TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-649
miRNA Sequence: AAACCUGUGUUGUUCAAGAGUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000259chr1524480 1664 25628 1111 11005 11726
NM_000332chr667069 6055 5126 2464 147 112 1894 26365 2273 --
NM_000337chr596450 6370 5891 5506 5134 4744 4258 2233 826 ----12225
NM_001008408chr795774 4987 4785 4122 1775 1755 1497 1085 95 1427 ----
NM_001034954chr10----12557 23055 705
NM_002136chr121428 ----2199 61
NM_002137chr772367 2165 1919 1846 1704 1647 782 181 ----
NM_004171chr1158853 8722 8473 6179 1571 13396 16997 12270
NM_004852chr181014034 12967 12105 12085 11429 9924 5615 3333 3141 994 112581 12831 15160
NM_004985chr1254038 3025 1536 1526 1326 ----13563
NM_005436chr1073998 3817 3575 3419 3266 2632 336 13672 --1577
NM_005665chr144495 3098 771 588 11017 14291 11156
NM_006546chr1785866 4893 1959 825 798 610 339 124 15626 12624 --
NM_006750chr16117438 7311 5700 2529 2222 2135 2053 1449 754 479 267 1825 ----
NM_014701chr1542655 2260 790 705 ----13156
NM_017658chr1433570 3326 545 1694 24102 1685 --
NM_017813chr844107 2033 1498 993 --1586 13678
NM_018364chr123515 2972 --33446 452 423 11464
NM_018374chr753997 3546 1847 1521 1403 1571 21778 867 --
NM_019072chr531585 680 492 --23834 179 13902
NM_019084chr1032287 1012 898 ----1805
NM_020772chr1738413 7838 1836 12761 35757 2220 265 11466
NM_021083chrX63217 2666 2500 2362 316 226 13125 ----
NM_022459chr1386282 4770 2013 1434 1415 1026 779 332 ------
NM_030806chr1139374 9114 8240 7701 7632 7066 6489 3562 3360 3152 1871 639 622 ----149
NM_032859chr1373689 3178 3058 2834 2642 1246 604 ------
NM_033224chr777837 7384 6920 5863 2268 549 393 ----1590
NM_033656chr2141950 1702 946 197 ----11244
NM_138423chr1522250 1840 --21688 624 1334
NM_152409chr552550 1308 824 556 26 13585 33096 654 210 --
NM_172071chr186646 6207 5778 5362 5091 5047 2287 371 --16920 --
NM_173468chr475359 5299 5071 3742 1227 664 104 1776 25560 5117 --
NM_180989chr133734 610 336 --2681 525 11554
NM_198859chr384884 4687 3804 2071 1255 1216 1180 163 --1151 --
NM_199320chr412176 12600 11164 11066