TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-650
miRNA Sequence: AGGAGGCAGCGCUCUCAGGAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000018chr171141 --138 --
NM_000037chr872166 2017 1568 920 756 463 30 32346 2045 672 31914 1822 238 --
NM_000038chr521815 805 12092 ----
NM_000081chr11319 --21870 532 --
NM_000084chrX156718 6680 6150 5398 5376 5249 4613 4585 4356 4223 4216 2321 1321 825 123 25243 204 25362 4813 21668 1163
NM_000088chr1721154 391 --21138 418 --
NM_000093chr92725 478 --2949 539 1295
NM_000125chr653205 1571 1555 916 771 11473 52703 727 689 374 84 13749
NM_000135chr16--1238 1747 --
NM_000141chr1041057 1051 1032 980 11119 2305 75 193
NM_000153chr14----1596 --
NM_000178chr201371 ------
NM_000182chr21409 ----1144
NM_000188chr101601 --2483 29 1645
NM_000217chr1295323 5197 4654 3983 2029 1852 1657 1270 826 --34934 1694 315 25175 5041
NM_000248chr322920 490 12621 32661 2381 38 1205
NM_000252chrX2995 471 --1145 197
NM_000269chr17----1182 --
NM_000278chr1082222 1709 1690 1657 1651 853 816 590 2314 48 31889 1741 108 --
NM_000278chr1082222 1709 1690 1657 1651 853 816 590 2314 48 31889 1741 108 --
NM_000304chr17--1869 --1976
NM_000314chr1043202 3103 2904 1030 --13008 --
NM_000321chr1321695 51 --1349 --
NM_000332chr636237 5731 449 --56709 6210 4618 440 287 14761
NM_000337chr545605 5026 1409 836 --34962 4918 1255 --
NM_000345chr41989 --1181 --
NM_000346chr1731504 1360 735 ------
NM_000368chr974238 4096 1056 948 928 708 619 --1186 --
NM_000393chr241857 1399 1366 152 --11763 --
NM_000425chrX3677 585 110 --1645 --
NM_000430chr1743072 3038 2555 1277 ------
NM_000445chr83949 264 224 1623 --1877
NM_000452chr1311400 --22072 582 --
NM_000462chr1521819 1429 --1165 --
NM_000476chr941397 606 551 278 186 --1199
NM_000486chr1283097 2582 2484 2228 1252 954 788 365 32367 924 884 33148 1228 122 13189
NM_000523chr211146 ----2743 50
NM_000525chr1161489 1480 1322 1241 1051 106 --21499 1030 --
NM_000555chrX95711 5623 5175 5032 5025 4933 4821 1713 859 12502 35899 5689 2050 26574 4768
NM_000578chr251732 1630 1219 676 463 ------
NM_000599chr2144101 4049 3978 3530 3211 2916 1677 1448 1345 1154 1085 908 636 66 33743 3505 2893 23237 564 --
NM_000602chr72168 121 2255 205 --2301 154
NM_000609chr1042794 653 257 81 --1530 22334 686
NM_000618chr1286279 5855 5545 5411 5404 5203 1270 531 --21064 295 --
NM_000625chr171351 --1373 --
NM_000635chr1931670 444 362 --194 11112
NM_000665chr71156 --1186 --
NM_000681chr101139 --1272 --
NM_000682chr2111695 1521 1386 1296 722 688 643 447 346 187 57 11322 31448 1175 83 --
NM_000719chr12136561 5939 4559 2173 1953 1514 1348 1342 1163 689 307 284 72 1500 26414 406 15900
NM_000721chr121986 1885 --3523 298 224 --
NM_000723chr1761637 1415 1196 1065 502 122 21251 90 21403 105 --
NM_000738chr114938 841 298 111 --1859 --
NM_000767chr195474 339 332 121 56 --51434 1421 1118 1068 95 --
NM_000793chr1455030 3856 3508 3313 399 --34939 4923 3556 14026
NM_000801chr201706 --1169 165
NM_000806chr521860 1627 --191 --
NM_000826chr41193 ----1605
NM_000828chrX31966 172 59 11367 21404 488 --
NM_000829chr112790 26 --12041 1426
NM_000831chr1155985 5923 5708 5649 5525 5387 5105 4824 4420 4153 4075 1155 428 392 134 15334 55782 5265 5111 1260 262 15305
NM_000833chr161267 11187 1555 --
NM_000836chr193852 696 384 --1991 --
NM_000838chr662753 2588 1978 764 235 156 --22006 1755 --
NM_000839chr31194 ----1339
NM_000875chr15166261 4829 4415 4371 4325 2823 2251 2116 1733 1455 952 844 764 346 294 96 15127 26447 857 --
NM_000880chr8----192 1613
NM_000883chr72267 67 1727 ----
NM_000901chr441976 961 639 29 --1538 12308
NM_000908chr51591 ----2296 180
NM_000924chr1241268 319 308 262 --11085 1384
NM_000944chr431778 1726 231 --1101 --
NM_000949chr51853 --1146 --
NM_000961chr20183961 3707 3465 3332 3325 3319 3036 2903 2896 1524 1251 1106 1088 1034 905 593 65 34 --22871 528 --
NM_000965chr321286 994 1833 11057 --
NM_000966chr12--1838 2754 157 --
NM_000984chr17----1436 --
NM_001001132chr2111030 --1134 --
NM_001001395chr1231856 843 365 --11798 12609
NM_001001484chr102956 831 --1145 1176
NM_001001557chr831585 706 169 --1875 1766
NM_001001560chr223746 734 123 1237 1717 --
NM_001001586chr12462 27 --1128 --
NM_001001701chr421847 665 12316 --1872
NM_001002296chr811106 ----1203
NM_001002857chr151164 ----148
NM_001002860chr1464638 3718 3617 1228 1109 687 22967 564 13364 14392
NM_001002909chr1741648 1628 1528 1430 --62117 2109 2071 1839 1386 431 --
NM_001003398chr122106 95 ------
NM_001003674chr18115627 4929 4854 4616 2690 2524 2306 2199 1951 1753 1744 --36924 6557 1136 14349
NM_001003676chr113980 770 238 --1335 --
NM_001003681chr224602 409 280 88 --11760 --
NM_001003688chr4----122 --
NM_001003800chr931241 860 40 --11138 23612 2724
NM_001003805chr14----164 --
NM_001003810chr41226 ----1723
NM_001004106chr5----2675 669 --
NM_001004317chr644427 3889 1714 907 12831 2662 588 --
NM_001005209chr26733 672 526 446 146 78 --1679 --
NM_001005271chr172373 340 ------
NM_001005404chr1794386 4069 3998 3836 1098 722 341 183 175 1163 33594 3359 2798 21761 757
NM_001005463chr1042496 2432 1694 730 --12029 32357 660 397
NM_001005473chr536405 5414 4941 --16494 --
NM_001005474chr331064 1057 82 ----1263
NM_001005781chr2----1486 --
NM_001006115chr352584 2170 772 682 245 --22249 1883 12658
NM_001006617chr921082 1044 --21063 908 --
NM_001006665chr11290 1581 2164 58 --
NM_001006946chr24725 296 177 85 --51383 1306 1293 611 56 --
NM_001007024chr17154101 3171 1512 1258 921 842 802 762 738 731 614 607 554 475 458 --1254 --
NM_001007098chr11825 ----2243 73
NM_001007156chr1541840 1760 1444 421 21613 1289 --11555
NM_001007278chr13104096 3787 3240 1861 1776 1560 632 625 482 475 1445 ----
NM_001007565chr32275 47 ------
NM_001007793chr10----146 --
NM_001008220chr543606 2430 940 112 2910 396 23819 3627 --
NM_001008222chrX11166 ------
NM_001008223chr121509 1475 1622 --
NM_001008239chr1852724 2393 2369 1388 871 --3698 564 298 --
NM_001008392chr323029 404 22833 1141 33327 3223 21 1675
NM_001008405chr7--11335 --21349 67
NM_001008410chr232172 1755 1665 --22155 845 12237
NM_001008493chr111539 1657 ----
NM_001008539chr865012 4456 3816 3652 1616 659 13927 44232 3967 1268 728 --
NM_001008541chr1072121 2008 1864 1714 1438 193 92 22143 759 1820 11783
NM_001008566chr222516 324 --1367 --
NM_001008701chr1952974 2933 2886 2689 2491 12575 22837 664 12854
NM_001008738chr562049 1914 1890 1103 628 353 --22357 2160 --
NM_001008800chr1145 --1207 --
NM_001009813chr19128 --159 --
NM_001009880chr2254133 3977 3317 3084 1357 24735 609 21941 187 21754 655
NM_001009899chr3215573 5383 4992 4608 4505 4256 4208 4082 2435 2408 2303 2229 2094 2055 1831 1581 1574 1447 1440 1177 1148 26017 5214 45249 4268 2378 2061 --
NM_001009993chr253927 3027 1462 1301 1195 31580 169 83 14109 --
NM_001010867chr1195925 5404 5257 5250 4642 4476 2631 2228 2100 2093 1758 1694 1581 806 787 477 336 315 60 25741 1452 45656 2602 2068 1652 25873 468
NM_001010888chrX84235 4079 3678 3283 3263 2953 666 531 13463 14101 11865
NM_001011513chr494022 3996 3869 1248 1098 1023 983 838 393 13929 12737 22535 804
NM_001011551chrX1459 --1483 --
NM_001011666chr796051 6029 5207 4881 4751 2356 1448 1261 767 125 34444 2465 1717 --
NM_001012267chr931413 762 698 11556 2477 388 --
NM_001012329chr132339 492 330 ----2772 609
NM_001012338chr15153 --139 --
NM_001012426chr6103289 3153 2798 2660 2653 1082 1058 959 885 465 1678 32628 1350 277 1543
NM_001012514chr21125 11048 1904 --
NM_001012643chr191528 --1222 --
NM_001012754chr1321663 492 --31891 1798 1515 --
NM_001012977chrX3999 521 166 --1281 --
NM_001013415chr431350 598 217 ----1623
NM_001013635chr122828 93 --1892 1906
NM_001013693chr172278 2153 2142 1971 903 616 427 1315 21829 233 --
NM_001014380chr1395680 5350 2358 1539 1338 879 872 680 191 --35749 2333 847 --
NM_001014434chr1----2293 187 --
NM_001014443chr1----1180 --
NM_001014794chr11180 --2208 90 --
NM_001014797chr1077510 7442 2256 1459 1419 981 286 21791 368 27602 2351 21833 300
NM_001014839chr11369 --21035 423 --
NM_001015053chr1751450 641 401 371 139 31163 1041 163 11541 --
NM_001015508chr82749 518 ------
NM_001017371chr221082 146 --1874 --
NM_001017395chr333279 3138 396 --1810 22855 2454
NM_001017523chr1231610 720 402 11832 125 21432 122
NM_001017926chr8------1395
NM_001018067chr134082 4075 3451 14048 12062 --
NM_001018078chr94471 176 77 31 --1262 --
NM_001018108chr1542147 773 733 172 --2581 153 11929
NM_001020818chr1951719 1184 688 401 369 --21733 115 1577
NM_001023567chr1512366 --1185 --
NM_001024218chr141524 --1648 --
NM_001024226chr1--1310 194 --
NM_001024649chr542873 1975 1914 779 --22477 1881 1528
NM_001024666chrX3476 459 103 --1646 --
NM_001024668chr121653 2684 280 1791 1748
NM_001024808chr1262489 2319 2127 1147 424 269 1764 32359 1036 914 --
NM_001024847chr331660 546 190 1946 22520 93 --
NM_001024858chr1492689 2629 2500 1901 689 637 621 431 68 32648 530 258 1156 22970 747
NM_001024948chr162637 2422 2168 706 275 223 --13275 22924 2153
NM_001024956chr1142151 2129 2080 1718 ----1346
NM_001025068chr331552 1331 486 ----21593 1464
NM_001025076chr1085235 5225 5214 4976 4208 3917 2440 791 12325 14842 24163 3925
NM_001025077chr1096593 6583 6572 6334 5566 5275 2149 885 70 1145 16200 25521 5283
NM_001025079chr373443 2583 1122 999 750 320 302 2418 328 11594 --
NM_001025205chr3----2111 89 --
NM_001025366chr631803 696 24 ------
NM_001025579chr173817 806 749 1100 3760 193 76 --
NM_001025579chr173817 806 749 1100 3760 193 76 --
NM_001025579chr173817 806 749 1100 3760 193 76 --
NM_001025580chrX113464 3350 3204 3165 2682 2615 872 738 326 292 32 13074 53667 3478 3256 390 344 --
NM_001025780chr941371 1162 1032 1025 --11000 1109
NM_001029875chr542657 2650 1160 955 --32026 136 115 --
NM_001029998chr441229 1125 144 91 --1456 --
NM_001030005chr1531136 946 239 2910 504 --11026
NM_001030055chr1444552 4381 3099 1476 12972 --13209
NM_001031738chr21115 131 1203 --
NM_001031812chr511481 ----21454 771
NM_001032282chr8------173
NM_001032289chrX2331 100 --1763 --
NM_001032293chr172592 76 ------
NM_001033025chr131200 304 138 --21511 409 --
NM_001033081chr191758 1672 1584 1542 1197 751 674 416 242 21221 661 11911 --
NM_001033085chr2----1237 --
NM_001033087chr2053206 3008 2840 1262 25 12635 23171 1016 13264
NM_001033088chr15128 --1325 --
NM_001033117chr3114658 4299 4104 3910 3808 3544 3240 1687 1610 1317 689 172 33457 1425 81 1674
NM_001033554chr17----1102 --
NM_001033557chr221080 417 ------
NM_001033561chr17----1771 --
NM_001033677chr122348 69 ------
NM_001034025chr122663 215 ------
NM_001034850chr521498 425 ----11548
NM_001034915chr841455 1162 986 167 --1471 1302
NM_001034954chr1052594 2452 2395 2267 1247 --22626 334 --
NM_001035254chr94670 586 542 391 --41881 825 643 117 --
NM_001037132chr731952 1918 1887 ----1841
NM_001037277chr121301 611 ----1321
NM_001037324chr32558 548 --2295 172 1196
NM_001037332chr532276 557 460 --1333 12580
NM_001037339chr151645 1621 1500 404 195 ----1692
NM_001038493chr231066 561 196 1232 2568 207 --
NM_001039459chr72769 214 --1741 1840
NM_001039479chr1411850 1755 1468 1571
NM_001039538chr2----1864 12594
NM_001039547chr3117789 7485 7008 6957 5756 2865 2732 2725 1867 944 613 ----12165
NM_001039550chr22702 53 --1747 --
NM_001039574chr11882 --1301 11007
NM_001039583chr221434 --2418 121 --
NM_001039618chr112851 793 --25985 479 15029
NM_001039690chr1671812 1491 765 489 447 421 351 --12008 --
NM_001039762chr1021540 725 ----1573
NM_001039840chrX96021 5017 4172 4012 1903 1808 320 81 55 --25999 569 15332
NM_001039916chr124480 434 238 123 ------
NM_001039960chr1231066 301 42 --1621 --
NM_001040020chr71126 --1214 --
NM_001040110chr721867 1240 11386 21310 574 --
NM_001040113chr16----1877 --
NM_001040167chr71374 --1223 --
NM_001040214chr64561 368 286 63 2767 138 ----
NM_001040217chr1--174 2193 184 --
NM_001040284chr1675868 5415 5079 4345 4035 3943 1269 25909 5385 25059 931 --
NM_001040429chr1362894 2527 2422 1233 1159 39 --11201 --
NM_001040441chr144284 3329 1559 1276 --11293 --
NM_001040613chr82539 168 --1103 --
NM_001040708chr81330 --11024 --
NM_001040715chr162826 180 ----2991 239
NM_001042368chr93200 180 78 --1210 --
NM_001042413chr983904 3199 2927 1593 1086 999 554 413 --24059 2533 1930
NM_001042440chr511419 --11738 1247
NM_001042486chr2031518 1368 1173 21124 305 ----
NM_001042494chr1583456 3262 3034 2769 2625 2618 2339 1187 1576 12593 23350 3149
NM_001042506chrX3999 521 166 --1281 --
NM_001042537chrX3467 271 89 --11713 11966
NM_001042539chr16--1292 1902 --
NM_001042555chr1264625 3154 1196 888 357 65 21451 439 --1561
NM_001042589chr91304 --142 --
NM_001042595chr191145 --1157 191
NM_001042599chr287822 7773 7158 6290 5302 5256 2801 2598 11688 46732 6715 5363 4787 --
NM_001042603chr12104236 3516 3458 3400 3350 3342 3277 1163 968 143 1116 24657 235 199
NM_001042604chr374437 4032 3751 1782 1628 912 71 23875 434 1542 23552 1446
NM_001042749chrX11409 ----1784
NM_001043318chr14123917 3780 3740 3514 2867 2724 2717 2692 1614 1506 1375 750 43452 3356 1531 828 31383 1271 807 13401
NM_001043351chr181650 1643 1513 1506 1482 880 453 166 --2783 173 --
NM_001044385chr243872 3804 3008 607 1400 11462 --
NM_001046chr522029 1920 --1337 1405
NM_001048183chr1113493 3229 3185 2888 2844 2710 2678 2352 1323 1277 502 --33716 3022 46 --
NM_001095chr1241718 1617 518 465 --41937 1203 275 72 1172
NM_001106chr3157925 7208 6958 6646 3789 3378 3171 2815 2798 2642 2271 2030 1836 1375 1105 11390 47560 6271 2247 506 --
NM_001116chr1672502 2289 2100 1893 992 795 766 11207 32864 1236 216 1257
NM_001121chr102364 295 ----11811
NM_001140chr171477 ------
NM_001149chr10----1554 1118
NM_001153chr21887 --1126 --
NM_001172chr142503 102 ------
NM_001174chrX11783 2762 100 ----
NM_001186chr2143307 2607 2520 640 --1194 12117
NM_001189chr411051 ------
NM_001201chr463990 2924 2917 1437 946 423 --13748 --
NM_001202chr14----1110 --
NM_001204chr2107116 6923 6744 5317 5309 3119 2612 1843 1467 826 11038 15214 1177
NM_001222chr102390 188 ------
NM_001232chr14888 835 814 173 --11032 --
NM_001241chr241814 402 383 211 ----1836
NM_001300chr101127 140 --1119
NM_001304chr1763680 2486 2434 1197 1095 96 11509 --13713
NM_001315chr62610 471 2730 254 188 --
NM_001319chr192828 706 --2835 413 --
NM_001326chr112410 50 ----1127
NM_001344chr141217 --1247 --
NM_001356chrX32493 1646 315 ------
NM_001358chr42408 297 --1176 --
NM_001364chr1154465 3515 1439 390 293 --23590 3009 --
NM_001365chr172760 96 --1556 138
NM_001383chr174571 536 252 180 ------
NM_001395chrX2320 310 --1192 --
NM_001401chr941497 577 384 55 ----11261
NM_001406chr1741507 361 272 223 2685 147 2497 372 --
NM_001407chr341480 1315 640 98 --2418 276 --
NM_001408chr131461 577 400 --3597 427 392 --
NM_001419chr1974409 3518 3185 3097 1825 1320 1101 23566 3234 --33368 3007 350
NM_001426chr23493 470 57 --1505 --
NM_001431chr611142 --11217 --
NM_001454chr172894 377 --2388 214 --
NM_001456chrX------1315
NM_001463chr22301 165 1316 1812 --
NM_001493chrX2684 224 --174 --
NM_001495chr81822 --2400 140 --
NM_001543chr5144440 4301 4001 3956 3869 3748 3052 2963 2938 1945 1936 659 635 265 23793 547 64121 3470 1825 1601 1567 353 11465
NM_001616chr242831 2578 1368 107 1558 ----
NM_001627chr331604 905 301 ----11702
NM_001635chr71885 ------
NM_001642chr1121257 1131 1884 ----
NM_001654chrX198 --2394 333 --
NM_001656chr52428 414 --11652 --
NM_001663chr141539 ------
NM_001665chr116533 145 129 82 62 54 ----1582
NM_001668chr132106 576 346 --32265 267 163 11535
NM_001679chr3----2637 190 1145
NM_001681chr121235 1517 ----
NM_001690chr392292 1786 873 739 732 707 701 205 92 --22542 1693 12034
NM_001699chr193666 531 524 --31722 1661 1457 11824
NM_001706chr34951 836 678 226 129 1100 --
NM_001707chr72121 23 --1702 137
NM_001722chr82513 151 ------
NM_001753chr741431 729 583 163 --31507 662 562 --
NM_001783chr193249 104 56 ----1301
NM_001792chr182371 245 --11113 --
NM_001806chr1942795 2468 1194 310 --12865 --
NM_001810chr202660 534 --3689 201 124 --
NM_001826chr11157 --187 --
NM_001839chr12181 132 --1163 --
NM_001845chr132157 124 11207 1332 --
NM_001923chr111594 --2608 494 --
NM_001933chr1471009 925 902 518 439 277 203 --1420 --
NM_001935chr2------11027
NM_001945chr51141 21033 174 1989 --
NM_001949chr641144 977 617 288 --22126 425 32133 1006 712
NM_001955chr6--2193 36 ----
NM_001962chr5----2450 190 --
NM_001980chr1272230 1861 695 619 480 473 448 --21893 1720 --
NM_001981chr121816 863 --1316 --
NM_001991chr1772026 1359 723 209 170 141 81 --21642 95 --
NM_001995chr42969 174 166 1320 --
NM_002006chr465258 4416 4152 2190 1672 975 15426 45838 1501 1463 830 23580 1575
NM_002017chr111234 --1170 --
NM_002024chrX1550 --11379 --
NM_002028chr1421049 423 11184 31108 508 502 11270
NM_002048chr921251 1002 --1889 --
NM_002062chr651275 1059 465 293 228 --1187 --
NM_002063chrX31124 349 34 ------
NM_002070chr34668 346 316 189 1925 ----
NM_002087chr17167 ------
NM_002094chr16171 ------
NM_002105chr114980 270 157 34 --1767 --
NM_002137chr731762 728 245 ----12005
NM_002147chr172886 115 ----1819
NM_002149chr22573 154 --1564 --
NM_002157chr2------1137
NM_002193chr251428 710 587 559 402 1278 ----
NM_002196chr205983 308 292 228 138 --137 --
NM_002202chr51418 ------
NM_002204chr173528 498 491 --21354 258 --
NM_002205chr121268 ------
NM_002211chr1031101 940 242 ------
NM_002226chr14----1685 1806
NM_002228chr12852 391 --1503 --
NM_002235chr1231607 1332 58 ------
NM_002236chr21303 ------
NM_002247chr10----2906 799 --
NM_002249chr12471 168 ----1204
NM_002253chr4--11055 ----
NM_002254chr292392 2043 1724 1517 870 647 568 269 169 --1149 1334
NM_002267chr1351850 1745 643 141 123 32132 438 292 1108 --
NM_002268chr3----11620 --
NM_002270chr534144 1407 69 --44550 1398 1203 571 1243
NM_002271chr131440 1582 ----
NM_002278chr17----1184 1416
NM_002283chr124813 770 524 24 --2802 517 194
NM_002293chr182686 2171 2159 1687 967 355 213 66 1644 --12669
NM_002305chr22----141 --
NM_002319chr74811 300 187 180 --1996 2236 88
NM_002332chr123642 311 36 ----2581 224
NM_002336chr1231801 1540 285 1454 1744 130
NM_002359chr1733889 1289 1207 --43615 3512 3320 1136 21716 1514
NM_002373chr1521320 190 --21223 976 --
NM_002375chr341726 1576 290 31 --41549 621 165 53 12000
NM_002382chr1421307 398 ----21086 41
NM_002442chr1231720 1566 607 ------
NM_002480chr121328 --11416 --
NM_002501chr19113918 3646 3448 3408 2971 2800 1558 1538 1222 896 377 2656 440 33870 1592 351 --
NM_002507chr171670 --31918 764 236 1777
NM_002509chr201172 1788 2292 215 --
NM_002519chr111160 --11101 --
NM_002522chr1783658 2927 2507 1496 1328 986 906 626 12493 12757 11551
NM_002537chr151790 --2917 436 --
NM_002556chr1142123 1525 181 109 --21621 1346 --
NM_002569chr1511293 --1128 2599 533
NM_002576chr11296 37 1946 11210 --
NM_002577chr363963 2806 2741 2605 2598 2573 12704 13511 13192
NM_002581chr961040 930 821 260 132 94 11494 --14274
NM_002585chr11131 --1276 --
NM_002587chr53312 134 76 --1399 --
NM_002588chr561726 709 642 481 438 36 --21373 354 --
NM_002608chr2261523 562 477 200 186 109 11307 31537 573 141 --
NM_002628chr311070 ----1490
NM_002632chr142232 125 1302 --1183
NM_002633chr11508 --1452 --
NM_002636chr6----188 --
NM_002645chr1152837 2738 2426 2155 621 --22331 637 --
NM_002646chr161643 1636 1510 723 179 138 1112 11478 22002 680
NM_002648chr63830 509 72 1947 41197 494 448 170 166
NM_002655chr864494 3955 3896 3681 978 479 ------
NM_002698chr1982683 2674 2375 1959 795 338 185 177 32526 692 161 42598 2320 752 312 --
NM_002699chr151364 1077 579 493 344 ------
NM_002709chr222895 1022 12270 --12979
NM_002713chr131109 845 261 --1120 --
NM_002715chr541202 957 438 160 ------
NM_002717chr81478 ------
NM_002719chr1432349 2109 1550 --21756 612 --
NM_002721chr92455 121 --1115 --
NM_002734chr175759 698 236 113 48 --12212 --
NM_002742chr144623 555 288 73 ----1279
NM_002745chr2254505 4465 3518 1352 570 11112 33599 1310 564 187
NM_002779chr10197 1554 ----
NM_002808chr31105 ------
NM_002822chr122433 314 --11807 --
NM_002829chr931233 925 438 11128 1268 --
NM_002833chr154408 348 244 36 --2355 120 --
NM_002834chr1263892 3367 3349 3094 1476 1104 11466 23995 202 --
NM_002841chr31621 --1468 --
NM_002843chr1163195 2542 1378 700 681 523 --22687 640 32909 2134 541
NM_002848chr1211041 --11311 154
NM_002851chr71168 ----1510
NM_002855chr1183579 3062 2637 2556 1469 1208 1003 349 1937 33118 2657 771 1970
NM_002868chr1282401 2383 1711 1556 758 671 406 198 --42262 2232 1844 128 --
NM_002880chr31257 --1160 --
NM_002886chr385204 4974 1989 1802 1612 1435 1266 138 --25173 3548 21051 161
NM_002890chr51354 --172 --
NM_002906chr1121889 804 --1236 12427
NM_002911chr1921304 1144 31298 653 517 11570 --
NM_002918chr191217 ------
NM_002924chr11230 ----1176
NM_002941chr32279 206 --156 --
NM_002959chr153204 3101 1022 790 258 --44171 3093 3048 677 1126
NM_002998chr82450 346 ------
NM_003002chr113575 290 117 --3235 49 41 --
NM_003010chr1752330 2289 1801 1541 1493 --31885 1683 466 --
NM_003016chr1731713 1336 296 ----11412
NM_003017chr61140 ----11256
NM_003026chr93505 463 26 --21264 484 --
NM_003028chr963585 3397 2495 2456 373 139 1960 32919 771 282 31425 1359 1291
NM_003029chr121428 436 --1193 --
NM_003030chr32759 73 11931 ----
NM_003036chr1----11157 --
NM_003038chr262672 1947 1696 882 820 427 --22444 800 --
NM_003043chr321695 1535 12694 13997 --
NM_003074chr341840 1653 653 368 1664 1136 11676
NM_003076chr1261488 1049 607 201 79 65 --11321 --
NM_003079chr173981 401 390 --1322 --
NM_003081chr201149 --11154 --
NM_003108chr2107266 7184 6706 2868 2659 2588 2452 2429 2083 292 15403 26500 1871 --
NM_003131chr65590 405 344 199 60 ----21588 179
NM_003149chr351621 1503 1224 1098 529 --31210 495 51 21663 406
NM_003150chr1782182 1770 1677 1643 1577 940 915 873 --21723 370 --
NM_003164chr11----1163 --
NM_003170chr172572 386 --165 --
NM_003173chrX51191 1046 946 387 353 ----1108
NM_003174chr102698 308 --2592 285 --
NM_003178chr331870 1583 1441 11397 1269 --
NM_003189chr132574 2438 386 --2692 553 12582
NM_003204chr17----1101 --
NM_003205chr1542177 730 323 293 ------
NM_003234chr312024 1705 2956 272 --
NM_003247chr6------1169
NM_003250chr172335 59 --1321 --
NM_003269chr611005 3530 422 119 1298 --
NM_003298chr355195 5160 4500 1941 205 35189 3828 2297 43959 3813 2187 1629 12165
NM_003305chr4------2357 300
NM_003324chr1221394 62 1318 21229 591 1569
NM_003334chrX----1153 --
NM_003337chr51324 ----11133
NM_003339chr5----1207 --
NM_003342chr1763156 2874 2670 2565 2111 2104 43088 2988 2467 44 --22605 992
NM_003367chr19144 ------
NM_003370chr192527 160 ----171
NM_003373chr1041662 752 564 140 --21947 450 --
NM_003389chr9----2228 181 --
NM_003399chrX----11062 --
NM_003403chr14----173 --
NM_003405chr221139 --1546 --
NM_003406chr831722 1495 26 --11593 31432 1380 317
NM_003407chr19----1561 --
NM_003412chr321946 1104 21085 609 21113 1061 --
NM_003458chr3153701 3365 3194 3126 3031 2778 2667 2626 1619 1315 1132 1120 816 661 406 12870 43555 3371 3238 973 --
NM_003468chr254132 3003 2829 1636 594 --23160 222 --
NM_003474chr1022054 1541 --21611 1459 --
NM_003482chr1232754 553 521 --11994 --
NM_003489chr211341 ----11165
NM_003502chr161455 ----2503 441
NM_003507chr221379 463 ------
NM_003557chr131315 1104 206 ----21584 286
NM_003558chr9------1507
NM_003574chr1865051 4111 3882 1986 1488 138 --22210 454 --
NM_003575chr731096 1030 441 11261 11429 --
NM_003590chr243699 2706 2626 1413 --13594 32461 1567 1223
NM_003591chr10------187
NM_003632chr173832 779 594 --2353 57 --
NM_003635chr102426 188 --140 --
NM_003644chr17136020 5942 5727 5714 4984 4869 4830 4391 4230 1612 711 413 216 11745 56323 5564 4480 1191 749 1376
NM_003659chr231073 786 365 --1314 1895
NM_003664chr52405 68 --1135 --
NM_003672chr131336 1222 482 --1109 --
NM_003685chr192378 194 --2790 392 --
NM_003704chr41437 --1463 --
NM_003711chr51214 --1127 --
NM_003741chr31103 ----1124
NM_003743chr232129 458 375 --12212 31528 616 562
NM_003749chr133932 905 304 --21601 184 --
NM_003760chr11562 --1551 --
NM_003768chr141553 1532 1496 554 ------
NM_003774chr1242183 1026 879 204 --1833 --
NM_003787chr1831321 1250 166 --1616 --
NM_003794chr31437 ------
NM_003799chr1823601 1309 11680 --1259
NM_003825chr15----21360 190 --
NM_003861chr1432344 2104 354 1536 42850 2639 2324 857 --
NM_003877chr122298 27 --3891 304 205 --
NM_003888chr1541464 1441 1302 1227 11524 --11607
NM_003893chr10--2198 110 ----
NM_003895chr2111702 ------
NM_003908chr2031055 485 450 --21414 976 --
NM_003913chr643563 1635 1095 492 1749 24359 2672 --
NM_003916chrX1947 ------
NM_003924chr431631 1126 362 --11376 --
NM_003930chr71824 --12001 --
NM_003941chr722303 123 ------
NM_003945chr53186 154 126 --2341 58 --
NM_003969chr191115 --1127 --
NM_003982chr14----1328 --
NM_003988chr1082299 1786 1767 1734 1728 930 893 667 2391 125 31966 1818 185 --
NM_004050chr1461799 1045 1025 681 633 309 --21999 789 --
NM_004056chr8------1406
NM_004064chr121239 ----1190
NM_004074chr11186 ----1148
NM_004077chr1231062 1044 995 --11076 --
NM_004085chrX----1301 --
NM_004093chr1342688 499 302 266 --2775 58 --
NM_004094chr1451999 747 665 325 48 --22309 2303 1295
NM_004097chr22255 204 --1716 1276
NM_004098chr10----11179 --
NM_004100chr652661 2117 1763 656 608 --174 --
NM_004115chr13----1129 --
NM_004124chr141797 --1351 --
NM_004132chr101156 2872 92 21066 200 1303
NM_004162chr311123 1917 139 --
NM_004183chr114754 556 180 24 --1628 --
NM_004187chrX181 1229 ----
NM_004210chr1041644 767 668 240 21970 1803 42125 1544 633 547 --
NM_004227chr752825 832 546 351 250 23062 1948 --1361
NM_004229chrX21524 1516 168 12121 11550
NM_004232chr1853885 3177 2689 848 755 --1662 --
NM_004240chr19144 ------
NM_004272chr521673 46 --1716 --
NM_004283chr193874 679 39 --2670 343 --
NM_004293chr963848 3457 3425 3123 2435 683 --1623 21258 819
NM_004295chr1741076 269 169 97 21311 1042 1243 2513 158
NM_004296chr1493949 3396 3371 2993 2709 2702 1576 1024 699 ------
NM_004302chr1222481 2279 --1721 12172
NM_004308chr1151429 1326 1193 1186 194 --4606 451 315 212 --
NM_004309chr17101122 1047 988 798 268 228 217 211 202 133 --41056 911 784 159 --
NM_004311chr1032064 2026 253 12749 32252 1197 690 --
NM_004316chr1221096 1073 ------
NM_004321chr243056 2856 2540 1025 22455 2335 53368 2814 2701 927 480 1412
NM_004329chr102402 240 ----2530 297
NM_004331chr81611 --11789 --
NM_004341chr2121 --164 --
NM_004379chr23673 391 367 ----1191
NM_004385chr52598 62 ----1262
NM_004389chr21564 --1100 --
NM_004392chr131780 ------
NM_004393chr392221 2084 1826 1748 1625 1534 1466 693 376 1947 --11954
NM_004397chr1143460 1349 1253 461 --13036 1886
NM_004416chr123972 709 389 --2659 56 --
NM_004420chr1162208 2098 1938 1928 1802 908 12332 32129 2019 1741 --
NM_004423chr391974 1812 1073 914 894 871 537 500 265 2653 569 22065 200 12216
NM_004426chr1222003 776 --11401 --
NM_004427chr141005 892 253 38 --21097 404 --
NM_004429chrX1226 --21275 207 --
NM_004430chr86872 809 733 390 205 109 --2135 43 --
NM_004432chr942250 2191 632 327 --21838 254 11769
NM_004433chr121552 186 --2668 270 --
NM_004438chr242239 2137 1089 931 --2542 293 --
NM_004440chr6--159 11774 --
NM_004444chr74692 636 284 36 ------
NM_004449chr2121049 87 11100 ----
NM_004451chr112558 535 ----1585
NM_004456chr7141 --1169 --
NM_004492chr15----1227 --
NM_004516chr193450 189 93 ------
NM_004519chr81158 --1190 --
NM_004537chr121485 --154 --
NM_004560chr92915 310 ------
NM_004575chr4----168 --
NM_004583chr17132 ------
NM_004588chr11113645 3464 3351 3240 3194 2934 2838 649 127 38 24 --43658 2970 833 91 --
NM_004603chr7196 1366 11098 1311
NM_004612chr984645 4620 4530 4101 3835 3522 3132 824 --1111 1621
NM_004614chr162793 571 2912 355 52000 1872 547 515 249 --
NM_004615chrX2721 622 --2908 675 --
NM_004626chr11------1145
NM_004630chr1131054 957 920 --1280 --
NM_004654chrY1992 --122 --
NM_004687chr1721342 269 ------
NM_004706chr19----1306 --
NM_004717chr731288 478 106 ----1262
NM_004723chr11764 --1234 1821
NM_004734chr1311274 ----2843 802
NM_004739chr112560 177 ----1186
NM_004742chr351833 1564 1265 93 70 --11242 11460
NM_004745chr8146176 6135 5907 5277 5014 4856 4711 4623 4559 2302 1672 587 551 34 --46309 1665 312 86 26752 5209
NM_004776chr2042402 640 396 113 3405 312 170 1980 --
NM_004781chr151546 443 243 208 146 11486 21108 388 --
NM_004788chr1142538 2049 1816 272 ----11843
NM_004798chr20103442 3207 2922 2722 2478 1469 919 639 597 126 12763 5926 688 302 287 43 21110 568
NM_004840chrX21656 486 --2599 364 2349 34
NM_004841chr1------1839
NM_004842chr631553 40 26 --31243 286 48 --
NM_004852chr181714008 13856 9485 9447 9188 8838 8710 5475 4961 4603 3906 3784 3419 3305 2715 1921 289 411104 9577 3745 446 313898 9690 9678 18885
NM_004859chr1712739 --1528 11156
NM_004860chr171224 ------
NM_004861chr22----1265 --
NM_004863chr1495018 4935 4530 4081 1793 1089 307 178 116 13665 53627 3319 3308 3265 437 13295
NM_004898chr432333 2291 1156 --22725 364 --
NM_004905chr13763 709 327 ----1185
NM_004926chr145530 450 440 375 296 ------
NM_004929chr811490 ------
NM_004930chr11194 1701 ----
NM_004934chr5----136 --
NM_004939chr2175 ------
NM_004944chr3152 ----139
NM_004952chr1169 ------
NM_004956chr744495 2812 1107 429 --23154 875 13109
NM_004965chr212630 261 --138 1649
NM_004969chr101368 --1209 --
NM_004991chr31127 ------
NM_004992chrX218546 8246 6827 6802 6469 6372 6352 6059 5973 5870 3417 3331 3195 3000 2365 2234 2070 1633 1238 91 57 --37459 5378 2813 12142
NM_005057chr131696 1689 50 --2380 110 --
NM_005065chr1484869 4805 4538 4374 2158 1231 466 158 ----21841 1662
NM_005077chr9------1392
NM_005096chrX41255 374 267 224 --3812 414 141 --
NM_005110chr51624 1134 2596 143 --
NM_005121chr1733862 1344 653 --1529 12705
NM_005156chr9105381 4913 4243 3367 1717 1565 1397 1304 1057 675 --44073 3589 3439 92 13520
NM_005168chr221492 1389 --1583 --
NM_005186chr114559 434 278 62 --2475 102 --
NM_005188chr11167886 7532 7460 7192 6186 6078 5786 5548 5350 5102 3093 2865 2682 2237 1272 961 15559 67466 6966 6635 5711 5583 1305 16248
NM_005189chr17102423 2322 2113 1847 798 791 261 241 204 126 22223 215 12392 2691 444
NM_005198chr22--140 ----
NM_005204chr101996 ----3846 144 66
NM_005206chr1711381 --2900 407 --
NM_005220chr1761449 1250 1048 468 458 59 21393 153 ----
NM_005225chr2031194 901 46 --2997 952 1129
NM_005230chr121566 ------
NM_005233chr362552 1032 680 586 140 21 --1883 --
NM_005238chr1143199 2817 410 249 --12535 --
NM_005249chr14------1649
NM_005254chr15----1871 --
NM_005259chr2----1990 --
NM_005277chr43730 611 97 --11600 --
NM_005329chr1622044 273 11645 11662 --
NM_005339chr433662 712 321 --22619 37 --
NM_005376chr1188 1332 2383 236 --
NM_005385chr362572 2266 2158 2139 2014 667 --2990 180 --
NM_005386chr201886 --2813 602 --
NM_005392chr92321 90 2418 286 2111 68 --
NM_005412chr123499 487 139 --1422 --
NM_005418chr11132 ----1140
NM_005430chr12----3880 666 377 --
NM_005436chr1073932 3832 3661 2744 861 607 72 --33940 3581 1518 11644
NM_005442chr33618 596 411 --2431 103 --
NM_005450chr17--170 ----
NM_005461chr201225 ------
NM_005493chr6----2307 134 --
NM_005504chr1255871 4897 2332 760 677 --1286 --
NM_005517chr121237 1168 1958 --1194
NM_005537chr132160 65 --1782 --
NM_005539chr104484 188 150 50 ----1987
NM_005552chr143467 81 71 1122 150 --
NM_005581chr192336 89 --1174 --
NM_005596chr996190 4461 2499 2372 1489 1413 1103 429 392 --14912 21407 792
NM_005604chr642350 2005 1003 409 --1260 --
NM_005626chr12180 165 --1149 --
NM_005634chrX1111 --1538 --
NM_005652chr1661196 865 338 204 197 172 --21107 1009 --
NM_005665chr194924 4381 4145 3645 750 614 607 582 165 11807 --1990
NM_005668chr582800 1232 910 776 769 744 683 471 --149 --
NM_005678chr153841 805 126 ------
NM_005683chr252457 2157 1634 961 928 11820 1118 --
NM_005686chr141281 1207 982 634 1990 2513 336 --
NM_005688chr331104 853 96 ------
NM_005697chr15171 --145 --
NM_005707chr151996 --2267 171 --
NM_005708chr13----1143 --
NM_005715chr631975 1965 618 --1696 11792
NM_005717chr13870 829 27 --1116 --
NM_005730chr1292948 2741 2593 1456 1443 1410 468 95 58 11127 93497 2958 2721 1291 1243 681 653 617 342 12919
NM_005746chr71492 ----1831
NM_005754chr53995 979 946 --1803 --
NM_005768chr124534 287 280 51 --1133 1122
NM_005779chr543141 2635 768 397 23540 870 --22959 454
NM_005789chr1751855 1329 812 518 56 1576 11913 --
NM_005811chr12----123 --
NM_005822chr662106 2055 908 134 81 33 --1169 1942
NM_005828chr1785035 3527 1023 778 536 384 352 202 --54277 3879 1852 635 51 11124
NM_005833chr9----1177 --
NM_005841chr43933 749 225 ----1441
NM_005859chr511352 --11108 --
NM_005880chr16------11008
NM_005907chr61502 ------
NM_005909chr543671 1173 1152 942 --13591 13437
NM_005910chr1793448 3044 2848 2765 1483 1349 906 862 360 --33664 1421 1031 --
NM_005920chr172845 2714 2511 1220 736 114 29 13075 23505 1499 --
NM_005924chr7--1188 --1345
NM_005933chr1162788 2758 1929 765 695 118 --22226 2077 --
NM_005935chr495104 4751 4005 3950 3478 3284 1062 826 27 --13697 11222
NM_005941chr853599 1378 945 891 575 1188 12985 22694 539
NM_005955chr194997 3870 2096 1962 1955 1707 1576 1468 1315 24290 4283 41474 1336 884 757 --
NM_005966chr232430 1576 92 --12403 --
NM_005967chr122634 470 --1122 1253
NM_005984chr222437 63 --2387 356 --
NM_005985chr203540 203 51 --1662 --
NM_006011chr15134182 4004 3996 3689 3349 3038 2960 2796 1312 1060 1048 925 409 43071 2997 2631 639 32912 1140 340 13411
NM_006022chr132414 302 ----180
NM_006032chr14135 ----180
NM_006047chr2043492 1292 561 527 ------
NM_006091chr1551670 1157 559 518 250 --21792 632 --
NM_006094chr822365 263 21597 26 21910 164 --
NM_006133chr1142156 1728 1569 680 11755 3700 688 346 11521
NM_006141chr1632787 1087 1027 11726 ----
NM_006145chr192879 350 --1453 --
NM_006156chr141265 --1215 --
NM_006176chr112626 284 --1325 --
NM_006185chr112501 179 1528 2241 86 --
NM_006188chr7------1242
NM_006192chr205352 280 105 94 43 --31153 794 398 21049 910
NM_006201chrX6865 847 457 409 284 240 11060 ----
NM_006202chr1941686 1399 457 78 --1595 11987
NM_006206chr432436 290 209 12449 22708 198 --
NM_006211chr83246 99 41 ------
NM_006212chr184238 3501 3446 2060 1763 1659 441 62 --23661 755 --
NM_006224chr1782514 2506 2375 2321 1910 1630 356 266 1517 22293 430 12248
NM_006242chr2051965 860 590 362 50 21772 32 2692 425 --
NM_006245chr62859 108 --1198 --
NM_006251chr543348 2417 745 612 2790 324 --168
NM_006252chr126898 5136 1693 26267 6173 2810 509
NM_006255chr141257 --1765 --
NM_006282chr2094637 3287 3153 3146 3121 1336 801 741 66 12934 34684 1649 454 24270 2970
NM_006283chr884427 3624 3611 3172 3011 233 70 44 23974 3923 24161 1861 24754 901
NM_006289chr92317 64 ------
NM_006306chrX63992 3947 900 737 304 209 11089 --1523
NM_006310chr1721087 36 --11276 --
NM_006321chr381643 831 683 622 494 214 84 50 11839 2839 616 11388
NM_006328chr112254 135 --1247 --
NM_006336chr981345 1149 1058 959 533 401 272 98 21016 302 --11282
NM_006338chr12264 165 ------
NM_006345chr4----1390 1241
NM_006366chr631006 822 200 1114 11146 --
NM_006373chr1791421 1339 981 890 489 446 347 164 89 --21113 253 --
NM_006387chr194915 793 459 351 1110 --11244
NM_006390chr121684 --21375 362 11638
NM_006424chr481890 1599 1422 1299 656 595 479 426 --21289 1278 --
NM_006458chr11----1343 --
NM_006465chr1562140 1883 850 840 706 268 --1390 1472
NM_006494chr195781 212 99 57 45 --2767 111 --
NM_006496chr141685 1566 1254 67 ------
NM_006516chr131448 639 280 --1360 --
NM_006532chr1981733 583 538 317 276 270 256 190 21589 1405 31393 422 238 --
NM_006540chr821404 22 21096 632 21372 185 --
NM_006546chr17136274 6216 5946 5899 5212 4306 2632 2140 1515 1415 1191 765 465 15148 34211 2503 2224 24335 1236
NM_006549chr1242825 2541 1168 43 1922 --22715 822
NM_006562chr103215 111 59 ------
NM_006565chr161339 --1519 --
NM_006593chr22154 78 ------
NM_006595chr11----11954 1159
NM_006599chr1698227 6704 5615 5038 2652 2449 1427 1390 636 --18050 15638
NM_006612chr171471 --174 --
NM_006614chr31413 --12848 --
NM_006621chr121879 173 --11343 --
NM_006624chr1011835 --2849 94 --
NM_006626chr952601 2302 1004 615 199 --12149 12055
NM_006628chr1584557 3802 3688 3553 3546 3191 1834 1630 14367 34234 4011 3521 --
NM_006633chr52606 157 --1720 --
NM_006640chr1741770 632 190 156 --21854 1375 --
NM_006651chr431473 580 146 11097 ----
NM_006662chr161122 1103 ----
NM_006670chr6----1140 --
NM_006695chr17----1237 --
NM_006703chr6196 ------
NM_006717chr942237 2164 1199 372 --11055 --
NM_006735chr7----164 --
NM_006742chr1651800 1700 712 613 522 21915 309 62008 1316 1277 1248 754 317 31509 603 147
NM_006749chr81401 --2458 129 11011
NM_006750chr16117851 6597 5546 5337 3151 2400 2201 2194 859 666 633 14993 67043 3064 1997 672 461 108 17209
NM_006754chr731211 813 157 --21127 278 --
NM_006756chr8----1158 --
NM_006762chr1147 --21178 133 --
NM_006763chr172001 1928 1888 1342 560 212 201 --31740 1709 430 11755
NM_006769chr1------132
NM_006772chr631545 455 311 --41576 667 117 105 --
NM_006788chr1831593 737 503 --31869 1456 463 --
NM_006795chr1181370 1241 461 444 427 294 263 118 11277 2519 483 --
NM_006801chr193516 207 129 ------
NM_006803chr82809 781 1136 185 12038
NM_006809chr205919 785 725 364 138 --1643 --
NM_006813chr62930 89 ------
NM_006814chr2062476 901 510 222 140 31 --11055 1435
NM_006815chr12------1222
NM_006836chr121628 --1178 --
NM_006838chr1211911 --11241 11461
NM_006851chr1222812 358 21834 321 12957 22578 868
NM_006861chr1231787 1696 513 21861 1559 3704 693 344 --
NM_006874chr4----1209 --
NM_006885chr1632981 1694 301 ----11147
NM_006898chr22169 123 2550 140 ----
NM_006902chr142824 1075 745 594 --23030 2461 2707 559
NM_006908chr741278 473 255 107 --11000 --
NM_006915chrX52506 1964 1829 1822 1797 --2721 494 --
NM_006939chr143890 358 207 --11056 1897
NM_006943chr20102944 2893 2435 2313 2303 776 694 550 441 394 --33295 2620 2589 1819
NM_006950chrX3772 728 722 180 1648 --
NM_006981chr932874 2667 916 --32827 456 30 1597
NM_006990chr1102490 1897 1591 795 632 605 536 501 358 329 1594 51789 1757 657 160 51 --
NM_006996chr111268 --1697 1457
NM_007008chr2------1805
NM_007011chr15166655 6353 6041 5826 5621 4578 4555 4288 2672 1253 1144 893 633 490 145 75 46058 5661 1873 839 24528 564 16524
NM_007038chr2155879 4660 2184 176 101 --33751 2173 298 --
NM_007051chr1----1123 --
NM_007098chr224478 382 367 53 193 170 --
NM_007114chr322064 1166 --11068 --
NM_007118chr51671 --2637 611 --
NM_007122chr12585 267 ------
NM_007125chrY----1157 --
NM_007150chrX72123 2057 1974 1950 1601 1394 295 --186 --
NM_007170chr16885 716 365 358 220 187 --2783 246 --
NM_007178chr123381 366 69 --1450 1492
NM_007182chr34553 545 302 288 --1712 --
NM_007185chr13429 313 123 --4339 288 196 172 --
NM_007207chr1------1659
NM_007213chrX----1560 --
NM_007224chr12129 --1634 --
NM_007238chr2074590 4192 3891 1909 1355 1348 789 --74836 4721 4105 3878 3452 3326 72 24661 4319
NM_007241chr17------1147
NM_007245chr161326 --3207 179 129 --
NM_007260chr16725 668 655 552 164 132 --2803 594 1739
NM_007271chr61125 2575 83 31632 1269 1154 --
NM_007276chr7----1217 --
NM_007286chr551896 1487 662 403 83 1840 42131 2114 2078 2071 --
NM_007327chr95951 887 867 433 126 --11112 --
NM_007345chr181259 ------
NM_007359chr1761636 1558 1535 1373 575 474 --31576 1267 162 --
NM_007361chr14------1577
NM_007363chrX11016 --1432 1810
NM_007365chr191871 1683 1458 855 690 681 236 145 72 11642 21657 28 12118
NM_007375chr11905 22542 524 31781 1717 491 --
NM_012069chrX42075 2068 1940 586 --32700 712 196 --
NM_012081chr573383 3342 3303 3274 2327 638 459 --2693 159 11466
NM_012090chr11131 --1195 --
NM_012095chr1041346 977 937 495 13350 21084 480 --
NM_012099chr196933 806 799 774 482 220 11154 ----
NM_012104chr1143531 3405 1379 879 13359 31219 531 133 11335
NM_012115chr6----1403 --
NM_012121chr1721190 292 --1493 11482
NM_012124chr11----2830 169 --
NM_012154chr8----1151 --
NM_012197chr92473 263 11071 155 --
NM_012199chr1104480 4144 4010 3646 2950 2829 1615 1475 303 122 13516 44076 2920 1067 780 --
NM_012207chr10------2692 273
NM_012214chr234862 2416 1368 14300 --36354 5014 1715
NM_012215chr1021332 225 186 2567 399 --
NM_012234chr323104 1117 --12463 --
NM_012281chr731964 1947 266 1139 22149 1761 --
NM_012282chrX2805 63 1216 3768 663 254 --
NM_012287chr382909 1539 1487 1353 1346 1315 441 415 ----23978 841
NM_012290chr221545 1325 ----142
NM_012294chr753695 3465 2577 1483 1164 --34114 3912 3178 --
NM_012296chr1173015 2977 2677 2639 2533 2434 289 23445 124 23090 2486 1243
NM_012297chr41411 --1900 --
NM_012300chr521640 211 1355 1743 --
NM_012304chr532341 1955 457 1668 12473 --
NM_012307chr183809 353 274 11003 ----
NM_012308chr1162371 1995 1989 1906 978 66 11844 32118 955 820 22486 418
NM_012309chr11104853 4735 3879 3815 3697 3616 1361 1340 1048 460 44683 4106 1489 849 33549 914 120 24227 4114
NM_012325chr2021323 400 ----1424
NM_012330chr1061634 1253 541 404 303 259 ------
NM_012340chr20----1175 --
NM_012345chr1331830 1413 589 --21754 675 --
NM_012419chr6------1145
NM_012431chr722854 2848 --22289 763 --
NM_012434chr621246 607 --168 127
NM_012464chr442796 2289 764 293 --11170 --
NM_012471chrX31848 1651 197 --1316 11594
NM_013231chr1434264 3526 2810 --1699 --
NM_013233chr211339 --1455 --
NM_013261chr443384 2738 1172 745 13400 --13139
NM_013275chr16--1146 1745 --
NM_013277chr122421 77 ------
NM_013354chr81133 --11353 --
NM_013368chr193493 229 114 --1406 --
NM_013372chr1521091 753 --31284 1129 120 --
NM_013396chr2111037 --21290 60 --
NM_013399chr1651278 1259 1179 519 290 --2749 311 --
NM_013433chr191532 --2750 139 --
NM_013449chr1272929 2907 1205 827 819 810 538 --22373 335 1516
NM_013958chr8----199 --
NM_013960chr81290 --2568 147 1115
NM_014010chr91621 --1552 --
NM_014011chr2----1479 --
NM_014016chr341071 602 170 105 ------
NM_014023chr1052754 1877 1132 654 397 --21179 865 --
NM_014034chr62546 332 ----11231
NM_014112chr874806 4038 4012 3860 856 779 111 ------
NM_014117chr1652134 1953 1781 843 396 1447 1173 --
NM_014216chr1441655 1339 1233 441 2504 356 --11673
NM_014223chr13724 109 75 ------
NM_014232chr1741119 497 397 38 --1272 --
NM_014240chr3103950 3785 3515 3377 2639 2614 2604 1353 327 143 23340 2587 31596 178 62 --
NM_014289chrX41436 1255 1093 268 --11001 11424
NM_014294chr8------1215
NM_014325chr1231540 811 793 --21377 175 22263 1769
NM_014335chr1511394 --1997 --
NM_014368chr951897 1889 1430 1342 350 --11611 11962
NM_014388chr1105859 5360 4519 4272 2442 2169 2033 1474 1378 646 35667 5191 3894 35844 2027 2001 --
NM_014393chr851865 866 628 214 165 --21712 945 1335
NM_014415chr311354 --11382 --
NM_014417chr191297 ------
NM_014423chr545178 4971 4719 1422 --21971 24 24631 4349
NM_014449chr12182 1171 ----
NM_014452chr61461 --1309 11195
NM_014455chr11322 --1199 --
NM_014458chr11114 1962 ----
NM_014470chr122591 558 ------
NM_014494chr1621500 503 --11665 --
NM_014504chr762011 859 755 538 312 238 --1275 --
NM_014515chr122168 54 ------
NM_014517chr32783 726 ----1734
NM_014550chr225648 222 151 133 87 1243 2676 538 --
NM_014573chr1741560 436 292 264 --11833 --
NM_014591chr102957 105 --2346 331 --
NM_014602chr3------1111
NM_014612chr9------11110
NM_014613chr592754 2265 2165 2132 1904 1080 1015 432 263 --22069 442 12709
NM_014632chr11392 76 24 ------
NM_014661chr10173935 3852 3783 3750 3336 3294 3236 3010 2381 1535 1284 903 693 521 514 203 112 --63549 2771 751 550 500 292 --
NM_014665chr8142888 2858 2678 2525 2343 2297 1084 829 454 419 389 349 151 131 43135 922 245 87 12369 --
NM_014674chr3103841 2739 2601 1292 1240 1116 894 706 473 466 21403 933 13502 --
NM_014682chr811433 --11472 --
NM_014686chr1912480 22337 240 12176 12526
NM_014707chr732172 632 345 11641 12271 --
NM_014709chr2188 ------
NM_014723chr20103056 2699 2675 2580 2322 2137 2077 1276 880 568 11071 23202 1131 --
NM_014726chr1761150 1094 877 451 294 283 --1911 --
NM_014730chr12144910 4336 4059 3791 3641 3443 2116 1931 1913 1473 1279 698 234 196 --33731 626 550 45205 4309 3437 2107
NM_014731chr2031440 1222 543 11514 ----
NM_014742chr2051773 1524 584 549 470 --11116 1387
NM_014747chr1135401 5297 5081 4659 4317 4114 4045 3829 3781 1781 1225 813 802 43542 1956 1707 340 55470 5004 3965 3957 1290 23795 266
NM_014751chr812170 --22146 827 --
NM_014755chr284147 3650 3438 2930 1666 1435 1281 95 --12873 22862 167
NM_014784chr1----2429 237 --
NM_014807chr111713 --4656 597 523 280 --
NM_014810chr163455 3411 1468 1284 179 96 --42560 1382 1268 59 --
NM_014820chr3----1544 --
NM_014824chr1121961 178 --11882 --
NM_014838chr2252793 2752 2277 797 156 --12665 1148
NM_014839chr1----11819 --
NM_014840chr1282921 2852 2595 1190 850 386 349 124 --11035 --
NM_014846chr8----1248 --
NM_014847chr12373 135 ------
NM_014849chr131200 910 335 --2342 306 --
NM_014858chr161088 977 740 363 150 98 ------
NM_014859chr1731360 238 23 1276 1254 --
NM_014893chrY11572 --12261 11780
NM_014899chr5--1948 --12700
NM_014904chr1053183 3073 1086 921 672 13795 --1570
NM_014924chr1442446 2117 2110 898 12232 ----
NM_014926chr3----21138 236 --
NM_014938chr1262603 2002 1993 1867 770 107 --2586 431 --
NM_014947chr172148 1972 1166 1159 1031 1024 999 12485 1204 23032 786
NM_014956chr112892 35 11000 2315 75 --
NM_014962chr202536 460 ----12181
NM_014974chr1031756 1402 603 ----1232
NM_014978chr1051127 495 377 297 243 --11341 11315
NM_014982chr14104762 3600 2135 1988 1831 1241 996 926 892 646 --23622 3274 1185
NM_014990chr14194 2834 247 1105 --
NM_014994chr1552329 2323 759 191 133 1448 --1215
NM_014997chr762579 2252 2131 2020 200 137 1990 32588 1124 189 --
NM_015011chr13----174 --
NM_015015chr191796 --11263 22049 1536
NM_015023chr171549 1519 1255 1207 674 314 297 --41714 1682 1269 1147 --
NM_015025chr222159 467 --145 --
NM_015026chr1221054 120 --14582 1639
NM_015033chr993253 2968 2688 1210 1075 1068 368 47 33 23287 72 33080 2511 1289 --
NM_015039chr1113520 3413 3256 3120 1630 1558 1491 1355 1219 281 204 13405 2436 70 --
NM_015044chr16113234 3145 2922 2820 2631 2420 1129 670 547 401 330 --13049 1527
NM_015045chr10----11423 --
NM_015052chr71251 --1168 --
NM_015059chr15143884 3773 3652 3566 3427 3326 2428 1553 1360 865 823 243 233 222 --1582 1909
NM_015072chr142129 111 --1393 --
NM_015074chr1124596 3510 3136 1799 1770 1450 1348 926 785 569 355 31 24391 1851 24287 3826 --
NM_015075chrX62276 1642 877 414 192 172 183 42090 1985 1569 178 --
NM_015090chr1145393 5198 5084 4819 4740 4216 2351 1740 1727 1336 702 619 578 403 35921 5419 1405 55218 5132 2395 961 595 23842 1551
NM_015092chr1624583 2835 --34527 4132 3193 13291
NM_015093chr6------1538
NM_015155chr1043254 3143 1321 1139 1310 --1529
NM_015156chr1483863 3352 2537 1249 443 352 282 156 --21565 855 1725
NM_015161chr1611100 ----1411
NM_015198chr72846 345 --1227 --
NM_015199chr332619 2192 616 ------
NM_015210chr182131 63 --11138 1455
NM_015213chr111297 ------
NM_015231chr11----141 --
NM_015263chr151397 ------
NM_015265chr222307 665 --22478 2118 1313
NM_015277chr1831324 423 188 21480 130 21354 269 --
NM_015282chr282668 2611 2556 2402 2339 2322 2170 651 1705 52580 2502 2485 2409 50 --
NM_015284chr162057 1932 1752 773 479 398 21943 1777 21872 832 12065
NM_015291chr182292 1401 1282 1206 1169 1071 978 813 --1822 --
NM_015308chr111222 ----1662
NM_015310chr886740 5650 2885 1944 1843 1194 1187 706 13308 15471 17431
NM_015313chr11103631 3539 3455 3325 975 682 600 556 392 58 13162 33470 3086 1622 14402
NM_015317chr222221 665 --12705 --
NM_015326chr192514 2479 2158 874 539 351 176 140 132 --2780 200 --
NM_015328chr772771 2560 2553 2238 2070 596 90 --52614 2460 2168 865 504 1661
NM_015335chr121357 12602 1507 --
NM_015336chr1211638 ------
NM_015344chr832082 1764 104 1422 ----
NM_015347chr1242793 2224 2154 145 ----1526
NM_015349chr631112 648 102 12160 1682 1110
NM_015355chr17----11569 --
NM_015361chr2----2637 254 --
NM_015382chr142108 55 ------
NM_015396chr31954 --11079 --
NM_015443chr1731273 515 379 --11051 --
NM_015455chr533891 1164 699 ------
NM_015457chr112848 31 11076 ----
NM_015460chr34702 565 208 58 1255 22081 37 --
NM_015477chr153322 112 92 --1701 --
NM_015481chr124843 763 439 221 ------
NM_015483chr721081 393 1741 --1191
NM_015488chr291632 1522 1363 1159 637 627 534 464 224 11389 41682 1504 1471 1463 --
NM_015497chr152890 828 1785 11113 --
NM_015503chr16----1456 --
NM_015509chr1241202 632 557 329 --31410 1279 385 --
NM_015511chr20160 --1860 11124
NM_015516chr1151216 1185 1136 1010 51 --3295 267 208 --
NM_015534chr12802 126 1382 1809 --
NM_015550chr762290 1348 1058 661 469 341 12607 53569 3106 2834 819 51 --
NM_015565chr2132264 1528 1442 --11396 1602
NM_015568chr2063785 1676 1523 1466 1252 235 22690 992 43915 3219 3183 191 34286 3000 1176
NM_015569chr164469 3107 2950 1925 1824 641 --11442 --
NM_015576chr332740 1144 764 1943 11983 --
NM_015577chr53560 420 350 --1712 --
NM_015584chr171197 --1499 11150
NM_015608chr10--1219 --141
NM_015609chr162758 2503 2170 1056 1050 45 ----32429 1035 427
NM_015626chr173929 496 324 --11156 --
NM_015651chr971911 1691 1437 629 339 228 198 11496 21743 861 11387
NM_015686chrX32502 2410 2304 12348 22434 1989 --
NM_015695chr651967 650 611 97 63 1843 11722 138
NM_015711chr194222 161 143 75 ----1703
NM_015719chr192553 199 --1736 --
NM_015852chr723458 2569 ------
NM_015855chr112671 140 ----2770 614
NM_015872chr151737 1701 1375 1255 1183 ------
NM_015878chr8----11403 --
NM_015879chr18108590 8582 8537 8157 7851 5194 3304 1725 632 369 25386 67 3902 694 299 27890 7161
NM_015885chr11--1124 ----
NM_015906chr154505 3348 3087 1866 1604 ----14487
NM_015915chr14------288 65
NM_015981chr592960 2562 2034 1962 1036 795 524 518 244 12142 32967 1189 636 --
NM_015982chr17--1402 ----
NM_016006chr3----1175 --
NM_016009chr154725 4462 3633 3466 3231 --24542 4253 --
NM_016022chr1----199 --
NM_016037chr161037 898 891 866 468 333 ------
NM_016057chr1241138 1001 960 882 1873 --1385
NM_016083chr633341 3046 329 --176 12942
NM_016107chr531388 354 274 --11181 --
NM_016120chrX1309 ------
NM_016129chr41314 --1322 --
NM_016131chr251795 1526 791 768 514 11659 11974 --
NM_016141chr33747 555 97 --155 --
NM_016147chr113956 414 206 1295 3943 854 82 --
NM_016151chr161162 --1343 --
NM_016162chr12--1816 1740 1268
NM_016206chr3177969 7638 7631 7608 7602 7505 7498 7185 6674 3550 3273 3172 3022 2862 2767 2142 2071 38152 6851 3299 18108 47158 3201 3056 1520
NM_016235chr1621014 439 --149 --
NM_016252chr21703 --1638 --
NM_016269chr4------1104
NM_016287chr171650 1489 1374 834 827 446 310 --21915 273 --
NM_016308chr11366 --21768 288 1610
NM_016322chr941052 538 341 72 12592 23135 2551 --
NM_016396chr1522487 947 ------
NM_016399chr121837 ----1577
NM_016406chr1----2357 92 --
NM_016422chr11----12772 --
NM_016424chr1751995 1403 531 208 150 --1250 --
NM_016436chr201782 --12014 1610
NM_016441chr211621 ------
NM_016467chr211020 --1178 11069
NM_016505chr13133 96 56 ------
NM_016577chr373301 3015 2854 969 567 69 23 24321 1247 33740 434 54 --
NM_016598chr34590 307 256 125 ----11482
NM_016605chr552323 1726 1680 393 339 21974 1689 32715 2170 834 12047
NM_016620chr111353 ------
NM_016626chr1811339 --2688 429 --
NM_016829chr33174 163 39 ------
NM_017409chr121783 1503 --1179
NM_017415chr594080 3690 3676 3587 3376 2967 1328 794 674 13533 --13797
NM_017423chr42491 271 --1546 --
NM_017544chrX2718 99 --1985 --
NM_017546chr22635 603 --1876 --
NM_017551chr1032177 1761 413 --1657 12671
NM_017582chr151711 1325 651 323 280 --185 --
NM_017590chr2232384 2259 2105 2675 296 22679 2175 --
NM_017596chr1134201 4171 3600 3477 3388 2899 1362 975 772 724 338 322 85 31464 999 254 71488 1258 1019 868 761 397 24 --
NM_017602chrX2371 196 1664 193 1779
NM_017629chr131761 1257 512 175 ----
NM_017633chr663719 3338 3137 2860 1116 900 --1833 --
NM_017634chr81244 --21399 498 --
NM_017666chrX62235 1420 1413 1388 761 245 1576 --1278
NM_017668chr162697 45 2778 115 1253 --
NM_017709chr143422 2931 851 69 11252 13016 --
NM_017728chr1752946 1150 1092 790 737 12305 32385 1141 456 --
NM_017730chr32579 130 176 ----
NM_017736chr1652320 2165 2011 1982 257 --12576 --
NM_017739chr12522 511 ------
NM_017742chr1851522 783 399 191 184 --1464 11226
NM_017744chr12740 438 --22207 1640 --
NM_017753chr91734 --1381 --
NM_017754chr664216 3460 822 641 570 435 --31019 892 350 13943
NM_017770chr632855 2307 666 1344 1744 --
NM_017772chr641635 1625 1151 165 ----134
NM_017776chrX21567 1012 2436 269 11144 133
NM_017778chr851518 1217 1169 992 514 147 11290 --
NM_017789chr22652 618 --1693 --
NM_017793chr151623 153 1753 1661
NM_017799chr1421691 1358 141 --11376
NM_017813chr895721 5627 5202 3884 2196 2059 2052 942 194 --25168 2027 15773
NM_017824chr1012660 21983 614 1348 --
NM_017847chr141969 635 469 165 ------
NM_017848chrX64598 4542 4481 2971 1726 440 13572 24161 710 23346 1144
NM_017851chr1591084 1023 912 886 837 430 155 74 43 1973 1383 --
NM_017873chr952227 2170 2124 1199 1192 11065 42944 2384 1167 719 --
NM_017902chr10195149 4756 4637 4513 4447 4179 4092 3987 3899 3828 3791 1206 984 904 847 632 612 433 22 24919 1153 55193 4489 1542 525 207 --
NM_017919chr945169 4805 1463 1400 --23921 623 13764
NM_017925chr931529 1491 1469 --1241 --
NM_017934chr6----179 --
NM_017964chr23779 705 214 147 ----
NM_017983chr172303 168 ------
NM_018014chr2--1105 ----
NM_018027chr1032004 364 173 --2235 163 --
NM_018030chr18------1799
NM_018036chr1464147 3983 3274 2717 1583 747 13094 1322 11027
NM_018067chr12503 162 ----1568
NM_018071chr141176 --3716 192 116 2548 230
NM_018085chr1167904 7228 7177 6532 6377 5370 5165 2942 2494 2274 2117 1873 1703 934 604 550 1834 57042 5582 2803 951 772 18151
NM_018087chr11194 ------
NM_018113chr12----2400 391 --
NM_018121chr1022632 2489 --12236 11241
NM_018133chr311703 --11991 1430
NM_018150chr15832 808 775 73 55 130 ----
NM_018159chrX------21178 258
NM_018193chr15142 ------
NM_018207chr111635 1136 21496 323 --
NM_018222chr1141776 1723 93 73 --11178 --
NM_018227chr413154 --1768 --
NM_018240chr15837 232 193 144 109 ------
NM_018244chr2011201 ------
NM_018254chr121883 212 1202 1344 --
NM_018275chr72460 430 --295 81 1551
NM_018293chr322948 2331 --12856 --
NM_018327chr2041802 1152 656 59 ----1161
NM_018364chr153712 3654 3398 3237 347 --2820 783 --
NM_018381chr192849 323 ------
NM_018383chr261476 1334 1327 718 431 29 ------
NM_018403chr332600 1570 398 --23504 1551 --
NM_018449chr91510 --2138 121 1303
NM_018462chr3--174 1592 --
NM_018482chr81828 2788 330 11731 2174 55
NM_018489chr142062 1797 529 227 --2372 61 --
NM_018509chr1721232 621 --21224 26 --
NM_018566chr184307 3441 3277 1282 1256 790 469 362 --22051 220 1504
NM_018569chr4----1199 --
NM_018584chr111257 --11087 --
NM_018590chr101453 --21513 84 --
NM_018638chr1235313 3542 568 13440 11938 1132
NM_018650chr121606 679 11511 --1848
NM_018682chr7----1521 --
NM_018689chr1562125 1897 1663 946 261 251 --2554 279 --
NM_018697chr722109 577 11571 21909 1770 1253
NM_018712chr113236 114 42 --11112 --
NM_018898chr522200 284 ------
NM_018945chr612701 --43453 2632 1037 152 --
NM_018976chr121592 ----21000 940
NM_018977chrX2370 363 --2879 764 --
NM_018992chr1651266 1220 1186 573 424 --51171 547 473 232 144 --
NM_018999chr1063511 3415 1870 1119 326 306 3686 591 385 14039 --
NM_019008chr2263099 645 453 342 164 82 --33581 2792 403 1329
NM_019044chr254628 4121 3988 3451 3166 --14668 2276 153
NM_019046chr10197 1807 2356 349 1244
NM_019057chr5125 ------
NM_019063chr242283 840 626 246 1888 1550 --
NM_019094chr1283747 1479 1354 1347 1322 1012 962 225 --12616 11386
NM_019106chr22102595 2233 2158 1285 899 799 722 699 528 319 12115 42681 2354 729 285 13208
NM_019106chr22102595 2233 2158 1285 899 799 722 699 528 319 12115 42681 2354 729 285 13208
NM_019106chr22102595 2233 2158 1285 899 799 722 699 528 319 12115 42681 2354 729 285 13208
NM_019114chr952435 2423 2417 1862 1715 22364 120 3986 179 40 --
NM_019606chr72161 154 --1174 --
NM_019610chr12750 574 ------
NM_019854chr124710 300 292 123 1182 ----
NM_020122chr275433 3969 3770 1584 1409 1369 673 12044 44263 1000 552 229 --
NM_020126chr19------1438
NM_020133chr696250 5808 5757 5207 2547 2366 934 744 51 --75054 4886 4570 4515 4286 4157 1051 22079 434
NM_020177chr522709 376 --11268 --
NM_020184chr261650 1515 730 425 154 42 --1777 --
NM_020193chr1121328 1024 ------
NM_020231chr3----1700 1678
NM_020310chr1762573 2496 2193 694 354 126 1883 21002 280 --
NM_020336chr2083463 3276 2684 2424 1465 968 896 482 12914 23752 2560 --
NM_020337chr422359 844 --1171 --
NM_020341chr2032070 1677 1362 1820 --11652
NM_020382chr122352 142 --41341 1257 431 275 --
NM_020403chr131621 ----11194
NM_020418chr3----155 2430 144
NM_020443chr1146916 6537 6216 5988 5931 5853 5846 5821 5267 2404 2306 1492 1165 241 36550 2760 746 56974 5141 2590 2519 1447 --
NM_020452chr152164 1914 1481 1430 472 --41330 768 390 103 --
NM_020463chr22211 170 --1443 --
NM_020474chr1822007 180 --1799 --
NM_020526chr141847 1118 739 103 31803 718 261 21791 300 --
NM_020647chr81415 --1867 --
NM_020651chr21558 --1270 11217
NM_020699chr195138 4700 4385 3860 3814 3316 1870 1359 832 11817 54962 4906 3820 1562 1316 14710
NM_020706chr21----1142 --
NM_020708chr2062384 2343 844 775 747 466 1863 21895 1002 --
NM_020713chr2082874 2170 985 833 731 591 342 112 12492 12721 --
NM_020718chr1685510 4898 4711 4140 2168 1342 1149 76 14226 36160 1979 1053 --
NM_020724chr442546 2168 567 338 --11794 1722
NM_020742chrX12685 21029 101 12331 --
NM_020750chr6------1967
NM_020752chr1042756 1157 922 538 1982 12705 --
NM_020765chr1----147 --
NM_020769chrX2804 117 ----2886 104
NM_020771chr6----11403 1119
NM_020777chr462572 2171 1551 599 439 426 --2694 566 --
NM_020778chr1584850 4680 3229 1692 1619 1440 819 201 125 44001 3208 1664 665 13612
NM_020791chr172514 79 ------
NM_020795chr1721315 1244 --21728 557 --
NM_020796chr532816 2632 81 12248 12427 12269
NM_020800chr3------1396
NM_020801chr51779 ----1631
NM_020825chr16163687 3608 3231 2857 2771 2746 2542 2498 1480 1337 1121 1020 958 941 361 300 1812 63555 1218 1109 1037 604 144 --
NM_020839chr321193 370 1179 21254 296 21279 1223
NM_020845chr1241847 976 732 163 22374 29 32284 1713 841 --
NM_020850chr1683190 3100 3091 2925 2751 2406 875 256 --1977 12634
NM_020858chr1512307 --22131 413 --
NM_020888chr151910 667 658 197 138 --2814 693 --
NM_020897chr141286 979 965 418 --21190 67 21350 272
NM_020898chr124774 321 278 132 --1682 --
NM_020899chr1741708 649 599 76 42195 593 255 233 1437 1829
NM_020918chr1011236 32313 2254 224 3859 437 142 --
NM_020940chr1032940 2328 1989 --12934 --
NM_020956chr1994733 4442 4375 3785 2894 1104 779 564 546 61915 1837 1759 1681 1564 771 54626 4028 3645 3399 571 --
NM_020958chr14----1380 --
NM_020962chr1562301 1639 1619 942 861 120 --31548 925 676 1419
NM_020981chr2----2786 122 1751
NM_021025chr5----1381 --
NM_021076chr222553 132 --1420 --
NM_021077chr15----1205 --
NM_021079chr1793047 2801 2600 2523 2451 2411 1279 211 203 22670 2484 22087 1067 --
NM_021090chr22114805 4527 4287 4269 4157 3533 3499 3371 1595 1538 630 24973 3175 --1217
NM_021109chrX----150 --
NM_021132chr1021342 123 --11255 --
NM_021155chr1993021 2933 2894 2202 1942 929 824 681 212 22969 527 42395 2355 1073 656 1138
NM_021158chr20164 --2101 74 --
NM_021165chr11604 --1640 --
NM_021174chr82661 494 1137 1689 --
NM_021183chrX52260 832 466 386 121 1175 ----
NM_021189chr1----2887 881 1288
NM_021198chr261446 1095 402 364 278 134 --51462 1249 1071 533 343 1215
NM_021238chr1251574 1467 196 189 164 --11503 --
NM_021249chr1441630 1384 588 399 1280 137 --
NM_021642chr141138 942 553 369 1930 --1382
NM_021648chr641787 797 296 241 1197 21080 553 --
NM_021808chr121565 --1262 --
NM_021813chr675338 4167 1750 1409 624 573 499 --12221 11463
NM_021818chr14----31083 511 97 --
NM_021914chr144866 648 452 344 31855 1793 40 2262 223 12089
NM_021926chr11173 ------
NM_021932chr111545 --1165 146
NM_021946chrX61243 1232 979 963 956 310 21252 1173 11300 1932
NM_021961chr11186104 5871 5193 5132 5096 5006 4942 4660 4553 2818 2768 2748 2706 2620 2439 2408 1758 1595 15841 37425 6975 6443 --
NM_021964chr334132 2600 189 --14960 --
NM_021965chr931343 1134 55 --41191 547 88 67 --
NM_022037chr21707 ----1211
NM_022048chr1586399 6021 5516 5292 4327 2373 1640 1411 --45827 4177 2379 1302 24257 1608
NM_022060chr1441370 911 901 893 21098 361 1857 --
NM_022123chr14------1197
NM_022130chr52303 181 1408 1549 --
NM_022133chr811161 --1749 --
NM_022170chr731504 426 111 1469 1236 --
NM_022338chr112261 57 ----180
NM_022465chr1262866 2454 2389 2161 907 279 --11122 --
NM_022484chr72895 334 --11247 11300
NM_022552chr21173 1904 1914 --
NM_022574chr752120 2105 1837 868 807 --21626 1424 --
NM_022648chr293550 3345 1846 1826 1400 1131 1048 883 624 1267 44412 3686 1734 389 1561
NM_022658chr1251142 374 348 329 248 ------
NM_022719chr2243876 3380 481 80 3842 670 569 33734 2946 276 --
NM_022737chr1931146 942 142 --21030 471 --
NM_022739chr1721226 56 ------
NM_022749chr821104 229 --31201 1113 57 --
NM_022753chr142228 892 774 630 22517 1023 32762 766 282 --
NM_022756chr121032 500 126 2297 46 11090
NM_022763chr352844 2701 2145 1256 972 --1895 --
NM_022778chr141330 938 517 465 11373 21113 1055 --
NM_022780chr211720 ------
NM_022781chr952929 2654 1258 720 708 32798 384 88 ----
NM_022782chr12--2405 99 ----
NM_022823chr2----1350 --
NM_022825chrX2276 268 ------
NM_022826chr21449 ----1485
NM_022836chr131278 565 513 --1572 --
NM_022841chr1542560 2213 1846 161 --174 --
NM_022894chr231317 622 277 21654 118 1711 --
NM_022898chr1474735 4135 4104 3974 3503 3412 1603 14192 177 14007
NM_023009chr12544 225 --2123 91 --
NM_023010chrX------178
NM_023079chr1721427 484 --1509 11621
NM_024015chr173906 801 483 ------
NM_024016chr172336 124 ------
NM_024052chr1742027 1095 1056 555 22618 687 12463 --
NM_024082chrX3104 49 36 ------
NM_024293chr23749 288 42 --1281 --
NM_024308chr171166 1376 256 49 --
NM_024328chr14--1240 3537 175 72 --
NM_024345chr985505 5024 4939 1817 1224 1213 1133 55 --14753 --
NM_024523chr71910 --277 37 --
NM_024524chr34985 750 694 672 1459 22465 681 --
NM_024528chrX----1118 --
NM_024536chr21407 --1301 --
NM_024551chr1242317 2072 1680 61 --1670 --
NM_024552chr19145 ------
NM_024565chr52550 520 --1608 --
NM_024567chr82701 535 --1695 1292
NM_024595chr1------1281
NM_024598chr16101136 1102 843 545 430 366 306 229 90 82 11079 11163 1117
NM_024607chr854378 3965 1059 923 195 --33115 819 472 13348
NM_024612chr1731001 407 54 1817 11030 --
NM_024665chr324070 1242 --23226 3016 --
NM_024674chr182813 2706 2585 2338 2206 2199 2168 972 1269 22174 1031 11986
NM_024700chr121139 122 --1113 --
NM_024701chr1031765 1490 1412 1712 --21742 1174
NM_024704chr20----3262 99 39 --
NM_024705chr1351054 973 353 319 30 --1858 --
NM_024721chr832053 1981 1759 12302 ----
NM_024727chr31596 ------
NM_024742chr1651193 591 523 405 103 ------
NM_024779chr1231444 1148 282 11348 41295 1129 476 348 --
NM_024817chr15105247 5002 4629 4329 3782 2306 1165 1155 1095 799 24461 1739 35449 137 41 --
NM_024824chr141557 --1602 --
NM_024877chr1941203 1017 174 60 31191 977 970 2801 70 --
NM_024911chr12713 101 1786 1159 --
NM_024947chr3119637 9520 8923 8305 8169 7554 7547 7419 7412 6289 3429 16477 33545 1811 1319 --
NM_024949chr464146 4001 3798 3295 784 371 13858 13259 --
NM_024953chr1211815 --12035 --
NM_024954chr102482 140 1621 3488 252 67 --
NM_024989chr2136949 6780 6138 5871 5817 3117 2827 2423 2296 2289 1471 1346 1231 --32992 2429 769 18126
NM_025009chr4------11774
NM_025057chr1421321 944 --21117 149 --
NM_025104chr1721160 542 ------
NM_025134chr1642375 837 816 370 ------
NM_025146chr312030 ----21944 478
NM_025164chr1141821 1397 815 748 1455 ----
NM_025179chr1104688 4391 4152 4138 3626 3239 1626 1440 987 957 44558 4358 1980 1055 63212 1377 1365 559 455 296 --
NM_025182chr92422 376 --3829 760 305 --
NM_025191chr152966 2170 797 375 311 12914 --1472
NM_025201chr15101680 1667 1555 1279 626 595 574 232 87 81 --22035 1417 --
NM_025204chr222896 204 --1373 --
NM_025208chr1132342 2157 1536 --12468 1645
NM_025222chr32464 127 --22600 926 --
NM_025251chr83469 451 208 --3338 319 289 --
NM_030571chr541486 1325 272 24 ------
NM_030627chr542765 1422 497 458 ------
NM_030648chr4124719 4651 4329 4319 4309 3712 1951 1709 1484 1365 1135 474 --14801 11831
NM_030761chr162144 911 768 501 187 69 --11883 --
NM_030802chr172108 43 --1196 --
NM_030806chr1178602 8567 8285 7694 7471 7432 7383 6747 6520 6084 5945 2848 2538 2076 1825 478 400 19185 33009 2506 1877 18393
NM_030820chr6--1333 --1784
NM_030885chr3----22167 186 --
NM_030912chr102355 99 ------
NM_030913chr14285 215 128 110 122 --1507
NM_030915chr262193 1902 1878 1474 698 171 11527 21700 795 --
NM_030920chr131586 1536 144 11918 ----
NM_030939chr6----1364 --
NM_030958chr81448 --172 --
NM_030964chr5103470 3369 3356 2955 2805 2753 2501 2331 1355 93 --2646 343 --
NM_031372chr421451 648 --1270 --
NM_031412chr12----2989 187 --
NM_031431chr132525 235 --21892 545 --
NM_031442chrX72445 1256 659 631 595 321 138 --12919 --
NM_031445chr273058 2920 2895 711 519 385 126 13339 43386 2687 144 73 --
NM_031449chr781823 1802 1581 1464 711 520 369 136 ------
NM_031450chr111230 2412 224 --1393
NM_031469chr674081 3985 2933 1503 893 691 234 13791 12767 11035
NM_031914chr142828 318 --1692 --
NM_031935chr1178 --1138 --
NM_031936chr12746 272 ------
NM_031937chr221258 135 ----
NM_032027chr12221 32 ------
NM_032042chr522794 54 --2383 206 12185
NM_032102chr112401 340 --1658 1414
NM_032124chr181324 --1898 --
NM_032160chr1853862 3729 2657 635 210 ----11405
NM_032174chr141464 1138 383 313 ----1511
NM_032182chr1031581 618 385 3569 430 152 11213 --
NM_032199chr101544 12884 13511 13295
NM_032208chr223412 295 --23564 384 1393
NM_032221chr201798 ----11816
NM_032228chr1143345 3189 2678 346 ------
NM_032242chr353042 2910 2891 2525 145 42099 956 720 301 22794 763 --
NM_032268chr1663165 3029 2630 2178 1207 441 --22198 1196 12838
NM_032289chr541700 748 514 508 1489 31827 1807 618 142
NM_032294chr17--21169 52 ----
NM_032298chr192310 135 ------
NM_032352chr141990 --1212 --
NM_032373chr1053592 2098 811 790 230 14163 11523 --
NM_032440chr1042968 870 701 106 --12145 --
NM_032449chr182755 2343 2203 1874 1147 835 806 662 32590 2038 24 32128 843 525 1637
NM_032452chr142206 62 --31440 1149 42 --
NM_032457chr423919 2670 --12813 1138
NM_032486chr1652556 2520 2192 756 422 --22615 809 11946
NM_032505chr31674 ------
NM_032539chrX----1547 --
NM_032547chr41551 --2419 404 --
NM_032578chr10--1500 21148 195 --
NM_032595chr1751385 536 434 344 223 --11094 --
NM_032622chr431534 1094 1078 --11561 --
NM_032632chr1421944 242 ----1760
NM_032646chr1781658 1561 1450 1237 715 244 191 112 11520 3697 399 25 21366 1170
NM_032682chr352982 2584 1266 674 473 1656 13485 1516
NM_032777chr841455 1118 1044 265 --21578 78 --
NM_032796chrX1700 --1147 --
NM_032802chr15------1196
NM_032804chr1062599 1842 1595 403 116 65 1274 11602 1909
NM_032810chr1021356 1269 --11243 --
NM_032842chr74634 499 492 203 --1467 11207
NM_032875chr171611 ------
NM_032900chr1063772 3532 3243 1061 990 216 --43257 2525 2393 191 --
NM_032905chr101293 186 21126 213 --
NM_032946chrX----153 1177
NM_032961chr411371 11354 1235 --
NM_032968chrX53284 1236 764 570 523 --23290 2636 13688
NM_032973chrY43279 1236 570 523 --23285 2635 --
NM_033025chr193910 314 266 --2958 323 1772
NM_033089chr201373 --1136 --
NM_033103chr1921089 953 --1485 --
NM_033105chr81446 ----154
NM_033121chr1231386 663 22 --11857 --
NM_033132chr133529 499 466 --2913 456 --
NM_033133chr1793662 3652 3376 2939 2614 1506 1056 977 969 --53732 3113 2596 1358 959 1949
NM_033222chr9----1355 --
NM_033224chr7147881 7509 7354 6848 6712 6705 5834 5542 2931 2533 2401 1731 1483 261 37132 1678 28 16680 --
NM_033238chr1522479 869 11112 2641 472 21727 614
NM_033272chr2----1351 --
NM_033285chr883514 3123 2727 1156 1069 703 182 85 --14169 11549
NM_033315chr1761980 1867 1782 532 432 207 32040 653 224 11635 --
NM_033360chr1233343 971 584 --2671 22 --
NM_033393chr43988 843 644 22528 2110 41166 761 708 25 --
NM_033420chr194402 353 329 69 --1966 --
NM_033449chr571936 1875 1703 1445 1423 1408 501 --1861 --
NM_033512chr892277 2034 1188 1080 785 682 672 167 89 --42731 1208 157 72 11132
NM_033540chr321113 152 --1319 11033
NM_033626chrX61627 1487 1252 1136 722 343 --11471 1325
NM_033631chr14623 409 374 40 12793 23528 881 1562
NM_044472chr12696 101 --135 --
NM_052840chr1571549 1399 1348 1226 1202 559 471 --11338 --
NM_052876chr1972303 2102 1865 698 637 478 378 2467 372 1216 1459
NM_052885chr1234081 1251 81 11650 34520 537 253 24286 937
NM_052896chr152527 2511 2065 409 119 146 ----
NM_052897chr122790 650 1857 1784 --
NM_052904chr61944 --185 --
NM_052907chr1233084 1705 1508 1632 137 23191 191
NM_052925chr193295 195 52 --3981 811 655 1781
NM_052936chrX2747 350 --1259 --
NM_052937chr8----1641 --
NM_052964chr4--145 --186
NM_052968chr112225 169 163 1153 --
NM_053024chr321392 331 --1125 --
NM_053025chr33655 609 412 --11686 --
NM_053046chr192365 97 --1110 --
NM_054114chr6----2817 307 --
NM_057175chr432451 2352 1842 ----1122
NM_058172chr441485 637 555 502 --1148 --
NM_080546chr911653 --21549 1453 --
NM_080625chr205901 409 224 173 87 11046 11078 --
NM_080669chr1784885 3478 3278 1949 1163 641 529 183 34250 4137 1844 1940 13083
NM_080738chr151626 1262 703 634 28 --11536 --
NM_080744chr7--2638 624 ----
NM_080764chr2273014 2647 2389 984 552 545 539 --1792 --
NM_080836chr20154411 4163 3515 3503 3384 3277 3120 1912 1786 1417 1319 847 545 532 74 --43588 3096 954 474 --
NM_080862chr31879 --31254 1139 430 --
NM_130459chr981585 1436 1246 1173 1161 227 216 206 11332 21515 264 --
NM_130901chr151107 ------
NM_133264chr1773405 2693 2409 1285 943 766 307 --21163 287 13827
NM_133265chrX23477 3229 1941 --11286
NM_133369chr5----1671 --
NM_133452chr1981190 1123 1000 923 842 349 315 196 1799 1392 --
NM_138288chr1432079 1478 1471 --1339 --
NM_138316chr102924 27 --11317 --
NM_138376chr14----1326 --
NM_138471chr11--1442 ----
NM_138473chr12135171 5094 4877 4526 4332 4154 3700 3629 1924 1627 594 529 358 --54757 4366 4070 3982 189 14508
NM_138569chr6----1244 --
NM_138724chr12----1277 --
NM_138764chr19187 ------
NM_138782chr52823 763 --12242 --
NM_138795chr151546 1224 639 563 230 --31602 1016 255 --
NM_138799chr251480 1427 1276 808 384 1688 1187 --
NM_144571chr496832 5932 5522 4818 2484 1537 1207 728 101 1545 21605 429 --
NM_144578chr1455437 4385 3848 3623 450 --24477 147 --
NM_144599chr1575464 5250 4579 3848 3775 1898 664 15376 23941 3576 15059
NM_144631chr21256 ------
NM_144633chr32979 66 --175 --
NM_144974chr132812 670 --1178 1757
NM_145012chr10----1766 --
NM_145056chr19138 ----1109
NM_145113chr1411579 1157 1191 21358 313
NM_145117chr1192642 1215 1065 778 696 444 391 248 193 12070 11152 12633
NM_145251chr141495 --1657 1121
NM_145349chr1792004 1997 1869 1862 1656 1491 674 127 53 31522 1500 615 21837 193 --
NM_145349chr1792004 1997 1869 1862 1656 1491 674 127 53 31522 1500 615 21837 193 --
NM_145798chr173817 664 222 1588 3867 341 213 150
NM_145891chr1621334 604 ----11253
NM_145912chr22114585 4576 3620 3288 3251 3120 1786 1625 872 393 330 24080 3821 44417 3641 1311 1288 13787
NM_147161chr11120 --3942 824 105 --
NM_147190chr121741 1181 ----
NM_147202chr962582 2300 1037 1022 630 288 12417 3879 600 143 --
NM_147223chr252312 1529 641 558 160 --12395 31711 799 745
NM_152237chr2271760 1705 645 631 529 440 136 --21584 221 --
NM_152253chr22114336 3615 3346 2866 2837 1670 962 824 743 507 123 53628 3124 2956 1516 431 --13289
NM_152272chr8----31073 1050 215 --
NM_152277chr51522 --1662 --
NM_152280chr152896 1396 523 479 344 --33070 2733 846 --
NM_152335chr152197 111 ----1133
NM_152342chr163496 199 100 --1370 --
NM_152344chr1721318 625 --2963 375 21508 1308
NM_152346chr175434 142 105 40 28 --1335 --
NM_152348chr171691 --1848 1673
NM_152381chr21351 ------
NM_152399chr4137 --1992 --
NM_152414chr831437 1044 632 ------
NM_152420chr92632 619 --2544 115 --
NM_152424chrX54597 3115 3057 1205 706 13100 2537 162 22942 2867
NM_152470chr1884114 3810 3496 3087 2648 1394 1345 819 --33254 1082 82 11232
NM_152534chr31113 --1163 --
NM_152550chr52393 192 ----164
NM_152553chr6------1189
NM_152608chr182123 2069 2011 1738 875 732 598 591 --2566 516 --
NM_152624chr566428 5971 2908 2494 1116 501 11997 164 1783
NM_152630chrX1994 --11034 --
NM_152641chr1222469 1980 12113 ----
NM_152660chr11811 --1678 --
NM_152678chr332085 1745 1052 --22678 469 --
NM_152694chrX163 --1629 1697
NM_152721chr18----2160 75 --
NM_152727chr162210 38 --176 1194
NM_152739chr7176 1106 ----
NM_152740chr7155 ------
NM_152744chr7143439 3051 2983 2825 2788 2765 2754 2694 2560 2485 2444 2382 942 731 33157 3045 824 --21296 934
NM_152749chr73387 282 74 1121 1748 1300
NM_152753chr641808 1371 421 179 --21528 194 --
NM_152756chr574325 3483 3351 3153 1130 446 406 13476 --13341
NM_152890chr11383 --21165 506 1368
NM_152896chr92800 732 ------
NM_152914chr17174085 3764 3629 3622 3209 3163 3048 2971 2951 2882 1590 1504 1117 1047 862 846 704 32999 1760 1700 33267 2733 1335 13356
NM_153020chr621085 343 --11372 --
NM_153035chr143270 627 184 53 32752 2205 580 22282 444 --
NM_153252chrX143 --1102 --
NM_153262chr153096 2763 1256 1197 566 12977 1672 --
NM_153334chr224783 625 534 92 ------
NM_153371chr133719 585 553 ----12338
NM_153453chr6--1930 2810 70 1877
NM_153487chr684756 4731 4099 3695 3587 1897 1850 379 24460 969 24773 1877 24745 4076
NM_153607chr522040 604 11141 12917 --
NM_153634chr12----1663 11244
NM_153685chr122906 894 --11054 1973
NM_153757chr4------11059
NM_172069chr22954 600 11654 22342 1676 --
NM_172097chr151834 ------
NM_172196chr2----176 --
NM_173354chr2131702 1676 491 ----21776 1392
NM_173460chr20122 ----181
NM_173475chr161123 21758 268 --11435
NM_173500chr1531140 543 283 --21377 915 --
NM_173511chr263945 3797 3623 1520 1513 496 12877 23257 1488 --
NM_173552chr322464 186 --12455 --
NM_173576chr103309 258 146 --1264 --
NM_173582chr1156083 6029 4068 3916 1346 --2817 709 --
NM_173595chr12114473 4201 3915 3813 1867 1852 1627 1602 1407 1157 770 11905 54979 4323 2100 1227 419 34301 3289 1043
NM_173642chr1178654 8571 8488 8409 8092 7646 7624 7272 6232 6013 3120 2174 1475 729 686 547 294 27728 2552 35983 2581 44 37632 3447 2239
NM_173666chr5------1234
NM_173676chr62759 285 1210 ----
NM_173681chr752050 1735 416 136 42 2225 154 21823 479 2318 51
NM_173698chrX41364 621 537 398 ------
NM_173808chr143567 3201 584 128 ----3646 618 479
NM_173814chr15----1429 --
NM_173822chr22469 245 --1257 --
NM_173825chr31812 --22491 557 1511
NM_173829chr584789 4731 4668 4434 4337 1758 1668 270 --24616 663 --
NM_173833chr841093 1053 281 94 11215 1508 11518
NM_173834chrX2410 76 --1432 --
NM_173851chr863353 3257 3246 2644 1075 936 12629 12723 13687
NM_173854chr141829 954 848 821 22054 1594 2799 632 1266
NM_174921chr421031 803 --2865 173 --
NM_175058chr1151312 1174 536 460 384 ------
NM_175061chr71462 --12213 --
NM_175069chr91754 --1140 --
NM_175709chr2252948 2857 2785 2590 2467 12071 12125 --
NM_175733chr1141964 1677 230 144 11609 22182 625 1492
NM_175736chr12177748 7657 7615 7435 6454 6297 6266 6205 5322 3137 3021 2993 2839 2832 2534 1939 1669 --22972 899 37119 5356 189
NM_175839chr201252 --178 1271
NM_175852chr143089 2340 675 634 1893 63014 2933 1903 1140 1114 705 11078
NM_175856chr5125 ------
NM_175875chr193211 130 23 1187 1634 1679
NM_175898chr1561574 1290 1283 1258 513 281 --2342 251 --
NM_176792chr1031429 151 67 1204 ----
NM_176795chr111371 --137 --
NM_176823chr163416 3379 2400 577 561 71 41353 1134 210 24 53849 1516 254 229 51 --
NM_176871chr882914 2557 2342 1261 620 488 370 220 11227 42429 2285 846 576 --
NM_177424chr111579 --1236 --
NM_177454chr23119 50 30 ----2357 342
NM_177539chr12782 360 2714 82 ----
NM_177999chr942790 2733 2687 135 12372 43507 2947 1282 499 --
NM_178013chr1471966 1205 845 708 363 129 112 --42915 1190 571 514 --
NM_178126chr17111980 1738 1585 879 842 691 684 551 544 387 146 12243 41744 1567 519 370 --
NM_178135chr451149 1142 1015 1008 513 --1220 --
NM_178423chr7----11232 1253
NM_178496chr3----1190 --
NM_178500chr172764 613 --3691 554 204 --
NM_178502chr123529 522 62 ----140
NM_178553chr2------1170
NM_178565chr821691 1677 ------
NM_178818chr1651844 1655 1629 813 390 --1553 --
NM_178830chr193718 581 83 --1114 --
NM_178835chr41788 1658 2576 554 --
NM_181358chr161676 1631 1591 1104 334 168 24016 2628 33715 3685 2810 11414
NM_181491chr9113018 2689 2621 2511 2398 2349 2252 2209 1237 772 302 --42861 2458 846 67 --
NM_181504chr563572 2675 2563 1383 870 51 --14111 14072
NM_181645chr11----126 --
NM_181670chr1241178 312 74 32 ------
NM_181671chr171130 --1109 --
NM_181672chrX11375 --1155 --
NM_181704chr21----1998 --
NM_181712chr162070 1923 1663 840 184 39 --12110 --
NM_181782chr642072 1877 351 96 --1115 --
NM_181784chr252395 829 343 303 118 11905 ----
NM_181836chr51398 --21894 1795 --
NM_181844chr1722017 281 1375 41633 182 68 31 --
NM_181877chr1551310 1171 1164 1139 287 --21588 90 1451
NM_182488chr132271 34 ------
NM_182509chr1431588 1088 135 1397 31554 1524 1513 --
NM_182526chr14113103 2802 2659 2589 2203 2056 2036 1974 1906 1208 601 --33086 3020 2939 12139
NM_182546chr7----1161 --
NM_182580chr162591 2181 1710 999 552 39 1231 11966 --
NM_182663chr141878 1532 911 832 11707 32186 1564 296 --
NM_182757chr663510 3383 2793 2605 750 707 1146 42962 532 112 83 --
NM_182765chr1042019 1681 84 61 ------
NM_182767chr12----21877 432 1384
NM_182830chr1421825 659 ----1825
NM_182970chr2064163 3449 3316 1700 699 537 22613 1658 64112 3908 1451 1164 338 173 1964
NM_182975chr1------1885
NM_183376chr1542198 847 489 64 ------
NM_183416chr111693 --1364 21501 1464
NM_194247chr224084 3317 --11654 --
NM_194285chr1122372 353 ----161
NM_194286chr12176217 6046 5361 5150 4462 2439 2322 2121 1952 1930 1760 1745 1616 1325 860 76 50 36159 837 188 24506 1086 12024
NM_194314chr164248 4183 3913 1975 515 148 ----11098
NM_194318chr132634 337 11624 21749 114 --
NM_197939chr1731160 197 57 --3446 425 371 --
NM_198513chr81568 1260 1141 1215
NM_198526chr153944 715 258 --1271 --
NM_198686chr1472603 958 743 713 502 420 45 12563 32050 927 793 --
NM_198859chr384326 4296 3435 1972 1953 1525 1032 525 14209 13197 14303
NM_198867chr192148 24 ------
NM_198965chr121344 --1122 --
NM_199000chr7----1506 --
NM_199054chr1951664 708 657 626 544 --21524 1390 --
NM_199072chr711190 --1277 11217
NM_199141chr192654 394 --1673 1362
NM_199262chr1772037 688 611 559 484 437 244 --1941 --
NM_203301chr141302 ----11530
NM_203446chr2122512 428 1775 31973 675 167 1222
NM_205833chrX4834 827 815 762 --1714 --
NM_205848chr122835 1852 2705 495 1321 --
NM_206853chr663860 3464 1514 1118 623 72 --11244 --
NM_206914chr1251894 1466 900 488 81 1230 22147 1881 11562
NM_206996chr1--130 ----
NM_207043chr162279 2193 1717 776 463 430 1549 12083 --
NM_207303chr1043873 3822 3080 389 1766 ----
NM_207325chr1911674 ------
NM_207356chr11505 ------
NM_207396chr16649 481 345 338 209 202 --1177 --
NM_212464chr1561456 758 365 238 153 78 21679 707 21824 768 --
NM_213589chr285336 4937 4540 4147 4140 3807 320 90 ----14431
NM_213606chr101194 --2621 101 --