TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-658
miRNA Sequence: GGCGGAGGGAAGUAGGUCCGUUGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000044chrX--174 --187
NM_000135chr163798 389 264 1792 1749 --
NM_000192chr121623 --1597 --
NM_000474chr71530 ----1263
NM_000503chr81106 11780 2609 143 --
NM_000522chr7----1219 --
NM_000555chrX57334 6943 5543 4938 179 ----17666
NM_000665chr71195 --2188 27 1150
NM_000795chr112324 178 --2952 867 --
NM_000806chr5192 ----136
NM_000945chr221779 1708 --1688 --
NM_000966chr1231029 158 97 --1343 --
NM_001001323chr12------12138
NM_001001852chr223317 259 117 --1135 --
NM_001002295chr1011080 ------
NM_001002838chrX------11790
NM_001002909chr1721406 378 --31548 337 324 21842 276
NM_001003694chr3------187
NM_001003799chr7------1224
NM_001005353chr1--1224 1179 --
NM_001005463chr1021892 305 ----123
NM_001007279chr222667 248 --1109 --
NM_001008220chr533815 2534 1036 13677 1114 --
NM_001008239chr1832756 872 294 21486 1268 --126
NM_001008392chr343328 2324 103 45 13393 13225 --
NM_001009813chr19260 29 --1112 --
NM_001009993chr243770 2882 1656 792 --1941 24390 3751
NM_001010857chr1----1109 --
NM_001010867chr185950 5765 2276 2048 635 357 337 61 26057 1910 12064 --
NM_001012393chr1132049 1707 21 11437 3610 323 286 --
NM_001012614chr41188 --1202 --
NM_001013693chr132234 1833 390 12550 ----
NM_001013739chr7----126 --
NM_001014443chr1------1240
NM_001018108chr151774 --136 --
NM_001024226chr11916 --296 38 --
NM_001024649chr51458 --21893 918 --
NM_001024808chr1242491 873 445 182 --1406 1481
NM_001024912chr1911557 --11386 --
NM_001024948chr133276 966 329 12268 ----
NM_001025076chr1085239 5226 5048 4905 4805 3964 2452 1968 11349 24982 4844 --
NM_001025202chr7----126 --
NM_001029882chr1194 --1116 --
NM_001032296chr1342805 2567 2266 393 12142 184 --
NM_001033677chr12----1357 1164
NM_001034837chr51138 --1293 --
NM_001035267chr12----2284 202 --
NM_001037324chr31549 --1174 --
NM_001038707chr131447 574 175 --2830 712 --
NM_001039574chr1----1884 --
NM_001039577chr123861 176 11504 13960 11291
NM_001039690chr1652009 576 422 405 54 ------
NM_001039772chr11----1491 --
NM_001040020chr7--1217 ----
NM_001040056chr161683 1189 175 --
NM_001040429chr1312909 --1378 --
NM_001040441chr131906 1183 1052 ----13971
NM_001040613chr8----1105 --
NM_001040624chr832209 2129 475 --22452 138 --
NM_001040709chr131898 431 55 --2559 303 --
NM_001042599chr225367 4788 25045 227 --17435
NM_001042749chrX----1389 --
NM_001043318chr1421324 775 13007 22688 1385 --
NM_001043351chr15682 487 169 51 38 --11478 --
NM_001095chr1241938 1608 1199 167 --11300 --
NM_001222chr1031614 191 178 ----151
NM_001267chr172444 351 --2103 40 --
NM_001364chr1153283 3138 3078 3010 256 --23805 3592 --
NM_001365chr17--1540 --1166
NM_001383chr172539 32 189 1573 --
NM_001396chr21----11914 --
NM_001493chrX----170 --
NM_001497chr932598 1003 61 22624 207 2119 48 11085
NM_001664chr3--1412 --1226
NM_001665chr112487 190 --2384 200 --
NM_001679chr31169 --1192 --
NM_001842chr9----1468 --
NM_001938chr11268 --1363 --
NM_001949chr6--1431 12128 1980
NM_001958chr20----1230 --
NM_002024chrX11380 --11790 --
NM_002048chr91199 --1891 --
NM_002105chr112272 253 --3982 305 159 --
NM_002126chr1722783 390 1520 ----
NM_002140chr9----1134 --
NM_002181chr21310 --2669 122 --
NM_002196chr202401 139 --2224 39 --
NM_002214chr71285 --11245 24894 1809
NM_002265chr17----1474 --
NM_002270chr531825 1506 1204 25100 257 --172
NM_002293chr132709 2153 32 --1105 --
NM_002356chr612828 --21948 259 --
NM_002359chr1783616 3397 3325 1617 1529 1137 486 74 --11123 --
NM_002376chr141218 ------
NM_002473chr22----3497 185 127 --
NM_002501chr19124121 4058 3931 3262 3111 1650 1519 973 799 598 564 34 23951 880 23894 3648 --
NM_002522chr1752886 2538 987 886 806 --12448 --
NM_002553chr7------1416
NM_002576chr111292 11052 --11213
NM_002607chr7--1477 21121 134 --
NM_002616chr171169 1201 1528 --
NM_002699chr151374 606 538 273 159 --21083 1058 --
NM_002707chr22132 47 ------
NM_002730chr191949 --11105 --
NM_002752chr5----150 --
NM_002911chr1961499 1461 1107 507 325 260 1391 11572 --
NM_002918chr1921150 1002 --2786 722 --
NM_002938chr421633 217 1583 11997 --
NM_002959chr153359 3205 3094 3049 431 ----13960
NM_002996chr1631222 577 488 --2393 246 11645
NM_003002chr11----151 --
NM_003011chr9----1314 --
NM_003036chr141082 815 83 73 --1259 --
NM_003075chr12----1129 --
NM_003091chr20--133 ----
NM_003108chr296454 5703 2859 2453 2430 2153 2002 1809 1062 --25997 1769 --
NM_003156chr112320 299 --21221 213 --
NM_003179chrX11394 --11290 --
NM_003216chr2252867 2169 1037 832 294 3689 578 378 42359 2059 534 49 --
NM_003250chr17----161 --
NM_003257chr15------11096
NM_003320chr1134168 843 84 13076 42705 1471 169 100 --
NM_003370chr191579 137 2262 236 --
NM_003378chr71357 --164 --
NM_003558chr9--170 ----
NM_003586chr163667 488 128 ----159
NM_003598chr191594 ------
NM_003607chr121002 32 1398 14253 1967
NM_003632chr172728 102 --2763 588 --
NM_003704chr42464 205 ------
NM_003714chr542088 2052 422 410 12738 12278 --
NM_003743chr221392 371 --21523 377 --
NM_003791chr161222 --1573 --
NM_003825chr1531361 186 38 --1584 --
NM_003861chr14----12856 --
NM_003900chr531386 1079 98 --1896 --
NM_003901chr1022335 1828 ----12557
NM_003941chr712305 --11696 --
NM_003988chr1081770 1740 1724 1708 1620 669 547 40 11821 21692 957 --
NM_004093chr131776 1526 --1305
NM_004132chr10------11069
NM_004188chr92533 511 --1477 --
NM_004290chr5150 1545 1881 --
NM_004311chr1052826 2792 2065 2052 1221 22993 1202 32744 1193 692 1228
NM_004316chr12------1833
NM_004329chr10----1557 --
NM_004395chr5297 57 ------
NM_004416chr121968 --2974 61 --
NM_004427chr121098 445 ------
NM_004464chr444061 3769 3645 1006 ----1445
NM_004503chr123812 782 340 ------
NM_004583chr171631 --137 --
NM_004588chr1163973 3456 3154 1101 829 49 --23220 2803 --
NM_004706chr19----1308 --
NM_004716chr111105 ----1718
NM_004730chr511747 ----12133
NM_004736chr12343 130 --1375 --
NM_004737chr2221076 186 --11272 --
NM_004745chr876725 6199 6181 2111 1558 530 313 25460 5042 136 11596
NM_004756chr19----1473 --
NM_004759chr141539 1406 361 293 --1571 --
NM_004783chr16----1247 --
NM_004824chr6----11069 --
NM_004840chrX11652 ----1367
NM_004849chr621124 112 --1188 --
NM_004852chr18914155 13887 12785 10843 10736 4579 3824 3755 2291 --213858 9686 212487 1372
NM_004907chr192991 683 1677 --1242
NM_004926chr14----1452 --
NM_004979chrX51083 815 736 446 397 ------
NM_005067chr3----1633 --
NM_005095chr11247 --11585 1406
NM_005099chr11137 --2855 246 --
NM_005184chr1951437 1423 1233 1136 1098 --21066 303 --
NM_005187chr1681569 1334 1325 365 326 231 166 85 --21489 808 --
NM_005206chr1731297 1058 896 ----11100
NM_005220chr171459 --2203 61 --
NM_005230chr12------1395
NM_005276chr1231526 617 264 11309 1506 --
NM_005281chr12778 704 --2946 756 --
NM_005336chr2--1317 11477 195
NM_005392chr92331 31 ----1324
NM_005418chr114629 588 501 77 --2135 97 --
NM_005430chr123407 373 245 --1312 1953
NM_005578chr311273 23349 814 --14085
NM_005581chr191175 --2438 138 --
NM_005647chrX73164 3023 2750 1336 858 693 600 11225 23227 772 --
NM_005698chr1----1235 1108
NM_005716chr19------1494
NM_005768chr121512 --1135 --
NM_005822chr622056 1793 ----1454
NM_005910chr1723707 399 --2912 91 1740
NM_005920chr123088 1475 --33498 2842 2424 --
NM_005933chr1162217 2197 2073 1204 564 119 12998 22079 1956 --
NM_005941chr8--13780 --1260
NM_005964chr17--1373 --11300
NM_005967chr121248 --1107 --
NM_005969chr1111100 ----1303
NM_006160chr173535 315 271 --11470 --
NM_006176chr113768 321 165 ----159
NM_006202chr1941975 1910 1409 582 --2620 75 --
NM_006224chr1742294 1619 940 226 2738 446 1268 --
NM_006243chr11898 --122 --
NM_006315chr423431 81 23175 1120 23652 315 13586
NM_006328chr111473 --1188 --
NM_006421chr8----140 --
NM_006439chr4163 ------
NM_006454chr452862 2040 1945 1159 1045 1562 12533 12712
NM_006467chr5----1215 --
NM_006494chr191782 --1763 --
NM_006517chrX11475 --11759 --
NM_006540chr8----11160 --
NM_006546chr1722498 22 --24241 2226 --
NM_006557chr9----11206 --
NM_006562chr10----3217 97 21 --
NM_006729chrX45406 4901 4879 3416 --14921 --
NM_006738chr1551866 1374 1239 357 197 --24400 3653 --
NM_006761chr172549 286 --1746 --
NM_006772chr6----21572 308 --
NM_006823chr821343 189 --11284 --
NM_006852chr1732635 1966 1154 --1696 --
NM_006908chr71383 ----1110
NM_006943chr2062894 2829 801 592 531 267 --1513 --
NM_006990chr152534 2421 1758 1719 1623 --31785 616 510 --
NM_007125chrY----1159 --
NM_007185chr12684 672 178 ----
NM_007245chr161718 --1135 --
NM_007249chr1348722 2606 2427 736 --23258 269 18987
NM_007327chr911143 --21151 24 --
NM_007361chr14------1503
NM_007373chr10----1565 --
NM_012104chr1132760 1036 221 --2135 48 --
NM_012199chr154145 4056 2976 1542 1442 13052 1755 11485
NM_012234chr312960 --12465 --
NM_012282chrX1300 --1256 --
NM_012286chrX------1451
NM_012300chr51174 --11580 --
NM_012308chr1132119 979 114 --11825 --
NM_012316chr1124576 4421 3873 1924 1910 1763 1320 924 707 172 145 64 14277 2412 112 --
NM_012342chr10------1124
NM_012395chr733452 765 650 1179 12360 1316
NM_012470chr7----1103 --
NM_013233chr2----11151 --
NM_013236chr22----1473 --
NM_013399chr1651719 1524 750 520 312 11737 11261 --
NM_013958chr81147 --1101 --
NM_013960chr81103 --1571 --
NM_014023chr1032051 866 223 1847 ----
NM_014112chr823349 1610 ------
NM_014212chr12191 --1902 --
NM_014240chr354088 2920 1592 310 63 11438 13511 --
NM_014286chr983095 2771 2748 2516 1223 952 467 443 --43510 2416 303 216 32907 265 106
NM_014388chr145363 4495 3945 3689 14544 12029 24513 4275
NM_014417chr191642 193 1299 --
NM_014423chr542214 2171 1972 25 --14973 --
NM_014554chr12----196 --
NM_014562chr2----4683 631 564 48 --
NM_014715chr11----134 --
NM_014723chr2052676 2323 2140 1127 283 12883 23058 2047 --
NM_014779chr3----1818 --
NM_014839chr1------12163
NM_014849chr141201 1107 914 523 --1359 --
NM_014891chr731344 616 532 --156 --
NM_014917chr11376 ------
NM_014926chr311139 ----1239
NM_014934chr1322552 1110 23545 3292 1224 --
NM_014938chr1232356 2310 119 --32021 433 255 --
NM_014961chr41775 --21372 756 --
NM_015002chr1221403 195 11488 ----
NM_015023chr161811 1779 1556 1258 671 661 --148 --
NM_015059chr1573930 3780 3404 3327 3215 3002 1462 --53654 3568 1356 584 215 1663
NM_015064chr1262894 2760 2306 715 666 538 --2143 116 --
NM_015069chr162413 245 129 ----
NM_015075chrX31977 1381 878 --2174 35 --
NM_015090chr164440 1903 1789 1743 1728 551 --25713 616 12398
NM_015092chr1623529 751 ------
NM_015094chr2293433 3157 3057 1374 678 670 610 571 125 --34326 1232 28 --
NM_015125chr19----1462 --
NM_015155chr1052481 2472 2233 891 367 13038 --1916
NM_015170chr82782 228 --1261 --
NM_015172chr111088 ------
NM_015178chr81838 --2611 60 169
NM_015210chr1821139 290 --1100 --
NM_015215chr1------1143
NM_015252chr2----1599 --
NM_015277chr1811400 ----1272
NM_015299chr1421596 1251 23619 1040 179 --
NM_015338chr202653 152 --21857 755 --
NM_015344chr81369 --1591 --
NM_015443chr173519 453 63 ----1277
NM_015447chr9----1691 --
NM_015457chr111976 --133 --
NM_015465chr5------161
NM_015481chr122946 440 ----2819 767
NM_015488chr281490 1464 1311 1302 1173 624 516 350 --31473 1365 1156 11617
NM_015542chr101884 --1169 --
NM_015568chr203311 248 112 44159 3957 3840 3524 --13994
NM_015609chr152894 2787 2703 2104 143 1694 ----
NM_015651chr91172 --11739 12188
NM_015678chr13----1102 --
NM_015852chr713463 ------
NM_015872chr131372 1215 706 --1591 --
NM_016022chr11287 ----1326
NM_016037chr11862 ------
NM_016132chr1532145 1252 512 --23077 756 --
NM_016141chr3--1813 157 --
NM_016174chr92136 130 --1335 --
NM_016485chr6----1785 --
NM_016486chr1----3119 77 37 --
NM_016545chr12885 130 --1342 --
NM_017450chr1721330 515 --21311 42 --
NM_017519chr611287 --1118 --
NM_017744chr11955 11499 11681 --
NM_017893chr1011187 1371 1450 1405
NM_017902chr1074199 3900 3792 905 848 398 233 --21552 1317 15248
NM_017919chr954124 1682 1468 1358 71 --1619 --
NM_017964chr21380 ------
NM_018027chr10--2875 238 1370 --
NM_018028chr193913 200 74 ------
NM_018184chr3164 11855 --11909
NM_018214chr61332 --140 --
NM_018375chr141404 --11716 --
NM_018469chr17189 --1132 --
NM_018584chr11424 ----1206
NM_018684chrX----11289 --
NM_018898chr522377 316 12092 1266 --
NM_018977chrX1364 --1881 --
NM_018999chr102526 307 ------
NM_019046chr101802 --1358 --
NM_019850chr24627 559 497 269 --2550 528 --
NM_019884chr19----2581 473 --
NM_020182chr2022761 55 11126 ----
NM_020205chr123377 964 --13421 1216
NM_020338chr1092507 2449 2280 1386 1183 1075 1054 1002 561 22768 37 1333 12706
NM_020382chr12----1550 --
NM_020439chr11815 --2742 59 --
NM_020465chr164739 673 600 207 11710 ----
NM_020474chr181257 ----1111
NM_020708chr2081870 1769 760 751 467 400 391 231 --21004 732 --
NM_020778chr1533894 1794 813 1745 24003 472 1327
NM_020825chr1672846 2696 2613 1110 774 471 297 2405 98 23610 3468 --
NM_020888chr151911 1863 1452 219 139 --12010 --
NM_020897chr131228 980 303 1134 11186 --
NM_020899chr1732035 1704 700 12511 1693 --
NM_021025chr51181 ------
NM_021103chr21182 ------
NM_021155chr1942944 2203 766 48 --32256 1055 652 --
NM_021728chr14------1667
NM_021939chr17--1742 196 --
NM_022048chr1544903 1926 534 191 26006 495 14998 --
NM_022075chr1--1122 ----
NM_022085chr62521 442 --11418 --
NM_022169chr111385 --1320 --
NM_022470chr311275 --1101 --
NM_022658chr12----1331 --
NM_022749chr821305 553 --31197 966 42 --
NM_022763chr312841 --1897 --
NM_022780chr221616 665 1598 21574 556 --
NM_022898chr141836 14230 179 --
NM_024015chr1741146 1120 877 806 --1407 --
NM_024090chr411868 --11209 --
NM_024345chr9--14090 1225 --
NM_024507chr163309 157 39 ------
NM_024676chr11260 --1218 --
NM_024771chr111883 12054 41717 1711 1616 856 1314
NM_024798chr1532496 852 48 ------
NM_024811chr1131510 659 332 --2760 147 --
NM_024877chr1911183 1821 166 --
NM_024954chr10----1484 --
NM_025010chr32890 223 --11942 --
NM_025160chr123967 482 11414 13375 --
NM_025179chr144140 3079 1875 297 1643 11275 13223
NM_030627chr5------13231
NM_030647chr724388 648 35524 4876 4090 170 1716
NM_030767chr972617 1935 1865 1051 1038 940 254 --12135 22640 792
NM_030780chr811765 --1207 --
NM_030795chr8----1137 --
NM_030913chr11502 ------
NM_030916chr12666 656 --1650 --
NM_030981chr1151140 979 938 850 796 1952 ----
NM_031417chr1932792 2171 45 --2419 203 2805 234
NM_031492chr112232 67 ------
NM_031890chr2232721 2273 1161 --32600 787 266 1963
NM_032052chr22----2938 166 --
NM_032153chr33906 106 37 1777 11949 --
NM_032207chr1921086 1054 --2802 306 --
NM_032283chr141716 1376 1233 249 --21539 172 146
NM_032389chr113948 734 427 --2232 190 1889
NM_032420chr51728 ----1264
NM_032514chr202320 153 ----1419
NM_032521chr2022224 81 1561 ----
NM_032538chr6142417 2287 2208 1915 1860 1805 1051 800 757 574 440 408 298 129 --22770 2033 --
NM_032539chrX1769 ----1550
NM_032828chr1911300 14874 34081 1278 805 1420
NM_032873chr1124448 288 13528 13618 13512
NM_032968chrX24091 575 --13286 --
NM_032973chrY24083 575 --13281 --
NM_032995chr21459 --31208 1094 482 1646
NM_033129chr2041450 777 599 532 11663 51977 1649 1630 1560 540 --
NM_033132chr13------1439
NM_033133chr1793649 3256 1121 970 960 863 481 345 59 --11365 --
NM_033315chr1761981 1787 1773 1489 646 462 --12035 1172
NM_033549chr5129 --1954 --
NM_044472chr11136 --1103 --
NM_052848chr1961817 1507 1391 1371 347 221 --21485 633 --
NM_052897chr122643 602 ------
NM_052898chr81419 ----11359
NM_052925chr191656 1728 2977 675 --
NM_052933chr71142 --1285 --
NM_057175chr41991 --11947 --
NM_058172chr41144 ------
NM_058175chr21----2781 560 1312
NM_058243chr192834 315 ------
NM_080607chr201967 --1775 --
NM_080625chr2021069 392 ----1176
NM_080764chr22----2794 401 --
NM_130386chr18----1250 --
NM_133433chr5----1172 --
NM_133445chr943661 3163 2811 43 1336 11202 --
NM_133467chr1----2332 98 --
NM_133625chr3----1122 --
NM_138328chr1743287 2767 2316 2063 --33251 2496 2187 --
NM_138349chr171208 --163 --
NM_138353chr191153 --140 --
NM_138774chr193137 62 53 --1728 1862
NM_139278chr83374 286 60 1268 11191 --
NM_144617chr192953 72 1718 ----
NM_145008chr11------132
NM_145056chr191104 ----141
NM_145239chr162325 245 --1177 --
NM_145260chr21285 --1646 --
NM_145349chr1752120 1833 1782 1634 116 --41493 679 445 195 --
NM_145349chr1752120 1833 1782 1634 116 --41493 679 445 195 --
NM_145349chr1752120 1833 1782 1634 116 --41493 679 445 195 --
NM_145798chr173868 702 597 --1141 --
NM_145808chr7----12158 --
NM_147192chr131261 579 134 --1467 1184
NM_152237chr2291761 1644 1420 1255 1124 634 422 275 225 --21580 534 --
NM_152253chr2244270 3379 3094 1705 --168 --
NM_152344chr171303 ----1966
NM_152384chr22823 715 --71692 1655 1516 1479 1341 1304 783 --
NM_152470chr1843425 2886 820 346 --13498 --
NM_152493chr121267 76 --21627 546 --
NM_152608chr132007 568 562 ------
NM_152636chr111736 1117 146 --
NM_152721chr18--1471 171 --
NM_153262chr111257 --1674 --
NM_153334chr222535 308 141 ----
NM_172070chr2----1423 --
NM_172127chr4------11963
NM_173491chr51104 --11428 --
NM_173674chr6------146
NM_174893chr17170 --131 --
NM_175736chr1286042 4805 2635 2530 2198 1858 552 473 2633 617 55022 2539 1294 1092 771 --
NM_175895chr12184 ------
NM_175898chr1521580 1053 21246 564 41254 588 580 344 1284
NM_176792chr101321 1403 ----
NM_176806chr51118 ------
NM_177999chr951394 1178 1053 844 547 --1501 --
NM_178126chr1711639 --31740 1414 844 --
NM_178502chr123548 530 75 ------
NM_178554chr331419 1037 806 --2143 124 --
NM_178557chr421183 446 --11246 1354
NM_181670chr121292 --276 68 --
NM_181704chr21----11043 11001
NM_181843chr11240 26 --1143 --
NM_182493chr1631389 736 653 1969 11803 14369
NM_182700chr711328 ------
NM_182757chr6----2534 114 --
NM_182970chr2054085 3919 3909 3798 3506 --21513 543 --
NM_198081chr642672 2415 595 197 1380 ----
NM_198562chr312232 --1308 --
NM_198581chr232932 1533 279 16131 56494 5549 5219 4922 54 --
NM_198686chr1462477 556 510 489 304 46 ----12506
NM_198867chr192341 79 --126 --
NM_198993chr1741204 564 205 107 11240 1412 --
NM_199511chr3------141
NM_201280chr62627 539 --187 --
NM_201520chr1731606 559 153 ------
NM_201521chr6----1363 --
NM_203382chr5----1233 --
NM_203403chr9158 ----11053
NM_203458chr123822 269 11529 --11410
NM_206853chr6173 --13461 --
NM_206914chr1221745 875 11588 31833 1661 173 --
NM_207380chr1523229 1322 1975 31284 1196 70 --
NM_207396chr121272 1230 --2477 173 --
NM_207406chr455525 2121 1885 985 311 --22457 1057 14615
NM_207645chr112479 91 --1153 --
NM_212464chr1521825 831 --1760 --