003872chr2112954 2863 2808 1850 1084 997 985 652 183 165 55 ----12611
NM_003966chr544806 1915 1832 1600 37738 5015 1179 37750 5449 4980 17866
NM_004098chr104369 294 121 55 1825 1128 1139
NM_004397chr11114150 4124 3987 3923 3398 3376 3097 1084 304 268 64 23216 1104 13831 1276
NM_004774chr1752065 568 292 286 263 12620 32751 2270 707 12311
NM_004898chr482571 1922 1787 1098 809 84 40 32 --1316 --
NM_005056chr1265249 4994 4739 3983 1132 1021 1278 11859 15499
NM_005477chr15102128 1862 1754 1672 1664 1629 760 451 236 222 --11677 1245
NM_005477chr15102128 1862 1754 1672 1664 1629 760 451 236 222 --11677 1245
NM_005596chr972494 2413 2033 1253 952 906 117 ----25135 4484
NM_005840chrX97367 6752 6343 5317 4946 2986 2017 772 138 15943 26999 2025 1450
NM_005937chr17113823 3713 3435 2798 1243 1163 1126 415 388 176 134 --33400 2633 894 23969 42
NM_005938chrX141401 1241 1168 1160 1152 1141 1006 988 973 479 209 202 191 176 1366 ----
NM_006203chr565205 5180 3778 2138 1721 1694 ----35000 4377 3666
NM_006371chr3164700 4479 4255 4031 3789 1839 1627 1515 1418 1324 1297 1240 1157 1119 1091 123 ------
NM_006546chr17166089 5742 5635 5299 4686 4476 4253 4062 2608 2599 2305 1949 1505 635 558 91 25043 4871 36336 2559 947 14542
NM_006650chr5143850 3722 3585 3381 3137 3024 2981 2747 1137 1118 466 458 220 94 33423 2750 835 13099 --
NM_006924chr1773322 3123 2720 1773 1488 1278 324 21064 969 23798 2936 --
NM_007050chr20147703 6990 6258 5884 5855 5511 5215 5147 3041 2917 2761 1939 1764 1556 12193 32035 1294 739 17244
NM_007249chr13149153 8809 7428 6239 3524 3145 3060 2582 2496 1783 1260 1246 883 214 18561 --12589
NM_012095chr1053287 2816 2477 2405 1057 23337 85 --2776 569
NM_012164chr976076 5128 3017 1885 1611 1012 676 11779 37407 1274 1232 11626
NM_012193chr1175247 3863 1709 911 799 376 42 11597 23869 1223 23388 1385
NM_012199chr1154473 4221 4174 4091 3893 3548 3378 2861 1593 1394 867 833 447 106 93 1159 ----
NM_012316chr195282 4571 3893 3831 3446 2181 791 484 21 --23784 225 21417 165
NM_012334chr583994 3861 1441 659 463 453 262 135 14025 24298 349 24561 494
NM_013286chr363761 3064 2378 1403 1221 1103 23485 1088 1205 23535 1494
NM_013411chr192691 1880 1026 590 569 562 213 111 81 --2575 437 --
NM_014293chr22113890 3630 3383 2817 1135 965 678 451 350 229 47 1815 23513 3270 22733 685
NM_014309chr22104553 3672 3537 3401 2160 2117 1658 1493 1094 1003 1428 12148 24438 1994
NM_014333chr1151932 1834 951 944 935 ------
NM_014586chr21134439 4124 4104 3825 3711 3491 3251 1691 1090 964 578 406 296 11098 24498 3628 --
NM_014826chr174164 3980 3393 2881 1206 782 410 12764 24234 3761 13310
NM_014909chr14153121 2631 2500 2483 2472 1572 1249 1078 949 686 507 501 335 255 80 23315 3251 22636 2518 --
NM_014921chr19152526 2306 2122 2065 2034 1967 990 561 376 347 281 269 234 76 42 1795 2154 47 32111 1974 475
NM_014935chr193265 3121 3047 1401 1322 843 831 791 131 2370 277 33451 309 143 23725 655
NM_015035chr20136645 6444 6091 5904 5718 5316 5018 4994 4832 4767 4664 2602 498 26652 4164 24773 1642 --
NM_015051chr993163 3007 2651 2630 2259 1053 733 452 327 1455 --22554 1040
NM_015090chr196119 5900 4701 2150 1312 1208 685 56 48 --32141 1265 251 24147 2041
NM_015094chr2294393 4348 4290 4231 4073 1435 850 191 47 33856 1574 372 22859 1346 23819 458
NM_015310chr897474 6516 2986 2051 681 631 593 514 240 ----26172 2722
NM_015879chr18118145 7418 7330 7314 6315 5957 3368 3026 2933 2281 1853 --25292 222 16400
NM_016260chr267063 5439 3007 2487 1590 249 21630 210 47544 2041 1294 22 --
NM_016418chr2273808 3702 3646 2633 761 423 174 33517 2472 668 32575 584 151 23632 2623
NM_016531chr484203 3656 2991 2941 1450 1278 1052 680 1738 --1295
NM_016953chr255876 5101 2412 2278 2009 12415 1274 2332 206
NM_017596chr1104402 4277 3887 3857 3838 1440 1331 638 429 249 23991 677 11388 23922 238
NM_017637chr9138980 8780 7948 7896 7602 7321 7083 6910 6582 3214 1863 842 423 13692 16886 --
NM_017811chr992858 1234 897 823 807 391 113 67 51 2848 58 12264 --
NM_019072chr553440 3253 1300 537 400 ----12996
NM_019857chrX130 122 31517 1483 152 1382
NM_020133chr6116102 6085 5475 2470 1673 1581 713 323 307 139 39 --25967 30 1334
NM_020452chr1112051 1859 1844 1781 1422 1389 704 335 259 242 194 --11833 2205 67
NM_020673chr20106717 5467 2531 2161 1486 850 468 425 364 335 17032 11379 --
NM_020699chr1175163 5130 4729 4560 4178 3932 3716 3689 3672 2062 2026 1598 1507 1433 848 810 709 35166 5112 880 ----
NM_020717chrX93599 1969 1341 940 927 634 520 506 183 24299 3602 31318 385 208 13179
NM_020772chr17118320 6843 6628 6113 6086 3068 2193 1038 678 631 456 2881 61 15830 --
NM_020774chr1845130 4385 3841 1594 24195 3898 --31918 598 503
NM_020779chr252727 776 367 359 352 22855 1103 ----
NM_020921chr1452771 2759 1059 773 717 --12626 23475 907
NM_020952chr95316 254 245 239 206 ----1694
NM_021090chr22114333 3837 3319 3251 1732 1310 933 594 468 405 100 --34968 3387 1463 11046
NM_021116chr7209104 8422 6945 6886 6717 6395 5799 3222 2835 2785 2502 1808 1631 1329 1301 1276 1186 1087 207 42 --68172 8142 2741 2491 1976 108 1285
NM_021202chr2052052 1030 767 673 484 --42824 2387 696 687 1753
NM_021813chr675712 5203 2013 1893 1641 1431 1282 24970 1945 --13761
NM_022048chr1595451 4930 4486 4298 2192 1535 1504 1232 35 --14399 12095
NM_022166chr16156210 4910 4322 4228 3977 3856 2464 2392 2149 2048 2019 1859 908 607 143 24948 4671 ----
NM_022648chr2154431 4016 3215 3164 3077 2995 1217 732 414 371 353 168 161 144 36 13586 33948 3195 56 13156
NM_024423chr1853677 1430 1346 1195 92 23444 1125 31711 1338 1048 --
NM_024947chr369048 8720 3632 2918 1615 752 --16948 36977 2788 698
NM_024971chr95316 254 245 239 206 ----1694
NM_024989chr266340 5963 2537 1699 1585 161 13096 --162
NM_025179chr1114311 4112 3405 3050 1960 1729 1262 1024 382 342 136 24099 285 13377 13853
NM_030634chr13862 674 172 --11525 2776 268
NM_030761chr192470 2293 2270 1002 895 622 392 370 46 ----32236 2177 525
NM_030806chr1188865 8585 7645 7623 7585 6917 6794 6680 6654 5770 5745 2672 2208 1968 1845 1668 1380 1187 26703 1766 --37255 7002 942
NM_031417chr19152612 2548 2320 2288 2139 2111 1997 1055 999 672 636 570 475 350 337 32823 2182 554 12130 12407
NM_032538chr6132846 2245 1945 1876 1113 1064 807 737 597 550 348 308 195 12663 12279 1607
NM_033133chr1793431 3311 3169 2733 763 472 216 47 35 ----13010
NM_033224chr746435 1602 119 106 27616 2086 --35773 322 100
NM_052906chr22254641 4347 4339 4210 4022 3704 3665 3524 3240 3110 2039 1904 1866 1617 1595 1466 1152 1065 1048 825 709 541 520 429 58 34133 3643 85 24486 4139 14111
NM_130391chr9103141 2976 2637 2561 1312 1083 861 469 463 280 --22996 475 --
NM_130392chr9103141 2976 2637 2561 1312 1083 861 469 463 280 --22996 475 --
NM_130393chr9103141 2976 2637 2561 1312 1083 861 469 463 280 --22996 475 --
NM_130446chr3123898 3675 3542 3526 3285 3141 2774 2687 896 212 141 117 --33763 2739 345 13051
NM_133170chr20147703 6990 6258 5884 5855 5511 5215 5147 3041 2917 2761 1939 1764 1556 12193 32035 1294 739 17244
NM_133265chrX82539 2408 2317 1415 1405 531 194 107 --2783 601 21100 493
NM_138473chr12124689 4400 4171 3871 3865 3773 3581 3282 1424 1406 1400 875 --11554 --
NM_138959chr1135771 5749 5158 4814 1734 1374 1217 990 928 855 839 806 297 35518 2365 1317 25838 1232 25978 384
NM_145912chr22154548 4148 4014 3552 3534 3485 3428 3381 3259 1514 1415 1406 741 443 405 84176 3898 3358 1845 1128 561 533 468 13139 --
NM_148955chr15166296 5497 5322 4975 4961 4763 4741 4388 4288 4281 3993 1400 1231 1102 618 443 76125 5196 4622 4537 2330 434 324 14901 --
NM_152263chr1115047 4354 3927 3831 3823 3798 2056 2021 1740 271 52 1128 25951 2035 --
NM_152388chr263459 1352 1158 719 667 389 21567 722 1541 1219
NM_152424chrX174568 4498 4177 4146 3978 3386 3366 3242 2912 1798 1481 1185 1138 1091 1031 548 209 44442 4249 3959 1737 14752 --
NM_152733chr6116312 4584 4527 4343 3959 2411 2305 2108 1032 902 113 35171 1867 612 15594 55876 4826 4739 2593 298
NM_152826chr15166296 5497 5322 4975 4961 4763 4741 4388 4288 4281 3993 1400 1231 1102 618 443 76125 5196 4622 4537 2330 434 324 14901 --
NM_153050chr22114333 3837 3319 3251 1732 1310 933 594 468 405 100 --34968 3387 1463 11046
NM_153051chr22114333 3837 3319 3251 1732 1310 933 594 468 405 100 --34968 3387 1463 11046
NM_153335chr175990 143 137 106 45 1195 2887 150 --
NM_153367chr1073507 3468 3374 3362 3210 215 206 --23242 1373 31339 501 261
NM_153456chr13106126 5875 4911 4618 4501 4333 2277 1718 1642 702 --56234 4592 3999 3875 678 11355
NM_173595chr12185113 4677 4659 4580 4517 4453 4194 4185 4156 3904 3886 3375 1724 1238 979 888 342 120 34646 4063 138 --1199
NM_173642chr1168305 8190 8123 8001 7184 7016 6598 6437 6418 6399 3504 3497 3477 3071 1076 991 --29003 543 --
NM_174911chr862822 2762 2458 788 350 32 1577 11060 3878 191 182
NM_175736chr12115748 3063 2815 2731 2717 2660 2445 1841 1441 1059 1019 --65761 4909 1853 1449 785 421 1721
NM_175859chrX130 122 31517 1483 152 1382
NM_175907chr187843 755 735 537 222 176 29 11879 21751 286 12224
NM_181491chr9132793 2716 2307 2103 2064 2057 1253 918 766 745 493 259 28 --31262 1028 520 12281
NM_181521chr16117225 6444 5450 5285 5275 2885 1932 1119 694 529 347 11645 24971 4947 12416
NM_181828chr2273808 3702 3646 2633 761 423 174 33517 2472 668 32575 584 151 23632 2623
NM_181829chr2273808 3702 3646 2633 761 423 174 33517 2472 668 32575 584 151 23632 2623
NM_181830chr2273808 3702 3646 2633 761 423 174 33517 2472 668 32575 584 151 23632 2623
NM_181832chr2273823 3717 3661 2648 776 438 189 33532 2487 683 32590 599 166 23647 2638
NM_182762chr774577 1847 1671 1558 730 476 31 ----12309
NM_194278chr14102984 1557 1498 1195 1075 954 548 468 80 73 1636 11201 13808
NM_198560chr3153503 3305 3274 3192 2839 2797 2750 2654 2408 1523 1424 1353 587 318 88 23459 1279 33621 926 242 23614 1343
NM_198900chr12115748 3063 2815 2731 2717 2660 2445 1841 1441 1059 1019 --65761 4909 1853 1449 785 421 1721
NM_201266chr2112954 2863 2808 1850 1084 997 985 652 183 165 55 ----12611
NM_201279chr2112954 2863 2808 1850 1084 997 985 652 183 165 55 ----12611
NM_203458chr173320 2585 2391 704 451 422 262 22394 533 23258 1447 --
NM_203463chr223049 837 2958 858 14581 24852 223
NM_206909chr897474 6516 2986 2051 681 631 593 514 240 ----26172 2722
NM_206944chr95316 254 245 239 206 ----1694
NM_206945chr95316 254 245 239 206 ----1694
NM_206946chr95316 254 245 239 206 ----1694
NM_206947chr95316 254 245 239 206 ----1694
NM_207012chr1053287 2816 2477 2405 1057 23337 85 --2776 569