TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-654-3p
miRNA Sequence: UAUGUCUGCUGACCAUCACCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr571941 1788 1471 1271 793 321 58 ------
NM_000052chrX73366 3331 3168 1387 381 235 168 ------
NM_000092chr294252 3297 2964 1506 1275 1173 1030 954 869 13979 ----
NM_000125chr653446 1276 364 314 30 --23178 2643 --
NM_000176chr531152 1086 1048 12928 11255 11549
NM_000216chrX63854 1315 1238 810 201 67 --13209 13668
NM_000217chr12105257 5014 4665 4375 3767 3583 3365 1930 921 519 --12128 14619
NM_000332chr686732 6609 6137 5836 5194 4900 1805 1295 21425 653 24504 245 --
NM_000337chr5156435 6134 5500 5287 4684 2184 2046 1595 1528 1510 1065 491 388 57 21 14223 14271 22508 617
NM_000428chr1452272 2026 693 352 52 --22455 1040 21911 1896
NM_000461chr384147 3839 3787 3056 2908 1805 1251 140 11446 --14593
NM_000486chr1283001 2971 2524 2233 1181 1138 1032 780 --11118 1866
NM_000555chrX107783 7540 7108 6381 6297 5674 5436 5342 1835 642 15977 67396 5198 1552 1516 1230 665 --
NM_000618chr1286331 5433 5120 5054 4975 4216 1082 636 1720 35568 4235 4098 12581
NM_000702chr1102206 2092 1786 1756 1666 1543 679 659 584 207 --125 --
NM_000724chr1061628 1600 1259 737 560 357 --1410 --
NM_000788chr451126 219 203 39 21 11430 ----
NM_000806chr531952 1924 1205 1343 21654 762 --
NM_000814chr1553489 906 451 104 92 --23102 1530 --
NM_000875chr15126151 4762 2814 2655 2087 1814 1806 1626 920 746 648 526 --11238 --
NM_000891chr1753088 2894 1316 1219 282 --23161 2487 --
NM_000899chr1273572 3044 2973 1293 1263 784 389 11732 --14168
NM_001001331chr362710 1780 993 893 592 79 1678 1285 --
NM_001001419chr5125019 5005 4162 3375 3327 3296 3170 1714 1350 664 613 72 --24027 99 --
NM_001001436chr161616 ----1671
NM_001001665chr242986 2544 1242 1166 23196 2921 12704 11100
NM_001001890chr2174120 3231 3127 3094 3015 2887 1035 --2788 764 --
NM_001003406chr22103039 2886 2806 2544 2360 2207 2084 652 271 74 ----1277
NM_001003712chr1253935 2637 2569 423 223 2479 346 12974 --
NM_001003800chr953124 1263 886 639 624 ----13690
NM_001004317chr673649 3086 1666 1578 559 293 140 11613 ----
NM_001004356chr4111431 606 481 444 333 313 279 168 125 79 43 1143 6948 580 549 461 432 259 --
NM_001004419chr1293128 3112 3041 2877 1285 608 602 415 24 11667 21688 461 164
NM_001005502chr1264698 4193 3735 3584 1940 750 --24234 1287 --
NM_001005845chr821378 172 --21787 1514 --
NM_001008408chr7106210 6150 4984 4475 4448 2400 2092 705 684 291 11102 11259 --
NM_001009899chr396508 5968 5342 4905 2569 1990 1469 694 162 15612 46323 2252 1604 72 --
NM_001010867chr195825 5028 4984 4753 2122 1568 1175 869 184 12527 26176 2207 --
NM_001010891chr576097 5609 5592 5222 4962 4768 856 14457 22640 1729 --
NM_001010922chr174012 3661 3493 2758 2640 1536 298 22852 505 ----
NM_001011666chr786076 5889 5705 4246 4064 2259 1692 474 16107 14825 --
NM_001013399chr63946 246 232 1813 1719 1238
NM_001014797chr10117568 6658 6557 5777 5747 5487 5144 2630 1845 930 264 24994 1744 17330 15628
NM_001015877chrX62774 2740 791 593 278 42 --12947 --
NM_001018064chr94392 354 178 45 11684 1509 11754
NM_001024948chr163343 3003 2367 1206 1194 932 ------
NM_001024948chr163343 3003 2367 1206 1194 932 ------
NM_001025076chr1095328 4935 4499 4391 1309 697 536 291 48 1592 ----
NM_001025077chr1096686 6293 5857 5749 2667 2055 1894 1649 1405 11950 ----
NM_001025252chr862904 2743 2552 2316 2049 259 11153 12212 --
NM_001025366chr651824 1783 1633 713 336 --11455 11873
NM_001025580chrX74268 4072 2792 1144 1052 981 856 --21346 1197 --
NM_001030007chr1651259 611 564 513 469 1865 12601 13875
NM_001030055chr1473717 3475 1877 819 647 98 52 ------
NM_001031695chr22123962 3650 3415 3354 1682 1574 1174 1161 715 511 397 357 11352 13404 13773
NM_001031804chr1673997 3538 3290 1529 1221 997 960 --13633 --
NM_001033045chr233771 3750 3611 --33197 2934 2807 --
NM_001033507chr171707 461 388 376 270 234 226 ------
NM_001034954chr104992 700 500 180 --12509 13167
NM_001037165chr7148706 8247 7974 7445 7258 7121 6678 6081 3381 628 445 392 207 87 --28811 840 --
NM_001037174chr241855 515 295 256 186 21632 393 --
NM_001040101chr461547 1489 1157 980 321 62 --21275 1167 --
NM_001040152chr794838 4731 4715 4398 4392 1596 1006 659 103 --24379 3544 --
NM_001040202chr452204 1719 702 667 575 --2762 528 --
NM_001040429chr1363526 3399 2668 2541 651 22 23332 949 12546 --
NM_001040450chr1542404 2136 1011 859 12217 22786 699 12017
NM_001042555chr1233406 3298 817 33985 3815 3285 24330 686 11612
NM_001042599chr297290 7234 6591 6322 5183 2358 2156 2009 1065 27555 1731 --14921
NM_001042601chr372705 2530 2438 2300 2147 2018 72 1299 ----
NM_001042604chr333895 359 145 23258 1902 13917 --
NM_001106chr398605 6964 6718 6596 3229 2779 2527 1062 236 26342 3601 29500 2537 --
NM_001204chr2127708 7446 6851 6705 5933 5795 5349 3090 2841 872 805 482 16467 26310 4962 --
NM_001364chr1184322 4271 4262 3750 3650 3397 1006 197 14775 11838 --
NM_001419chr1984703 3810 3406 1674 732 661 494 411 1231 13395 --
NM_001420chr19142252 2166 1148 1117 1030 1022 915 897 866 843 833 808 533 103 12057 --11089
NM_001423chr1231536 1488 403 --21419 539 11836
NM_001627chr35938 748 658 589 92 32007 714 81 ----
NM_001650chr1883644 3371 3184 2612 1412 1192 1154 26 22652 972 ----
NM_001655chr1172121 1992 1724 1701 794 586 181 --2818 629 --
NM_001695chr884213 3570 3558 3390 2815 2768 1675 927 1398 11173 13152
NM_001858chr684554 4402 3819 3784 3771 3762 3592 1296 11835 1130 --
NM_001969chr1463714 2810 2668 1501 1212 168 43898 3728 2731 927 1410 --
NM_001987chr1273742 3301 2891 1303 850 379 172 --11726 --
NM_002015chr1353226 2430 792 740 174 22684 2078 12644 --
NM_002025chrX189267 8063 7919 7265 7112 6420 3413 3341 3258 2710 2657 2539 2239 1617 1605 1376 714 395 25920 1723 26779 3545 --
NM_002126chr1753642 3524 3031 2896 667 31565 1500 109 --11471
NM_002137chr762391 2178 1879 1731 1577 1488 1427 ----
NM_002221chr162553 2386 1974 1152 982 602 ----21832 948
NM_002264chr395010 4605 4191 3978 3635 3316 3178 1809 1037 14042 1592 --
NM_002270chr555181 4394 4188 3769 1440 21519 1071 1874 --
NM_002310chr545717 4002 1442 1009 --26152 1860 15939
NM_002581chr994914 4776 4230 4016 3665 3541 1965 1066 546 33888 3694 1292 14896 15520
NM_002655chr875290 5077 4114 2097 1561 1501 1013 13626 14646 --
NM_002834chr1283754 2743 2581 2551 1332 252 224 75 13270 ----
NM_003051chr131834 628 105 --21420 456 --
NM_003298chr395858 4905 4857 4371 4321 1757 720 575 147 --45449 4131 2142 840 --
NM_003320chr1194434 4206 4143 3859 3652 3351 1694 1397 918 1340 14398 --
NM_003583chr1273674 3350 3112 2981 2965 894 333 13585 ----
NM_003590chr263750 3735 3641 3200 813 467 --21292 1211 --
NM_003822chr172990 2054 1149 726 317 257 135 1153 ----
NM_003884chr361746 1648 1446 1164 190 85 --1164 --
NM_003913chr654231 3398 2973 1292 919 ----11043
NM_004090chr1783259 3138 2767 2385 2362 1150 1138 1061 --11143 --
NM_004113chr361935 1894 1492 1317 746 322 11574 ----
NM_004124chr1452953 2863 1123 706 303 ----162
NM_004171chr11139176 8175 5912 2554 2082 1955 1743 1720 1254 936 761 339 168 ----27077 6775
NM_004227chr793127 2879 2718 2089 1932 1148 740 390 370 --12867 1521
NM_004397chr1153907 3605 915 859 498 --1132 --
NM_004612chr974876 4821 4110 3581 3502 3326 1121 --13472 --
NM_004745chr8116984 5384 4778 4367 1961 1518 1166 556 434 428 135 ------
NM_004748chr1543303 2649 1071 928 14120 33537 3138 2973 11612
NM_004852chr182513466 13446 13189 12987 12383 12310 11908 11761 11728 11501 10873 10389 9810 8969 8865 5119 4423 3916 1846 1634 1443 1306 924 241 52 12619 414244 11664 4203 635 19799
NM_004985chr1273744 3501 3432 3046 1565 1276 485 24335 30 24081 2926 13464
NM_004992chrX157938 7232 5746 5457 3162 3133 3106 1934 1865 1532 1314 809 316 300 286 --12159 --
NM_004999chr673576 3504 3288 2815 2760 1362 478 --1489 --
NM_005057chr141864 490 249 243 --11884 --
NM_005312chr982536 2447 2319 2241 2186 2050 1994 224 --22667 2452 --
NM_005359chr18126229 5165 4414 4210 2122 2097 1945 1476 1409 1254 682 152 180 24852 203 --
NM_005385chr362346 1055 956 936 831 116 --1174 12218
NM_005436chr10103771 3106 2858 2835 2679 2629 1479 958 561 195 1531 ----
NM_005578chr3104652 4600 4572 4481 3630 3321 1177 839 748 691 --23242 1616 --
NM_005585chr153409 396 98 --1113 1283
NM_005596chr994696 4572 4547 3971 1666 1631 1394 1208 1023 11469 11337 15803
NM_005647chrX52472 1117 756 733 244 --13296 33285 2891 1066
NM_005748chr1262937 2724 1352 1048 403 90 --12729 --
NM_005759chr284274 4049 3528 3431 3381 2945 1324 807 --1864 --
NM_005941chr843907 3479 2888 2597 33489 3171 1331 11139 13537
NM_005955chr174395 4202 1732 1674 1659 1553 49 --21985 1443 1131
NM_005964chr1761511 1471 1427 1137 393 195 --11253 --
NM_006141chr1652542 2467 2027 1119 779 ------
NM_006282chr2041840 1443 813 787 24631 4110 --11436
NM_006330chr811584 1373 --11185
NM_006393chr1044022 1228 623 131 13417 34332 3592 3092 13439
NM_006540chr871354 554 527 381 291 217 126 --11139 --
NM_006546chr1775746 5047 4169 2653 2475 2207 1612 14544 --14233
NM_006599chr1698219 7001 5596 5520 5461 2707 2231 1804 568 26973 6388 18136 16271
NM_006717chr973291 2700 2502 2085 1181 445 239 159 ----
NM_006729chrX65392 4614 4391 3893 2022 1467 25673 1757 1757 --
NM_006750chr1687073 6763 5296 5034 2562 1880 1590 476 25536 335 36197 1282 189 --
NM_006777chrX52755 2535 1826 734 570 11923 ----
NM_006788chr1841819 1403 630 228 --22024 2008 11439
NM_007007chr1243726 3296 3186 1128 11853 --1766
NM_007050chr20146782 6250 6173 5958 5428 5280 2981 2899 2358 2134 2091 1870 1584 1355 --1504 27968 1656
NM_007249chr13209421 9367 8473 7909 7855 6992 6751 6525 6002 3410 2781 2491 1894 1835 965 938 901 839 586 552 47867 2973 1722 1251 38598 316 245 19252
NM_012134chr171851 1657 1327 1154 610 592 472 --1647 --
NM_012156chr2052856 2769 868 440 280 3178 172 162 ----
NM_012262chr194585 4540 4114 4086 3464 1097 1010 808 134 25116 4832 1191 --
NM_012287chr374010 3329 3293 1375 297 240 107 --23996 3265 13081
NM_012316chr195565 5497 3977 3468 1893 1271 453 299 180 15640 --15525
NM_012464chr442825 692 305 76 32687 370 54 12872 --
NM_013255chr798272 7988 6771 5561 5503 2856 2659 2547 723 --36085 1122 1079 --
NM_013261chr432977 1044 989 --23542 2850 --
NM_014016chr3----1512 2669 429
NM_014028chr632814 2792 287 1871 12647 22471 208
NM_014048chr16105320 4774 4651 4417 3576 3444 1713 1048 779 395 ------
NM_014117chr1652544 2480 1801 1749 217 --1224 --
NM_014586chr2174736 4561 4369 1537 1465 1128 858 2928 904 14509 --
NM_014630chr1583392 3328 3059 1600 1568 831 683 407 --22667 780 --
NM_014686chr1952501 2279 1985 1975 364 ----1542
NM_014707chr741992 1526 758 157 11504 --1106
NM_014755chr2103957 3854 2912 2889 2709 2643 1503 1247 782 484 --14169 --
NM_014772chr18103318 3294 3247 3205 2941 2571 849 522 150 122 --12472 12364
NM_014783chr1531374 1175 647 --1507 11627
NM_014803chr1052934 2861 2368 2260 1155 --22426 80 --
NM_014877chr1785875 5688 5495 5272 4757 2860 1620 629 27446 1994 46179 6045 4841 1800 21780 643
NM_014906chr1793863 3693 3343 2965 2587 1593 943 933 73 ----12593
NM_014920chr653622 3608 3555 350 139 --1459 --
NM_014935chr183620 3416 2919 2855 2738 2622 1263 371 --22563 1255 --
NM_014946chr232877 2123 930 --22772 594 --
NM_014947chr172945 2565 2250 1259 1241 1146 312 --11189 --
NM_014953chr1363911 3078 3022 1731 1465 688 31707 1696 803 1127 --
NM_014982chr1484176 3445 3413 3389 1602 740 51 23 25267 781 --1507
NM_014989chr631769 1605 97 11803 165 --
NM_015042chr1573543 2760 2751 1546 943 668 85 --12691 11101
NM_015071chr5116124 5705 5660 4704 4111 2116 1994 1870 1511 500 345 15844 25476 2065 --
NM_015074chr174930 4611 3441 3299 514 415 290 --11947 11435
NM_015275chr1251765 1427 754 704 613 ----11977
NM_015313chr1174760 4754 4191 1348 1217 911 766 --14070 13576
NM_015317chr23986 916 580 --22400 855 12034
NM_015393chr463228 3114 1301 1086 930 819 43820 3421 3341 3136 12422 12538
NM_015455chr593574 3319 3064 2551 1591 798 772 206 171 ------
NM_015852chr753655 2643 2587 2580 2325 ----13205
NM_015898chr1941970 1857 471 398 1971 21529 115 1144
NM_016297chr252813 1350 1112 570 512 1555 22550 93 --
NM_016356chr652718 1072 744 241 156 12387 11864 1462
NM_016441chr252218 1744 1493 516 272 22317 244 1830 --
NM_017580chr1042085 706 301 33 --32253 622 412 --
NM_017628chr444981 1885 1534 557 24898 4712 14239 1545
NM_017633chr653828 3163 1176 742 41 1767 1458 --
NM_017637chr9119019 8069 7261 7169 6005 2862 2495 1442 1428 1208 624 1733 27434 1955 --
NM_017644chr364726 4364 4312 1700 860 404 --1561 --
NM_017658chr1463973 3385 3031 1182 989 310 13418 1660 1918
NM_017693chr1351197 383 370 194 144 ----1184
NM_017919chr995575 4738 3771 1897 1347 1185 1007 900 443 ------
NM_018243chr464037 3908 1080 955 732 503 14069 ----
NM_018717chr452058 1829 1027 565 541 --12238 12631
NM_018841chr122508 835 13029 23691 1170 13552
NM_018844chr741902 1886 1807 1424 ----1175
NM_018999chr1064278 4093 3785 1155 1037 250 ----13891
NM_019072chr563345 3217 3131 3007 1633 172 12636 14211 --
NM_020119chr7153585 3524 3518 3483 3221 2841 2806 1556 1092 840 786 488 393 236 72 --33198 3022 883 --
NM_020122chr255640 5120 4644 3890 21 --24656 2192 --
NM_020338chr10103692 3045 2816 2792 2599 2554 1295 1230 777 731 --22748 1256 --
NM_020357chr351247 566 297 245 197 ------
NM_020440chr183254 2682 2294 2203 1270 1022 840 478 --32035 1059 169 --
NM_020728chr763008 2376 2130 974 803 152 --12973 174
NM_020772chr1767926 5629 3200 3168 2050 1866 22174 824 ----
NM_020774chr1886278 5924 4266 1812 1208 1161 687 491 25794 339 11832 --
NM_021038chr372973 2194 2124 871 842 554 132 3909 894 406 12795 --
NM_021097chr262972 2417 1962 1181 990 201 22373 1191 ----
NM_021638chr4144764 4526 4400 3854 3517 3319 1979 1958 1865 1858 1357 637 562 300 11193 24030 3174 11530
NM_021813chr6145831 5436 5222 5156 4978 4878 4438 3962 1417 1178 1119 1048 828 215 15859 23605 1241 --
NM_021961chr1197443 7079 6677 6581 5348 1508 1063 374 26 --25822 2567 --
NM_022058chr241669 328 281 266 ----1696
NM_022166chr16146025 5989 5832 5508 4973 4366 4062 2203 1994 1977 1581 1183 1044 993 --1308 --
NM_022459chr1375606 5018 5007 4963 4299 2096 571 13892 21214 283 11371
NM_022648chr2114568 3752 3291 3005 1587 1307 992 959 924 680 489 11630 ----
NM_022841chr1552340 2154 2111 725 424 2396 42 1761 --
NM_022912chr262571 1981 732 669 600 345 --22267 1116 --
NM_024607chr8103856 3837 3589 3553 3352 2817 1399 1298 356 40 --1659 --
NM_024947chr3178659 8460 8328 7749 7210 3488 3182 2996 2636 1716 1708 1559 1491 1223 981 717 699 38003 1159 510 48818 7577 6482 1589 --
NM_025054chr852892 1531 1429 1404 492 --12761 --
NM_025160chr173808 3681 3483 3016 970 840 813 --21243 103 11133
NM_025191chr183307 2849 2672 2474 2421 1359 321 65 --11154 --
NM_030621chr1483931 3919 3736 3693 2893 1310 846 755 11020 ----
NM_030647chr746061 4301 4053 1263 14155 14041 25153 5137
NM_030918chr175349 5184 3600 884 722 116 34 13759 34472 3751 2105 21183 685
NM_031483chr202416 338 13043 1350 12489
NM_032208chr273453 2658 2588 1103 814 711 540 13351 2794 172 --
NM_032373chr1075726 5708 4490 2267 1556 649 602 --25103 1882 --
NM_032457chr443282 2876 2828 451 11044 13223 1469
NM_032458chrX73104 3070 1121 923 608 372 250 --13277 --
NM_032682chr363083 2672 2556 2545 2526 2208 --2894 794 --
NM_032777chr82592 181 ----11380
NM_032859chr1353122 2920 1004 336 262 --13412 --
NM_033224chr7127810 7188 7003 6525 6202 5846 5483 5035 3097 2747 735 174 36533 6424 2633 26871 3115 1855
NM_033285chr894225 3803 1765 1132 865 689 335 309 136 --23325 672 --
NM_033389chr17124716 4705 4340 4046 4036 3521 3408 3127 1284 595 448 337 1729 24811 3712 --
NM_033505chr286510 6145 4317 2640 2332 1653 824 493 12303 195 --
NM_033656chr2195672 4960 1685 1547 1510 1471 1437 1395 287 --15853 --
NM_052907chr1233101 2678 1491 22894 417 34040 3952 293 --
NM_052937chr82622 533 ----12212
NM_130386chr18------2424 416
NM_130847chr11104583 3634 2340 2153 2076 2054 1942 1432 1094 341 22283 743 --15099
NM_133264chr1732986 1240 1233 ----12459
NM_133493chr664128 3740 3371 1717 1598 1246 23796 3248 --13101
NM_133646chr274903 4508 3529 1499 1487 1274 561 --15219 14964
NM_138444chr1364615 3643 3546 3309 3207 3175 --34806 4592 3836 11052
NM_138468chr275963 4141 4059 1661 1346 139 37 --15376 11026
NM_138473chr1284718 4352 4097 4003 3879 930 901 80 2444 27 ----
NM_138959chr1106256 6169 5845 5663 4821 4146 2529 2203 1711 1321 156 --15038
NM_144571chr456892 6745 5049 4281 2099 --24979 986 --
NM_144578chr1494531 4188 4143 3968 3518 1746 1499 476 189 14698 23932 1061 --
NM_152253chr22103917 3602 3267 3205 3117 2825 2634 1692 952 435 --24027 1372 --
NM_152409chr543388 2840 2615 2318 ----13252
NM_152455chr1552623 2363 2165 2107 1098 12490 22778 701 --
NM_152624chr567395 6677 6625 2792 725 126 15918 --15715
NM_152754chr753468 1071 819 754 461 ----1409
NM_153207chr1274120 3977 2941 1562 1436 1156 478 12881 ----
NM_153619chr1583346 3042 2980 1099 991 798 715 82 12363 ----
NM_170665chr1284442 4386 3598 3076 2854 1603 1578 1022 --44590 904 773 321 --
NM_172071chr177381 6427 6026 5745 2335 517 322 ------
NM_173495chrX42467 2069 1596 227 --21869 113 21654 928
NM_173531chr1943451 1258 1173 776 13072 21457 1115 23596 131
NM_173602chr1253646 2397 1012 482 208 23727 3594 13308 --
NM_173851chr893298 3175 2767 1321 1140 923 885 803 793 --11551 13563
NM_175854chr1392525 2234 1790 970 761 743 675 374 27 ------
NM_175861chr1285324 5160 2363 1713 1513 856 334 141 --1901 11553
NM_181836chr542352 1954 1816 615 --12209 12103
NM_182487chr9114449 4409 4151 3852 3056 1601 1389 1168 1138 335 277 --12818 --
NM_182503chr664188 3991 2226 2117 1844 306 1679 ----
NM_182734chr2042190 1315 979 216 12120 11109 --
NM_201613chr121130 --1715 1206
NM_203406chr542917 2709 767 356 ----1457
NM_206855chr675855 4213 4168 2037 1062 899 467 34967 4624 2359 22115 682 1572
NM_207406chr476453 6075 4707 2594 2525 568 381 1482 11342 --
NM_213589chr265222 4592 4551 2169 1002 769 35411 5398 299 24170 657 --