TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-654-5p
miRNA Sequence: UGGUGGGCCGCAGAACAUGUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000074chrX2781 238 --2848 75 --
NM_000088chr1781131 1120 1112 1105 504 494 285 33 --21204 515 --
NM_000090chr2--2776 180 1317 1342
NM_000188chr105698 502 194 64 22 ------
NM_000217chr1265177 3550 1916 651 279 33 21963 773 11332 --
NM_000230chr752545 2431 1858 1746 313 2265 215 1230 --
NM_000238chr7----132 --
NM_000245chr751672 740 600 587 30 12023 ----
NM_000260chr111206 ----164
NM_000278chr10131894 1844 1430 927 842 825 712 531 441 258 241 130 71 1317 22136 226 1338
NM_000278chr10131894 1844 1430 927 842 825 712 531 441 258 241 130 71 1317 22136 226 1338
NM_000304chr17----1423 --
NM_000319chr122995 375 --132 184
NM_000362chr2252305 375 355 225 185 2835 381 22812 984 --
NM_000425chrX6717 592 554 249 140 71 3656 449 127 2724 604 --
NM_000461chr364097 3210 2890 1323 381 293 1268 21821 1465 --
NM_000503chr811389 1542 11837 --
NM_000530chr16411 404 363 300 284 208 --1446 --
NM_000539chr331516 171 43 2200 78 31246 1188 1097 --
NM_000555chrX127657 7568 6981 6055 6002 5759 2760 2577 2166 1998 1447 330 --36786 5166 2532 --
NM_000599chr2134132 4059 3642 3473 3315 3192 3170 1399 1378 1251 73 38 28 64075 3565 3487 3220 1683 1391 44184 4064 3159 3105 --
NM_000612chr11113461 3444 3177 3089 3030 1534 1488 845 818 502 145 12534 33746 3060 2922 --
NM_000660chr195205 199 71 44 24 --1110 --
NM_000678chr205865 807 617 567 298 1604 --1687
NM_000723chr17111703 1318 1229 1222 686 679 476 283 260 233 68 --11168 --
NM_000725chr1241008 644 287 186 1335 157 --
NM_000767chr1951262 465 304 291 53 ------
NM_000787chr94888 869 215 48 --1580 --
NM_000809chr456058 5869 3555 3092 722 --15903 --
NM_000828chrX31763 863 730 --1438 --
NM_000832chr95872 724 714 556 332 --5718 138 134 108 88 1753
NM_000836chr1910941 914 770 744 693 638 322 122 64 21 1926 1235 --
NM_000841chr63809 776 755 --5841 833 800 780 767 --
NM_000875chr15206580 5852 4836 4817 2795 2672 2375 2058 1940 1715 1696 1558 1488 1476 1349 1026 976 450 429 136 12224 44628 2151 1330 980 --
NM_000924chr1291336 1295 1155 428 371 182 171 120 81 --1251 --
NM_000966chr124817 758 434 109 1224 1420 --
NM_001001132chr2131272 1200 303 2421 55 ----
NM_001001323chr1232406 892 165 12112 --1262
NM_001001396chr173738 1786 1138 770 591 342 65 13084 14505 --
NM_001001396chr173738 1786 1138 770 591 342 65 13084 14505 --
NM_001002909chr1772030 1920 1912 1740 1712 551 268 --1418 --
NM_001003652chr1878498 7134 2582 2374 1610 941 450 --13213 --
NM_001003674chr18126906 6468 6443 5026 4916 2598 2442 2397 2347 1798 1397 1222 25830 4410 16091 --
NM_001003800chr923706 1378 --11462 --
NM_001004304chr1273079 2952 1279 1153 800 732 105 22863 80 12911 --
NM_001005271chr1741100 1039 97 88 1201 ----
NM_001005404chr1761391 1341 1242 318 132 31 --1295 --
NM_001005415chr191436 --1382 --
NM_001005505chr391662 1642 646 525 386 210 81 59 32 11594 11420 1547
NM_001005609chrX53550 3355 3216 2319 606 22453 1066 2849 700 --
NM_001005739chr21856 ------
NM_001006115chr3122748 2689 2660 2439 2431 2346 1956 1035 999 724 542 442 22390 689 22777 401 --
NM_001006944chr113591 120 58 --1718 1447
NM_001007271chr102388 178 2950 379 1822 --
NM_001007279chr223591 234 149 1898 1318 --
NM_001008567chr91338 --1287 --
NM_001008701chr1962941 2701 1088 738 409 327 22056 205 1304 --
NM_001009813chr193395 95 69 --2166 124 --
NM_001009880chr22134550 4526 3553 1396 1255 1110 979 950 934 583 419 242 228 1636 63990 1901 1369 232 74 66 --
NM_001010924chr10----11088 --
NM_001011538chr41171 --1778 1272
NM_001012264chr147739 712 394 386 352 262 221 --1302 --
NM_001012393chr1174916 3853 1164 1018 879 834 487 33245 861 630 11458 --
NM_001012426chr6233156 3132 2612 2485 2451 2286 2141 2134 1300 1196 1181 1086 968 901 746 686 680 640 509 497 437 186 62 43295 3185 977 317 2956 624 --
NM_001012514chr23780 289 254 --3896 192 151 --
NM_001012643chr192374 124 --179 1518
NM_001012761chr551868 1649 991 671 496 21056 139 --11085
NM_001012977chrX5513 213 183 69 47 3224 95 87 2507 217 --
NM_001013031chr1042758 2422 1108 1010 2945 671 12784 --
NM_001013615chr14796 786 470 285 --11166 --
NM_001013620chr1277958 7293 6345 5996 3066 2908 2895 --11072 12972
NM_001013635chr1221119 267 --2886 253 --
NM_001013640chr19159 --2870 217 1363
NM_001013693chr1132642 2489 2464 2447 2159 2091 1880 1860 1837 1104 892 714 240 32323 2252 1977 3958 886 836 --
NM_001014797chr10197997 7879 7707 7660 7533 7067 5568 2886 2847 2813 2408 1981 1835 1802 1793 1751 1054 786 42 47888 7168 2398 103 16283 --
NM_001015881chrX2913 159 1951 ----
NM_001017368chr173382 359 353 ----12054
NM_001017395chr32534 29 32287 452 342 12647 --
NM_001017440chr7146609 6267 6004 5946 5893 5595 3236 3132 2912 2652 2098 597 516 497 46524 2893 1986 1005 57283 3013 2541 696 36 16311
NM_001017999chr142060 1432 545 28 --11527 1729
NM_001018050chr2273187 2963 2830 2498 2374 1308 1229 41235 515 159 28 13302 1138
NM_001018064chr911465 1847 --1409
NM_001018108chr1572183 1915 1760 915 909 513 90 31512 341 62 31605 646 244 --
NM_001024226chr15912 753 721 468 294 1846 1881 --
NM_001024401chr1692685 1800 1097 1082 864 837 781 478 433 12636 42644 1864 1853 44 --
NM_001025076chr1095705 5255 5184 4764 2185 2000 1332 1324 575 35401 5193 1377 14147 --
NM_001025079chr311647 ----11483
NM_001025232chr12----1336 --
NM_001025366chr641189 583 520 344 155 ----
NM_001029858chr652373 1263 490 405 189 12832 --156
NM_001029863chr662858 2841 2193 2122 2000 1028 --21118 1004 --
NM_001029864chr2062089 1953 1568 1008 824 342 1737 22174 721 --
NM_001029882chr15173 163 153 124 83 ------
NM_001030007chr1663733 3488 2752 923 260 33 23797 896 11535 --
NM_001031690chr773050 2840 2126 2064 1990 877 35 22764 1192 33036 2159 1971 --
NM_001031696chr191259 --1253 --
NM_001031738chr23402 390 43 --2415 149 --
NM_001031740chr131733 1427 239 1268 11211 --
NM_001031812chr51913 ----1239
NM_001032293chr171663 1526 ----
NM_001033081chr12617 286 ------
NM_001033503chr5----1402 --
NM_001033561chr173837 319 38 ----1349
NM_001033677chr123352 156 72 --1143 1307
NM_001034852chr1451913 1651 717 489 81 ----1121
NM_001037324chr31312 1211 1569 --
NM_001038702chr522185 477 --141 --
NM_001039141chr22102374 2281 2252 961 818 807 796 540 262 93 32472 2245 126 ----
NM_001039538chr232961 723 400 ------
NM_001039577chr164219 4159 2759 864 841 81 --13857 13966
NM_001039590chrX2349 173 23129 2439 21386 447 --
NM_001039618chr1155385 5055 4359 1811 277 1855 1433 --
NM_001039690chr1672120 1966 1853 380 311 205 127 --1907 11949
NM_001039711chr12163 44 138 1918 --
NM_001039802chr131314 155 126 ------
NM_001040197chr1181 1656 --154
NM_001040214chr631592 569 28 --1246 --
NM_001040273chr1051343 827 732 315 23 144 21859 476 --
NM_001040613chr811476 ----11147
NM_001040712chr963073 2548 1153 1138 1123 949 1434 ----
NM_001042486chr2081564 1461 1241 1140 1126 596 480 147 1587 21161 971 --
NM_001042506chrX5513 213 183 69 47 3224 95 87 31168 507 217 --
NM_001042533chr352827 895 449 443 25 12375 12741 12048
NM_001042632chr2052001 1911 521 492 287 11837 1168 --
NM_001080418chr13230 45 34 1585 4482 442 247 103 --
NM_001092chr1752120 732 480 330 210 22546 198 ----
NM_001095chr1261620 1523 1354 1216 665 546 21674 711 --11541
NM_001140chr174468 429 109 91 135 ----
NM_001194chr196617 572 502 437 429 213 --1207 --
NM_001204chr264839 3075 2907 1268 604 113 11894 ----
NM_001292chr15--1218 --1241
NM_001356chrX41550 622 255 245 --1249 --
NM_001362chr144388 225 174 60 ------
NM_001365chr174303 276 270 104 1571 ----
NM_001390chr182184 138 22335 1060 13188 --
NM_001396chr212423 202 1985 --1870
NM_001406chr1761405 630 503 310 182 174 --1341 11603
NM_001407chr321262 434 21527 1450 ----
NM_001420chr19152934 2727 2671 1237 1158 1129 1096 994 987 777 335 329 231 212 24 ------
NM_001427chr772074 1674 1351 696 678 669 489 21544 841 --1651
NM_001447chr561318 1252 1231 1131 390 160 11219 --11056
NM_001453chr61396 161 --1164
NM_001493chrX5740 309 294 235 98 292 81 ----
NM_001495chr81120 --2485 414 --
NM_001530chr14----1844 --
NM_001616chr243462 2980 1126 851 12592 ----
NM_001664chr32879 234 ----1188
NM_001677chr11244 125 --1767
NM_001678chr1781760 1681 1529 1319 664 351 78 22 41766 1351 373 196 1343 --
NM_001703chr11222 --122 --
NM_001759chr1265334 4713 3796 2086 1249 118 33439 1174 1135 ----
NM_001858chr644226 4117 3398 1185 --11504 --
NM_001895chr201386 21166 373 148 --
NM_001896chr16138 ----1168
NM_001946chr121882 --1255 --
NM_001949chr672509 2030 1067 997 781 293 88 1854 12202 --
NM_001964chr511173 --2833 181 --
NM_001968chr4----1269 --
NM_002006chr465489 5359 4085 1865 1726 378 ------
NM_002045chr34341 105 62 31 1135 ----
NM_002063chrX----1803 --
NM_002077chr941833 1734 419 277 --21773 148 --
NM_002151chr192185 104 ------
NM_002167chr1----1122 --
NM_002193chr2--1372 41207 1203 1195 1183 --
NM_002196chr204858 204 119 113 ----1393
NM_002204chr1761228 1103 907 268 206 117 21008 533 31290 438 28 1140
NM_002211chr101988 11048 11063 --
NM_002226chr143830 764 704 --2859 664 --
NM_002232chr11958 1521 1467 --
NM_002235chr1261656 1619 1589 1280 1232 674 1122 11288 --
NM_002245chr11458 --1223 --
NM_002264chr331938 619 69 --21545 225 --
NM_002265chr17252 38 --1469 --
NM_002267chr13----1337 --
NM_002294chrX------1489
NM_002319chr77834 246 213 147 75 65 25 1773 1883 --
NM_002334chr1131492 305 117 2385 290 --1425
NM_002355chr1241063 573 317 98 1882 ----
NM_002373chr1541281 550 499 492 1169 11259 --
NM_002384chr1841003 785 318 104 1159 1666 --
NM_002398chr231190 229 136 1194 ----
NM_002401chr1792362 1974 1885 1876 1847 1765 883 660 291 --11006 --
NM_002442chr1261594 1358 1345 1170 231 225 21130 561 31261 712 284 --
NM_002498chr13----1364 --
NM_002501chr19234065 3939 3659 3643 3535 3457 3419 3377 3340 3334 3223 3015 2518 1227 1219 941 759 667 469 448 442 368 140 33525 3157 980 ----
NM_002515chr143758 703 655 --11333 --
NM_002556chr1131589 548 333 ------
NM_002569chr1581412 1332 970 580 458 383 206 132 1602 1149 --
NM_002581chr994327 4028 2031 1817 1583 1044 1004 601 211 24142 1539 34519 4438 327 --
NM_002596chr151332 1004 444 291 195 --41319 1036 848 543 --
NM_002599chr112989 380 1346 11110 --
NM_002612chr7----12047 --
NM_002634chr173732 216 83 1225 ----
NM_002651chr14899 637 106 90 1563 ----
NM_002653chr55937 850 188 151 144 --4913 857 335 103 --
NM_002698chr1962806 2760 2718 2609 1037 114 2999 875 1639 --
NM_002707chr21136 --124 --
NM_002710chr121966 ----11033
NM_002748chr1531109 868 825 --1784 --
NM_002753chr41715 --159 --
NM_002773chr163506 151 134 --1449 --
NM_002833chr1531311 359 21 1329 21345 1196 --
NM_002834chr1254000 3901 2996 2808 1592 ------
NM_002848chr122408 175 --140 --
NM_002859chr1291859 1701 1525 1223 1203 593 545 279 270 --1232 --
NM_002886chr321787 163 21096 317 1196 --
NM_002906chr11190 1474 --1741
NM_002942chr32312 196 ------
NM_002971chr3----164 --
NM_003026chr92329 109 31338 471 126 ----
NM_003028chr9153771 3591 3531 3327 3142 3073 3034 1555 1415 1349 1281 1229 482 228 222 21071 66 22961 569 11160
NM_003030chr31117 21337 798 1327 --
NM_003047chr181230 1129 1066 961 384 144 134 115 3489 193 48 11331 --
NM_003076chr1251659 1359 1326 631 191 ------
NM_003079chr173809 333 269 1381 1916 --
NM_003081chr20--1809 1110 --
NM_003107chr64226 205 198 144 --11930 --
NM_003128chr21306 11930 --1364
NM_003131chr661928 1920 1421 325 212 181 11900 11502 1896
NM_003137chr6--22005 1572 1345 --
NM_003139chr114772 681 267 147 --1209 --
NM_003142chr2190 --1103 --
NM_003155chr832429 2097 1998 2195 29 11045 --
NM_003173chrX111332 1209 1155 993 934 230 203 130 120 110 62 11052 11121 --
NM_003204chr1721586 231 ----132
NM_003214chr651272 1024 453 339 138 1246 ----
NM_003255chr1771813 952 748 734 726 511 206 21784 605 --2527 423
NM_003270chrX----1252 --
NM_003324chr1251282 1172 1159 1073 961 11220 ----
NM_003342chr1763045 2516 2481 1020 710 85 12663 13023 --
NM_003367chr192421 34 --2211 172 --
NM_003406chr831793 1692 342 ----11341
NM_003439chr743558 3102 3004 2257 ----1537
NM_003468chr263067 2766 1163 1063 952 190 ------
NM_003478chr1132568 2539 248 1286 ----
NM_003482chr12142654 2496 2415 2403 2041 1113 1077 760 678 499 493 487 382 38 1205 1173 --
NM_003485chr1451273 1164 1004 143 50 --21391 418 --
NM_003490chr221393 2859 832 2358 274 --
NM_003528chr151237 333 327 321 79 --11510 --
NM_003559chr17143844 3784 3270 2980 2739 2495 1485 1369 1328 1166 602 420 220 204 43818 3074 2517 863 1407 --
NM_003575chr721567 1129 --1630 --
NM_003593chr176669 650 554 278 220 63 --175 --
NM_003603chr41126 --11801 --
NM_003633chr572216 2168 1761 1035 1029 708 37 2953 372 ----
NM_003670chr32474 304 1505 ----
NM_003704chr41161 2261 248 1561 --
NM_003754chr11----1136 --
NM_003768chr15644 467 248 100 59 190 11782 --
NM_003873chr1031672 795 482 12026 1848 --
NM_003876chr17141 ----1335
NM_003893chr103325 116 45 --136 --
NM_003936chr27992 778 765 759 306 130 31 --124 --
NM_003947chr33316 169 85 2466 67 31021 186 33 --
NM_003988chr10121971 1921 1507 919 902 789 608 518 335 318 207 148 1394 22213 303 1415
NM_004080chr751205 1190 963 940 277 ------
NM_004090chr1763022 2945 1075 343 303 161 2855 457 ----
NM_004100chr642632 2548 2481 1794 --1412 --
NM_004116chr21435 --145 --
NM_004130chr3------1567
NM_004136chr151931 --1792 11145
NM_004171chr1139115 2819 2007 27822 2185 12025 13808
NM_004200chr11142927 2621 2589 2307 2236 2152 2114 1211 1201 1099 1084 676 517 179 83199 3103 2352 2108 985 903 58 47 32790 2737 458 1323
NM_004302chr1272620 2575 2504 2398 404 158 125 --32524 837 81 --
NM_004311chr1032834 2496 672 12896 12264 --
NM_004349chr821181 1042 ------
NM_004370chr61808 2685 112 ----
NM_004392chr1332321 1995 1680 ------
NM_004393chr34821 804 794 707 22117 950 31527 151 96 --
NM_004395chr54521 264 151 109 --272 43 --
NM_004423chr372747 1716 746 433 357 169 36 1439 --22490 228
NM_004428chr14681 638 554 209 2258 114 ----
NM_004429chrX51261 1144 1063 931 924 --21291 97 --
NM_004430chr882037 981 947 904 626 263 223 24 11075 2464 344 --
NM_004455chr151050 913 742 249 121 ------
NM_004494chr1101176 1141 975 347 326 193 153 138 102 29 ------
NM_004497chr19141 --2601 208 --
NM_004498chr15----1156 --
NM_004516chr19----1312 --
NM_004555chr16------1154
NM_004588chr11133766 3234 3227 3122 3103 3061 1224 1144 1060 967 248 175 154 33758 3143 751 32512 343 117 --
NM_004598chr553065 2944 2935 2591 1257 12821 --13161
NM_004643chr142298 282 ------
NM_004654chrY----1435 --
NM_004660chrY32065 618 365 ------
NM_004709chrX1600 --11358 --
NM_004711chr22123515 3502 3051 2259 861 841 825 670 283 117 35 25 53664 3531 2844 2553 678 32321 1292 894 22271 2228
NM_004715chr186576 537 444 280 257 85 1678 ----
NM_004725chr1011184 --11218 --
NM_004742chr3------1505
NM_004745chr8116037 5542 4639 4616 2767 1689 1462 628 482 236 168 32447 728 414 15422 12191
NM_004772chr54384 319 306 298 --11241 --
NM_004774chr1711228 --22230 764 --
NM_004815chr134200 4109 1552 1288 ----
NM_004834chr263407 2748 2557 2154 2110 1224 --1965 --
NM_004852chr181714253 13440 12774 12667 12507 12326 12316 11057 10862 10615 9406 9330 4888 4812 3110 1517 358 513521 12644 12478 10882 10637 312362 10848 9154 212766 3147
NM_004890chr17193 1112 180 --
NM_004926chr149603 594 586 576 456 176 76 42 29 --21632 250 --
NM_004952chr11907 1727 1892 --
NM_004992chrX258506 7786 7743 7364 6921 6673 6624 6539 6477 6178 6011 5949 5893 5874 5194 2965 2525 1983 1540 1400 1004 552 452 443 330 23251 2494 37591 6713 5265 12864
NM_005057chr121858 114 ------
NM_005067chr32743 142 ----1820
NM_005096chrX41076 1023 1004 355 --31209 431 127 --
NM_005156chr933705 3522 3379 44183 2080 1386 179 ----
NM_005191chr331224 103 46 ------
NM_005220chr1751435 1404 1134 271 245 11115 ----
NM_005225chr2051122 970 957 341 223 --139 --
NM_005229chrX3945 348 340 --11137 --
NM_005273chr74247 133 51 45 ------
NM_005335chr3161 --1365 --
NM_005370chr195819 517 125 102 88 2394 369 2511 248 --
NM_005374chr17112124 1913 1733 1600 850 498 437 430 408 232 26 22321 2240 32194 929 220 --
NM_005386chr201678 2363 222 1612 --
NM_005392chr921563 1523 194 --1379
NM_005400chr252659 2410 1890 174 123 1211 --12220
NM_005412chr12254 24 1452 ----
NM_005413chr24392 169 156 45 ------
NM_005418chr112700 583 --2618 130 --
NM_005430chr125648 231 155 145 136 1933 191 --
NM_005439chr125475 402 175 126 85 --1382 --
NM_005440chr1773238 2303 2109 1045 953 656 327 22533 483 1537 2872 491
NM_005458chr921730 1618 31709 954 781 ----
NM_005465chr12658 133 ----1307
NM_005529chr16925 775 753 739 299 288 11072 3757 743 684 --
NM_005540chr151389 1206 643 337 50 1204 --1150
NM_005544chr2------1319
NM_005581chr198444 428 416 399 354 333 86 68 1450 180 --
NM_005596chr965902 2405 2205 2158 1477 37 1512 13962 --
NM_005604chr621023 587 2463 380 ----
NM_005629chrX81088 510 366 272 266 254 147 63 1200 3321 310 27 --
NM_005654chr5153 --1150 --
NM_005668chr564140 3463 3001 897 728 327 23853 99 23938 2862 --
NM_005678chr153766 742 721 2863 698 1880 2902 794
NM_005711chr51390 ------
NM_005716chr194544 537 449 230 --1562 --
NM_005737chr271073 487 419 387 234 215 106 22660 2207 12044 --
NM_005789chr17102176 2031 1835 1741 1580 1475 1359 655 537 522 ------
NM_005828chr17154595 4457 4395 4140 3885 1613 1521 1440 820 809 703 165 121 59 21 --14131 15067
NM_005899chr171455 --1119 --
NM_005907chr621534 1206 1212 --21332 476
NM_005909chr552697 1593 1132 840 234 --2882 828 --
NM_005920chr1133667 3512 3288 3077 2516 1262 1192 1125 1101 875 390 98 54 43200 2736 1242 243 22750 61 --
NM_005933chr1172799 2432 2411 2148 1164 519 463 ----11962
NM_005937chr17133919 3902 2918 2867 2708 1333 1316 1227 1090 924 687 557 445 53754 3042 1281 1234 930 23444 256 --
NM_005938chrX41321 1265 286 169 11341 11367 --
NM_005941chr82830 370 13511 --11478
NM_005955chr164354 2087 1424 643 608 120 11204 21918 357 --
NM_005967chr124527 217 127 48 ------
NM_005984chr221360 2502 445 --1376
NM_006062chr25998 453 343 336 91 31059 464 172 21250 1136 --
NM_006096chr8----21389 398 11546
NM_006128chr83284 243 132 144 ----
NM_006139chr262590 2198 516 329 231 43 12096 22835 1848 --
NM_006141chr161756 12699 22406 304 --
NM_006160chr1751550 1301 1043 517 84 --21475 44 --
NM_006191chr123147 129 88 3953 336 52 ----
NM_006195chr92909 388 ----190
NM_006197chr8----1439 --
NM_006201chrX51102 890 813 451 176 2313 158 2126 99 1744
NM_006242chr203563 482 412 --1155 --
NM_006256chr122528 1919 --1348 --
NM_006268chr113450 348 71 --1842 --
NM_006279chr1--2783 601 ----
NM_006317chr52573 363 1201 2657 561 --
NM_006336chr951072 525 452 325 293 ------
NM_006380chr1733511 2986 224 24293 4190 24309 1378 --
NM_006389chr11101286 1275 1268 901 550 240 226 164 118 33 31101 417 47 ----
NM_006424chr461705 1428 1325 560 136 68 21443 587 31881 1709 709 --
NM_006458chr115385 286 265 150 144 1349 1314 --
NM_006469chr111244 ----1502
NM_006517chrX92115 1975 1804 1673 1535 748 723 709 52 21987 338 22068 1442 --
NM_006521chrX81295 1226 918 284 143 81 69 34 ------
NM_006546chr17176569 6523 6380 5914 5902 5517 5127 5108 4355 2494 2055 1535 1031 1022 877 751 189 45269 2189 771 288 22364 132 --
NM_006557chr921108 674 ------
NM_006593chr24819 748 103 26 --1204 --
NM_006621chr12439 378 1612 2576 29 --
NM_006662chr163298 253 31 1138 ----
NM_006675chr1263169 2336 1132 1027 126 107 22327 1234 53269 3024 1286 368 24 --
NM_006695chr172325 86 1244 ----
NM_006713chr5------1213
NM_006750chr16127232 6670 5843 4995 3155 2944 2245 2188 2044 2031 608 51 35605 2095 522 24989 163 --
NM_006761chr174717 631 617 50 ------
NM_006772chr6131655 1620 1565 1423 1411 1321 1224 594 438 353 347 302 47 31590 1079 149 2264 142 --
NM_006791chr15----1456 --
NM_006856chr1221152 81 3777 769 374 143 --
NM_006861chr1241953 1505 158 58 11320 3396 260 195 --
NM_006885chr1663131 3042 1130 1108 730 517 --23822 411 --
NM_006902chr131059 899 776 23102 1216 1462 12398
NM_006943chr2082147 2097 1006 981 596 348 196 97 12374 82485 2111 1071 828 524 506 391 133 --
NM_006950chrX7894 733 679 597 225 122 99 ------
NM_006981chr912081 22515 896 1769 --
NM_007087chr163696 615 263 1640 --1144
NM_007144chr1781058 1052 964 868 828 488 102 74 1814 11117 --
NM_007174chr12102381 1904 1758 1663 1624 952 920 789 133 92 1702 11572 --
NM_007187chr13------1189
NM_007192chr1431033 1024 422 ----1175
NM_007212chr1----11666 12079
NM_007249chr1398428 8102 7275 6631 5923 3253 1473 809 406 66983 6637 1624 399 348 176 27671 7064 --
NM_007271chr631852 1176 650 1104 --1409
NM_007275chr35932 820 778 239 126 ----1906
NM_007327chr981187 1039 1029 871 749 277 261 76 --101033 777 453 449 423 403 335 175 151 147 11068
NM_012081chr563336 2969 2362 697 347 204 1197 --1733
NM_012104chr1153469 2455 1224 1013 704 31394 664 124 13492 2829 304
NM_012134chr1101743 1596 1243 752 663 409 370 359 295 52 --180 21306 1252
NM_012137chr14972 958 628 164 --2566 65 --
NM_012189chr182585 251 2195 111 ----
NM_012199chr1133753 3249 3071 1829 1096 1089 759 660 645 621 256 225 218 23834 1651 23620 3149 1287
NM_012202chr114341 277 155 100 --1149 --
NM_012215chr102640 341 21427 149 ----
NM_012286chrX----1444 --
NM_012296chr11143961 3435 3153 3025 2965 2943 2827 2788 1403 880 637 245 90 57 32839 872 446 22911 200 --
NM_012297chr4----1286 --
NM_012302chr1------11216
NM_012308chr1151030 824 645 355 53 --21830 655 --
NM_012309chr1174876 1414 1387 883 602 152 104 44032 1199 551 416 21569 482 1186
NM_012316chr1125218 4719 4604 4446 3635 2132 2071 1875 1867 1861 1539 855 191 21793 199 --
NM_012326chr25779 766 292 226 219 --1641 --
NM_012333chr1----11098 --
NM_012396chr14645 624 587 509 139 2544 486 --
NM_012402chr1171236 1144 979 963 517 431 148 --1511 --
NM_012464chr432906 2111 1150 ------
NM_012471chrX31643 495 307 1431 1463 --
NM_013260chr1761242 1192 1144 476 302 192 ------
NM_013261chr423677 2880 13074 --12994
NM_013279chr1182147 1759 1669 1628 877 355 123 90 --21777 416 --
NM_013316chr7143 ----168
NM_013433chr1941938 1883 701 172 1470 21554 290 --
NM_013449chr1272996 2355 836 705 567 560 43 12382 ----
NM_013952chr262497 2459 2077 974 593 524 3710 558 377 --2982 51
NM_014002chr1193 199 1111 --
NM_014023chr102877 786 11149 22147 245 --
NM_014117chr1611880 125 ----
NM_014157chr16113936 3260 3142 2473 1335 867 557 549 539 154 117 1903 12610 --
NM_014232chr1771639 1181 548 446 388 92 65 21239 1039 ----
NM_014240chr3123689 3368 3342 3329 2829 2784 2669 2633 1601 1540 933 784 12807 13506 --
NM_014289chrX41280 1267 1029 987 1553 11345 --
NM_014342chr1111282 --11471 --
NM_014344chr113230 201 141 --1104 --
NM_014345chr62417 278 ----1313
NM_014368chr941863 785 779 109 1190 193 1132
NM_014388chr1105948 5807 4901 4878 4794 4584 4567 1169 264 203 34734 3762 935 24381 2160 --
NM_014417chr193660 591 55 1666 1294 1308
NM_014421chr411680 --11968 --
NM_014423chr514587 ----14873
NM_014431chr1091600 1216 623 588 425 316 254 116 26 --21630 1203 --
NM_014489chr113545 176 78 1256 2148 35 --
NM_014494chr1631852 333 21 11915 31927 671 516 --
NM_014554chr122799 748 ------
NM_014621chr2----122 --
NM_014665chr8153519 3398 3046 2940 2482 2246 1051 992 975 924 708 656 573 490 469 12261 33338 2963 1369 13015
NM_014682chr832116 1922 543 ----1626
NM_014730chr12125233 5217 5053 4889 4604 3761 3622 3193 2036 1632 908 593 25245 831 24957 3556 --
NM_014731chr2031594 1359 153 11549 2402 193 --
NM_014751chr832177 876 850 ----11725
NM_014761chr1631038 962 876 ------
NM_014766chr752834 1271 901 152 42 32391 2335 1199 ----
NM_014772chr18113507 2935 2807 2742 1378 593 586 306 282 218 28 43539 2959 534 298 ----
NM_014807chr114586 542 47 39 --1125 --
NM_014827chr131357 1247 470 ------
NM_014830chr1283695 3526 3112 2628 1364 1239 289 224 12634 22668 1121 --
NM_014847chr13172 112 29 --1126 --
NM_014901chr562327 1650 1471 1435 1428 605 --1222 1227
NM_014903chr12--1627 32185 702 487 --
NM_014938chr12102432 2178 2115 1940 1804 787 730 419 271 54 11774 32010 194 128 --
NM_014945chr52471 143 1703 --11585
NM_014952chr1552030 1770 630 440 426 --2677 656 --
NM_014989chr6------21897 1864
NM_015001chr1----1807 --
NM_015020chr1622650 348 1587 13346 --
NM_015026chr1211297 ----1661
NM_015039chr142902 2887 2651 1157 11013 2355 316 --
NM_015075chrX221770 1732 866 846 837 813 801 774 737 628 588 579 460 429 418 408 381 363 339 332 48 42 42107 1754 744 325 ----
NM_015080chr116902 874 350 259 186 22 1626 ----
NM_015090chr1195846 5806 5501 5468 4829 4386 4309 4132 3891 3798 3788 2384 1886 1562 1305 1047 1032 1004 918 75873 5853 5121 2509 1491 295 80 22126 329 14808
NM_015092chr1664629 4373 1528 642 400 359 31263 663 49 1241 --
NM_015107chrX71547 587 486 441 180 154 25 --22267 435 --
NM_015111chr583835 3680 3542 2877 2838 1476 1041 791 1951 13828 11414
NM_015138chr15102415 1130 991 954 898 815 802 215 53 40 32533 2209 190 1410 --
NM_015158chr9------1104
NM_015213chr11142 1699 1823 --
NM_015215chr11710 22653 740 --12640
NM_015227chr21103084 2784 2770 2759 2727 2715 2249 1339 1023 878 53118 1407 1333 1102 153 1532 --
NM_015271chr4----1673 13632
NM_015282chr24693 678 106 68 12761 12287 --
NM_015288chr5113804 3791 3739 2574 2526 1156 1139 559 454 420 263 23835 1296 4821 624 397 329 12825
NM_015305chr1461338 690 600 510 196 44 11726 --11811
NM_015315chr593266 3214 3161 1241 991 835 645 424 383 22609 563 ----
NM_015327chr141305 1193 500 378 190 ----
NM_015328chr742718 2150 2091 331 --1119 1587
NM_015331chr15562 552 489 474 60 1200 ----
NM_015332chr7103640 3632 3388 3379 3222 3216 2562 1344 1007 146 33071 2294 966 43495 2961 2930 1214 12757
NM_015338chr2021222 363 1347 --1491
NM_015349chr661897 443 249 53 40 22 ----11193
NM_015355chr1711766 11272 1734 --
NM_015396chr3135 --11478 --
NM_015397chr931340 741 729 11395 21607 331 --
NM_015435chr8--11346 --1958
NM_015455chr511448 1962 --11147
NM_015457chr11139 --11008 --
NM_015481chr12111062 999 935 806 755 701 421 256 212 121 36 21021 885 2749 74 --
NM_015520chr32389 52 --1506 --
NM_015526chr1921425 1132 139 ----
NM_015531chr11------129
NM_015570chr73335 112 87 --1639 --
NM_015609chr1122924 2709 2669 2605 2126 2096 1906 1858 1088 826 405 200 32149 2015 898 42918 2660 2585 148 --
NM_015686chrX132374 2199 2174 2079 1871 1822 1806 517 452 407 256 152 146 52225 2209 2097 607 29 2347 306 --
NM_015694chr7----1334 --
NM_015897chr191123 ----136
NM_015898chr19122487 2262 2020 1850 1815 1708 1641 1631 827 821 605 266 2259 69 31784 836 641 --
NM_015906chr153374 3286 1350 1324 107 ----11241
NM_015982chr173358 323 76 ------
NM_015995chr15165218 5198 4643 3811 3561 3539 3401 1906 1868 1813 939 684 626 443 100 32 45350 1337 1197 190 14360 --
NM_016021chr622274 2079 11852 1988 --
NM_016022chr181069 382 310 294 86 50 43 32 2236 121 ----
NM_016037chr141024 850 459 285 ----1927
NM_016083chr663867 3547 3457 1561 1272 577 ------
NM_016120chrX173 ------
NM_016132chr1512834 1124 --12093
NM_016147chr1151100 1077 753 719 95 --11036 --
NM_016151chr163254 118 101 1371 ----
NM_016162chr121144 --1253 --
NM_016206chr378131 7470 7457 3591 3080 2155 1610 23204 2289 2885 50 --
NM_016231chr17----1263 --
NM_016308chr1------1222
NM_016588chr61280 --131 --
NM_016604chr521127 843 --1474 --
NM_016605chr542587 938 827 715 1727 21846 1057 --
NM_016639chr161353 1379 134 1437
NM_017420chr1422671 2342 12536 ----
NM_017488chr221309 396 --1247 --
NM_017514chrX7773 707 360 277 240 217 53 --1790 --
NM_017550chr1951034 299 206 182 91 11040 161 --
NM_017551chr1031657 502 34 --2518 26 --
NM_017553chr152468 234 ------
NM_017582chr151611 1580 1514 545 500 ----11572
NM_017602chrX2229 66 1782 1154 --
NM_017622chr17----3653 150 91 --
NM_017628chr474322 4308 3940 3270 3256 2024 1187 --14210 --
NM_017629chr1----168 --
NM_017637chr989350 8701 8640 8240 7999 6184 3419 46 38504 8262 36 17791 --
NM_017686chr11116 --11025 --
NM_017715chr7------1610
NM_017744chr131567 615 80 1993 ----
NM_017749chr112390 286 ----1696
NM_017811chr932903 2894 282 1972 13113 --
NM_017848chrX74457 4184 3993 3581 3247 773 517 14498 14492 --
NM_017893chr1091388 1331 1325 1153 1142 1088 532 526 101 --1212 --
NM_017907chr114382 328 55 44 ------
NM_018013chr632378 342 195 1212 12151 22190 93
NM_018031chr33495 81 44 --2615 516 --
NM_018051chr71406 ----1326
NM_018202chr12782 642 ----1175
NM_018205chr1062328 2213 2041 1853 1683 74 1844 121 --
NM_018339chr91417 ----1175
NM_018375chr142501 96 1440 ----
NM_018383chr231803 1307 463 21744 65 21463 204 --
NM_018440chr8107388 7283 6969 6011 5833 5610 5540 1892 1270 981 2338 258 28261 5769 --
NM_018445chr15------1397
NM_018449chr93790 555 290 1518 ----
NM_018553chr171110 1231 1483 --
NM_018602chr1531688 1279 27 --21464 1454 --
NM_018710chr81285 --11121 --
NM_018718chr752076 1989 815 529 516 ----1771
NM_018931chr51207 --1559 1284
NM_018957chr223220 111 49 --1130 --
NM_018976chr1222805 1900 --11078 --
NM_019032chr14694 668 651 178 1644 164 --
NM_019096chr63866 848 834 2840 320 2442 237 1744
NM_019106chr22143288 3210 3014 2995 2967 2806 2564 2202 2177 1019 673 617 602 34 23117 1320 33193 2517 2466 12306
NM_019884chr194498 438 165 138 1157 --175
NM_020123chr10------11069
NM_020137chrX238 22 --1468 --
NM_020177chr532910 2881 883 ------
NM_020184chr251966 1550 781 769 55 --42105 1629 860 28 --
NM_020235chr3----1319 --
NM_020310chr17132519 2506 2368 2228 2019 1818 706 567 351 341 290 111 57 170 11960 --
NM_020365chr1----163 --
NM_020390chr321161 989 11701 ----
NM_020410chr19122 --129 --
NM_020428chr192899 832 1138 187 --
NM_020429chr772945 2149 1022 317 231 214 181 22782 2524 12414 --
NM_020526chr161658 1525 1376 1337 731 720 --5659 633 563 388 39 11224
NM_020640chr3----1632 --
NM_020647chr832252 302 49 1560 191 --
NM_020699chr1245308 4895 4859 4747 4502 4116 3880 3825 3799 3764 3432 3413 3407 3368 1672 1555 1461 1330 1320 1002 951 636 415 27 13793 33894 3873 1334 1102
NM_020703chr1----1395 --
NM_020713chr20143093 3055 2667 2653 2481 2251 1043 914 629 576 472 466 109 103 --23059 2465 1621
NM_020718chr1635880 4742 525 46165 2022 1285 68 --16149
NM_020737chr61283 ------
NM_020752chr1021980 268 22869 2344 ----
NM_020796chr592827 2778 2071 780 409 324 312 211 53 32694 2584 93 --1585
NM_020805chr181111 11803 ----
NM_020808chr111154 --1708 --
NM_020839chr32548 390 11282 21167 76 --
NM_020850chr1672997 2930 2841 2835 866 859 111 22623 1322 22553 2487 1172
NM_020899chr1751611 500 397 385 174 2324 56 1504 --
NM_020920chr14----1263 --
NM_020940chr1032466 1175 71 ----1751
NM_020956chr19153951 3594 1422 1283 1128 1013 701 558 550 535 501 307 143 124 68 24760 167 83850 3475 3209 2935 1390 1180 1120 761 11463
NM_020971chr192614 227 1219 1733 --
NM_021035chr203907 858 527 --1446 --
NM_021064chr661394 1225 641 419 300 154 --21452 570 --
NM_021079chr1732756 2541 1178 165 23064 3028 --
NM_021116chr7198398 8251 8203 8099 8078 8021 6878 6740 3600 3245 3135 2975 2028 1346 830 782 586 450 255 18086 38641 7207 2549 18178
NM_021149chr1631000 153 143 --1964 3131 96 88
NM_021168chr1671466 1161 1110 1094 649 100 85 --11177 11018
NM_021183chrX----12555 --
NM_021189chr11749 1429 1121 --
NM_021249chr1431663 1516 87 ----11529
NM_021267chr1951288 204 133 81 36 --21304 215 --
NM_021638chr474929 4919 3950 3796 3421 3272 1450 43770 1970 1949 1852 54813 3227 1991 1700 160 21821 466
NM_021813chr684753 4664 4380 1686 1680 1090 328 40 ------
NM_021814chr61103 --11666 --
NM_021946chrX81337 1311 1224 1057 1007 983 942 55 ------
NM_021947chr1721107 275 1473 ----
NM_021964chr356277 4557 2529 1762 254 --12056 24096 2470
NM_022042chr44954 833 731 234 1335 3884 877 395 --
NM_022048chr15116072 5706 5173 4899 4421 4169 2418 2354 1306 363 247 24355 1032 ----
NM_022143chr711216 ------
NM_022462chr1993796 3365 3296 3260 3208 3148 1124 567 156 33769 2874 1252 2144 133 1612
NM_022465chr12142327 2248 2165 2155 1889 1053 992 819 734 501 446 332 321 147 171 --129
NM_022574chr7102136 2125 1938 1932 1877 1792 1619 1489 811 326 2573 162 ----
NM_022658chr123364 285 182 1354 11116 --
NM_022719chr2293536 3169 3069 3062 2757 748 695 459 180 23231 763 1723 --
NM_022781chr923080 1077 11093 12129 --
NM_022821chr13396 180 80 --127 --
NM_022824chr52689 23 11832 ----
NM_022893chr252834 251 83 67 32 ------
NM_023079chr1741719 674 61 29 ------
NM_024015chr1711116 --1390 --
NM_024050chr192123 83 1415 5613 107 91 87 53 166
NM_024519chr16141 ----155
NM_024545chr2------1266
NM_024595chr121082 988 --1769 --
NM_024612chr173842 827 819 --1986 --
NM_024742chr1661538 1458 598 545 468 430 21349 44 11530 --
NM_024798chr1542628 700 531 136 12218 22387 2334 --
NM_024811chr1161884 1668 1642 1636 89 55 ------
NM_024887chr172087 1569 1430 674 593 538 397 2574 314 1510 --
NM_024949chr474431 4313 4227 4014 1490 1482 528 13773 ----
NM_024953chr122754 648 1282 --12574
NM_024963chr7215679 5375 4608 4144 4127 4005 2215 2153 1933 1880 1841 1824 1805 1430 1393 1320 1025 933 735 326 123 15449 31551 584 21 --
NM_024969chr2----1263 --
NM_025057chr142315 222 3933 498 412 ----
NM_025069chr84201 134 65 33 ------
NM_025083chr1551947 1757 1581 780 186 --2774 756 21374 474
NM_025134chr16----11748 --
NM_025160chr174025 3786 3510 3313 3303 3093 237 ------
NM_025182chr97925 856 836 751 714 426 122 1115 143 --
NM_025222chr342362 2268 1969 439 --12038 2937 812
NM_025224chr2082198 2152 2109 1882 1866 815 516 133 22001 700 62064 1774 786 446 94 44 --
NM_025248chr17123058 3041 2899 2377 2250 2155 2123 611 551 373 78 25 1162 22903 2495 --
NM_030647chr756046 5843 1985 705 166 1726 15957 14228
NM_030761chr1102651 2638 2541 2512 2227 1761 717 652 253 80 174 22496 1692 --
NM_030981chr1151062 846 838 321 133 --3943 757 148 1865
NM_031208chr163943 159 115 --1751 --
NM_031407chrX4202 187 144 121 1114 ----
NM_031445chr23775 670 26 11155 ----
NM_031936chr13700 591 303 ------
NM_032028chr52290 35 ------
NM_032052chr2231026 518 366 1536 1258 --
NM_032124chr1821178 849 11026 ----
NM_032192chr174466 267 74 63 --2212 164 --
NM_032199chr1031505 314 184 --22385 575 --
NM_032207chr1931062 902 811 --2512 311 --
NM_032208chr243013 1234 488 400 11219 22251 96 --
NM_032256chr121189 1854 ----
NM_032268chr16103072 2457 2436 2391 1089 1081 868 642 399 228 33255 2221 496 22308 68 --
NM_032294chr1771707 1530 1436 280 132 121 115 --31747 460 62 --
NM_032353chr173469 357 36 1101 ----
NM_032364chr122357 217 --1842 --
NM_032387chr172337 275 --1305 145
NM_032408chr721167 164 11099 1306 1914
NM_032420chr55605 592 239 82 61 --1574 --
NM_032440chr1022316 1078 1775 22528 650 --
NM_032452chr1441016 554 346 231 ----11383
NM_032514chr203371 305 145 --3342 325 294 --
NM_032547chr4------1392
NM_032569chr1651231 740 479 472 23 --199 --
NM_032595chr17121363 1335 1267 1122 999 967 551 514 406 130 122 77 1479 1585 --
NM_032786chr122173 83 --165 1592
NM_032808chr156847 215 130 98 87 69 2164 154 2939 817 --
NM_032818chr942285 1862 1745 915 ------
NM_032827chr25975 820 402 181 125 --21085 272 --
NM_032840chr1251160 307 266 163 129 2981 409 138 --
NM_032959chr74918 767 754 372 1410 2128 119 --
NM_033088chr13240 118 90 198 ----
NM_033141chr1471976 1700 793 638 621 267 201 ----11727
NM_033201chr164414 322 197 43 21102 813 ----
NM_033224chr7127550 6892 6664 6552 6178 5103 2940 1674 1542 897 245 30 21548 301 16839 --
NM_033225chr832007 1097 511 22869 778 ----
NM_033274chr573433 3391 3188 3139 590 465 110 --13531 --
NM_033315chr1792159 2109 2076 2042 1651 699 669 466 435 22130 1935 1404 11661
NM_033340chr1031114 981 434 21046 1006 --193
NM_033396chr114367 122 47 24 2390 90 ----
NM_033449chr591856 1849 1815 526 343 325 173 124 118 11497 31779 779 313 1552
NM_033631chr173718 3680 3181 2872 2850 830 54 --1706 1256
NM_052840chr1551640 1464 1392 628 585 ------
NM_052848chr19111356 692 618 567 366 285 205 172 166 38 32 ------
NM_052874chr163159 125 97 264 41 ----
NM_052875chr1142192 1347 47 34 1470 12200 1731
NM_052896chr152163 2049 2042 485 42 32231 2211 544 41817 610 489 106 --
NM_052897chr123207 154 116 3689 268 197 ----
NM_052905chr221389 52 21530 323 1332 --
NM_052906chr22114277 3851 3601 1986 1741 1672 1304 1267 1168 1112 1098 1873 61642 1145 1002 880 658 647 13587
NM_052910chr1391999 1733 1524 1434 1376 1370 1358 599 54 21989 1818 21720 560 --
NM_052925chr192797 150 --2411 359 --
NM_052978chr1441188 487 302 40 2593 32 ----
NM_053064chr1431939 509 85 ----12760
NM_058172chr411830 1472 ----
NM_080391chr1----1584 --
NM_080422chr18----175 --
NM_080600chr19------1118
NM_080607chr204352 174 104 21 2398 147 125 --
NM_080616chr201713 2204 75 ----
NM_080738chr121333 572 11320 11950 1723
NM_101395chr2121091 870 2505 199 --1418
NM_130807chr1952300 2285 1554 544 365 21820 1444 1265 --
NM_133264chr1783394 2859 2713 811 756 591 576 373 23243 597 32535 1116 151 --
NM_133328chr195708 611 551 215 27 1296 1543 --
NM_133450chr161265 --138 --
NM_133507chr122342 127 1603 142 --
NM_138385chr441012 421 185 104 ----1988
NM_138426chr721558 23 11780 1489 --
NM_138462chr91436 ------
NM_138471chr112462 412 1385 180 --
NM_138473chr1275085 4999 4992 4863 4147 1934 171 21239 599 1289 --
NM_138479chr192073 1401 823 650 556 502 461 329 199 ------
NM_138795chr191566 1523 1122 583 307 286 215 103 66 21467 240 31189 93 70 --
NM_138962chr172152 133 1118 ----
NM_139015chr1241656 1642 1558 1457 --1617 --
NM_139159chr1971128 940 837 511 261 113 85 11166 ----
NM_139161chr192433 208 --1347 --
NM_144571chr466934 4683 4303 4294 2338 812 12249 24635 2650 --
NM_144691chr194479 226 136 102 --1473 --
NM_144723chr52350 330 --1244 --
NM_144778chr1332744 852 484 2894 730 ----
NM_144973chr1243973 3394 1647 946 --1961 --
NM_144994chr271140 1083 1063 1034 994 376 60 ------
NM_145008chr112348 92 1138 ----
NM_145012chr103728 205 147 ------
NM_145206chr1052874 2587 2352 380 121 23317 2333 12045 1995
NM_145239chr1641028 833 399 101 --3947 837 59 --
NM_145245chr194837 358 222 78 --11126 11201
NM_145296chr193687 640 53 1119 1662 --
NM_145808chr731122 1048 973 --12645 --
NM_145891chr1681593 1567 1339 1306 1198 668 651 523 ------
NM_147202chr9202639 2332 2147 2138 2128 2115 2020 2001 1835 1723 851 841 772 766 582 509 502 375 268 213 32212 2183 720 32246 1846 750 11992
NM_152253chr22174308 4302 4021 3948 3473 3374 3126 2761 1491 1483 1464 1203 1190 1012 903 761 383 33694 3244 3081 --21657 1384
NM_152263chr1105630 5347 4024 2376 2245 2206 974 162 156 66 --15798 --
NM_152264chr111413 1121 2979 406 --
NM_152272chr851063 941 453 382 335 1318 ----
NM_152287chr1662518 2388 2110 982 492 64 1243 2430 108 22592 503
NM_152296chr194254 233 129 117 --125 --
NM_152344chr1731379 1151 299 ----21247 229
NM_152345chr1751113 950 877 832 388 2981 843 1997 --
NM_152346chr1761057 977 884 454 440 396 1316 11061 11050
NM_152365chr1150 --2423 112 --
NM_152376chr141836 1653 1322 511 21740 220 ----
NM_152424chrX84225 3968 3909 3655 3331 3141 602 155 34192 1662 1243 11237 --
NM_152493chr141274 1255 271 24 --133 --
NM_152608chr1--1627 1719 --
NM_152622chr52318 285 ----1826
NM_152680chr451647 767 608 316 270 21580 952 1148 --
NM_152753chr64656 311 298 73 1327 --1354
NM_152756chr5----14251 --
NM_152758chr812225 13032 ----
NM_152860chr1271374 1368 1345 1230 1033 995 22 11056 21131 179 --
NM_152896chr91165 1736 1533 --
NM_152996chr111879 --12043 --
NM_153487chr6154747 4721 4715 4605 4096 3326 3320 3000 1588 1249 1069 862 763 227 55 54634 4398 3767 3015 81 44628 4311 1775 1488 24495 114
NM_153619chr1562301 1207 1031 775 557 404 2968 864 11025 13262
NM_153620chr73389 157 108 1286 1268 --
NM_153685chr1281107 917 474 392 267 261 226 59 ------
NM_153712chr252605 428 369 322 89 11311 12760 --
NM_170707chr14930 844 382 54 --165 --
NM_171998chrX42147 960 358 233 ------
NM_172070chr212066 --1839 --
NM_172071chr1137287 7205 6792 6629 6301 6203 5828 5753 4970 4734 2909 2278 424 35441 4590 448 --11570
NM_173074chr2----142 --
NM_173468chr454330 1263 675 397 347 12110 ----
NM_173595chr12265133 4877 4526 4477 4332 4216 4127 4115 3747 3726 3653 3640 3609 3247 2067 1668 1425 1071 1045 1014 941 913 731 575 279 25 35242 3327 411 74046 3340 3279 3205 1998 1387 148 --
NM_173681chr762114 1891 1833 1603 1446 450 32072 2063 1965 ----
NM_173683chr821556 1407 --11329 --
NM_173854chr172066 1968 1483 583 93 80 26 --21703 747 --
NM_175630chr21133 --1625 --
NM_175709chr22102680 2610 2516 2260 2092 2043 1909 1224 826 733 41159 809 148 137 12584 --
NM_175736chr12197696 7647 6391 6346 6104 4965 4798 3140 2475 2404 2063 1811 1693 1398 1375 572 556 535 383 37014 4989 313 46412 1976 1679 798 --
NM_175884chr7----1535 --
NM_175898chr155414 405 351 112 45 --21414 593 --
NM_176792chr103355 235 116 --31379 1223 517 1866
NM_177424chr131731 1624 750 ------
NM_178313chr21712 12117 1172 --
NM_178423chr74924 495 283 58 1837 ----
NM_178557chr461631 641 597 498 385 232 --4306 62 54 23 1337
NM_178566chr91652 1107 ----
NM_178568chr174720 529 254 241 11734 1427 142
NM_178831chr762631 2559 2385 2314 1069 69 2379 226 1715 --
NM_178835chr45803 763 612 267 46 2104 64 1709 --
NM_181358chr123180 3148 --2272 133 22659 712
NM_181670chr121452 1264 183 --
NM_182509chr1451037 567 331 187 108 --175 --
NM_182526chr1473068 2943 2086 893 820 756 79 22425 631 --12177
NM_182553chr112442 162 --1515 --
NM_182557chr11142065 2045 1936 1813 1727 1607 1439 861 827 748 529 462 436 249 1310 21897 1397 11761
NM_182765chr1021907 214 ----1108
NM_182970chr20144174 3976 3791 3669 3615 3156 2889 1710 1488 1048 955 516 177 159 --23985 2961 --
NM_183059chr17410 404 370 303 168 127 91 ----1472
NM_183425chr2051643 1401 637 130 116 123 ----
NM_198270chrX------1622
NM_198560chr363571 3245 3169 2698 1305 116 32479 843 499 21138 578 --
NM_198859chr364756 3958 3797 1613 1518 728 2518 261 ----
NM_198991chr18----1610 --
NM_198993chr1781580 1508 1496 560 499 365 86 37 11137 31678 546 264 --
NM_199129chr202965 282 --1140 --
NM_199141chr197724 716 634 261 182 170 64 --155 --
NM_199351chr11369 1493 1186 --
NM_203374chr194685 658 276 196 1861 ----
NM_203413chr1731032 1003 284 1760 1253 --
NM_203434chr9--1803 --1300
NM_203446chr2142205 731 710 135 11160 22188 1135 --
NM_205833chrX----1869 --
NM_205848chr122792 1774 11973 22379 98 --
NM_206914chr1232138 858 163 11994 ----
NM_207313chr174970 662 353 290 11009 1372 --
NM_207387chr172727 405 41389 1178 303 137 ----
NM_207497chr641394 1228 1173 121 11266 21088 1017 11334
NM_212464chr1561722 1370 796 646 312 250 21957 810 --11553