TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-657
miRNA Sequence: GGCAGGUUCUCACCCUCUCUAGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr521856 653 --1513 --
NM_000074chrX1926 1899 2843 320 --
NM_000084chrX96660 6559 6201 5674 4708 2199 1908 1727 1439 16734 16328 1368
NM_000109chrX21799 825 --1334 --
NM_000138chr1512407 ----22538 2354
NM_000141chr1031085 250 173 --11440 --
NM_000163chr512215 ----1763
NM_000170chr91452 ----1514
NM_000176chr583745 3408 2524 1574 865 792 693 452 --23948 3529 --
NM_000176chr583745 3408 2524 1574 865 792 693 452 --23948 3529 --
NM_000245chr722098 257 22181 217 11941 --
NM_000248chr352962 2721 2657 2377 326 ----12079
NM_000259chr15116389 5380 5348 4596 4397 4190 4123 1291 1246 1195 1130 36045 4608 768 ----
NM_000262chr2271643 1584 1422 679 535 440 104 --1504 --
NM_000267chr1722765 2651 23050 1333 13515 11221
NM_000314chr1063015 2535 1018 711 613 45 11044 13036 --
NM_000329chr12611 334 --188 1112
NM_000332chr6106742 6518 6460 6452 6228 6205 4862 2162 1554 283 36933 6007 2453 22418 1652 14941
NM_000333chr31275 --1137 1313
NM_000337chr586039 5735 5569 4147 2103 1888 1251 965 --36577 6327 5020 --
NM_000368chr974188 4125 3794 1670 1398 660 647 23621 592 44167 1632 799 321 34590 474 30
NM_000378chr11------11242
NM_000405chr561760 1565 1537 1207 333 232 --11787 --
NM_000408chr232390 2139 271 23265 1016 22883 2156 12280
NM_000437chr142152 1872 1742 847 ----11460
NM_000445chr87971 760 698 323 242 166 151 1398 ----
NM_000489chrX63369 2792 2677 2402 2244 312 --12270 --
NM_000503chr821422 463 21393 301 1285 --
NM_000522chr741223 404 363 31 11273 ----
NM_000533chrX31474 1289 678 --1542 --
NM_000612chr1153732 3726 3514 3440 2507 11538 ----
NM_000618chr1286025 5200 4725 4378 2034 1207 981 69 34152 2158 1286 25852 4648 --
NM_000620chr12----21416 1308 1220
NM_000756chr81378 ----130
NM_000757chr18823 749 688 679 595 574 544 128 --1839 --
NM_000800chr521400 116 --1134 --
NM_000806chr521722 79 ------
NM_000816chr52129 111 ----1219
NM_000818chr101492 --1469 --
NM_000826chr4--11758 1433 --
NM_000828chrX41328 849 530 483 ----11941
NM_000829chr1122060 1911 --2519 419 --
NM_000841chr67844 836 803 783 770 168 97 --2762 234 --
NM_000842chr112544 27 ----1691
NM_000868chrX42266 1794 1603 1006 ------
NM_000877chr252263 2238 1167 779 482 182 12989 --
NM_000891chr1743482 1272 537 270 --11413 1278
NM_000899chr1234108 1285 403 ----2284 228
NM_000901chr431973 1666 739 --21994 77 --
NM_000909chr431093 338 77 ----158
NM_000912chr863564 2270 1243 796 567 314 12593 ----
NM_000933chr20----11203 11187
NM_000944chr421880 1747 --1924 --
NM_000945chr242106 1478 1461 59 ------
NM_000965chr3----11053 --
NM_000989chr8--129 ----
NM_001001132chr2121193 474 1217 11436 --
NM_001001323chr1232768 2273 533 12914 11117 --
NM_001001331chr342426 2011 1763 951 22534 2239 --1814
NM_001001557chr83871 187 130 --11692 11530
NM_001001701chr4----1765 --
NM_001002243chr22613 73 ------
NM_001002296chr831332 331 106 --11360 --
NM_001002838chrX11455 1388 1544 --
NM_001002843chr15--2379 134 11312 --
NM_001002860chr1474556 4484 3388 3256 1037 912 848 24100 3461 --14461
NM_001003406chr2263245 3091 2532 1237 1159 168 --12716 1884
NM_001003652chr18138652 7938 5655 5417 3463 2955 2693 2471 2130 1765 1613 439 153 11347 36185 5376 3487 --
NM_001003681chr2251969 1891 1727 415 298 11550 1277 --
NM_001003686chr73344 300 172 ----1416
NM_001003688chr4----21217 202 --
NM_001003712chr1234034 3438 751 13875 23403 1522 --
NM_001003800chr992845 2432 1495 1205 1134 1061 909 375 37 22915 389 --1450
NM_001003810chr43748 669 89 ------
NM_001003927chr171157 --1637 --
NM_001004317chr653430 3420 1200 249 95 21486 1146 11778 --
NM_001004333chr17----1238 --
NM_001004419chr1244109 3094 266 242 13265 11045 14481
NM_001004432chr12408 125 --1623 --
NM_001004720chr21321 ----11051
NM_001005473chr576038 5652 4388 4267 2342 1943 1290 15501 --1549
NM_001005611chrX--1491 ----
NM_001005743chr141392 --11333 --
NM_001005910chr31181 --1537 --
NM_001005920chr1651038 938 686 202 115 ------
NM_001006115chr392673 2652 2571 2407 2184 661 636 149 88 --22333 67 --
NM_001006600chr541579 579 216 147 1875 1261 --
NM_001006612chrX1324 1138 199 --
NM_001006636chr23150 117 44 1898 1161 2101 27
NM_001006657chr232710 2363 553 --33030 662 594 12065
NM_001007027chr11164 ------
NM_001007097chr975079 4919 4091 4011 1236 1013 904 34368 1389 398 --1170
NM_001007102chr61443 11544 11575 --
NM_001007156chr152660 365 1766 1288 --
NM_001007255chr13316 284 112 ------
NM_001007277chr116879 747 706 200 131 94 21078 34 11014 --
NM_001007277chr116879 747 706 200 131 94 21078 34 11014 --
NM_001007553chr13212 99 54 --1787 --
NM_001008239chr1863580 3129 1480 982 499 406 1890 1840 12885
NM_001008493chr141565 1148 459 342 11130 ----
NM_001008541chr1042157 517 495 262 1154 11888 --
NM_001008661chr13376 321 71 ------
NM_001008701chr1952682 2402 1209 287 163 --41908 994 651 422 --
NM_001008738chr532970 2046 506 --12564 --
NM_001008783chr61164 2816 306 1717 --
NM_001009993chr284486 3963 3470 3378 3342 3082 562 398 24067 336 23325 2953 11187
NM_001010888chrX53938 1823 1751 1225 1094 24033 3090 14212 --
NM_001010891chr5105753 5641 5227 4855 4560 4413 2744 1733 1605 218 16017 26338 1145 --
NM_001010917chr1082223 2143 1958 1736 701 362 218 57 --32038 1442 808 11514
NM_001010942chr1211281 ------
NM_001010983chr3----1321 --
NM_001010986chrX32047 1972 942 1774 12491 --
NM_001011553chr7----1851 --
NM_001011666chr786403 6026 5595 4875 2346 1032 591 90 --24748 1673 --
NM_001011713chr1421403 117 --21323 403 --
NM_001011885chr151103 ------
NM_001012329chr162283 1995 1867 1543 767 673 1910 1598 --
NM_001012398chr16----1166 --
NM_001012426chr693402 3178 3049 2454 2080 1262 1069 649 152 --13338 22417 878
NM_001012977chrX21423 253 --1575 --
NM_001013031chr1021163 151 13505 11078 1314
NM_001013438chr31854 1708 --1672
NM_001013620chr12107810 6388 5977 5550 3069 2981 2614 784 208 195 ------
NM_001013635chr121844 ------
NM_001013693chr142597 2200 1825 598 22842 1994 1900 12682
NM_001015877chrX62819 2802 2748 2428 2043 1149 --1808 --
NM_001017405chr4----2252 87 --
NM_001017440chr7178218 8199 7266 7214 6843 6428 6194 5939 5559 5353 5177 4990 2527 1954 1927 1835 1714 32767 1940 1266 11910 1721
NM_001017523chr122464 94 ------
NM_001017923chr1411231 --1640 --
NM_001017969chr9------2640 516
NM_001017999chr181898 1562 1519 1506 411 403 285 21 --1239 --
NM_001018004chr152580 61 ------
NM_001018024chrX----1209 --
NM_001018025chrX2299 240 --1893 --
NM_001018050chr2262971 2773 2648 2494 2141 638 --32165 730 34 --
NM_001018064chr961826 1389 616 605 585 322 --11794 --
NM_001018067chr1105300 4448 4362 3774 3767 2010 1918 1655 440 310 11454 --14405
NM_001020658chr121705 486 --11604 --
NM_001023587chr361102 1033 941 356 308 268 ------
NM_001024660chr341645 1332 1191 1140 --1679 --
NM_001024668chr122839 71 1815 1981 1610
NM_001024858chr1432955 2914 2641 21978 1009 ----
NM_001024948chr153158 2512 2255 2189 2175 13354 --13316
NM_001025076chr1026023 4855 14009 21240 314 15170
NM_001025079chr353346 3217 1670 1255 747 13894 ----
NM_001025108chr2103816 3535 3493 3297 2677 1663 1026 934 844 473 24119 1107 14026 13959
NM_001025580chrX23950 1321 11374 24051 3474 --
NM_001029863chr622825 439 --33108 2794 2505 --
NM_001029882chr1----1491 --
NM_001029884chr632654 997 294 1644 ----
NM_001030006chr1742205 733 229 91 1546 52533 2326 794 159 136 --
NM_001030007chr1633507 1611 1079 12524 23644 930 --
NM_001030055chr1434670 4341 1909 14288 21721 381 --
NM_001031680chr152409 2352 2234 1028 98 --42518 1788 1730 1039 --
NM_001031684chr241310 476 455 391 --11239 11518
NM_001031685chr11652 --1691 --
NM_001031732chr412964 --1699 --
NM_001031804chr1663063 1499 1262 1166 843 284 2701 355 1302 3987 792 417
NM_001032288chr2051335 1168 1012 474 430 1512 ----
NM_001032289chrX1300 --1759 --
NM_001033045chr2113907 3310 1649 1468 1418 870 851 602 552 434 309 23740 3080 1901 43878 3685 3359 3049
NM_001033057chr331550 1342 63 --11799 1288
NM_001033117chr374876 4417 3969 3805 1723 1535 1027 ----1637
NM_001033561chr172371 242 --1762 --
NM_001033564chr641945 1889 1506 1299 ----1548
NM_001033576chr1742633 2485 2426 1854 1489 ----
NM_001034850chr551582 1540 1467 1352 1294 ------
NM_001034915chr81143 --11563 --
NM_001035254chr962077 1662 771 574 518 399 156 11979 1680
NM_001035260chr1041019 536 77 66 --21383 1247 --
NM_001037132chr731915 1810 555 ----11487
NM_001037339chr131507 687 192 192 1397 --
NM_001039538chr273591 3555 3173 2979 2926 540 182 12822 12264 12741
NM_001039547chr3118061 7744 7355 7211 5732 5566 2305 2255 2207 2138 640 27128 5359 17786 --
NM_001039577chr153921 3609 3587 1392 1265 44471 4141 728 257 --11317
NM_001039585chr1114084 3531 3488 3393 3360 3105 3057 1645 1586 1315 278 32974 1214 339 22876 26 1609
NM_001039590chrX43092 2533 1321 374 2177 145 11347 --
NM_001039618chr1175891 5787 5311 4583 1638 523 287 --21750 599 --
NM_001039619chr14----1125 --
NM_001039690chr1652037 2022 635 551 182 22154 1916 11823 --
NM_001039840chrX105995 5900 5713 4630 4340 4240 3785 1764 302 33 11744 ----
NM_001040101chr411530 136 1154 --
NM_001040142chr231508 962 381 ----11750
NM_001040152chr794936 4441 1986 1469 1156 1030 681 290 278 170 14429 14267
NM_001040153chr131333 1769 ----
NM_001040260chr461089 851 167 152 105 29 1903 1777 11166
NM_001040284chr1675055 5037 4960 4447 4102 3975 1439 12093 --25944 868
NM_001040439chr1641463 1008 933 394 2524 29 --1117
NM_001040441chr1105094 4706 3616 3421 1884 1719 1030 980 864 740 35165 5029 3836 1522 1134
NM_001040446chr551690 1087 881 693 125 ----12671
NM_001040694chr112936 457 2430 246 1356 --
NM_001042371chr1652102 1870 305 279 86 ----123
NM_001042388chr186781 731 684 395 290 76 2945 342 ----
NM_001042472chr203586 478 249 4575 550 171 100 ----
NM_001042481chr1412016 11033 --12623
NM_001042506chrX31384 1325 253 --1575 --
NM_001042510chr842098 2069 628 538 171 ----
NM_001042517chr131831 1986 1978 --
NM_001042537chrX22373 2038 --21993 1961 --
NM_001042555chr1234706 1866 752 --14362 --
NM_001042604chr343150 1862 559 235 ----24722 4124
NM_001042632chr2032612 2111 721 3291 241 205 --182
NM_001042749chrX31265 316 22 --11807 --
NM_001043351chr142125 1640 1540 450 --166 --
NM_001044305chr621418 615 ----1268
NM_001044385chr263560 3254 1495 1295 735 620 1766 11044 --
NM_001066chr1102012 1901 1462 865 791 699 497 318 311 291 21817 167 12192 --
NM_001079874chr121730 828 --21439 221 163
NM_001092chr1782270 2152 1860 1716 889 779 649 51 --1501 --
NM_001094chr17--1286 1249 --
NM_001106chr3219636 9039 9001 8676 8645 8299 8019 6919 6652 6448 3818 2791 2716 1954 1930 1887 1811 1102 865 834 363 16248 18590 --
NM_001121chr1031820 1547 361 --11698 --
NM_001148chr432075 1479 416 1494 ----
NM_001156chr101535 170 ----
NM_001167chrX136718 6566 6363 6214 6100 5844 5429 5355 5264 4271 4106 2500 2283 1948 11221 --
NM_001174chrX41738 1708 800 326 1571 1442 --
NM_001206chr942366 2320 2181 428 --22174 883 --
NM_001222chr101479 11445 1597 21243 518
NM_001256chr1732820 1911 1890 --11940 22405 538
NM_001271chr1562555 1182 977 966 939 423 --23126 603 12653
NM_001304chr1763273 2932 2423 785 585 207 1975 11449 1990
NM_001310chr122990 214 1747 22991 2563 1128
NM_001315chr652239 2108 855 540 478 --21644 552 --
NM_001326chr11----1162 --
NM_001349chr21609 --1105 --
NM_001356chrX51866 889 840 650 406 1528 12361 1506
NM_001364chr1174022 3847 3493 2980 1696 1104 839 1557 34188 3501 1111 13530
NM_001365chr174316 279 212 142 ------
NM_001386chr832122 2086 111 21988 1923 11726 --
NM_001390chr1832826 1383 124 2651 570 21414 435 --
NM_001391chr1821143 27 --3989 781 442 --
NM_001396chr2172552 2521 2184 2163 2078 1868 148 --21925 253 --
NM_001402chr632009 365 242 21938 1843 22030 300 --
NM_001408chr151591 456 418 141 105 ------
NM_001415chrX11391 1363 1656 --
NM_001426chr2187 ----1736
NM_001427chr741876 624 541 501 --1362 --
NM_001438chr143313 2818 2538 331 ------
NM_001449chrX11094 ----1844
NM_001455chr6154571 3869 3752 3704 3675 3528 3272 3173 3165 3139 1870 1343 1150 1144 262 --2435 84 --
NM_001546chr6----11073 --
NM_001608chr22108 73 --153 --
NM_001616chr253408 2349 2273 425 293 --12668 12857
NM_001624chr611841 21186 1169 11870 --
NM_001627chr341900 753 417 370 12075 ----
NM_001642chr1111161 --11179 --
NM_001656chr511597 --21648 425 --
NM_001663chr1432227 2186 425 ----12542
NM_001699chr1931699 652 344 1106 --11138
NM_001706chr3------1763
NM_001707chr73681 194 184 1650 --2811 108
NM_001720chr1122146 2096 1893 1792 1734 1709 1340 1328 1320 752 470 369 11754 ----
NM_001723chr63870 285 237 --1925 --
NM_001743chr21503 --1536 --
NM_001753chr731712 1360 1153 21354 1178 11541 11868
NM_001755chr16--1229 12234 --
NM_001759chr1264608 3281 1210 1196 561 43 34707 4162 321 35256 3556 3391 34693 3677 293
NM_001826chr12428 377 --1332 --
NM_001842chr91157 136 1561 166
NM_001854chr111083 11425 --1432
NM_001859chr9103816 3650 2940 2809 2496 1539 1477 1317 764 342 21213 971 23194 1005 1933
NM_001863chr191110 ------
NM_001895chr2011046 21125 241 ----
NM_001904chr31800 --21032 123 1337
NM_001938chr121211 386 ----1347
NM_001956chr14609 602 504 87 ------
NM_001970chr175620 526 464 157 70 ----149
NM_001987chr12114013 3780 3728 3702 3199 3134 3067 2906 1563 1295 222 34127 662 483 --1344
NM_001995chr421136 377 --1966 --
NM_001999chr5----21344 1265 --
NM_002015chr1373079 3040 2138 1137 591 550 478 21241 1015 1603 --
NM_002024chrX22220 1950 --12060 --
NM_002025chrX149092 8637 7973 7654 7601 6128 3094 2860 2425 1964 1639 1534 1068 455 27843 3562 18728 17621
NM_002052chr861206 973 507 149 135 38 11033 11456 --
NM_002054chr2140 1343 ----
NM_002063chrX------11222
NM_002069chr721201 631 11727 ----
NM_002139chrX1483 ----1590
NM_002148chr2----1653 --
NM_002158chr263370 2906 2326 885 375 288 ------
NM_002190chr61853 ----1403
NM_002193chr2111874 1668 1263 1255 1228 1198 1190 665 604 571 535 11222 ----
NM_002207chr34722 153 37 25 --1490 --
NM_002214chr774793 3492 2229 1819 831 425 317 --15554 --
NM_002226chr143862 672 587 ------
NM_002227chr111179 --11275 --
NM_002264chr3123870 3738 3670 3376 3211 1749 1323 1291 1171 448 144 27 22008 1331 ----
NM_002267chr1361721 1710 1623 750 640 562 --1815 --
NM_002268chr331377 740 130 ----11477
NM_002270chr555412 5395 4939 2213 1186 --14334 21881 1161
NM_002356chr622776 88 ------
NM_002359chr17104043 3986 3646 3013 2612 1356 1333 1308 1224 536 --33841 3383 3278 1142
NM_002382chr144859 435 380 268 --11081 --
NM_002397chr522168 641 12077 22232 1378 1515
NM_002399chr1511278 ------
NM_002430chr2231632 225 151 12589 --1923
NM_002481chr1117808 7511 6894 6508 5692 5323 3192 2300 1679 1016 852 21561 1150 16530 15231
NM_002499chr1592335 1806 1771 1760 224 198 187 169 31 ----2882 297
NM_002501chr1983912 3703 3147 2512 1353 1109 851 502 ------
NM_002515chr1421717 602 --1267 --
NM_002519chr1121417 85 1100 --1239
NM_002522chr1763846 3294 3200 2719 1045 140 13807 13350 --
NM_002547chrX43722 2973 2668 1495 11651 --1691
NM_002577chr372860 1277 858 592 439 397 109 11462 13185 --
NM_002581chr984151 4104 1939 1665 1578 1454 803 715 14537 25144 4886 --
NM_002590chr131470 ------
NM_002605chr153214 207 122 1115 11049 --
NM_002607chr731256 1005 972 11183 21277 438 --
NM_002613chr16115314 4412 4266 3641 3432 1748 1491 528 325 89 43 23747 3653 ----
NM_002623chr20139 --1133 --
NM_002635chr121401 --131 --
NM_002645chr1122237 148 1706 --12716
NM_002648chr63885 847 503 --31240 522 490 --
NM_002655chr824455 1041 14628 --14937
NM_002657chr20103249 2794 2782 2658 2592 1154 875 709 476 259 13602 13434 1414
NM_002668chrX----1155 133
NM_002718chr362091 2010 831 568 427 405 2396 122 ----
NM_002730chr191428 --11333 --
NM_002742chr142543 231 --1274 --
NM_002747chr1831934 765 544 --21366 185 11653
NM_002753chr43542 143 95 1875 1291 --
NM_002807chr23198 87 21 ------
NM_002822chr1211516 ------
NM_002828chr18------1356
NM_002833chr1541333 1209 228 24 --21323 1217 --
NM_002834chr122877 198 1984 1856 1915
NM_002835chr72759 147 --1493 --
NM_002844chr621064 73 --141 11002
NM_002858chr131344 292 24 --1258 --
NM_002886chr374096 3272 3207 1734 1333 673 335 1862 21111 1083 --
NM_002892chr1421588 485 --1211 --
NM_002912chr6----1690 --
NM_002926chr471154 1139 1054 889 730 333 113 2917 263 ----
NM_002941chr321483 1266 --11066 --
NM_002968chr162374 334 --1284 --
NM_002971chr3----1413 1127
NM_002996chr165767 742 459 410 191 ------
NM_003010chr1782037 1938 1798 950 915 825 812 328 12440 ----
NM_003011chr941578 1403 1241 1220 --1305 --
NM_003071chr3----1686 --
NM_003107chr622081 278 --11916 11883
NM_003114chr82231 93 --1170 1703
NM_003137chr611484 --1460 11977
NM_003139chr11--1174 191 --
NM_003144chr612200 --21855 40 --
NM_003151chr2------1214
NM_003156chr1141187 987 198 144 ------
NM_003173chrX101408 1370 1251 1151 1090 350 133 123 113 103 ------
NM_003204chr1761770 1709 327 73 67 61 ------
NM_003205chr152702 97 --22065 1424 --
NM_003222chr2021267 775 ------
NM_003246chr152270 154 1693 ----
NM_003270chrX11022 --21120 1034 11224
NM_003292chr142188 2163 1800 45 --11699 --
NM_003304chr3------169
NM_003340chr421017 307 ----128
NM_003341chr3------1572
NM_003344chr7101454 1442 1380 1131 1119 689 461 444 275 186 --11740 --
NM_003347chr2251968 1922 1510 861 757 1704 --1174
NM_003370chr19----1793 --
NM_003385chr22283 140 --1227 --
NM_003395chr1--5505 425 344 153 72 ----
NM_003405chr22--1129 ----
NM_003412chr342745 2092 755 748 --21054 134 --
NM_003413chrX----11282 --
NM_003425chr19------1631
NM_003466chr271944 1850 660 519 460 332 49 12052 ----
NM_003471chr322246 1610 32179 1664 861 1901 --
NM_003478chr1152894 2585 1301 1077 970 1368 11126 22419 232
NM_003488chr172890 626 1757 --1930
NM_003489chr2183322 2971 2621 1324 1042 935 905 54 21058 952 ----
NM_003498chr1672123 884 716 517 283 159 106 12104 1328 --
NM_003558chr92130 93 ------
NM_003615chr343781 2972 1372 1031 ----12447
NM_003618chr2----198 --
NM_003629chr163116 2810 2411 2396 951 738 --23498 3149 --
NM_003632chr173715 600 248 ----1627
NM_003633chr522401 2144 1690 31995 246 139 --
NM_003644chr1796479 5958 5479 5244 4680 4652 4449 2582 2234 66038 5257 4962 4837 1518 1510 36252 5898 4147 12381
NM_003701chr1331094 881 746 ----1421
NM_003718chr71484 ------
NM_003743chr22780 760 12247 --196
NM_003750chr101135 --1952 --
NM_003768chr131493 693 110 2652 361 11777 --
NM_003787chr182524 507 ------
NM_003791chr163597 555 143 ------
NM_003822chr163201 2955 2872 2694 549 536 23027 625 1124 --
NM_003850chr13--1626 --1262
NM_003877chr1241017 949 229 75 --1808 --
NM_003878chr8----166 --
NM_003884chr351593 1309 1168 678 462 --1302 11379
NM_003885chr1772608 2324 2005 1843 1717 853 261 --11659 12390
NM_003913chr623244 172 13758 2793 475 14302
NM_003924chr431693 280 245 ------
NM_003939chr1083932 3666 3017 2866 1666 628 65 27 --1416 --
NM_003941chr752284 1944 1756 164 143 --12211 --
NM_003955chr175571 425 407 380 177 --11438 --
NM_003980chr631434 1421 456 ----11097
NM_003993chr12230 126 ------
NM_004056chr81180 --1118 --
NM_004079chr192523 2493 1097 928 623 556 395 229 204 --1651 --
NM_004080chr7--21402 1133 1310 --
NM_004093chr1353160 2932 2190 1195 22 22144 560 13179 --
NM_004096chr1011687 --11886 --
NM_004112chr1711517 --31536 1420 63 11163
NM_004140chr178728 706 278 192 125 99 70 32 ----1108
NM_004170chr931433 1209 465 --11496 --
NM_004171chr11166949 6754 6354 6340 6230 5866 3685 3545 2724 2536 1689 987 946 665 528 122 18719 49616 7918 2919 636 15922
NM_004183chr113734 122 45 ------
NM_004200chr11102950 2740 2659 2502 2189 2117 2058 1047 1017 819 ------
NM_004236chr151397 1509 --1389
NM_004242chr61399 ------
NM_004274chr1453165 3092 2668 2057 441 --12923 --
NM_004302chr1252927 2490 2062 1824 653 12714 1529 --
NM_004311chr1032188 1903 1073 --11012 --
NM_004321chr283343 2565 2320 2178 1251 893 152 73 --1489 12389
NM_004330chr151396 --1102 --
NM_004331chr882673 2352 1875 1848 1769 1042 74 36 1343 --12458
NM_004342chr741681 662 337 215 11626 12185 --
NM_004349chr8------21219 849
NM_004354chr4----1721 --
NM_004370chr62358 177 --1479 --
NM_004379chr261765 1598 1574 186 59 24 ------
NM_004386chr192497 435 --12327 --
NM_004389chr22181 84 ----1576
NM_004392chr1382601 2540 2528 2052 1810 465 205 186 --1262 --
NM_004393chr352008 1908 680 656 521 21497 82 22235 505 --
NM_004423chr382423 2061 1950 1853 1788 689 531 506 --21052 196 --
NM_004426chr124773 455 401 62 ------
NM_004428chr1----2606 67 --
NM_004432chr91232 --1335 --
NM_004454chr332054 1482 520 --12216 21767 353
NM_004458chrX32146 906 41 --21890 1697 --
NM_004501chr193485 3452 3342 1475 785 695 666 608 110 --23517 983 --
NM_004504chr262955 2878 2414 2317 1224 560 12687 1191 1127
NM_004514chr1752492 1047 318 231 198 1632 ----
NM_004516chr192439 197 11061 --21045 150
NM_004537chr1211545 ----134
NM_004538chrX--190 ----
NM_004583chr17--1176 ----
NM_004586chrX105329 4338 3550 1736 1686 1569 1376 1286 564 527 31640 1312 89 ----
NM_004593chr33838 626 336 --125 --
NM_004615chrX3611 110 37 ----1690
NM_004654chrY2373 226 11330 21308 1243 --
NM_004655chr1731040 428 215 21158 1152 ----
NM_004660chrY61983 1906 1796 862 614 404 ----195
NM_004709chrX21244 66 11362 1161 --
NM_004742chr311687 --31561 1431 1310 --
NM_004748chr1533883 3097 2639 ----13457
NM_004755chr14----2141 111 --
NM_004774chr1743112 2480 2361 250 --33152 2532 2258 --
NM_004781chr12596 421 11136 165 --
NM_004788chr1162742 2662 2316 1024 731 183 --12718 --
NM_004792chr2157 ----1168
NM_004794chrX185 ------
NM_004798chr20113417 3401 2289 2239 1105 606 594 482 354 174 150 13022 11431 --
NM_004801chr2------2527 474
NM_004805chr2--31340 1014 80 ----
NM_004815chr184564 4557 4393 4188 3937 1705 1263 592 --33341 1412 670 --
NM_004836chr22947 835 ------
NM_004845chrX84025 3605 3504 3109 1519 1397 526 350 2963 292 1375 --
NM_004849chr6196 ----1462
NM_004852chr181913894 13141 11148 10998 10071 9746 9385 8880 8834 5719 5304 4711 3793 3692 3610 3084 2653 755 617 213678 9454 312924 11483 2867 313687 9180 1176
NM_004857chr1444088 2990 1259 721 ----14615
NM_004859chr1761236 1150 415 303 289 148 --1560 --
NM_004865chr6----150 1401
NM_004869chr1811391 ----11540
NM_004922chr102962 718 ----1732
NM_004984chr12--129 182 --
NM_004992chrX208170 6769 6546 6305 6227 6023 5933 5861 5830 5652 5566 5550 5369 2528 2085 1643 1447 1366 1117 635 28478 2969 48463 8179 6777 6068 --
NM_005065chr14134853 4785 4772 4332 4016 3317 2155 1627 1477 1466 1360 151 49 24403 63 21093 463 --
NM_005080chr221814 --1198 1158
NM_005105chr1----184 --
NM_005124chr64715 707 660 100 ----1294
NM_005156chr934335 3340 1806 11297 11438 1576
NM_005180chr1021353 595 ----1402
NM_005202chr142165 906 684 372 --32319 1674 140 --
NM_005203chr10------1133
NM_005225chr204948 452 440 89 ----1982
NM_005238chr1163540 3297 2777 1311 1278 487 --13004 --
NM_005249chr141275 --1771 --
NM_005316chr113396 118 69 2157 52 ----
NM_005318chr2211198 ----11149
NM_005328chr8----2584 201 --
NM_005329chr1642310 1518 527 340 21481 256 1369 1867
NM_005336chr27698 677 616 570 524 199 72 21806 857 133 --
NM_005358chr1321368 230 --1722 --
NM_005402chr731294 1223 573 --1530 --
NM_005412chr12----1365 --
NM_005413chr2--1396 ----
NM_005414chr3--193 1267 --
NM_005433chr1842207 584 371 51 --22132 33 --
NM_005436chr1083990 3859 3237 3176 1599 1267 735 483 ----1386
NM_005458chr932117 1939 638 22054 259 12493 1290
NM_005461chr2041286 599 504 112 --11848 1631
NM_005475chr1252019 1105 756 333 63 --33094 2823 1311 --
NM_005504chr12126601 6194 5946 5548 5504 5086 1982 1214 591 563 199 101 12431 36175 4992 2601 --
NM_005509chr521642 1241 ----11590
NM_005520chr51753 ----1581
NM_005537chr1321024 832 ----1700
NM_005561chr13----1108 --
NM_005569chr2271448 1403 620 363 357 282 228 --1390 --
NM_005573chr52581 127 152 1706 --
NM_005596chr954172 3909 2566 2484 2368 ----21321 1185
NM_005611chr164377 249 108 36 ------
NM_005626chr1--1492 ----
NM_005668chr533382 3032 803 1164 ----
NM_005690chr12----143 --
NM_005708chr13----1139 --
NM_005711chr5175 --1168 1772
NM_005717chr131264 256 24 ------
NM_005730chr12113577 3493 3384 3103 2770 2694 2378 2338 557 208 198 32347 2291 1277 32686 711 677 --
NM_005731chr22348 52 ----1150
NM_005737chr242047 771 441 225 ----12147
NM_005748chr1253472 3375 2750 2337 486 --22423 823 --
NM_005776chr144762 615 104 95 ----1268
NM_005779chr563546 3307 2232 1205 911 236 1351 22661 1467 --
NM_005786chr181373 11113 ----
NM_005802chr91248 --1815 --
NM_005813chr242531 2489 2257 65 188 12635 12294
NM_005819chr173123 3047 2976 2230 1287 1075 675 11120 22985 433 --
NM_005859chr541174 1116 591 194 --1131 11060
NM_005860chr19171574 1433 1427 1401 1307 1216 656 632 608 584 560 536 512 488 464 440 207 11284 11268 --
NM_005869chr51289 --2115 28 --
NM_005871chr103869 358 334 --1409 --
NM_005880chr1641543 1440 1432 436 1398 ----
NM_005885chr531469 327 21 ------
NM_005898chr1111000 11253 --13000
NM_005899chr1771493 1288 1054 144 106 97 30 ------
NM_005906chr6----11376 --
NM_005909chr563833 3605 2863 2623 1145 116 ----1860
NM_005910chr17123858 3838 3743 3624 2622 2528 2506 1060 986 750 714 455 43992 3229 1641 667 1140 --
NM_005924chr71133 --1215 1373
NM_005933chr11102890 2880 2021 1926 1904 1211 1170 852 796 283 21978 834 --1620
NM_005935chr415075 --54508 3689 3281 1958 1059 15173
NM_005941chr862977 1273 1219 205 110 50 33577 1617 676 ----
NM_005966chr242399 1493 787 353 --22154 450 --
NM_005967chr121130 ------
NM_006011chr15103983 3525 3406 3048 2687 1626 1444 1085 388 173 1157 12703 --
NM_006015chr111232 1962 --11200
NM_006016chr622287 748 11623 1770 --
NM_006022chr131853 1992 175 --
NM_006038chr2032016 1352 384 1102 1790 --
NM_006047chr2043556 2382 1289 1130 --192 --
NM_006054chr1121087 550 1279 --1106
NM_006080chr713005 1962 141 12350
NM_006094chr82572 346 --11831 --
NM_006133chr11102145 2109 1510 741 732 468 359 281 249 67 32248 1563 508 1259 --
NM_006135chr121472 1056 --1977 --
NM_006141chr1622362 56 ------
NM_006148chr1782185 2136 1809 1042 816 377 301 279 1664 1101 12720
NM_006154chr154895 531 347 233 1754 ----
NM_006160chr1721287 160 --11083 --
NM_006162chr1841648 1590 1452 1396 --11437 --
NM_006166chr1242285 2235 2122 626 12192 11605 --
NM_006177chr1421062 892 1961 --1373
NM_006186chr21207 ----21000 196
NM_006201chrX6454 445 433 143 121 102 ------
NM_006224chr1732022 1979 696 --1219 --
NM_006228chr84377 362 348 93 1142 ----
NM_006237chr1322088 1618 1112 11728 1534
NM_006243chr1----1779 11006
NM_006246chr1431218 481 143 --132 --
NM_006254chr3146 ------
NM_006267chr21391 --11878 --
NM_006290chr61555 ------
NM_006304chr72107 34 ------
NM_006313chr1221064 145 ----11109
NM_006322chr13----1931 --
NM_006325chr123676 669 659 1199 ----
NM_006328chr112654 224 ------
NM_006380chr1774298 3886 3065 1403 1221 629 301 12854 ----
NM_006464chr2124230 4096 3963 3050 2923 1599 1531 1301 1078 761 356 153 23420 231 23517 663 --
NM_006517chrX31893 692 101 --22111 1594 --
NM_006519chr61252 --2275 260 --
NM_006520chrX31693 627 546 --21686 1269 --
NM_006526chr201409 --1433 21805 151
NM_006532chr1931983 718 314 1471 1416 --
NM_006538chr273884 3750 3517 3480 2850 1367 836 --24034 3590 1636
NM_006540chr841052 501 101 45 ------
NM_006559chr1----1336 --
NM_006565chr16--11223 1178 --
NM_006574chr3----1264 --
NM_006587chr421377 457 21412 76 11641 --
NM_006599chr16128200 7800 6454 6309 5927 5434 2751 2205 1404 1387 1329 1287 11163 27960 1561 --
NM_006601chr12----2445 138 --
NM_006621chr161958 1820 1809 1750 1425 619 --1170 1350
NM_006628chr1533018 1164 509 11824 3915 526 27 --
NM_006667chrX21095 111 ----1463
NM_006670chr6--2509 458 --1563
NM_006690chr2052292 1871 1781 531 448 --1573 11498
NM_006713chr52779 50 ----128
NM_006717chr963335 2544 930 766 754 679 22399 2110 ----
NM_006729chrX85293 4243 1292 968 835 594 265 188 35627 5550 3498 12031 14657
NM_006743chrX5941 842 615 244 149 ----1379
NM_006750chr16157707 7685 7623 7602 6830 6697 5988 5821 5434 2191 1623 1259 649 592 453 21378 121 37487 4984 1037 --
NM_006761chr173833 781 96 ----1671
NM_006762chr131174 986 146 --2123 56 --
NM_006805chr551649 1605 420 366 171 --21144 346 --
NM_006814chr2042311 2245 773 169 ------
NM_006818chr1----1126 --
NM_006852chr1751983 1759 1089 415 313 --12525 2323 107
NM_006857chr22883 627 ----180
NM_006875chrX----1225 --
NM_006888chr1453509 2663 2655 2152 1244 11272 --1168
NM_006920chr23822 397 46 11740 1300 --
NM_006930chr52529 141 21451 241 ----
NM_006939chr14----1833 --
NM_006981chr921985 45 --22954 913 1185
NM_006996chr131729 452 254 --1744 --
NM_007005chr931241 1050 158 --1190 --
NM_007007chr1243452 1306 947 741 --21224 223 2154 102
NM_007008chr22911 166 ----1281
NM_007011chr15166519 6344 6101 5634 5468 5220 4796 4524 4476 2287 1746 1098 684 475 142 94 14842 34312 2603 2180 --
NM_007026chr17146 --1553 --
NM_007038chr2165028 4491 4187 2262 1371 213 --35720 554 143 15944
NM_007043chr1242145 1812 623 425 ----1634
NM_007050chr2096452 6084 5825 5637 2841 2780 1080 625 303 48015 7798 7086 807 46918 2858 2708 22 33054 2832 582
NM_007067chr1721286 287 --11238 --
NM_007084chr1311579 11267 1304 --
NM_007106chr1342499 1951 1806 493 ------
NM_007114chr341337 968 870 506 22103 1174 11120 1695
NM_007118chr53633 55 37 1907 ----
NM_007129chr131108 --1913 --
NM_007170chr11713 --1882 --
NM_007175chr832333 1049 853 --12565 32655 1374 1316
NM_007185chr14395 335 284 85 ------
NM_007189chr7101513 1424 1355 1213 1128 503 339 301 186 58 21279 1017 1146 --
NM_007195chr1853671 3630 2733 2280 928 --12506 13606
NM_007202chr171709 1175 128 --
NM_007236chr1532088 824 49 --1157 --
NM_007247chr171902 1429 2742 283 --
NM_007249chr13118431 7569 6938 6869 6606 3309 3107 787 599 471 444 36480 1456 533 47496 7005 3298 2652 16487
NM_007276chr72915 328 1965 ----
NM_007286chr551824 1369 1359 444 59 21935 784 ----
NM_007363chrX----1805 --
NM_007372chr17----1752 --
NM_007375chr122567 891 12463 --12415
NM_012082chr8------1617
NM_012090chr13891 384 378 --1332 --
NM_012092chr261703 1653 1337 288 137 54 11262 --1368
NM_012098chr9------11572
NM_012104chr1163750 3512 2857 2711 755 90 23018 188 13677 --
NM_012134chr171761 1603 1246 755 666 98 25 ------
NM_012156chr2033203 2112 1087 33073 2796 506 ----
NM_012158chr1331647 410 376 --1694 --
NM_012164chr996591 6109 4578 2655 2526 2450 2352 2057 695 --26054 335 21906 1168
NM_012189chr18--1123 ----
NM_012193chr1195241 5125 4403 4163 3749 3422 1641 1367 1178 13598 --11110
NM_012207chr1011086 --11060 --
NM_012223chr2------11053
NM_012232chr1741971 1901 1862 838 2690 586 12225 --
NM_012234chr363101 3039 2955 937 667 61 11326 1288 1764
NM_012238chr1031495 1145 466 --11213 --
NM_012247chr1011033 ----11002
NM_012249chr232204 1387 107 --1125 1368
NM_012256chr71822 --11168 --
NM_012262chr174355 4075 3426 3330 1314 1207 1157 35085 5041 888 ----
NM_012281chr721944 193 22409 642 ----
NM_012288chr6105590 5540 4714 4347 2099 1608 1445 943 463 449 24999 1512 2737 123 --
NM_012290chr2----1480 --
NM_012297chr441824 762 593 453 22319 513 ----
NM_012301chr711818 --12000 --
NM_012307chr182907 191 21037 294 --1752
NM_012308chr1162393 1859 667 279 263 182 1328 42453 2422 1772 951 --
NM_012309chr1174751 4566 4483 4043 802 715 485 24758 3505 33694 3613 268 --
NM_012316chr1145177 5090 5013 4698 4408 4247 4225 3888 3618 3552 2246 1796 1408 139 21013 648 25660 1601 --
NM_012326chr24835 769 716 308 ----1805
NM_012347chr642614 1953 1887 958 21187 655 21999 480 --
NM_012416chr9----1209 --
NM_012433chr2----153 --
NM_013250chr111173 --11385 --
NM_013261chr463680 3470 2889 2482 802 663 ------
NM_013286chr373473 2985 2914 2700 2654 551 60 --43491 3315 2784 331 --
NM_013316chr731081 1003 992 1917 1334 --
NM_013354chr8----2506 459 --
NM_013372chr1553338 2682 1108 409 246 --3848 451 134 --
NM_013377chr12----1441 1276
NM_013433chr1931766 1416 176 ----1545
NM_013436chr22782 86 156 ----
NM_013437chr841003 521 466 157 ----1137
NM_013438chr921138 69 1552 ----
NM_013449chr1221112 74 --161 --
NM_013960chr81564 2706 64 ----
NM_013995chrX32323 1957 406 ----1993
NM_014011chr242573 2238 1030 142 ----12525
NM_014015chr162254 155 1305 1759 --
NM_014043chr321302 600 ------
NM_014048chr1633830 1504 144 13286 34631 4102 572 --
NM_014112chr855498 4200 3966 3907 3687 14822 3991 239 108 11972
NM_014117chr1632581 2410 1728 12705 ----
NM_014153chr16------1661
NM_014154chr311545 11510 ----
NM_014232chr1731317 487 325 --21463 662 --
NM_014264chr41170 ------
NM_014268chr181998 --1109 --
NM_014271chrX------149
NM_014283chr111556 --21256 540 --
NM_014288chr1149 --194 --
NM_014293chr22114125 3840 3779 3460 3111 3025 1507 1310 804 671 35 22605 142 2233 79 --
NM_014294chr81210 11300 142 --
NM_014296chr331539 1148 135 --21330 449 --
NM_014319chr1221947 1498 1404 21702 1293 11419
NM_014335chr152467 101 --21250 957 --
NM_014372chr1----1605 --
NM_014382chr331371 1107 277 --1154 --
NM_014399chr73887 332 197 1286 ----
NM_014405chr1792320 2217 1796 1673 1502 929 640 470 309 ------
NM_014408chr1----1124 --
NM_014423chr565133 4677 3938 1245 531 520 13985 34559 4341 1949 1220
NM_014445chr331543 691 47 ------
NM_014452chr61808 --1969 --
NM_014458chr1--1155 ----
NM_014491chr71936 2795 740 ----
NM_014494chr161674 2664 76 22143 2100 --
NM_014498chr3----167 --
NM_014562chr23535 172 39 2338 144 ----
NM_014613chr583003 2399 2360 1153 1008 799 767 429 22434 410 1200 --
NM_014615chr1683393 3334 2885 2686 2581 1152 320 286 13326 43537 2662 857 463 13067
NM_014616chr3113388 3262 2791 2692 2544 2451 1227 844 648 520 196 12860 1398 --
NM_014620chr121252 ----1754
NM_014636chr9114112 3770 3685 3400 3103 2896 996 826 793 751 182 33091 1026 277 1358 --
NM_014665chr883341 2749 2635 2237 1250 646 416 193 23624 2652 12577 --
NM_014682chr8--21875 1621 1675 --
NM_014683chr1731853 743 460 --1183 --
NM_014701chr1563309 3302 2352 1231 1059 933 ------
NM_014705chr7121 --1129 --
NM_014709chr21526 ----1178
NM_014723chr2043089 2159 795 28 23236 904 1983 --
NM_014729chr8--12112 21634 920 --
NM_014730chr1275147 4933 3205 1974 1809 959 791 --24349 4056 11030
NM_014731chr20101630 1619 1172 1135 611 563 540 461 421 156 1433 ----
NM_014732chr16105567 5550 5410 5143 5127 5108 4654 3916 2322 644 45094 1196 676 91 --14826
NM_014751chr832117 1914 567 ------
NM_014755chr244134 3173 1407 1133 ----2937 753
NM_014767chr10103626 3338 3110 3083 2686 1131 942 883 527 520 --13346 11422
NM_014782chrX191 --1302 --
NM_014795chr2155 ------
NM_014806chr91135 ------
NM_014810chr143690 3642 3522 2260 31302 1212 865 11131 --
NM_014819chr511844 --1769 2893 45
NM_014824chr1111417 --11579 --
NM_014830chr1283326 3004 2440 2383 1130 1019 705 214 --21081 569 --
NM_014839chr151012 1000 785 237 59 ----2432 157
NM_014868chr121672 2916 589 ----
NM_014869chr341202 555 362 35 ----1271
NM_014873chr1113780 3636 3615 3524 3315 1441 1083 843 771 436 191 14680 --13106
NM_014877chr17177680 7301 7115 7051 6900 6829 6348 6142 5508 5315 5000 3046 2843 2126 1176 1111 894 1149 26538 2602 --
NM_014903chr1222027 697 ------
NM_014904chr1034012 3935 71 1143 1284 13626
NM_014906chr1764133 2771 2762 2544 1392 384 23622 200 24016 710 --
NM_014912chr1021266 94 12832 13468 --
NM_014927chrX133 ------
NM_014942chr642474 2408 423 260 ------
NM_014945chr581960 1557 1501 792 731 271 117 105 1432 ----
NM_014946chr241131 797 263 137 22836 762 --123
NM_014947chr111156 --32953 2142 93 22185 710
NM_014950chr1451276 1239 676 593 492 --2669 239 --
NM_014952chr1551878 1599 1587 457 295 --31731 1489 1298 --
NM_014962chr2041142 798 255 194 177 156 --
NM_014988chr42853 796 11886 1347 --
NM_014989chr631858 106 55 11812 ----
NM_014990chr14188 ----11096
NM_014994chr15102395 2023 1945 1919 1669 1602 870 691 603 306 1460 2290 79 --
NM_015000chr1211167 12893 --1390
NM_015020chr1661178 1068 636 592 251 57 ----2916 532
NM_015023chr161736 1728 1664 1537 582 294 --1165 1446
NM_015025chr221786 729 1169 12327 --
NM_015026chr1213070 --11181 --
NM_015039chr184079 3673 1745 1396 873 825 522 112 1145 24224 3592 --
NM_015042chr1593945 3910 3761 3585 2655 1727 1611 672 649 --23999 799 --
NM_015045chr1021748 1467 ----1197
NM_015049chr233048 1151 801 13119 1332 --
NM_015051chr943300 2559 723 247 1989 1200 1311
NM_015062chr10------1208
NM_015074chr1134643 4194 4094 4044 3928 3575 1963 1441 1324 1250 1159 1035 533 13650 13822 --
NM_015075chrX31494 432 189 --11639 --
NM_015076chr664467 4404 4278 4157 3715 1038 --11051 --
NM_015082chr562388 2086 1628 532 522 282 ----1105
NM_015093chr621317 494 11736 1214 --
NM_015110chr942246 572 216 23 --1117 --
NM_015130chr421051 269 11122 --11015
NM_015132chr7------11701
NM_015143chr451365 462 321 232 156 --1271 --
NM_015153chr62636 79 ----1551
NM_015192chr20------1275
NM_015205chr1365241 4272 729 445 216 33 12009 25248 1024 --
NM_015206chr1573004 2390 1303 1234 986 900 749 ----13452
NM_015210chr18----1367 --
NM_015215chr132788 2240 452 23004 2222 1756 1625
NM_015229chr176969 767 732 477 157 151 --21205 77 --
NM_015236chr431497 488 359 11244 ----
NM_015263chr152294 256 1391 ----
NM_015265chr262372 2356 1048 1031 836 581 --11065 --
NM_015270chr1261862 1755 1555 1533 1491 752 2793 484 ----
NM_015271chr433166 1453 711 --12810 13333
NM_015272chr1621619 130 32080 1712 1435 11336 --
NM_015282chr272608 2588 2398 2216 983 923 734 --1268 --
NM_015284chr151618 1296 383 167 63 --12119 12113
NM_015310chr867203 6606 6461 2939 2695 205 25909 1810 37954 7876 1625 --
NM_015317chr242852 2641 2552 2535 11924 11753 --
NM_015328chr752714 2442 2273 398 109 11169 12001 --
NM_015336chr1212224 1686 --12626
NM_015349chr632730 2370 1891 1452 1116 --
NM_015353chr1722550 1030 32216 795 170 1224 --
NM_015358chr211188 ----1263
NM_015396chr321024 23 ------
NM_015455chr59992 944 477 436 338 229 123 53 43 13539 2696 554 --
NM_015460chr311490 --11836 --
NM_015461chr182736 127 ----1697
NM_015464chr72933 41 --177 --
NM_015477chr157977 779 697 175 155 135 25 --1242 --
NM_015483chr72786 257 --1922 --
NM_015523chr11------1103
NM_015527chr16----1830 --
NM_015556chr141171 ------
NM_015576chr322003 635 22658 854 ----
NM_015577chr561835 1675 1398 1191 557 490 --1708 --
NM_015578chr1911739 21835 364 ----
NM_015626chr1721146 472 21176 242 ----
NM_015635chr9--1553 12008 1801
NM_015652chr102438 238 --172 1171
NM_015678chr13------2531 369
NM_015691chrX72642 2305 2229 1802 781 449 38 --22965 746 22284 1948
NM_015695chr621356 189 --11777 --
NM_015850chr882489 2148 1891 1533 660 193 146 79 ------
NM_015878chr832169 2014 1456 11902 ----
NM_015886chr835349 4987 444 2883 332 15688 15129
NM_015955chr2--130 ----
NM_015984chr12465 124 1169 ----
NM_015994chr141282 --1209 --
NM_015999chr12571 489 --1666 --
NM_016019chr73838 296 137 21050 949 1154 1204
NM_016022chr12185 35 ----1223
NM_016061chr251563 1178 456 378 304 ------
NM_016084chr171171 ----1550
NM_016107chr511171 ------
NM_016131chr232209 1740 241 --1883 12154
NM_016132chr1512499 --22334 1227 --
NM_016133chr21175 --21429 613 --
NM_016151chr16----1355 --
NM_016154chr194325 268 118 24 --186 --
NM_016195chr10------156
NM_016205chr441133 552 513 445 ----1962
NM_016206chr3148726 8552 8260 8170 7624 7232 3051 2686 2639 2414 2061 1382 1229 799 --1502 --
NM_016252chr21913 1166 ----
NM_016255chr653121 2613 2586 2326 168 11321 1186 13270
NM_016271chr1841504 447 411 85 134 ----
NM_016272chr2232759 2597 431 11071 --12184
NM_016289chr232042 1746 660 --1103 --
NM_016322chr932578 2547 957 12089 11003 --
NM_016338chr521045 802 --279 58 --
NM_016353chr842229 452 373 281 21538 574 11587 --
NM_016374chr11212 11549 --1516
NM_016403chr112720 274 --1237 --
NM_016441chr242051 1884 364 83 22392 1514 151 --
NM_016472chr141116 --1390 --
NM_016485chr64758 503 348 127 1908 ----
NM_016492chr17137 --1140 --
NM_016526chr1172035 1695 1580 881 754 508 333 11887 131 --
NM_016531chr454100 3130 1219 1185 547 43567 3428 3033 597 11026 14118
NM_016559chr32479 357 --2970 509 11111
NM_016562chrX31590 1446 1033 21144 1052 ----
NM_016577chr342987 1669 1639 1608 --23849 3171 34343 1420 1326
NM_016592chr2061001 497 392 245 203 57 ------
NM_016605chr532590 830 90 11013 12186 --
NM_016618chr2------1439
NM_016623chr8122 ------
NM_016628chr10148 --1335 --
NM_016821chr32118 38 --182 1413
NM_017420chr1433035 1102 311 1143 13254 --
NM_017423chr43886 409 114 2620 179 2425 75 --
NM_017540chr572799 2715 2556 2366 2059 1186 991 21284 463 --13084
NM_017544chrX2889 681 ----1323
NM_017548chr352005 1753 1701 1561 492 12015 1531 1272
NM_017590chr2262708 2429 2422 2223 352 217 --12675 --
NM_017596chr1104696 4103 3644 3361 2844 1015 942 621 523 346 1366 14058 --
NM_017602chrX1193 ------
NM_017610chr1562064 1882 1859 1661 1487 85 1828 --1301
NM_017629chr131870 1816 269 11239 ----
NM_017693chr1331369 421 236 --11297 --
NM_017694chr221756 1265 --11805 --
NM_017724chr31732 --2808 623 --
NM_017744chr132020 1573 635 12119 ----
NM_017745chrX1457 ------
NM_017799chr1411851 --21875 24 11570
NM_017811chr952807 1106 726 614 70 13148 1395 12012
NM_017913chr92347 56 ----1301
NM_017922chr141620 --1105 --
NM_017925chr921720 510 --11288 11302
NM_017944chr1182939 2928 2521 2483 2262 1947 1892 789 --11105 --
NM_017952chr254274 3797 3321 1751 627 44240 3264 1686 1307 23950 3812 1292
NM_018027chr1062505 2038 978 884 260 124 22717 2126 23232 512 --
NM_018031chr32439 40 ----1581
NM_018045chr192851 2809 2678 1983 1025 813 484 435 253 22429 188 21260 1058 --
NM_018061chr121598 1109 11706 152 --
NM_018067chr11183 ----1143
NM_018078chr41856 1872 --1793
NM_018086chr241780 1377 1192 572 --157 --
NM_018113chr124153 101 94 46 1138 ----
NM_018133chr321856 851 --182 12187
NM_018150chr13238 204 44 190 ----
NM_018184chr341580 1546 1342 233 --31735 1674 855 12022
NM_018214chr6----11168 --
NM_018243chr482825 2775 2539 1205 885 642 384 37 1334 1812 11266
NM_018244chr203872 365 178 --21064 519 --
NM_018270chr201209 --1714 1825
NM_018287chr1011027 --2456 21 --
NM_018323chr411328 --21419 74 --
NM_018362chr1143793 3641 2749 1075 --1428 --
NM_018364chr133426 2562 1596 12673 13227 --
NM_018373chr14136284 6100 4762 4502 4306 3966 1536 1486 1364 1300 1205 805 769 26092 5240 12481 --
NM_018383chr251466 830 788 466 183 ----188
NM_018482chr82877 469 12264 1825 21912 1682
NM_018489chr122030 1669 --1710 --
NM_018509chr172612 101 2581 234 ----
NM_018557chr21526 ------
NM_018638chr1285345 4877 4806 4249 3716 1818 1154 731 11444 23908 3731 1228
NM_018667chr1642019 1069 1038 140 22031 390 12608 --
NM_018717chr421095 879 --22404 777 --
NM_018834chr5--1879 --1274
NM_018836chr11826 --1388 2897 80
NM_018898chr532114 1812 1560 2694 353 --2683 125
NM_018951chr731105 361 88 ----11068
NM_018955chr17----1110 --
NM_018977chrX3759 301 214 1150 --1749
NM_018979chr12----12651 --
NM_018999chr1053959 1696 968 743 508 24826 3373 --21512 835
NM_019008chr2273714 3592 3117 2736 2355 1448 434 --13577 --
NM_019046chr104833 781 113 49 1208 194 --
NM_019050chr43492 189 21 ----11736
NM_019063chr222215 2157 ------
NM_019080chr1321111 373 ----1498
NM_019084chr1052023 1948 1877 395 326 ----1535
NM_019106chr2273056 2445 2180 954 660 456 191 22576 2470 13224 1400
NM_019114chr942354 583 566 282 --12241 1373
NM_019116chr16103516 3353 3308 3214 2487 872 727 315 261 124 23422 66 ----
NM_019605chr11562 ------
NM_019606chr73542 183 56 1126 ----
NM_019610chr132147 2008 491 --11542 1599
NM_019885chr262876 2456 2195 840 512 115 11987 167 --
NM_019886chrX3490 135 104 ------
NM_020116chr411538 --11678 2684 511
NM_020122chr2116016 5134 5023 4948 4783 4634 4391 3693 878 669 584 23647 1795 25430 723 --
NM_020123chr1051497 1423 609 511 364 ----159
NM_020144chr71265 11948 1278 --
NM_020148chr1832297 507 474 1579 22535 1055 12099
NM_020168chr1561105 547 395 170 76 21 1512 163 --
NM_020177chr522842 548 ----11197
NM_020189chr8----151 --
NM_020193chr112425 252 --133 --
NM_020310chr1792827 2783 2641 2271 1116 804 590 243 48 22063 1999 11955 12817
NM_020338chr1063449 3301 1449 1287 448 80 21327 1251 1866 23630 2486
NM_020342chr232188 1658 474 --11937 1623
NM_020346chr111168 ----191
NM_020363chrY61343 491 427 278 209 84 1348 --1375
NM_020432chr71585 --1360 --
NM_020438chr921015 205 --41187 979 957 422 --
NM_020440chr172312 2162 1096 845 573 489 398 33238 2981 1116 13062 --
NM_020452chr121599 617 32124 664 440 ----
NM_020466chr6114762 4733 4655 4633 4584 4200 4032 1879 1775 551 384 33909 3791 3451 11927 --
NM_020526chr151787 296 252 216 152 21732 711 ----
NM_020644chr111326 1792 2258 143 --
NM_020647chr882321 2255 1758 691 668 578 181 159 11643 1287 --
NM_020689chr202605 385 --11552 --
NM_020699chr1105039 4990 4525 4505 4377 4369 3567 1558 718 639 25416 4245 24396 3889 --
NM_020702chr911796 1720 --1249
NM_020718chr1675846 5806 5482 4530 1962 1949 1848 --34569 743 348 11722
NM_020734chr1222731 1346 2843 426 --174
NM_020742chrX32532 591 556 ------
NM_020748chr1721419 757 11341 11979 157
NM_020752chr1042825 2295 2191 654 ----1617
NM_020760chr211903 1502 --11388
NM_020764chr162244 223 ------
NM_020774chr1854780 4478 4388 1460 652 21233 961 25612 2311 --
NM_020775chr1123 --2190 57 --
NM_020801chr551802 855 533 521 427 ------
NM_020803chr442267 2152 1828 446 12337 --1964
NM_020805chr181157 1364 --1287
NM_020810chr1463334 3300 3262 2719 457 444 1660 12740 --
NM_020824chr10----1742 --
NM_020834chr1421931 601 --11241 --
NM_020845chr1282280 1891 1749 917 797 663 655 546 --21986 342 1421
NM_020850chr1683230 3072 2714 2688 2577 973 872 793 --12629 --
NM_020856chr1911124 ------
NM_020858chr1572357 959 851 560 462 313 193 11575 1155 --
NM_020896chr111312 --170 --
NM_020925chr131173 245 232 --1383 1305
NM_020949chr31187 --157 --
NM_020956chr19154783 4724 3212 3199 3168 3161 1526 1216 1101 1050 1016 704 658 414 235 ------
NM_020981chr23782 630 522 1531 ----
NM_021004chr142324 298 ----1361
NM_021005chr15----1240 --
NM_021019chr12----1196 --
NM_021025chr51377 ------
NM_021033chr132693 504 1225 11027 183
NM_021038chr313220 --12731 12482
NM_021072chr542491 836 558 208 11759 --1899
NM_021097chr241077 858 513 103 12413 ----
NM_021103chr2--171 ----
NM_021140chrX3968 912 721 ------
NM_021155chr1952974 2665 2177 1179 810 --12958 12059
NM_021165chr1147 --1848 --
NM_021183chrX22558 88 1575 1118 --
NM_021219chr211201 --1158 --
NM_021222chr141430 1180 992 437 1279 --1233
NM_021238chr1231571 325 316 1769 1699 --
NM_021245chr101202 --1218 --
NM_021633chr131122 868 422 ------
NM_021637chrX1975 ----1121
NM_021639chr13742 186 27 --1918 --
NM_021728chr14----1202 --
NM_021813chr685276 4424 3985 3633 1499 1352 79 62 45459 4630 4074 860 22217 1057 --
NM_021914chr141449 1612 ----
NM_021938chr192355 45 ----1106
NM_021956chr631060 1048 986 --188 --
NM_021964chr395522 4825 4817 4749 2155 2127 1076 604 409 --1245 --
NM_021965chr931238 1171 78 --11357 --
NM_021998chrX----11027 --
NM_022048chr1584977 2490 1408 1372 1309 836 471 196 2919 56 22119 1298 24303 636
NM_022051chr12200 60 --1467 --
NM_022062chr1141906 1657 252 159 --1710 --
NM_022072chr3----1243 --
NM_022143chr731045 383 185 1579 1256 --
NM_022166chr1696122 5934 5246 4857 4384 4338 4009 1406 792 --45053 4688 3921 180 12503
NM_022170chr751489 1325 1238 100 54 2585 440 ----
NM_022362chr102342 41 ------
NM_022470chr341254 818 317 152 --161 --
NM_022482chr2012212 2632 198 22580 1653 1147
NM_022484chr711368 --159 --
NM_022574chr772198 2164 1884 1622 847 579 462 ----175
NM_022658chr122323 136 1148 --1884
NM_022719chr2253554 3179 3086 2695 1125 23338 322 1441 144
NM_022726chr6----1564 1473
NM_022737chr1971307 1282 521 467 306 285 156 1226 21116 337 --
NM_022763chr352859 2656 1228 785 603 12204 11217 --
NM_022781chr982853 2484 1320 1207 981 807 561 77 --21106 852 --
NM_022826chr2----1883 --
NM_022841chr1522693 158 1327 12006 --
NM_022893chr243067 2925 779 187 --23158 2517 --
NM_022894chr22496 222 1166 ----
NM_022897chr5----1422 --
NM_022898chr1454855 3327 362 73 67 33951 987 30 24272 146 --
NM_023112chr1451933 771 504 273 170 --22732 29 --
NM_024052chr1762752 753 657 238 75 38 --12560 --
NM_024060chr11--2232 117 ----
NM_024430chr1831543 585 388 ----11662
NM_024496chr142837 672 --1768 --
NM_024539chrX123 --1167 --
NM_024567chr8------198
NM_024574chr4--1104 ----
NM_024631chr11------1227
NM_024665chr332931 1239 711 13682 33649 1722 229 1450
NM_024670chr1031768 1602 1536 --1365 1643
NM_024713chr15----21614 170 --
NM_024721chr862601 873 726 622 465 266 ------
NM_024742chr1691282 1247 779 755 720 671 629 606 26 ------
NM_024792chr1731094 1063 343 --1163 --
NM_024814chr7----1372 --
NM_024887chr132090 513 435 --11756 --
NM_024911chr12645 622 ----1820
NM_024922chr1651600 788 620 527 459 11437 ----
NM_024947chr3139223 8465 8348 7593 7544 6961 6019 3808 3728 2510 596 74 54 19485 29459 6213 --
NM_024956chr15--1171 ----
NM_024969chr23292 266 104 --1285 --
NM_025054chr8123946 3134 3015 2899 1417 1278 1156 886 737 438 223 74 ------
NM_025057chr142869 126 --1485 --
NM_025074chr433020 2984 2775 ------
NM_025137chr15--2315 309 ----
NM_025138chr1351432 1019 498 249 68 ----11168
NM_025179chr184740 4685 4446 4116 3907 3710 666 36 23098 783 24478 3921 --
NM_025181chr22648 154 --1256 --
NM_025191chr142635 1195 1105 155 --32722 2488 1412 --
NM_025195chr831922 580 325 1633 21643 421 --
NM_025208chr1132197 1987 30 12100 1640 1106
NM_025244chr2----1240 --
NM_030571chr541646 614 371 111 168 ----
NM_030576chr1752656 2547 758 556 469 --1421 --
NM_030623chr221447 202 --1128 --
NM_030625chr1032306 2176 647 12118 --1825
NM_030627chr533358 1627 1246 --12762 13252
NM_030636chr752272 2049 1467 804 264 --2519 222 --
NM_030647chr7146334 5812 5742 5324 5020 4946 4870 3925 1964 1317 1055 189 136 60 16057 --11136
NM_030648chr475539 5141 4949 1132 278 42 29 31960 1167 408 13390 --
NM_030665chr174216 175 75 43 --1919 --
NM_030751chr1031559 1311 756 ----189
NM_030806chr1109018 7224 6262 3552 3187 2211 2181 1956 1652 238 48973 8620 8558 1514 23506 3140 37687 6883 167
NM_030816chr153131 2879 770 427 257 13499 32989 2895 878 12865
NM_030906chr11----2586 451 --
NM_030915chr231955 1938 903 2637 135 12141 11788
NM_030918chr175179 5171 5024 4754 1772 1766 1599 --44356 3293 1431 1074 --
NM_030938chr1711131 ----2253 100
NM_031216chr1831963 1397 614 --1126 --
NM_031417chr1932717 2307 666 41045 972 891 112 ----
NM_031442chrX32008 1082 419 22804 339 13119 2728 188
NM_031445chr232732 2250 190 --1745 --
NM_031483chr2073547 3107 2782 2585 2351 1419 826 21293 761 12596 1627
NM_031886chr1942334 2121 2071 1708 12025 22431 564 --
NM_031899chr321362 498 1612 11523 --
NM_032017chr14769 628 363 214 --41616 828 319 237 --
NM_032042chr532807 2285 561 12466 12379 --
NM_032145chr61725 --1212 --
NM_032172chr72987 908 --1113 --
NM_032208chr211290 11187 1839 13629
NM_032211chr1031049 459 196 --1125 --
NM_032217chr42507 354 --11269 124
NM_032221chr20--1639 193 --
NM_032268chr1632518 2283 1073 11280 12326 12921
NM_032312chr21292 --186 --
NM_032364chr12------1998
NM_032379chr113692 66 52 ----1143
NM_032382chr161389 2497 111 ----
NM_032410chr821075 433 133 --1474
NM_032431chr113962 735 680 --1436 11096
NM_032440chr1052696 2556 2326 1945 103 --11812 1299
NM_032458chrX63149 3132 3078 2758 2373 208 --11138 --
NM_032466chr811349 1532 ----
NM_032505chr36985 826 689 394 354 51 ----12099
NM_032510chr1842113 2000 1843 740 2426 63 1794 --
NM_032512chrX3992 754 252 1369 ----
NM_032523chr2----1526 --
NM_032552chr941667 1356 271 101 11384 --1129
NM_032558chr911019 --11413 --
NM_032560chr143774 434 30 ------
NM_032594chr141957 1893 --184
NM_032632chr1461903 1857 1381 765 624 33 --146 --
NM_032689chr1941380 476 378 192 21440 337 ----
NM_032727chr1031573 1364 88 11384 1307 --
NM_032784chr61929 ----1774
NM_032796chrX1827 1746 1143 --
NM_032808chr158851 721 676 349 315 204 169 65 ----1999
NM_032833chr132672 2513 117 1268 11000 --
NM_032876chr1412071 --11858 --
NM_032961chr42476 387 1999 --1921
NM_033083chr363005 2829 2611 2491 520 511 1227 21283 603 --
NM_033124chr12----140 --
NM_033132chr1371961 1551 583 551 106 81 64 ------
NM_033133chr1753402 2397 2346 234 138 1122 13558 22779 1217
NM_033211chr542064 573 452 327 ------
NM_033215chrX165 --2351 342 --
NM_033224chr7187746 7621 7013 6834 5327 5161 2832 2389 1712 1248 1170 1090 1051 674 570 409 248 179 17554 --23024 220
NM_033389chr17104838 4204 4100 3483 3357 3052 3041 1320 442 308 ------
NM_033449chr581852 1843 1732 1581 1394 691 629 567 --1143 --
NM_033495chrX------1955
NM_033546chr18----184 --
NM_033631chr193690 3671 2962 2810 2517 2444 1493 782 602 13156 13780 12576
NM_052880chr2221304 1084 21435 294 11191 --
NM_052886chr822117 624 21326 678 --11751
NM_052897chr121842 181 ----
NM_052905chr261824 1579 1452 370 304 200 1445 ----
NM_052906chr22104988 4684 4342 3845 3732 3648 3512 3354 1476 1101 1466 24880 1518 --
NM_052918chr1031362 350 30 13704 11277 1513
NM_052927chr511494 2149 26 --1212
NM_053024chr3----1119 --
NM_053042chr463046 2909 2819 2631 245 156 ----22573 2405
NM_053064chr1413038 --12539 --
NM_057175chr452596 761 711 300 71 22514 1747 ----
NM_057749chr82551 477 --11068 --
NM_080669chr1794587 3676 3500 3170 1868 1713 1193 1115 683 ----23657 3418
NM_080867chr1444038 3196 647 589 14225 13230 1754
NM_133264chr1773525 3466 3412 3170 2883 2678 579 12772 --23670 84
NM_133468chr72377 33 22411 1614 --1241
NM_133478chr262300 2009 590 238 75 26 32079 1944 884 12368 --
NM_138385chr431179 188 43 1108 ----
NM_138423chr1542351 2183 1996 1698 ------
NM_138426chr72738 540 164 ----
NM_138468chr2135782 4967 4903 4176 4131 3971 2438 2272 2114 1130 812 573 123 25706 5255 15733 --
NM_138473chr12114753 4709 4362 4151 4051 3596 3209 1960 1733 1512 1283 11782 ----
NM_138612chr161197 150 ----
NM_138961chr11----1391 --
NM_139057chr1521075 870 22109 903 --12795
NM_139278chr821042 411 --11303 1104
NM_139279chr263352 2946 2708 2510 1062 755 11356 --1122
NM_139321chr20104205 3910 3709 3141 3129 1597 1291 1208 918 667 2140 61 2901 452 12921
NM_144571chr4116979 6446 5662 4581 4556 4297 1809 1618 1258 763 724 147 15639 --
NM_144578chr14105313 4859 4760 4558 3908 2112 1425 938 886 486 15055 --1346
NM_144582chr272525 2312 1918 1724 1012 909 102 11052 31936 661 229 --
NM_144591chr101435 1115 ----
NM_144599chr1585512 5416 3754 3746 1378 1349 936 262 1960 ----
NM_144600chr16--11071 --11394
NM_144664chr1132600 2433 2362 12323 12494 --
NM_144723chr51553 --1786 --
NM_144778chr1331925 1823 563 12153 11907 135
NM_144778chr1331925 1823 563 12153 11907 135
NM_144963chr81945 ----1237
NM_144973chr1264803 4488 3372 1872 1480 176 13307 25129 2055 --
NM_145044chr361378 1316 1173 342 169 86 ----11482
NM_145165chr1482408 2168 2093 1104 1008 980 718 59 11998 11833 --
NM_145176chr632153 1294 1265 21056 436 --13422
NM_145206chr1033270 3237 784 32668 850 823 53143 2922 729 643 515 --
NM_145251chr1441560 1271 640 142 1278 1527 --
NM_145284chrX----1745 --
NM_145305chrX3468 448 108 1182 11041 --
NM_145307chr1054347 3290 3093 1581 616 ----13625
NM_145735chr1332317 2235 772 --22827 48 --
NM_145800chrX31007 889 716 --1753 1778
NM_145808chr763154 2764 2531 2061 840 84 21240 1126 ----
NM_145891chr16--1414 11606 11165
NM_145912chr22144659 4598 4302 4248 3860 3782 3665 3063 3013 2946 2897 1632 1000 964 22967 1652 34327 3929 3701 24100 370
NM_147156chr1051254 1092 942 489 174 ------
NM_152253chr22134333 4249 4140 4010 3522 2769 856 808 582 415 360 287 90 --2839 60 --
NM_152271chr8139 --1413 1192
NM_152292chr41851 1752 ----
NM_152344chr1741219 1099 1035 371 --11270 --
NM_152380chr141296 1219 1084 186 ------
NM_152390chr23648 435 108 --1101 --
NM_152415chr81349 --1513 --
NM_152442chr1231184 1105 1011 11085 21164 193 --
NM_152455chr1562857 2132 1893 951 862 664 1218 22810 1072 --
NM_152470chr1833842 3454 1563 ----1113
NM_152510chr22------1681
NM_152520chr21780 11198 1958 11205
NM_152557chr721508 1412 --1244 --
NM_152581chrX----1385 --
NM_152588chr1231509 1470 1249 --2563 500 11165
NM_152594chr1521962 57 --12111 --
NM_152622chr543516 3121 2223 46 1899 --1346
NM_152638chr122358 311 ------
NM_152641chr1212524 1252 12614 --
NM_152666chr11831 ------
NM_152682chr421484 1173 --2673 195 --
NM_152716chr1131232 1017 594 146 21135 350 --
NM_152734chr684963 3883 2167 1674 438 419 216 115 24254 338 --11436
NM_152748chr7190 --145 --
NM_152749chr741010 966 939 200 ------
NM_152787chrX12482 11084 ----
NM_152903chr1331112 777 611 22711 1764 11081 --
NM_152995chr41843 1359 1662 --
NM_153035chr163246 3196 3080 2301 2187 1002 1172 1493 --
NM_153038chr2--1114 --1718
NM_153183chrX4417 285 216 208 ----1861
NM_153207chr12104109 3886 3359 3017 2971 2953 2690 2595 1036 756 145 --13104
NM_153267chr9------1338
NM_153354chr52706 643 1820 1808 --
NM_153450chr11----1637 --
NM_153453chr6--1416 ----
NM_153487chr684306 3282 1569 1421 592 422 305 269 34338 204 129 ----
NM_153607chr552754 2708 2506 2037 271 1882 12913 --
NM_153619chr1563595 2567 2520 1431 1167 943 22813 1081 21393 240 --
NM_153712chr243523 2572 2346 568 --13104 1668
NM_170606chr711613 1733 --1578
NM_170662chr31644 --1276 --
NM_170711chr193771 251 226 ------
NM_172020chr751749 706 634 60 45 21803 276 ----
NM_172070chr251760 1648 559 395 267 --12258 --
NM_172071chr187466 7086 6785 2835 2788 2716 1684 860 24671 227 14857 --
NM_172127chr431303 764 437 --11775 --
NM_173199chr92349 156 ----1206
NM_173469chr152989 135 ----11555
NM_173470chrX1518 ------
NM_173475chr1651742 1402 1101 234 34 --1284 --
NM_173500chr1531137 880 50 ------
NM_173552chr311655 ----1121
NM_173557chr18------1735
NM_173576chr103728 437 340 2553 236 --1816
NM_173595chr12115000 4790 4680 4508 4168 4160 1800 1490 1038 804 740 15075 1709 --
NM_173681chr761745 635 494 475 405 359 1169 1133 --
NM_174902chr11--195 41752 1438 497 37 11779
NM_174911chr831490 1360 282 --23957 910 --
NM_175736chr12207763 7631 7584 7392 7346 6653 5719 5470 5230 4972 2961 2513 2421 2000 1836 1714 1319 1069 944 63 --36326 3134 1119 11752
NM_175852chr162897 2813 1028 577 503 112 2206 132 --1715
NM_175856chr5----1792 --
NM_176823chr152476 1448 1365 225 68 --23643 1530 13759
NM_178123chr22850 267 --1246 --
NM_178191chr131169 399 374 2593 196 --1454
NM_178313chr221921 175 ------
NM_178505chr10134 12498 ----
NM_178539chr1221666 230 ----1189
NM_178550chr11346 --1457 --
NM_178812chr82418 403 1320 21353 462 1991
NM_178835chr43636 226 132 ----1338
NM_181356chr6--124 1138 --
NM_181358chr1103327 3284 3244 3151 3061 1050 749 499 448 116 11523 33711 3529 165 --
NM_181491chr972968 2654 2453 2389 2267 2167 946 --31266 1230 32 --
NM_181671chr171306 177 ----
NM_181782chr631956 1949 611 32105 1787 1465 22031 93 --
NM_181784chr252099 745 671 567 284 12466 --1525
NM_181803chr20--155 ----
NM_181874chr33402 133 62 --176 --
NM_182485chr452887 1367 1242 548 380 2753 523 11379 1879
NM_182487chr9123477 3429 3247 3141 3100 2785 1622 1592 1121 1092 524 173 1184 34127 2980 1367 --
NM_182511chr1851168 957 428 270 198 --1566 1917
NM_182515chr19126719 6181 5699 4797 4632 4252 4094 1038 995 508 95 45 26654 4157 14955 --
NM_182557chr1172237 1910 1868 1739 904 486 353 ------
NM_182580chr182582 2307 2192 1943 1872 1799 909 216 --11950 --
NM_182757chr643130 746 678 437 2970 959 21081 133 --
NM_182830chr1452065 839 695 416 220 --11512 11428
NM_182894chr14101706 1432 1360 1171 713 638 522 504 412 94 --11762 --
NM_182935chr332509 1690 118 1285 1178 --
NM_182970chr20144141 3999 3443 2821 2797 1482 1190 793 607 574 547 240 135 57 13834 11285 --
NM_183416chr14828 359 342 21 --12106 11980
NM_194247chr294565 4227 3372 3243 3223 2770 1289 802 542 1551 2999 118 --
NM_194282chr422850 120 22770 411 1192 22987 2801
NM_194285chr1172908 2790 2723 2517 499 437 189 23374 2862 ----
NM_197941chr572681 2463 2078 1868 831 305 260 --1753 --
NM_198066chr1443105 2831 543 246 --23079 1041 --
NM_198157chr2262176 2130 1718 965 200 95 1912 1215 2382 22
NM_198270chrX32794 2264 94 23263 1141 ----
NM_198440chr22132543 2415 2400 2167 2037 2008 1684 1001 606 386 174 141 61 ------
NM_198446chr1------1231
NM_198465chrX22031 748 --1328 21141 510
NM_198511chrX41769 1605 532 131 1351 ----
NM_198513chr821987 719 ----11869
NM_198560chr362679 2434 1048 566 506 158 11518 12486 21056 247
NM_198567chr51181 --1371 1110
NM_198581chr2137356 6921 6657 6554 5706 5135 4604 2540 2458 1292 1126 453 158 16794 ----
NM_198686chr1492550 2511 2184 923 860 804 789 386 365 --1134 --
NM_198859chr353785 1667 1207 1038 998 21617 505 14614 162
NM_199044chr162751 2643 2417 2286 1969 353 11121 1569 --
NM_201280chr631584 1167 407 11102 --11057
NM_201520chr1741727 1651 226 205 1577 ----
NM_203364chr111982 --1270 --
NM_203365chr22226 130 134 ----
NM_203390chr84640 533 156 119 1443 21833 1267 --
NM_203446chr2142530 841 636 128 --185 --
NM_206853chr643147 2920 505 308 2924 114 21573 683 --
NM_206854chr654408 4181 1766 1569 800 11375 11944 1497
NM_207387chr175607 497 478 231 49 --1101 --
NM_207411chr883573 3477 3218 2908 2743 2506 2356 1132 52813 2528 1174 315 286 1213 1724
NM_212464chr1561897 1820 1749 1450 764 385 1678 ----