TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-647
miRNA Sequence: GUGGCUGCACUCACUUCCUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1262328 2205 2186 1908 566 117 1153 ----
NM_000068chr1941047 299 224 97 11025 1215 --
NM_000081chr11654 1231 11565 --
NM_000084chrX116516 6072 5693 5205 4673 4418 2761 1982 1626 1592 1198 46094 4399 4266 309 12638 26317 1942
NM_000125chr684180 3144 2945 2928 1552 1542 1257 1107 31690 196 73 11144 --
NM_000129chr621059 275 --1963 1555
NM_000176chr543900 3234 1367 1220 1289 1618 --
NM_000202chrX23599 105 1165 12603 --
NM_000210chr21346 22262 371 ----
NM_000217chr1243627 3520 3335 41 21258 499 23813 1569 --
NM_000267chr1763016 2850 2807 2624 2270 742 ------
NM_000282chr13242 22 ------
NM_000314chr1032604 1173 571 1976 --1697
NM_000332chr626626 4595 16555 22366 309 --
NM_000346chr17--1538 ----
NM_000368chr954116 3661 1446 1181 1094 --34446 3462 825 --
NM_000378chr11------1229
NM_000408chr233419 2547 756 125 13269 --
NM_000428chr144565 366 228 46 1522 1968 --
NM_000430chr1732435 1435 601 11317 --1674
NM_000439chr521592 773 12093 --12112
NM_000445chr86813 674 347 316 256 34 ------
NM_000461chr314423 --23517 1023 --
NM_000462chr1531524 661 210 ------
NM_000533chrX41421 1414 774 553 1645 ----
NM_000539chr331605 70 64 --1562 --
NM_000555chrX77435 7412 7303 6602 2920 1708 492 26022 871 --17788
NM_000599chr2114129 4093 3806 3369 3277 2864 1561 905 575 459 58 ------
NM_000615chr1142758 1869 625 50 2480 269 ----
NM_000617chr1211813 21478 77 132 --
NM_000738chr117944 890 834 798 740 379 141 ------
NM_000801chr202930 876 ------
NM_000807chr43559 530 208 ------
NM_000812chr42300 108 ------
NM_000813chr565370 4269 4259 1870 338 279 --25569 1808 --
NM_000814chr1523376 1349 --1268 --
NM_000826chr4--2382 271 1444 --
NM_000838chr621989 541 22037 1718 ----
NM_000868chrX2987 650 11748 ----
NM_000875chr1576229 4846 4624 2163 911 665 200 26175 6062 25334 4491 24647 1092
NM_000883chr73638 287 238 ------
NM_000891chr1723571 634 --1112 --
NM_000945chr231738 672 517 ------
NM_000965chr31214 1294 ----
NM_000966chr122778 691 ------
NM_001001132chr21195 ------
NM_001001331chr352329 2260 932 311 295 ------
NM_001001396chr143702 2727 1709 237 1501 ----
NM_001001481chr852991 1284 1225 903 827 ------
NM_001001557chr81166 ------
NM_001001560chr221272 ------
NM_001001661chr76665 646 266 234 51 27 ------
NM_001001740chr1153 ------
NM_001001974chr1011687 167 21824 695 --
NM_001002762chr10112603 2296 2271 837 679 592 536 364 357 184 72 1898 32751 772 568 --
NM_001002838chrX41442 734 474 391 ------
NM_001003398chr121497 --2163 59 --
NM_001003674chr1874587 4381 1807 1470 732 433 53 15791 11205 11671
NM_001004065chr943692 2866 1227 402 12673 1495 --
NM_001004127chr132915 681 --31024 805 709 --
NM_001004360chr231591 596 100 ------
NM_001004419chr1221009 792 21150 837 ----
NM_001005473chr514230 12477 36055 5505 651 --
NM_001005609chrX53427 1236 633 620 463 22952 2334 1108 --
NM_001005732chr213660 471 38 145 1485 --
NM_001005845chr82635 176 ----1268
NM_001005910chr32151 89 ------
NM_001005920chr162692 326 1367 ----
NM_001006617chr931124 1069 276 11289 ----
NM_001006636chr2130 ------
NM_001006944chr112684 616 ------
NM_001007097chr9124917 4589 4280 4239 4221 3215 1858 1689 1560 1184 971 695 11989 --1227
NM_001007226chr17----148 --
NM_001007277chr114740 174 51 37 --1369 --
NM_001007278chr1331806 1423 441 65218 4518 3941 675 586 525 11305 13766
NM_001007559chr181150 11780 242 25 --
NM_001008220chr533401 2528 1095 2768 347 23443 1266 12797
NM_001008392chr352797 2616 1306 1137 363 12672 11239 --
NM_001008407chr781636 673 609 527 241 95 60 44 --3683 258 219 --
NM_001008408chr796017 4411 4090 1891 1711 1647 915 758 142 22525 1685 11599 --
NM_001008701chr1992629 2555 2395 1114 998 384 300 209 128 --21052 444 --
NM_001008738chr51119 21963 466 --1923
NM_001009880chr2294404 4170 4130 2973 1897 1873 1011 392 319 33507 3419 660 54147 3787 771 295 119 --
NM_001009899chr395757 5210 4473 4280 4153 2432 2052 1534 395 14895 16163 --
NM_001009955chr1----1575 --
NM_001009993chr284187 4165 2985 2867 1576 1322 915 643 --137 --
NM_001009996chr35574 467 394 383 189 174 ----
NM_001010911chr104792 756 693 322 11061 1994 --
NM_001011545chr21------1469
NM_001011663chr101327 --1383 1210
NM_001011666chr725130 289 14375 15968 25438 5022
NM_001012267chr981912 1906 1898 1735 772 510 446 310 --21696 1651 --
NM_001012977chrX2955 21 --1964 --
NM_001012989chrX------1446
NM_001013699chr12----1491 --
NM_001014434chr1----1157 --
NM_001014809chr4----1847 --
NM_001017440chr7177907 7318 6914 5934 2967 2881 2412 2279 1794 1723 1399 1362 982 569 378 282 32 35054 1238 1100 1329 12832
NM_001017926chr821290 1227 ------
NM_001017930chrX123 ------
NM_001018050chr22113330 2989 2710 2669 2517 2380 1334 527 367 307 73 ------
NM_001018108chr1541755 1401 770 169 --12286 --
NM_001024226chr13732 338 148 --1156 --
NM_001024455chrX62584 2490 2368 1848 995 257 11004 21995 857 --
NM_001024463chr153826 343 181 ------
NM_001024649chr552536 2454 2101 950 943 --1495 --
NM_001024666chrX--168 1687 --
NM_001024847chr32553 362 21863 259 ----
NM_001024947chr51369 --1263 --
NM_001024948chr143188 2294 2282 1342 --12981 11043
NM_001025079chr32451 178 --13778 --
NM_001025105chr541185 403 193 96 ------
NM_001025108chr262846 2796 2755 1110 864 86 23737 930 14070 13856
NM_001025266chr374674 4218 3919 3137 1786 1235 1175 --2976 366 --
NM_001025579chr1721138 803 ------
NM_001025580chrX53447 3114 2825 297 22 ------
NM_001025596chr112446 397 ------
NM_001025780chr9----1198 --
NM_001029864chr2032323 2249 349 11819 --12013
NM_001030005chr1521182 1109 ------
NM_001030007chr1653541 2879 580 318 279 13850 --12489
NM_001031680chr141838 1799 665 313 21001 959 32194 1980 168 --
NM_001031695chr2264670 4275 3969 3958 3585 991 14328 14235 1340
NM_001031711chr551174 705 376 355 305 --1161 1425
NM_001031717chr32374 326 --2197 123 --
NM_001032280chr621505 196 --1482 --
NM_001032380chr1021930 1538 --11294 --
NM_001032394chr61117 --1366 --
NM_001033081chr141388 1298 1275 254 11239 1137 1564
NM_001033087chr2042549 2403 2101 2051 --1661 12805
NM_001033507chr1----11534 --
NM_001033566chr17--2201 194 ----
NM_001033723chr832421 2316 1928 2816 785 42104 926 835 226 --
NM_001034841chr16125307 4723 4694 4095 4085 3682 3562 3371 1396 1342 1179 880 25443 2209 21510 787 --
NM_001035chr111045 --1348 --
NM_001037225chr11----143 --
NM_001037334chr1832395 1647 1511 --2416 346 --
NM_001037582chr441430 1303 281 265 1365 ----
NM_001037637chr51151 ------
NM_001037954chr1163362 2834 1357 1252 1215 670 ------
NM_001039348chr2--140 1369 --
NM_001039350chr721699 351 --11199 11270
NM_001039395chr9--11503 --22100 1644
NM_001039479chr1482417 2272 2138 1847 1818 751 525 102 --21541 700 --
NM_001039577chr1104095 3846 3312 3300 1677 1475 1369 859 393 123 161 54405 3380 1746 1454 1034 --
NM_001039577chr1104095 3846 3312 3300 1677 1475 1369 859 393 123 161 54405 3380 1746 1454 1034 --
NM_001039577chr1104095 3846 3312 3300 1677 1475 1369 859 393 123 161 54405 3380 1746 1454 1034 --
NM_001039590chrX31611 1125 458 ----1683
NM_001039618chr1175802 4846 4824 4399 4205 1790 1517 14648 --11723
NM_001039690chr1632157 2029 161 ----133
NM_001039693chr222963 592 11498 33626 3411 628 --
NM_001039762chr103963 949 350 --1697 --
NM_001039960chr1281648 1112 658 608 559 489 281 180 --1198 --
NM_001040057chr71243 --2574 137 --
NM_001040159chr42320 228 ----1144
NM_001040214chr63705 352 332 12059 ----
NM_001040284chr1655111 4445 4437 4130 940 14567 11567 --
NM_001040429chr1311354 --22827 464 --
NM_001040439chr1641203 533 243 120 11078 21290 77 --
NM_001040441chr155175 5143 4042 1798 944 11974 23796 1338 --
NM_001040450chr1522813 2781 --1258 --
NM_001040613chr811249 ------
NM_001040712chr942971 2521 1334 976 ------
NM_001042430chr14----1168 --
NM_001042481chr1421041 31 ----12674
NM_001042506chrX2955 21 --1964 --
NM_001042537chrX21632 1613 1723 --1977
NM_001042539chr162156 96 --1924 --
NM_001042539chr162156 96 --1924 --
NM_001042599chr236681 5388 255 ----16697
NM_001042604chr364153 4054 3266 1825 1278 980 ------
NM_001042681chr11603 --11737 --
NM_001042749chrX--11779 11305 11504
NM_001092chr1792283 2268 2228 2213 1819 1553 1020 904 459 ------
NM_001099678chr346051 4902 4870 4256 14189 --12435
NM_001106chr3108872 8081 8008 7970 7177 6664 2842 821 303 111 18200 28231 7904 13365
NM_001121chr101270 ------
NM_001148chr461593 854 832 788 221 123 --1758 11892
NM_001157chr102705 480 ----1677
NM_001174chrX8798 752 619 611 525 400 180 41 ----1860
NM_001188chr62456 161 11169 ----
NM_001204chr244989 4957 885 150 --1662 --
NM_001206chr91182 ------
NM_001222chr1071669 1604 610 464 161 89 34 --155 1140
NM_001234chr3174 --1166 --
NM_001238chr191411 ------
NM_001241chr2--11521 22456 30 1354
NM_001241chr2--11521 22456 30 1354
NM_001241chr2--11521 22456 30 1354
NM_001260chr13159 ----1130
NM_001262chr1------1112
NM_001270chr5142 11000 11068 --
NM_001304chr172917 234 --1405 --
NM_001343chr541657 1548 1375 77 --21108 345 --
NM_001356chrX51668 674 502 185 64 1794 12019 --
NM_001364chr1111882 ----1113
NM_001383chr173568 212 43 1194 ----
NM_001386chr821991 296 --22328 134 --
NM_001390chr1892548 2287 2255 1181 776 306 167 133 122 12854 --1220
NM_001406chr171702 21583 1194 ----
NM_001407chr351671 1531 1477 681 95 ------
NM_001416chr17129 --1441 --
NM_001417chr1231498 210 169 ------
NM_001420chr1962801 2378 2331 812 774 106 ------
NM_001421chrX31507 507 307 --11314 --
NM_001423chr121751 --21440 249 --
NM_001438chr173409 3337 3069 1080 820 744 148 ------
NM_001448chrX21560 1361 11238 11790 --
NM_001478chr122814 228 ------
NM_001489chr9------1247
NM_001530chr14159 --1456 --
NM_001543chr5134795 4333 4298 4185 3512 2943 2933 1927 1346 874 858 200 99 23404 3065 13045 --
NM_001554chr1----2476 197 --
NM_001627chr31499 --22244 220 --
NM_001635chr73871 827 696 ----1865
NM_001660chr3--2578 543 ----
NM_001663chr141850 --12251 --
NM_001668chr11496 1762 --1712
NM_001678chr1731668 745 221 --11258 --
NM_001681chr121555 ------
NM_001730chr131479 --1258 --
NM_001755chr16--11502 1255 --
NM_001759chr1254710 4689 4005 3880 556 13667 24748 4455 --
NM_001842chr91422 ----1226
NM_001923chr112539 233 ------
NM_001935chr221008 776 ------
NM_001949chr611295 ------
NM_001966chr3------1339
NM_001969chr1462963 2829 2706 2386 1208 61 13210 13566 13401
NM_001982chr1221107 822 --2183 43 --
NM_001999chr53558 336 43 ----11040
NM_002025chrX98651 6441 3689 3089 2482 1867 1744 1660 1556 17405 12631 1834
NM_002054chr2146 --1378 1153
NM_002080chr1631003 859 117 ------
NM_002086chr1752004 1927 1492 794 87 1723 ----
NM_002105chr111382 --1866 11011
NM_002137chr73822 404 119 ------
NM_002143chr12305 248 ----1729
NM_002188chr52653 636 1672 1660 --
NM_002193chr291653 493 385 315 274 246 141 104 43 1180 2360 236 --
NM_002203chr542870 2751 1466 44 --23751 2946 --
NM_002233chr11----1420 --
NM_002234chr12----1271 --
NM_002239chr2------1965
NM_002241chr131248 797 286 --22391 1201 --
NM_002247chr1022311 1823 ------
NM_002252chr22361 116 ------
NM_002264chr321085 525 11820 11914 11736
NM_002265chr1731072 420 240 --2175 169 --
NM_002268chr321682 738 --11420 --
NM_002269chr61375 --188 --
NM_002270chr522025 23 ------
NM_002293chr182509 1913 1785 1747 1013 750 724 343 --1562 --
NM_002310chr544896 4082 2425 25 11658 --15050
NM_002336chr1223543 3326 14563 1443 --
NM_002355chr124518 454 74 58 ------
NM_002356chr61701 --1893 --
NM_002398chr221099 69 1106 1933 --
NM_002399chr1521069 202 1106 ----
NM_002401chr1762226 1826 1629 182 122 116 --32439 2407 280 --
NM_002442chr1251163 1147 408 86 38 --192 --
NM_002473chr2241318 860 837 405 ------
NM_002480chr1221439 243 11151 168 --
NM_002501chr1963305 778 652 482 222 169 --24038 1082 1278
NM_002515chr1421391 779 ------
NM_002539chr2----1125 --
NM_002556chr1121680 808 1361 ----
NM_002581chr983875 1812 1570 1431 562 274 249 72 44639 4178 1761 448 14824 --
NM_002613chr1684336 3753 1957 1445 890 611 494 95 --13983 --
NM_002657chr2052626 1321 590 556 85 --1430 --
NM_002698chr1992706 2660 2522 2441 2040 674 305 157 40 --132 --
NM_002709chr242681 2274 1275 86 ------
NM_002731chr142357 2222 856 610 22369 1099 ----
NM_002753chr4193 ----1321
NM_002833chr1531453 1170 147 --11028 --
NM_002835chr7----1509 --
NM_002844chr6162 --1322 --
NM_002850chr193407 153 119 --11203 --
NM_002855chr1173165 2928 2505 2382 1390 1290 503 23074 2752 1163 --
NM_002868chr1252100 1946 944 755 182 ------
NM_002923chr1----1621 --
NM_002942chr31142 11236 ----
NM_002965chr1568 62 47 41 35 ------
NM_003010chr1741700 1621 1512 962 2584 449 2924 340 --
NM_003012chr8103164 2893 2320 2234 2156 1079 735 658 307 169 --2261 192 --
NM_003016chr1711775 --11364 --
NM_003026chr921187 237 ------
NM_003028chr9103820 3568 3469 3344 3012 2429 1512 889 844 79 13578 23445 3276 21184 632
NM_003074chr322144 488 1191 ----
NM_003108chr256815 6716 2102 2041 1190 --14721 --
NM_003112chr71384 ----1972
NM_003128chr21515 12306 1505 --
NM_003137chr642068 1650 1388 183 ------
NM_003150chr1741633 1461 756 331 22218 75 1594 --
NM_003178chr331956 1435 882 22207 1979 11391 --
NM_003181chr62117 93 --153 1610
NM_003223chr16----155 --
NM_003253chr211124 --1150 --
NM_003262chr344827 3782 1280 890 14570 1402 13643
NM_003319chr2------1769
NM_003320chr1164324 3825 3482 913 852 142 21032 395 23763 3703 --
NM_003340chr431358 1170 1085 ------
NM_003344chr731495 1117 484 21545 1403 1666 11521
NM_003348chr1211550 1475 11475 1447
NM_003385chr2----159 --
NM_003390chr1111005 ------
NM_003392chr321553 1090 --11483 --
NM_003406chr81391 ------
NM_003407chr19------1453
NM_003413chrX----1169 11936
NM_003458chr3123616 3571 3185 1616 1335 825 783 399 389 376 200 85 11215 23097 2701 --
NM_003468chr284109 3686 3659 2733 1641 1272 839 489 13328 ----
NM_003470chr162607 592 --1383 --
NM_003482chr12----2265 86 --
NM_003483chr12--1633 12679 --
NM_003557chr121370 350 ------
NM_003559chr17103609 3507 3083 3058 2793 2725 2535 1325 1150 141 --23444 3262 12772
NM_003564chr14532 492 479 206 ------
NM_003592chr7----185 --
NM_003629chr173163 2686 2669 1370 429 278 195 --1148 --
NM_003701chr132333 171 ------
NM_003743chr272173 1818 1516 778 496 471 296 --1100 --
NM_003758chr15----1281 --
NM_003870chr1532018 713 585 199 ----
NM_003873chr1021750 536 22096 28 1199 --
NM_003877chr12----153 --
NM_003895chr2131974 1886 794 11592 1243 --
NM_003900chr521226 298 ------
NM_003901chr101973 --22486 2395 --
NM_003913chr611070 11430 11301 --
NM_003958chr632756 556 149 11061 23130 2857 --
NM_003988chr10102306 2154 1896 1843 1498 786 651 500 419 191 ------
NM_004090chr1752391 2260 1134 757 511 13462 11028 --
NM_004093chr1352805 2337 759 678 603 ------
NM_004118chr20123 ------
NM_004124chr142988 570 --12764 --
NM_004132chr1021049 413 --11010 --
NM_004161chr221048 366 1186 --11382
NM_004170chr9--1513 --11485
NM_004172chr521620 1538 11585 ----
NM_004200chr1142994 1232 294 124 12254 11010 --
NM_004227chr772430 2062 792 717 348 94 63 --1609 --
NM_004286chr2242575 2201 1873 115 22813 2158 31969 184 78 --
NM_004309chr1721001 876 --2346 261 --
NM_004311chr1052689 997 700 495 382 ----1875
NM_004316chr121319 1172 21051 1026 --
NM_004321chr2103332 3026 2791 2537 2492 2315 1022 774 516 24 32383 2302 354 22924 739 --
NM_004385chr54581 539 270 122 141 ----
NM_004392chr1342585 2022 1906 1027 11694 149 --
NM_004393chr332232 352 182 --11699 --
NM_004397chr1154086 3466 2645 1500 811 ----11109
NM_004416chr122150 80 21004 931 1124 --
NM_004423chr3102494 2111 1868 1049 901 642 576 409 185 43 ----1815
NM_004427chr11995 --2486 367 --
NM_004429chrX41345 1325 520 452 --11231 --
NM_004430chr852752 1024 174 125 79 1230 1856 --
NM_004432chr9--1291 12183 --
NM_004438chr21405 12203 --12105
NM_004458chrX42182 359 197 39 ------
NM_004480chr141142 168 ----
NM_004482chr2------199
NM_004504chr22862 382 ------
NM_004505chr173719 604 253 ------
NM_004521chr10----169 --
NM_004537chr1211291 ----1139
NM_004539chr18------1973
NM_004580chr151170 --1291 --
NM_004583chr172583 518 1791 1302 --
NM_004603chr71818 --3894 730 227 --
NM_004615chrX----2255 239 --
NM_004643chr141587 ------
NM_004654chrY1322 ------
NM_004655chr1731386 925 137 ------
NM_004660chrY42195 670 178 65 --11613 --
NM_004685chr1312410 22516 301 ----
NM_004717chr731428 1096 68 ------
NM_004723chr12864 392 ------
NM_004734chr1343230 3207 2696 2448 22546 393 123 --
NM_004748chr1533602 3168 1676 --12594 --
NM_004758chr171178 --11022 --
NM_004772chr511226 ------
NM_004774chr1743004 2953 1941 1924 --11199 --
NM_004788chr1142349 2179 1813 1105 --22507 1801 --
NM_004799chr1----150 --
NM_004801chr211047 1402 ----
NM_004805chr241090 530 521 201 --21179 218 --
NM_004839chr15----1261 --
NM_004850chr241768 1675 1204 274 --122 --
NM_004852chr181212738 12358 11299 11270 9585 9512 9383 2028 1431 1031 745 546 612751 12345 10528 8826 4253 1450 310944 10917 385 --
NM_004884chr1541647 1155 463 155 --11200 --
NM_004898chr442615 296 218 190 12856 12664 --
NM_004921chr11511 ------
NM_004958chr11650 --1883 --
NM_004964chr12402 158 ------
NM_004973chr62568 399 11548 1200 --
NM_004995chr143467 232 114 1611 11116 --
NM_005026chr151470 1368 1280 457 182 --1471 --
NM_005076chr1113957 3593 3525 3511 3021 2805 1214 961 379 57 30 1758 1937 --
NM_005105chr13341 321 54 1425 11591 1815
NM_005121chr1742727 2709 307 268 1723 11161 --
NM_005168chr211516 191 --11214
NM_005180chr101514 --1477 --
NM_005184chr1931061 1031 503 11476 11053 --
NM_005187chr1671987 1975 1749 1546 1483 1295 217 1787 11425 --
NM_005188chr1186550 5545 3007 2817 2297 2040 1811 699 13322 47725 7058 5634 178 26485 808
NM_005225chr203763 220 53 ------
NM_005233chr322291 288 1710 11918 --
NM_005239chr211272 1198 ----
NM_005281chr14872 817 810 804 ------
NM_005318chr2211025 --2919 487 --
NM_005324chr1732104 1945 830 --21522 492 --
NM_005328chr81297 --127 --
NM_005329chr1621862 270 21938 1593 ----
NM_005336chr271609 1577 918 860 602 286 163 --1321 --
NM_005339chr423462 398 1642 1947 --
NM_005375chr621082 952 --1241 --
NM_005378chr22209 24 ------
NM_005385chr3------2414 216
NM_005392chr991587 1537 1260 707 641 414 327 241 154 1511 --1630
NM_005399chr154180 2878 1736 1537 252 14057 13536 --
NM_005417chr2021660 1465 11767 ----
NM_005418chr111658 ------
NM_005436chr1023355 2617 11428 1165 --
NM_005458chr931643 1611 382 --11686 --
NM_005465chr111699 2744 122 --12012
NM_005491chrX42206 834 478 77 1517 1660 --
NM_005503chr151106 --41129 877 385 26 --
NM_005520chr5----128 --
NM_005537chr13----1730 --
NM_005540chr111041 1428 1116 --
NM_005542chr721356 272 ----11756
NM_005546chr572389 1677 610 574 541 198 112 ----1176
NM_005578chr384046 3818 3698 3657 3352 3237 1304 21 --1451 --
NM_005596chr976378 3882 1100 625 568 351 337 25057 48 --16395
NM_005604chr632082 913 406 ------
NM_005629chrX41190 539 387 46 1842 138 --
NM_005639chr1261743 1230 1189 666 97 49 ------
NM_005647chrX73291 2704 2622 2236 723 67 46 --42652 2497 1303 1229 --
NM_005715chr622101 1896 12434 --11813
NM_005717chr11826 --1446 --
NM_005723chr4----1233 --
NM_005731chr2----1341 --
NM_005739chr152658 545 1404 1594 --
NM_005746chr712096 193 ----
NM_005776chr142286 93 ------
NM_005779chr533485 2364 157 --1740 11121
NM_005813chr21909 --11721 --
NM_005819chr163008 2810 2371 826 365 222 ----33040 2430 1125
NM_005832chr32541 92 1408 ----
NM_005859chr52248 57 ------
NM_005862chr3----1717 --
NM_005868chr71404 ----12392
NM_005876chr21794 --1601 --
NM_005885chr51425 11499 ----
NM_005899chr1731405 1332 1036 ------
NM_005909chr584178 4126 4026 3901 3759 3452 2988 2673 21159 278 ----
NM_005911chr211157 --1125 --
NM_005933chr1162947 2632 2019 1033 454 79 22655 665 ----
NM_005941chr853295 1104 735 643 108 --13849 --
NM_005955chr185173 4546 1833 1018 686 628 605 513 24419 1654 11564 11809
NM_005957chr1154819 4787 4116 3472 3307 3286 1973 1360 1247 986 804 661 484 337 217 13896 51678 1540 1096 1070 139 --
NM_005966chr231827 615 175 42292 1927 1516 120 ----
NM_005969chr114996 916 306 46 --11107 --
NM_006015chr12980 921 ----11063
NM_006037chr2104266 3734 3540 2971 1961 875 848 329 205 137 2791 58 ----
NM_006054chr1131211 469 372 --1508 --
NM_006114chr191155 ------
NM_006129chr81555 ----1575
NM_006141chr162783 698 12436 12745 --
NM_006159chr121108 ----1100
NM_006161chr51122 ------
NM_006224chr1772552 2039 1900 741 612 543 60 1761 199 --
NM_006251chr533083 1311 1054 159 ----
NM_006256chr12814 249 1755 12306 --
NM_006306chrX85808 5746 4970 4354 4331 3778 1505 1067 13885 15548 --
NM_006325chr12147 --1261 --
NM_006371chr344948 4592 2034 640 34742 3502 1171 25162 4899 --
NM_006378chr9----1367 --
NM_006380chr1743294 1661 1374 1267 --1960 --
NM_006454chr4113043 2920 2620 2569 2307 2300 2250 2080 1055 994 41 --22170 916 --
NM_006472chr161258 1190 1180 1161 192 24 ------
NM_006517chrX62255 2061 1701 866 480 121 ------
NM_006532chr1961627 501 342 253 199 129 --11323 --
NM_006539chr16------1502
NM_006544chr1475396 5387 4549 2293 1548 899 66 34821 1575 110 24376 148 14613
NM_006546chr17136640 6562 6487 6126 5983 5969 5610 4993 2665 2176 1730 1451 1086 ------
NM_006557chr931553 1536 1154 ----11399
NM_006558chr81368 130 ----
NM_006599chr1666210 5602 2636 2269 1666 696 35923 5278 2303 --18280
NM_006614chr31988 23454 2518 ----
NM_006622chr51397 ------
NM_006624chr1022029 1547 ------
NM_006646chr1372898 1203 1052 828 806 704 550 ------
NM_006651chr451244 490 375 305 90 11526 ----
NM_006690chr2062322 2124 1447 781 73 41 ------
NM_006769chr1----1653 --
NM_006775chr642760 2145 2023 570 11185 ----
NM_006788chr1841952 1727 1655 675 12063 ----
NM_006827chr1441333 766 363 40 --1772 --
NM_006836chr121248 1138 ----
NM_006856chr122156 30 2992 255 ----
NM_006885chr1623252 407 --13196 --
NM_006902chr122286 1321 22875 152 --1508
NM_006908chr731401 1144 564 ------
NM_006914chr91574 ------
NM_006927chr1692106 1939 1907 1616 1394 1366 752 280 98 1202 ----
NM_006939chr14------11115
NM_006946chr114573 468 413 173 ------
NM_006981chr932541 825 115 1398 1688 --
NM_006990chr142040 1588 395 379 11547 12474 12452
NM_006996chr11363 1272 1123 --
NM_007008chr23625 593 138 ------
NM_007011chr15106159 5548 4569 4309 4297 2302 1800 787 158 31 --45167 4978 4938 4859 --
NM_007013chr81331 150 ----
NM_007038chr2145940 4104 1141 57 44432 3808 752 612 23888 492 --
NM_007106chr1331825 783 550 ----1252
NM_007107chr321661 1629 12061 --1594
NM_007124chr631656 512 497 ------
NM_007135chr92158 122 ------
NM_007146chr1722604 2209 --12155 12688
NM_007159chr321281 1192 11349 11401 --
NM_007162chr64573 455 198 165 --1104 --
NM_007170chr1----1323 --
NM_007174chr1232190 1504 103 --1230 2649 579
NM_007202chr173537 503 476 182 ----
NM_007246chr41209 --1979 --
NM_007282chr31353 1252 --1637
NM_007285chr16155 --1394 --
NM_012069chrX52477 1690 325 314 98 31983 993 120 11071 --
NM_012104chr1143056 2703 1368 753 1790 --11051
NM_012137chr152620 2557 1842 507 356 12816 ----
NM_012154chr8293 53 ------
NM_012193chr1155168 4087 1511 1359 276 34713 4302 1236 ----
NM_012199chr154592 911 899 363 185 13863 14390 13726
NM_012234chr312408 --11330 12561
NM_012238chr1011425 1398 --1538
NM_012249chr253339 1118 994 465 66 ----1474
NM_012257chr71778 1734 ----
NM_012259chr61202 --184 --
NM_012285chr17----199 --
NM_012286chrX----1585 --
NM_012293chr231986 908 698 22213 1598 12142 --
NM_012300chr552533 2355 2204 864 141 ------
NM_012301chr721954 1666 --1235 --
NM_012302chr14324 308 242 73 ------
NM_012307chr181286 --137 --
NM_012308chr1141806 961 900 497 ------
NM_012316chr1125376 5330 5268 5101 4778 4005 3886 2066 1598 98 59 45 ------
NM_012323chr2261386 1354 1083 620 158 26 ------
NM_012326chr25714 699 326 320 299 ------
NM_012329chr17------1576
NM_012330chr1021172 726 --1286 --
NM_012333chr141213 413 369 233 1309 ----
NM_012395chr742829 2122 929 357 --12394 11332
NM_012399chr22----178 21472 660
NM_012402chr1131304 362 51 2354 255 ----
NM_012421chr1----187 --
NM_012455chr271443 1234 1083 443 437 224 213 11255 11544 --
NM_012458chr1981230 1076 956 944 938 221 172 164 --1851 --
NM_012479chr772127 1014 934 611 454 216 46 ------
NM_013231chr1453566 3507 3153 3059 748 ------
NM_013255chr757890 5965 5915 3070 65 37554 2468 1705 16066 11592
NM_013261chr463495 2989 1169 1151 959 603 ----12336
NM_013267chr12--1481 1117 --
NM_013309chr1542327 2246 2217 1696 --144 --
NM_013354chr811193 ------
NM_013397chr62887 784 --1102 1797
NM_013399chr1641768 1691 1317 384 --1371 --
NM_013437chr8------1196
NM_013943chr121241 394 --23297 376 --
NM_013960chr8135 --1545 --
NM_014112chr81801 24343 1099 --15044
NM_014117chr1622344 458 --12709 --
NM_014155chr1156251 6155 5527 2205 1325 45225 4792 1532 921 16618 1198
NM_014160chr331343 358 161 ----188
NM_014191chr121965 1256 --1334
NM_014212chr121706 ------
NM_014231chr122704 439 1810 11659 12011
NM_014238chr1741262 1235 266 257 --11460 --
NM_014248chr22----1134 --
NM_014253chrX2697 503 1250 ----
NM_014268chr1841067 961 903 144 ------
NM_014286chr972960 2819 2619 1423 1369 298 120 --22952 474 1811
NM_014289chrX31163 924 198 --1470 --
NM_014293chr2273716 3320 3042 2842 1586 985 818 1511 21201 716 --
NM_014317chr10----128 --
NM_014319chr1221840 398 1783 ----
NM_014325chr12--32105 1749 1699 1592 --
NM_014345chr61385 --2847 116 --
NM_014388chr1105198 4516 4337 4305 4278 4206 4133 3733 2367 731 32435 2076 491 ----
NM_014421chr421687 663 21369 582 32081 1449 196 --
NM_014491chr711029 1806 1871 --
NM_014494chr163667 441 103 --180 --
NM_014515chr12------1905
NM_014554chr1231809 688 62 12262 ----
NM_014571chr152420 1218 432 406 127 21005 602 ----
NM_014603chr1781530 1312 1244 223 165 117 97 69 11209 1686 --
NM_014615chr1653332 3268 2636 2496 1241 ------
NM_014636chr953835 2770 1447 921 72 --23800 1123 --
NM_014644chr11316 1231 292 37 --
NM_014661chr10113882 3844 3617 3430 2569 1153 900 818 471 316 254 --33136 2424 229 --
NM_014665chr8163590 3540 3322 3033 2799 2763 2522 2491 1405 996 836 742 690 671 483 39 23603 961 43434 3076 2995 1072 --
NM_014666chr51851 --1829 21068 205
NM_014682chr81888 11425 --1205
NM_014686chr1961816 1606 768 688 308 159 --1628 --
NM_014689chr2------154
NM_014701chr1521277 683 --149 --
NM_014702chr623028 536 ------
NM_014705chr71714 --22067 1742 --
NM_014706chr121481 ------
NM_014712chr163531 251 168 ------
NM_014729chr822228 2159 2841 74 1398 --
NM_014730chr12104907 4553 1953 1861 1807 1400 1382 1210 165 53 21544 843 45094 1889 1345 949 24489 1608
NM_014751chr82835 656 12018 11391 --
NM_014770chr1221046 1008 11157 ----
NM_014772chr18183228 3209 3184 2912 2850 2775 2548 2255 1283 1245 773 616 565 538 463 366 36 25 22520 2410 --1865
NM_014774chr163261 3012 2543 2458 958 559 1734 ----
NM_014779chr311011 --194 --
NM_014790chr5----197 --
NM_014795chr2--1144 --11430
NM_014810chr122519 600 13545 ----
NM_014824chr111262 21754 778 1697 --
NM_014844chr14124170 4114 3813 3643 3174 1589 1460 1290 1211 401 366 358 --13856 --
NM_014848chr1542298 900 851 770 12307 22120 1121 12363
NM_014872chr911922 --31758 554 244 --
NM_014873chr163800 3498 3017 1889 1279 905 --24274 4164 --
NM_014876chr2221835 1743 11849 ----
NM_014877chr1777432 7106 6980 6846 5233 1597 1202 37310 6065 2470 --1281
NM_014893chrY21816 353 --1138 11710
NM_014901chr51525 --21692 728 --
NM_014945chr521915 438 1569 11696 --
NM_014947chr152978 2331 2181 1997 1149 ----12137
NM_014949chr1------1783
NM_014952chr1551889 1361 692 641 380 ------
NM_014962chr2022563 22 12728 12746 --
NM_014967chr1531180 1020 188 --1995 --
NM_014974chr1031532 554 103 --21771 160 --
NM_014982chr1423633 1551 14134 11433 --
NM_014989chr631623 1329 637 ------
NM_014990chr141186 1162 1208 --
NM_014991chr433177 2383 735 --12748 --
NM_015020chr1673658 3399 2585 943 567 390 184 13624 33617 2986 500 --
NM_015025chr242218 2071 1769 749 --22120 441 --
NM_015027chr1621916 537 ------
NM_015042chr1553959 1356 1067 1021 246 --23148 444 11326
NM_015044chr1673244 2452 973 871 850 715 292 2865 353 1758 --
NM_015045chr102403 388 ------
NM_015064chr12123567 3535 3404 2680 2342 1380 1277 1186 1055 1032 229 24 ------
NM_015071chr556374 6025 5718 5642 503 35449 4265 181 35026 4800 584 --
NM_015074chr165005 4008 3638 3426 3271 3239 14449 13976 --
NM_015075chrX92002 754 715 660 502 375 348 270 237 1897 ----
NM_015076chr614299 --11672 --
NM_015092chr1621681 703 23449 442 ----
NM_015097chr322251 620 ------
NM_015100chr1----11859 --
NM_015107chrX1715 ----11848
NM_015110chr941868 1616 334 175 22195 2061 ----
NM_015111chr593155 2774 2673 2605 2583 2554 2492 1513 1437 11109 ----
NM_015138chr1542424 2336 131 97 --12308 --
NM_015141chr332453 1000 967 22475 332 1835 --
NM_015144chr1653633 2751 827 564 245 --1342 --
NM_015156chr1493930 3624 3512 1395 349 334 328 317 79 1933 23449 110 --
NM_015172chr141535 526 396 247 ----178
NM_015215chr152773 2289 2280 863 707 --12216 --
NM_015231chr11----1373 --
NM_015236chr4----11007 --
NM_015270chr1252211 2041 816 523 331 ------
NM_015272chr1632118 2074 1873 --11404 --
NM_015278chr642892 1198 767 346 --12882 --
NM_015282chr262819 2553 2317 327 202 90 --22534 2512 --
NM_015284chr161824 1641 1593 1520 378 203 ----1809
NM_015288chr572614 2568 2517 1107 746 490 61 ------
NM_015293chr62492 117 ------
NM_015299chr1493550 2971 2825 2556 1402 914 541 187 43 11474 23623 2855 --
NM_015315chr563178 2830 2199 1367 421 345 ------
NM_015326chr172653 2487 536 301 253 231 222 12682 22647 594 --
NM_015327chr13947 846 535 --21105 63 --
NM_015328chr711172 1725 ----
NM_015332chr793376 2900 2281 2266 1326 882 740 302 112 11139 13257 --
NM_015335chr123377 256 236 ----1898
NM_015339chr202669 37 --1825 --
NM_015349chr653018 1185 601 555 235 23097 1873 ----
NM_015361chr2----1380 --
NM_015375chr174691 4283 4251 3303 1901 775 196 --23412 510 --
NM_015382chr143630 284 193 ------
NM_015388chr62106 40 ----1211
NM_015396chr331474 1014 905 --1301 --
NM_015439chr6147 164 ----
NM_015460chr351833 616 574 353 71 ------
NM_015461chr181728 ----1669
NM_015503chr161276 --2286 98 1108
NM_015515chr171234 ----1272
NM_015542chr10------1267
NM_015545chr77576 550 532 238 198 191 115 --1541 --
NM_015569chr121311 250 21830 697 13016 --
NM_015577chr521710 250 --171 --
NM_015578chr191750 1547 11537 --
NM_015609chr152911 2885 2690 1988 902 12495 22156 698 --
NM_015630chr2----143 --
NM_015652chr10----1423 --
NM_015678chr13----11320 --
NM_015902chr81878 1235 1715 --
NM_015982chr172285 169 ------
NM_015995chr1583656 3416 3364 1875 1805 560 480 376 11418 24544 24 --
NM_016009chr133522 251 119 23222 390 ----
NM_016022chr12195 183 ------
NM_016026chr14--11519 ----
NM_016061chr2----1274 --
NM_016075chr13----1471 --
NM_016081chr441570 564 244 89 --152 --
NM_016132chr152867 683 ------
NM_016147chr1121068 101 ------
NM_016235chr1641246 592 436 113 1136 ----
NM_016246chr19----1154 --
NM_016255chr622369 2058 --1105 --
NM_016261chr172178 146 1532 1784 --
NM_016271chr181115 11561 1761 --
NM_016339chr1751771 1602 1306 1292 377 --11213 --
NM_016373chr161539 --1130 --
NM_016396chr1512854 --21206 395 --
NM_016424chr173655 615 213 1692 ----
NM_016436chr2022315 1684 --11720 --
NM_016441chr23710 582 542 ------
NM_016472chr1411195 ------
NM_016525chr9188 ------
NM_016529chr131959 1132 --197
NM_016544chr253199 2624 2586 843 529 1997 43216 1319 661 613 13181
NM_016604chr52869 137 ------
NM_016620chr1125 --1269 --
NM_016623chr8------1235
NM_016929chr664219 1147 1122 790 273 238 ------
NM_017412chr811020 1108 ----
NM_017415chr554368 4119 4077 1735 1571 13488 13250 --
NM_017420chr1463294 3251 3146 2939 2668 191 ------
NM_017423chr41502 1481 1390 --
NM_017450chr1721241 922 --122 --
NM_017542chr121423 153 --1716 --
NM_017548chr32475 62 11790 1276 146
NM_017554chr31656 1330 ----
NM_017580chr1022184 1878 --21891 1870 --
NM_017590chr2251802 868 481 194 117 --22062 1969 --
NM_017599chr1211835 --1410 --
NM_017602chrX2874 334 --1327 --
NM_017610chr1531880 1857 1404 ----161
NM_017628chr494271 4255 3844 2109 1998 1950 1439 296 244 --24705 3967 --
NM_017637chr9109482 7179 7153 6379 6221 3561 2969 1733 1726 1398 27752 1203 12898 11786
NM_017640chr6--1663 2332 47 --
NM_017650chr785662 5491 5224 4883 4270 4048 3688 1592 14132 1776 15147
NM_017666chrX32036 1514 829 1106 ----
NM_017801chr31159 ----12544
NM_017811chr942869 2176 2094 1909 --11020 --
NM_017824chr1021786 694 --1225 --
NM_017848chrX11825 24133 1459 ----
NM_017849chr273183 2807 2699 926 262 51 31 ------
NM_017851chr1551154 463 276 173 85 1185 ----
NM_017893chr104456 202 150 79 1161 ----
NM_017923chr43816 773 53 1523 ----
NM_017925chr93773 582 558 ------
NM_017943chr14179 1693 1723 --
NM_017944chr1142763 2674 654 533 ----11143
NM_017949chr17154 --2265 98 1244
NM_018008chr32342 328 --1271 --
NM_018014chr21101 21354 301 ----
NM_018028chr191104 --3852 843 227 --
NM_018120chr821125 299 ------
NM_018121chr1063079 3069 2886 2580 2175 2118 11110 ----
NM_018128chr1741303 1271 220 37 --21010 477 --
NM_018133chr3----2401 60 --
NM_018137chr13930 37 22 11062 --11162
NM_018157chr123482 338 284 --2663 391 --
NM_018202chr12839 678 1236 --2271 72
NM_018254chr11484 11929 ----
NM_018362chr1133375 3116 2747 --22610 1216 --
NM_018364chr1------13831
NM_018367chr1121994 746 1671 1398 --
NM_018387chr9----1409 --
NM_018388chrX21216 143 ----1114
NM_018439chr1842616 2495 2029 109 ------
NM_018469chr172424 100 --2571 382 --
NM_018553chr1741383 266 117 23 --1476 --
NM_018584chr12859 843 --1301 --
NM_018593chr61274 --1717 --
NM_018638chr1233810 3670 494 14654 11354 --
NM_018667chr1692248 2169 1954 1120 586 520 125 46 40 21130 496 1436 --
NM_018718chr762048 1826 779 501 449 374 11644 ----
NM_018719chr741354 1116 1099 24 ------
NM_018898chr52386 31 11685 1593 --
NM_018945chr663078 2940 2626 1213 91 85 21066 740 23681 2576 --
NM_018979chr1241008 592 235 77 --12531 --
NM_018999chr1061606 800 793 735 345 99 21314 470 ----
NM_019046chr105904 695 663 316 102 --1133 --
NM_019058chr102622 330 --2531 119 --
NM_019106chr2232524 2453 2188 13341 12820 11029
NM_019116chr1643453 2443 1033 971 --1214 --
NM_019854chr121207 --1679 --
NM_020127chr14671 635 502 208 --11661 --
NM_020137chrX------1441
NM_020143chr22130 95 ------
NM_020180chr1811200 1141 ----
NM_020198chr17------11565
NM_020310chr1772564 1925 1830 983 802 681 89 11104 22166 615 --
NM_020338chr1063447 2489 2335 1382 1216 146 --12873 --
NM_020341chr2031770 306 196 1109 1498 --
NM_020342chr23626 442 47 ------
NM_020348chr1052415 894 733 632 555 1925 ----
NM_020382chr1211186 ----1290
NM_020429chr792813 2530 2463 2022 1129 827 634 453 407 12539 32792 504 247 --
NM_020440chr162567 2064 928 773 687 246 --12985 --
NM_020443chr174877 4636 4595 2511 1743 1676 51 25896 5694 16425 15533
NM_020463chr211243 1138 ----
NM_020474chr1821458 132 11252 21265 424 --
NM_020644chr112905 881 1212 ----
NM_020699chr144944 3955 3750 3593 14757 11936 --
NM_020715chr1431722 1462 853 --12286 --
NM_020718chr1665999 4717 801 789 586 214 --12033 --
NM_020742chrX1350 1372 1156 11776
NM_020748chr172363 229 --12145 --
NM_020752chr10----1621 12229
NM_020760chr2----11686 --
NM_020778chr15154677 4664 4278 4133 4034 1971 1670 1437 1191 1063 906 719 516 244 54 14919 21247 913 --
NM_020807chr1661495 1217 1124 730 561 69 1691 31775 397 210 --
NM_020813chr1952248 1977 685 258 116 1340 42434 1875 841 494 --
NM_020824chr102163 99 ------
NM_020830chr25825 698 627 69 40 1259 2352 102 --
NM_020845chr12112177 1983 1962 1954 1909 1902 1863 1767 873 400 339 1754 ----
NM_020850chr1682748 2591 2483 2012 1248 1236 645 215 1594 13026 --
NM_020851chr1531747 339 62 2676 426 --11792
NM_020897chr131176 501 487 --1233 --
NM_020921chr1443585 1325 1008 238 23157 1272 ----
NM_020927chr1611920 --1124 --
NM_020956chr19124792 4559 4399 4360 3999 3599 3573 3486 1582 1067 994 820 14225 13917 11341
NM_020962chr1531734 965 682 ------
NM_020988chr1641153 1147 524 359 ------
NM_021003chr142751 155 ------
NM_021005chr15------1788
NM_021020chr8103211 2523 1262 1204 1047 737 725 616 588 195 --12395 --
NM_021038chr341120 508 124 79 1761 ----
NM_021045chr1022208 1936 --1701 --
NM_021079chr1763369 3044 2765 1081 1045 812 11326 1245 --
NM_021090chr22124661 4266 3917 3511 3149 3077 3056 1957 1838 1109 923 688 ----1842
NM_021106chr93651 633 611 1523 --1742
NM_021116chr7138509 7993 6410 5770 3369 3337 3111 2951 2646 2452 1617 89 79 12609 58062 6573 2467 1729 1287 17165
NM_021117chr1122110 1643 --3543 466 50 --
NM_021145chr73966 283 113 ------
NM_021161chr141240 ------
NM_021200chr11----11129 --
NM_021202chr2061929 1907 1176 1170 705 522 ------
NM_021239chr141402 --1249 --
NM_021637chrX1904 ----1888
NM_021914chr1441493 926 745 158 1241 11604 --
NM_021943chr651810 1398 211 132 74 --51918 860 738 463 110 --
NM_021961chr1186028 2825 2703 2596 2327 1800 1410 266 15761 12265 --
NM_021964chr376417 5520 4423 2586 2400 1657 1263 --1699 --
NM_021977chr643439 1404 1148 94 23194 2457 1220 --
NM_022042chr44813 743 345 24 --1909 --
NM_022048chr15116069 6018 4752 4711 4190 3857 1253 1206 1015 639 59 34318 1101 860 25127 163 14119
NM_022066chr174844 775 728 46 --11052 --
NM_022080chr2021933 578 11889 --130
NM_022373chr74916 796 658 21 ------
NM_022459chr1331763 1091 198 1342 1882 --
NM_022462chr1943402 2914 961 706 ----172
NM_022463chr1751237 515 390 246 158 21414 1365 ----
NM_022465chr1272851 2704 1112 585 383 304 98 12263 ----
NM_022480chr153144 33 23 --11335 --
NM_022491chr1232286 336 218 --23153 2709 --
NM_022574chr72639 591 11851 144 11806
NM_022648chr263815 3483 3272 2916 1247 962 --11818 --
NM_022719chr22113615 3580 3322 3250 3166 2684 1047 1016 643 565 52 12962 ----
NM_022726chr6----11602 --
NM_022758chr632104 1274 1162 1594 22848 240 --
NM_022778chr151397 1316 1305 1160 1106 ------
NM_022780chr221176 605 ----184
NM_022782chr121290 --161 --
NM_022841chr151280 --1650 --
NM_023010chrX------144
NM_023033chr122390 110 ------
NM_023034chr8----1379 --
NM_023079chr1741780 1367 1356 437 ------
NM_024019chr42981 133 ------
NM_024036chr111208 --1229 --
NM_024090chr441654 743 723 135 ----194
NM_024092chr115980 960 189 135 65 1146 ----
NM_024329chr111413 ------
NM_024345chr983801 2213 1707 1542 1420 1221 1092 1055 --24585 3717 --
NM_024522chr151708 673 200 111 49 --21815 1634 --
NM_024551chr1242239 2069 2040 882 --22331 2083 --
NM_024594chr51198 --11857 1277
NM_024613chr841412 635 397 99 --11301 --
NM_024631chr111241 1554 ----
NM_024665chr322974 1761 2116 49 1933 --
NM_024713chr151208 --1454 --
NM_024721chr8------12227
NM_024757chr941108 199 180 149 --11060 --
NM_024771chr1162383 2354 1987 1685 1510 317 ------
NM_024798chr1572340 2264 2198 2009 974 421 252 1210 12868 --
NM_024887chr121666 1353 ------
NM_024919chr63781 461 311 --1116 --
NM_024954chr101606 --1190 --
NM_024989chr275699 2654 2472 2065 1070 495 347 --25214 526 --
NM_025054chr811073 22868 673 ----
NM_025083chr15112005 1977 1642 1599 1450 466 320 291 282 260 169 ------
NM_025134chr1612221 32229 1862 566 --1421
NM_025160chr132988 2652 509 ----11579
NM_025179chr194475 4335 3980 3947 3434 3334 1607 980 176 1161 33420 1652 684 13769
NM_025182chr91896 ------
NM_025187chr1611179 --11282 --
NM_025191chr163331 3243 3216 2593 973 907 ------
NM_025195chr81464 1695 11461 --
NM_025222chr352419 1202 758 427 421 --22155 42 --
NM_030571chr531528 1439 336 ------
NM_030621chr1454182 4120 3348 2832 385 ----14239
NM_030627chr533071 2675 107 ----11070
NM_030629chr1641465 674 464 64 --175 --
NM_030647chr785316 4911 4539 4265 2465 2311 1790 916 ----25917 782
NM_030648chr454324 1410 1216 1204 338 --32115 2059 1739 --
NM_030761chr132417 580 480 11935 2919 776 --
NM_030799chr532099 562 369 22160 1925 1263 --
NM_030806chr1157822 7416 7041 6963 6643 6435 6375 6365 6159 5940 3377 1769 1500 1411 454 --46720 3328 3123 1754 11800
NM_030816chr133290 2886 2347 13095 1274 --
NM_030939chr6----1733 --
NM_030964chr563575 3174 1367 915 613 329 ------
NM_031216chr181123 --1633 --
NM_031284chr15--286 45 ----
NM_031286chr12346 321 1258 ----
NM_031417chr1992788 2348 2315 894 501 179 92 86 41 --163 --
NM_031422chr181395 1595 ----
NM_031890chr2242645 2540 2326 930 12737 ----
NM_031892chrX--3916 786 68 1687 --
NM_031936chr1------1761
NM_032021chr11158 --11002 --
NM_032102chr1142942 2267 2183 756 --1367 --
NM_032199chr1053619 1254 1248 765 21 33360 944 838 ----
NM_032208chr263007 2372 2237 738 225 213 --22286 769 --
NM_032268chr16113292 3091 2759 2472 2388 2360 2060 1236 840 800 390 1422 11301 --
NM_032289chr541789 485 97 70 11236 1112 --
NM_032342chr92171 131 ------
NM_032410chr821005 83 ------
NM_032431chr112707 43 11083 2696 192 --
NM_032440chr1042905 2752 2231 64 --22192 837 --
NM_032444chr165914 879 804 765 41 --11119 --
NM_032457chr463635 3427 3413 3033 2379 644 ------
NM_032491chr12--11259 --1229
NM_032499chr151572 1200 ----
NM_032538chr692755 2525 2358 485 318 278 201 117 75 2985 456 22853 58 --
NM_032582chr173742 619 265 ------
NM_032682chr342529 2454 1276 339 --12552 --
NM_032689chr1951397 1307 1266 1083 442 --21234 1115 --
NM_032765chr52860 680 --124 --
NM_032804chr102938 125 --3646 156 111 --
NM_032818chr952635 2333 689 460 178 42511 1663 858 54 ----
NM_032859chr1321378 757 --33546 2425 863 --
NM_032864chr1----189 --
NM_032866chr1542045 1128 811 288 22000 966 43159 2547 1056 52 --
NM_032867chr112234 160 --1452 1225
NM_032947chr51133 124 11024 --
NM_032968chrX1139 ----22593 1246
NM_032973chrY1139 ----22592 1246
NM_033055chr11789 ------
NM_033083chr332644 2609 928 23154 2185 2852 360 --
NM_033121chr12--21279 572 1404 --
NM_033141chr1452130 2098 1595 347 36 21902 318 ----
NM_033201chr1611002 --11095 --
NM_033215chrX--2337 131 ----
NM_033224chr787905 5806 5241 5087 3093 3002 2151 1019 26755 3202 12326 1193
NM_033285chr874268 3806 3544 2868 1429 1096 839 ------
NM_033296chr4--124 1274 --
NM_033512chr832467 1185 486 ------
NM_052848chr1961825 1622 1382 819 478 53 --11962 --
NM_052864chr441907 780 437 386 ------
NM_052897chr12175 --2755 581 --
NM_052971chr5----133 --
NM_053023chr1172763 2579 2282 1001 496 288 250 ------
NM_054035chr171858 --2583 217 --
NM_057161chr62525 426 ------
NM_057175chr422562 1980 1317 ----
NM_080422chr18----130 --
NM_080546chr912202 2608 149 11532 --
NM_080625chr204930 384 208 46 --2353 187 --
NM_080669chr17114606 4585 4049 3730 3441 1850 1081 1075 764 429 69 21779 1088 43809 3741 1233 422 --
NM_080744chr72592 144 1255 1675 --
NM_080836chr2064291 4008 3878 3328 3108 1326 --43044 3000 1368 837 --
NM_130387chr31948 --175 1147
NM_130459chr941427 1363 1127 672 --1578 --
NM_130847chr1123660 882 35801 5721 2138 24243 3823 --
NM_133171chr203832 318 130 --11258 --
NM_133265chrX53162 2648 1132 585 456 --22380 856 --
NM_133445chr953724 3223 3129 2671 163 13100 23112 972 --
NM_133507chr122817 121 ------
NM_134470chr3----2634 514 --
NM_138370chr2144 ----1704
NM_138468chr2105712 4288 3886 2352 2320 1814 1795 1524 1492 196 25537 130 15468 --
NM_138473chr1265168 4739 4106 3754 1612 1274 11764 ----
NM_138569chr6------1298
NM_138771chr7----11289 --
NM_138774chr193717 154 41 ----1166
NM_138782chr5------11943
NM_138927chr212904 833 --169 --
NM_139057chr1542344 1146 1073 182 ----11932
NM_139058chrX2158 138 --1124 --
NM_139161chr192182 68 --2425 22 --
NM_139279chr232804 2772 993 1584 13490 --
NM_139280chr171551 --11091 2369 159
NM_139321chr2073742 3719 3634 3205 2836 1566 1195 14141 1929 --
NM_144574chr141227 1219 ----
NM_144578chr1475458 4220 3628 1870 1845 894 563 13812 1922 --
NM_144604chr16----2371 53 --
NM_144628chr2062857 2516 2289 892 522 297 1620 ----
NM_144633chr3--1497 1282 127
NM_144691chr19----1458 --
NM_144963chr8173 --2304 205 --
NM_144998chr174416 348 325 76 ------
NM_145048chr42955 97 1614 ----
NM_145203chr132192 95 ------
NM_145307chr1014220 --13480 13162
NM_145313chr1021293 388 1347 ----
NM_145349chr1781957 889 873 775 183 156 143 63 --1665 --
NM_147156chr1021039 336 ------
NM_147161chr15784 439 334 208 197 --1453 --
NM_147189chr812176 --22322 568 --
NM_147202chr942622 2470 135 115 ------
NM_147223chr272356 2001 1699 961 679 654 479 --2283 171 --
NM_148894chr41768 ------
NM_148957chr1381967 1636 1035 963 733 305 152 81 ------
NM_152237chr2271462 1368 1267 685 603 545 373 11211 2659 204 --
NM_152247chr222632 312 ------
NM_152253chr2284018 3698 3367 2789 2638 1451 658 456 --1701 --
NM_152265chr1149 11349 11425 --
NM_152287chr16132279 1778 1713 948 585 561 464 458 444 400 251 149 33 ------
NM_152344chr1721315 262 21204 38 ----
NM_152345chr1721047 445 ------
NM_152371chr151991 1916 1862 763 608 --11639 --
NM_152380chr121082 569 --1333 --
NM_152384chr2101699 1621 1572 1523 1397 1352 1270 778 340 174 1324 ----
NM_152409chr521031 565 --12645 --
NM_152418chr821495 677 --11951 --
NM_152424chrX54762 3299 1398 1125 671 ----1522
NM_152470chr18123309 3300 3270 3051 3028 2778 1436 1284 1164 974 926 55 --21074 421 171
NM_152480chr193788 742 87 --1710 --
NM_152482chr1981611 1449 1380 680 612 573 559 443 --11297 --
NM_152556chr712263 --12255 --
NM_152581chrX------1371
NM_152586chr104970 821 784 193 ------
NM_152608chr132066 2058 685 ------
NM_152636chr1122466 2441 21253 448 1462 --
NM_152641chr1222400 42 --1659 --
NM_152666chr12781 711 --1826 --
NM_152705chr132453 21 ----11068
NM_152731chr6183 1246 --1354
NM_152744chr752993 2421 1236 634 605 --22241 1102 13099
NM_152765chr8----12306 --
NM_152780chrX21237 254 ------
NM_152787chrX1954 --1620 --
NM_152835chr132524 2310 2212 22295 2171 22772 764 --
NM_152857chr6--270 22 ----
NM_152860chr1211097 ------
NM_152896chr91136 ----1116
NM_153184chr3--11925 1133 --
NM_153235chr612154 11884 ----
NM_153331chr3----1569 --
NM_153335chr171289 ------
NM_153619chr1521084 134 --11108 --
NM_153685chr12179 ----126
NM_153756chr121356 662 ----132
NM_153810chr1044874 4749 3917 317 1306 23817 3383 --
NM_153812chr142112 1764 413 196 1755 1473 --
NM_170711chr193814 61 55 ------
NM_170724chr6----1170 --
NM_171998chrX21757 1585 --11576 --
NM_172020chr761876 1715 1522 786 145 126 ------
NM_172071chr167113 5011 4938 4584 2934 1844 35481 2356 1629 16437 --
NM_172127chr4----11849 --
NM_172193chr141118 --11356 --
NM_173075chr41572 ------
NM_173156chr172213 1907 1611 840 610 310 93 ------
NM_173355chr23697 332 311 ------
NM_173469chr15--1394 --1294
NM_173470chrX32364 1037 836 32679 2537 1814 22693 1866 --
NM_173475chr16--1611 --152
NM_173477chr1781875 1539 1502 1403 715 569 513 93 1527 1257 --
NM_173510chr22--31827 980 813 21113 157 --
NM_173515chr61291 1741 ----
NM_173519chr83729 151 52 ----1168
NM_173531chr1913182 ------
NM_173545chr2--11500 1457 --
NM_173552chr322007 954 ------
NM_173570chr351872 1549 1404 868 443 1750 ----
NM_173595chr12134701 4600 3820 3780 3600 3225 2061 1939 1469 1434 1404 1081 141 --1522 --
NM_173653chr31450 --1222 --
NM_173681chr781871 1483 1428 516 460 260 221 36 21678 1594 41999 1915 648 30 --
NM_173808chr131294 577 307 13422 --11090
NM_174911chr873171 2556 2493 1266 783 599 324 --2153 52 1992
NM_175061chr721888 62 11881 ----
NM_175767chr51163 11449 21389 1306 --
NM_175852chr1113035 3003 2972 2888 2357 2225 2097 684 83 47 41 ------
NM_175854chr1332269 1842 137 --11085 --
NM_175866chr12278 197 --1135 --
NM_175898chr1551453 1421 355 278 73 1423 1568 --
NM_175907chr1852696 1820 1814 942 449 --22239 1032 --
NM_175913chr2051067 916 397 374 355 ------
NM_177539chr15779 621 564 290 78 ----1598
NM_178123chr2170 199 ----
NM_178313chr232036 785 372 1843 1690 --
NM_178423chr73786 358 148 ------
NM_178539chr1221325 312 ------
NM_178562chr7----2736 646 1671
NM_178835chr43622 609 281 --2867 305 --
NM_178864chr111483 ----1685
NM_181336chr641321 943 415 298 --1868 --
NM_181504chr532736 173 38 13073 ----
NM_181645chr11----1140 --
NM_181656chr172319 67 --2921 142 --
NM_181672chrX41882 1821 1488 144 ------
NM_181784chr262289 2262 2217 1898 153 115 --42606 529 208 36 --
NM_181809chr1133697 3644 2988 2541 2454 1506 1264 1256 1167 1065 1020 750 232 13069 22657 28 --
NM_182485chr421201 117 --1962 1146
NM_182503chr665197 4534 3565 2218 1023 287 --1438 11286
NM_182557chr11102098 1768 1701 1409 902 731 570 325 227 166 ------
NM_182580chr142339 2330 2018 1847 1857 ----
NM_182717chr10154 --1169 --
NM_182765chr1032374 2266 403 --1432 --
NM_182830chr1432089 1808 1476 --1738 --
NM_182970chr2083743 3387 2957 1480 572 470 379 258 --24211 442 --
NM_183425chr20121528 675 576 283 277 231 199 135 105 57 37 27 ------
NM_194247chr263331 3301 2930 1477 201 162 --1223 --
NM_194285chr1122872 2646 1305 23089 2928 --
NM_194286chr1265474 4959 1878 1118 1038 953 14525 16134 --
NM_194291chr821895 506 ----1238
NM_197941chr531996 939 708 --22523 2320 --
NM_198066chr14--12288 11241 185
NM_198256chr221451 294 21554 517 ----
NM_198270chrX22349 210 ------
NM_198404chr13193 --139 --
NM_199262chr1742268 2063 1648 694 11737 1905 --
NM_201520chr1761240 721 580 527 264 76 --1553 --
NM_203434chr931110 871 391 --1342 --
NM_203453chr921565 187 --176 11641
NM_206827chr13------150
NM_206853chr6169 --1100 --
NM_207043chr121962 102 --11446 --
NM_207306chr1174331 3749 1364 1040 932 896 828 684 648 612 576 504 468 350 314 96 42 14476 23272 1631 --
NM_207317chr5288 34 1332 ----
NM_207325chr192381 92 ----1735
NM_207362chr22541 177 --1511 --
NM_207506chr82206 157 ------
NM_212464chr1561695 1548 1332 411 282 270 1350 11661 11353
NM_212467chr1552272 2125 1909 961 45 --22238 96 11930
NM_212558chr923183 2853 13953 23119 650 --