TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-659-3p
miRNA Sequence: CUUGGUUCAGGGAGGGUCCCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr541616 695 223 22 1818 ----
NM_000046chr563112 2993 2814 2090 490 386 22145 1963 13183 --
NM_000052chrX33377 2140 637 33225 2422 321 --12606
NM_000084chrX176139 6042 4385 2377 1975 1942 1783 1609 1580 1393 1245 1006 901 436 377 309 142 66430 6318 4459 4400 2165 459 36213 5546 980 16566
NM_000088chr172921 40 5462 207 200 190 99 ----
NM_000112chr5115212 4982 4410 3915 2187 2051 1604 1160 626 107 32 24954 2221 11189 13520
NM_000138chr1552015 1686 769 79 57 52585 2111 690 529 483 12237 12657
NM_000168chr7103311 2905 2840 2141 520 411 297 218 37 27 ------
NM_000176chr563688 3226 3003 1053 657 549 22500 1124 ----
NM_000216chrX64120 3330 3252 2884 446 400 33194 934 611 ----
NM_000217chr1264602 3773 3763 3567 1970 285 64854 4567 4359 3578 1627 500 11322 2754 179
NM_000252chrX11227 2456 348 21136 114 --
NM_000259chr15116145 5731 5376 5087 4575 4428 4353 1276 1088 473 225 56283 5971 4493 2220 2042 14312 13945
NM_000267chr1772779 2613 2510 2334 906 530 29 32403 2261 837 --11397
NM_000332chr6116789 6649 6388 5828 4586 2631 1413 1342 1228 886 522 35627 2084 1904 ----
NM_000337chr586415 6074 4018 2486 2473 1221 348 239 75914 4986 4441 4113 1535 927 894 16045 14563
NM_000362chr2273471 2913 2662 2295 936 605 169 1553 --12585
NM_000368chr984573 4502 4470 4349 3832 3492 2976 1389 11577 --34794 3546 3134
NM_000408chr262639 2585 1092 821 671 25 31165 861 63 13216 --
NM_000411chr2163212 3041 3006 2995 2806 1251 1378 --12141
NM_000430chr1752921 2454 1499 516 287 12661 1279 --
NM_000461chr364387 3569 3379 1559 959 360 34117 3915 826 --24318 1174
NM_000489chrX53374 1380 1071 979 892 22633 1198 166 --
NM_000555chrX177604 7349 7255 6639 6611 6092 5271 5204 3061 2843 2247 1579 1225 1169 942 871 578 47789 7091 6228 1466 45793 5477 2376 732 --
NM_000575chr251031 945 869 329 255 21125 439 1158 --
NM_000599chr294512 4406 4393 1831 1773 1657 1257 796 476 1659 12910 --
NM_000609chr1082065 1191 972 863 419 388 282 53 --11996 1716
NM_000611chr11146909 6609 6391 5985 5826 5301 5198 5100 4571 2460 2238 1878 1263 239 --36155 5729 2522 --
NM_000612chr113423 351 311 42443 780 751 299 1566 13372
NM_000618chr1296518 6510 6246 5574 5227 5070 2429 372 304 26365 5737 --1989
NM_000618chr1296518 6510 6246 5574 5227 5070 2429 372 304 26365 5737 --1989
NM_000633chr18114925 4701 4469 4316 3532 2019 1681 1607 1594 1202 195 14096 14101 --
NM_000719chr12106363 5393 5342 4945 4908 4627 1362 673 415 132 --15190 --
NM_000726chr24458 425 367 64 1489 1355 --
NM_000793chr1454557 3377 1826 1047 981 44717 1772 1706 838 24359 1620 11843
NM_000806chr5--2783 319 --11919
NM_000809chr4177399 7192 6670 5828 5812 3543 3469 2633 2366 2075 1307 1138 1130 828 738 552 177 38666 2405 397 37242 6636 1814 1640
NM_000813chr593641 3619 3566 3530 2070 1409 1249 577 48 65027 4781 4650 4474 3838 354 35623 613 556 --
NM_000814chr1594066 3747 3653 3272 2845 1692 1182 1176 625 --13949 --
NM_000826chr442376 1995 907 271 42362 1919 696 550 12072 --
NM_000831chr195796 5454 5376 5037 4666 4110 2409 239 100 42299 1276 1139 1129 --11792
NM_000875chr1566175 5206 4952 4502 2130 838 16702 45643 4975 4563 289 11969
NM_000877chr282922 2530 2473 1099 575 431 321 136 23016 2051 12579 --
NM_000899chr1294127 3654 3523 3415 3204 2929 1530 1060 685 34056 3988 2864 13583 --
NM_000926chr1199486 9403 9300 8433 8241 8032 6387 2255 1244 67724 7052 5761 3147 1104 915 17378 --
NM_000963chr151543 800 572 399 37 52166 1655 935 771 232 ----
NM_000983chr111396 1618 --156
NM_001001323chr1233081 2211 2046 32806 1218 942 22994 35 --
NM_001001331chr352403 1965 1949 291 140 42145 1827 1002 122 --1578
NM_001001344chrX3811 703 120 42589 2130 1855 1037 12215 --
NM_001001419chr585030 4368 3671 1744 1488 1256 1116 133 13178 11781 --
NM_001001420chr585030 4368 3671 1744 1488 1256 1116 133 13178 11781 --
NM_001001481chr843352 2416 1364 774 22573 2263 ----
NM_001001668chr19114064 3335 2997 2851 2686 1600 887 827 644 534 238 53849 3100 922 908 350 14238 --
NM_001001890chr2164234 3822 3052 2643 1283 397 31262 988 881 --11302
NM_001001928chr22147403 7127 6595 6434 5588 2988 2361 1680 1528 1352 960 412 286 171 47319 5445 3038 2258 28090 792 12324
NM_001002814chr883657 3010 2460 1103 426 289 105 87 11340 11239 --
NM_001003407chr1064221 4080 3619 1390 990 170 34593 4425 900 ----
NM_001003408chr1064221 4080 3619 1390 990 170 34593 4425 900 ----
NM_001003652chr18108124 7971 7226 6777 6474 5431 5425 2010 1999 541 35439 1122 768 --12964
NM_001003674chr1885791 5397 4846 2785 2050 1671 1551 39 46824 1818 761 115 45658 4885 4506 430 1491
NM_001003675chr1885791 5397 4846 2785 2050 1671 1551 39 46824 1818 761 115 45658 4885 4506 430 1491
NM_001003712chr12123732 3580 3542 3252 3033 2830 1579 1538 962 55 29 21 1983 13310 11504
NM_001003760chr673275 2294 1153 991 951 743 53 53619 3247 3209 2784 1246 --12428
NM_001003800chr963203 3152 1195 921 847 51 13604 13764 12976
NM_001004065chr963022 1223 1163 301 52 44 23651 699 --22758 205
NM_001004317chr644181 4106 3095 3058 24198 472 --1503
NM_001004360chr251914 1896 1651 1583 144 ----1787
NM_001004419chr1263716 1388 1345 837 632 97 33387 1151 220 --24009 653
NM_001005404chr1774042 3534 3467 1811 1669 1423 841 34026 2965 51 33695 1711 1053 12955
NM_001005473chr546194 5595 2477 1822 45717 4747 4528 4103 14812 1414
NM_001005502chr12125136 4745 4688 4305 3513 3398 1744 1191 503 494 342 41 11267 25250 3813 --
NM_001005746chr24458 425 367 64 1489 1355 --
NM_001005747chr24458 425 367 64 1489 1355 --
NM_001006600chr552382 2158 1647 241 167 12411 ----
NM_001007023chr1454557 3377 1826 1047 981 44717 1772 1706 838 24359 1620 11843
NM_001007024chr1784199 4035 3762 3453 3355 2773 2680 361 21737 279 14328 --
NM_001007025chr1784199 4035 3762 3453 3355 2773 2680 361 21737 279 14328 --
NM_001007097chr995106 4926 3907 3770 2039 1613 1591 1381 834 --24690 3993 13585
NM_001007466chr664007 3480 1792 1660 202 194 54846 3622 3518 1247 530 1658 --
NM_001008239chr1853116 3105 2437 2346 1043 33290 2998 2686 13555 --
NM_001008408chr736391 1685 446 34842 2526 2061 --14599
NM_001008539chr865214 2119 1626 979 921 643 23289 1468 14903 21478 1424
NM_001008738chr572640 2618 2305 2085 923 729 48 1259 --11153
NM_001009554chr4124460 4216 4196 4045 3724 3374 2938 1881 1527 1246 1024 998 34382 4235 3795 14519 23231 1355
NM_001009554chr4124460 4216 4196 4045 3724 3374 2938 1881 1527 1246 1024 998 34382 4235 3795 14519 23231 1355
NM_001009555chr441556 1300 703 47 --11152 21177 670
NM_001009899chr3136430 6292 6178 5964 5938 5399 4895 2426 1933 1856 1709 1610 422 14903 25588 4600 --
NM_001009909chr1193275 2829 2666 1279 925 904 723 338 160 33230 3005 980 33235 521 427 13660
NM_001010861chr152097 1101 912 314 132 32708 1756 265 --12232
NM_001010867chr1126717 5747 5420 5273 4558 4079 2213 1876 1833 863 694 571 12290 35755 4593 4112 --
NM_001010891chr596410 6374 5556 5365 2783 1952 1450 1213 1000 66072 4379 4342 2192 316 116 15749 1479
NM_001010980chr173137 3007 2483 2150 837 445 332 33529 2788 479 21221 460 1589
NM_001011513chr461488 718 583 437 248 145 13624 1753 --
NM_001011666chr7125962 5641 4930 4384 4288 2452 2076 1704 1606 1464 1166 829 35439 5060 2421 15613 24018 2174
NM_001012393chr1195057 4429 3993 3973 3728 3287 1797 1088 79 23149 700 ----
NM_001012751chr1041762 1498 1198 303 11229 --1694
NM_001012755chrX105006 4529 3929 1964 1468 974 893 591 407 238 23697 378 ----
NM_001013399chr621093 29 --1879 2461 377
NM_001013620chr1298286 7823 7802 6110 6032 5419 3107 1825 363 47067 6454 5774 837 1340 12610
NM_001013659chr1975098 4429 3715 1808 920 729 323 55070 4683 4110 3429 2094 24464 716 14701
NM_001014342chr121517 675 2605 45 --11665
NM_001014380chr1385480 5159 4075 4060 3835 1469 633 252 34709 1439 955 ----
NM_001014797chr10178165 6823 6524 5881 5619 3085 2949 2863 2192 1483 1170 914 864 214 150 73 36 67699 5974 2531 1623 1353 65 36897 1817 1613 --
NM_001015877chrX42920 2812 2719 719 42995 1996 1187 83 ----
NM_001017368chr1762678 2654 2450 1982 1955 119 --21762 696 1520
NM_001017440chr7116938 6506 5691 2832 2170 2022 1894 1783 1534 1238 124 28195 6595 37655 5500 3044 --
NM_001018065chr9125957 4871 4748 2378 2372 2310 2138 1892 1151 672 511 152 --15284 36048 4154 46
NM_001018066chr9125957 4871 4748 2378 2372 2310 2138 1892 1151 672 511 152 --15284 36048 4154 46
NM_001018067chr165358 4711 4159 3377 3288 1774 44341 1162 1046 987 14194 15224
NM_001018068chr165358 4711 4159 3377 3288 1774 44341 1162 1046 987 14194 15224
NM_001018069chr165358 4711 4159 3377 3288 1774 44341 1162 1046 987 14194 15224
NM_001018074chr563688 3226 3003 1053 657 549 22500 1124 ----
NM_001018075chr563688 3226 3003 1053 657 549 22500 1124 ----
NM_001018076chr563688 3226 3003 1053 657 549 22500 1124 ----
NM_001018077chr563688 3226 3003 1053 657 549 22500 1124 ----
NM_001024094chr563688 3226 3003 1053 657 549 22500 1124 ----
NM_001024660chr351640 1602 590 537 186 ----21225 49
NM_001024855chr331538 1307 383 21583 1565 --1262
NM_001024948chr142870 2675 973 717 12362 ----
NM_001024956chr1194699 4484 3989 3611 2107 2000 1100 408 370 35548 3882 2175 ----
NM_001025068chr321740 1291 ----2736 113
NM_001025069chr321740 1291 ----2736 113
NM_001025077chr1067425 6995 5796 1962 94 61 37177 5851 4659 --14754
NM_001025252chr862711 2037 1036 900 808 490 3624 414 132 33145 2442 779 11140
NM_001025253chr862711 2037 1036 900 808 490 3624 414 132 33145 2442 779 11140
NM_001025266chr374049 3995 3367 2979 1859 172 118 ----14344
NM_001025580chrX31556 1042 148 23433 769 1756 --
NM_001025780chr931363 1325 1191 1283 --1170
NM_001029858chr662899 2497 2426 2138 915 726 12096 --23291 270
NM_001029863chr642806 1234 1225 404 32296 370 327 22536 767 --
NM_001030055chr1454687 4169 3488 1168 133 31255 950 460 21547 1529 --
NM_001031700chr452231 1901 619 137 65 2395 339 11584 --
NM_001031804chr1674390 4255 3671 3223 926 785 85 33925 3321 1749 ----
NM_001032394chr63724 402 156 12243 --22309 1933
NM_001032395chr63591 269 23 22110 1045 --22176 1800
NM_001032999chr2095138 4465 3729 2147 2015 1641 1228 990 187 44724 4503 3741 3594 --25323 4571
NM_001033117chr343764 3310 3140 3023 44818 4729 4540 3365 43851 3789 3338 1803 24531 1124
NM_001033723chr852832 2444 2168 2072 601 --32637 2394 317 12812
NM_001034841chr1695496 4686 4300 4238 4152 2209 1621 805 330 35356 910 28 --1898
NM_001034954chr1083109 2579 2323 1143 1064 443 250 191 1533 160 --
NM_001034955chr1083109 2579 2323 1143 1064 443 250 191 1533 160 --
NM_001034956chr1083109 2579 2323 1143 1064 443 250 191 1533 160 --
NM_001034957chr1083109 2579 2323 1143 1064 443 250 191 1533 160 --
NM_001035260chr1041629 1615 596 55 --11423 11236
NM_001037165chr7158757 8319 7880 7514 7264 5955 2997 2879 2797 1439 1300 1181 1035 486 479 38952 8082 7783 ----
NM_001037172chr321098 132 1358 21294 343 1490
NM_001037317chr152097 1101 912 314 132 32708 1756 265 --12232
NM_001037553chr2185142 4810 3320 1745 1726 1541 1465 61 44203 3594 1736 1434 2858 140 15199
NM_001037954chr1173466 3108 2277 1212 1108 743 484 2274 79 13502 32544 546 73
NM_001039199chr2094800 4447 4052 3658 1878 1450 720 569 399 34959 3256 440 21676 1485 1342
NM_001039538chr263497 3132 1270 1207 585 430 23652 2828 12906 --
NM_001039580chr474848 4399 4110 3385 3273 1213 1005 ------
NM_001039585chr153904 3765 3349 1153 546 31659 1470 1095 11188 24113 69
NM_001039618chr1194648 3860 3755 2044 1961 1388 1233 944 169 35170 1857 1724 25912 4930 14419
NM_001039709chr2095138 4465 3729 2147 2015 1641 1228 990 187 44724 4503 3741 3594 --25323 4571
NM_001039840chrX45865 5200 3882 1098 14466 25519 5218 --
NM_001040108chr14103141 3093 3009 2760 2516 2197 1227 948 705 100 1834 ----
NM_001040152chr7124815 4600 4470 4118 4066 3912 3381 3310 881 844 537 123 43830 1995 1667 1416 1199 --
NM_001040202chr462366 1849 1806 687 674 407 ------
NM_001040429chr1353458 2636 2586 2268 104 1207 13595 11057
NM_001040441chr161724 1391 1355 860 701 213 44828 4217 3679 368 25236 439 14809
NM_001040450chr1572386 2178 951 887 766 75 25 22441 2013 ----
NM_001040453chr1572386 2178 951 887 766 75 25 22441 2013 ----
NM_001040624chr862525 2235 2156 2096 1672 1101 31796 766 695 --11806
NM_001040625chr862525 2235 2156 2096 1672 1101 31796 766 695 --11806
NM_001040626chr862525 2235 2156 2096 1672 1101 31796 766 695 --11806
NM_001040627chr862525 2235 2156 2096 1672 1101 31796 766 695 --11806
NM_001040628chr862525 2235 2156 2096 1672 1101 31796 766 695 --11806
NM_001040629chr862525 2235 2156 2096 1672 1101 31796 766 695 --11806
NM_001040630chr862525 2235 2156 2096 1672 1101 31796 766 695 --11806
NM_001040712chr962808 2748 1160 303 275 67 32885 1429 820 32668 854 170 12307
NM_001042355chr1664804 4704 3371 1782 1122 993 --1378 24110 2052
NM_001042412chr1664804 4704 3371 1782 1122 993 --1378 24110 2052
NM_001042481chr1432292 763 194 42193 874 604 558 --11879
NM_001042492chr1772779 2613 2510 2334 906 530 29 32403 2261 837 --11397
NM_001042493chr611872 31459 721 135 --11817
NM_001042555chr1264418 3498 1794 1617 757 714 44460 1677 1476 145 --1498
NM_001042599chr2116561 5880 5689 2718 1613 1229 1172 1160 951 266 204 12320 33159 1822 1141 25425 1812
NM_001042603chr1284801 4687 4497 4431 2116 864 221 41 13818 --25276 4564
NM_001042604chr394042 3633 3180 3104 3056 1933 1257 669 348 34250 1372 250 23862 724 --
NM_001044385chr283656 3414 3371 2645 923 529 235 227 23908 597 11372 --
NM_001046chr521949 1017 42766 589 562 351 --12361
NM_001049chr1462277 2242 884 855 700 431 22476 2402 11996 154
NM_001071775chr1351631 1550 1316 732 181 21887 665 1635 --
NM_001083620chr442374 1993 906 270 42360 1917 695 549 12070 --
NM_001095chr1231389 1189 202 1419 --3532 219 23
NM_001100108chr1127464 6606 6097 5169 2771 2666 2187 1960 1175 867 736 654 28140 998 12445 --
NM_001106chr3159761 9688 7947 7898 7130 7024 6660 3826 3651 3365 3130 2736 929 739 91 39144 8201 1453 48815 7354 3346 279 --
NM_001167chrX126691 5887 5752 5199 5014 4938 4111 2698 2419 2137 1598 688 35960 5098 2659 26239 608 --
NM_001173chr1454687 4169 3488 1168 133 31255 950 460 21547 1529 --
NM_001198chr652283 1972 1795 1757 1745 32328 2137 2113 11574 --
NM_001201chr443408 1022 812 452 33292 1038 252 --23439 1169
NM_001204chr287172 6912 6847 6539 5696 4766 739 346 25612 2695 --26759 2185
NM_001206chr92709 548 33089 2662 2011 22495 1005 --
NM_001219chr742245 2141 719 388 1778 11446 --
NM_001256chr1772700 2659 2641 2020 854 651 326 1813 --2594 355
NM_001259chr786111 5659 4869 1963 1567 1165 277 178 34606 4167 1691 --16033
NM_001304chr1742842 1405 1155 295 ----11441
NM_001310chr1253086 1093 544 525 35 32535 921 435 ----
NM_001331chr1132472 643 434 22243 999 --12006
NM_001364chr11104645 4327 3915 3523 3056 1765 1729 1533 1427 1170 --21462 1270 --
NM_001390chr1893440 3285 2854 2545 2530 2457 897 632 152 ----33340 3130 699
NM_001396chr2182374 1806 772 751 340 188 112 88 12358 ----
NM_001419chr1984119 3246 1502 1387 1310 272 196 158 21897 1045 13265 1680
NM_001432chr463671 3305 3043 3005 2430 1338 ----12961
NM_001438chr143485 1436 634 106 12926 22803 675 1662
NM_001453chr641231 1172 214 200 180 --2545 23
NM_001460chr143345 1423 984 37 33351 1208 370 --11053
NM_001609chr10124481 4301 4264 3829 3751 3368 1766 1476 973 827 542 401 22757 1709 13979 --
NM_001616chr293270 2935 2691 2290 2261 1393 1338 368 277 1390 ----
NM_001621chr722065 304 32707 2671 141 22379 2199 1428
NM_001621chr722065 304 32707 2671 141 22379 2199 1428
NM_001663chr1411834 52704 1946 1714 508 41 ----
NM_001683chr352403 1965 1949 291 140 42145 1827 1002 122 --1578
NM_001695chr883953 2831 2764 2684 816 790 485 421 23611 1670 13402 1686
NM_001754chr2164234 3822 3052 2643 1283 397 31262 988 881 --11302
NM_001759chr1274372 3689 3667 2009 901 816 523 34277 1205 784 ----
NM_001806chr1932382 1016 845 22598 694 12317 1221
NM_001821chr194834 4354 4172 3980 3519 3089 3083 1203 508 33577 1780 831 21853 1602 11078
NM_001830chrX53700 2463 1195 708 466 12578 23478 626 13169
NM_001859chr941301 1207 1026 704 53173 2534 1522 1013 467 33791 739 286 1180
NM_001874chr12125136 4745 4688 4305 3513 3398 1744 1191 503 494 342 41 11267 25250 3813 --
NM_001918chr1199123 8939 8466 8079 7743 7439 7184 6823 6416 6024 5854 3450 3007 2917 2853 2593 2151 1928 908 48105 6251 3417 1921 12583 18850
NM_001969chr1453668 2877 2826 729 594 43909 3702 3655 3211 --13233
NM_001987chr1253481 2697 898 739 147 14134 --24226 778
NM_002006chr4115204 4356 4246 4217 3974 2140 2000 858 820 439 364 ------
NM_002009chr1552208 2050 1848 455 104 1226 125 12142
NM_002025chrX149020 8875 8713 8207 7986 7300 6510 6428 5899 3501 1356 1227 551 405 75927 5864 5813 3247 2421 835 618 12492 13587
NM_002033chr11104109 3892 3886 3433 1575 1177 1084 916 712 280 --53997 3668 3613 1327 422 --
NM_002035chr1874013 3185 2991 2882 2752 1370 121 13766 23362 2724 --
NM_002040chr2182862 1998 1190 736 691 651 536 481 --12580 1433
NM_002061chr151600 1562 1317 402 291 1651 ----
NM_002126chr1743649 3222 1367 76 23878 1391 --1933
NM_002128chr1332353 733 542 --12361 1765
NM_002158chr263689 3465 3293 2718 1319 819 --1396 --
NM_002193chr231337 454 176 21854 187 --11580
NM_002242chr251611 1377 545 342 214 41911 1468 1251 760 ----
NM_002264chr374415 4106 3566 3290 1820 1736 876 23277 215 ----
NM_002267chr1362450 2296 2177 2037 1636 1556 2779 507 11779 --
NM_002270chr5104861 4329 3711 3559 3476 3451 546 531 355 116 1751 ----
NM_002271chr1352437 908 455 131 31 1286 32072 2049 1979 --
NM_002310chr575231 5050 4958 4841 4491 1788 470 41339 1115 244 178 ----
NM_002313chr1064221 4080 3619 1390 990 170 34593 4425 900 ----
NM_002336chr1231961 1717 463 24412 268 13968 --
NM_002350chr81481 --1863 1390
NM_002356chr672897 2370 2106 1108 932 718 99 22336 2249 ----
NM_002374chr263497 3132 1270 1207 585 430 23652 2828 12906 --
NM_002519chr1141190 528 310 233 ----11469
NM_002545chr1195057 4429 3993 3973 3728 3287 1797 1088 79 23149 700 ----
NM_002577chr363166 2770 1032 556 227 148 1735 12470 23705 834
NM_002581chr9134878 3972 3598 3494 1906 1761 1732 1165 892 828 614 493 448 75298 4179 4083 4054 1889 1364 919 1175 --
NM_002645chr1141182 1146 511 190 --1175 13034
NM_002655chr8105004 4332 4216 3836 3474 1506 1294 922 472 174 ----34388 1952 1165
NM_002698chr1993031 2413 2123 1885 621 611 512 470 84 102955 2908 2388 604 595 570 559 491 443 427 21899 735 1531
NM_002709chr212926 43131 3090 1193 317 12552 13004
NM_002715chr53795 238 36 21266 1053 1197 1130
NM_002716chr1163669 1173 1092 822 303 230 22469 1392 --12478
NM_002731chr153155 2369 2301 1983 746 22103 953 --22992 2834
NM_002737chr17126264 4959 4541 4215 4208 4194 4085 2323 1936 1161 443 181 24974 370 ----
NM_002834chr1293826 3565 3004 2577 1359 1343 678 611 380 22940 2902 33163 3086 1517 14091
NM_002839chr962808 2748 1160 303 275 67 32885 1429 820 32668 854 170 12307
NM_002886chr394256 4241 3499 3486 2082 1398 1164 960 502 144 24586 3802 --
NM_002906chr1152234 2201 896 560 41 ------
NM_002941chr331446 555 449 31479 1433 534 --11157
NM_002959chr143845 2803 660 40 33539 3185 137 21174 1049 --
NM_002977chr253290 2893 2300 1311 405 13178 1575 --
NM_002999chr2051774 1428 567 455 449 ----11570
NM_003028chr993817 3578 3561 3421 2566 1184 979 620 71 23622 972 13339 1440
NM_003034chr12117817 6226 5705 5525 3098 1289 1242 1229 714 571 441 45772 5386 2819 1575 47303 2329 331 30 --
NM_003043chr354087 2837 2761 802 67 22880 1663 21543 652 23700 1121
NM_003045chr1384703 4235 3730 1386 1069 937 742 450 25007 126 1355 1507
NM_003046chr865214 2119 1626 979 921 643 23289 1468 14903 21478 1424
NM_003071chr342076 1601 1492 733 2519 352 --1502
NM_003099chr15106273 5039 4861 4501 4242 4057 2588 467 445 134 56588 6228 6206 1064 835 ----
NM_003114chr82696 674 ----1212
NM_003144chr642024 905 277 266 ----11430
NM_003155chr872175 2125 1849 996 928 753 160 31757 709 598 11871 11124
NM_003161chr1762899 2806 666 404 323 163 12788 --12852
NM_003199chr1865695 5406 4838 4105 2064 543 65532 5164 3987 2278 2204 1132 33543 3452 1606 --
NM_003221chr633916 2967 894 33055 1100 131 1771 13483
NM_003236chr293092 2672 2436 2204 2159 1104 1068 537 217 12266 12718 1800
NM_003262chr3104692 4068 3854 3827 3510 3203 1249 1147 1123 537 43985 3644 2014 341 13848 --
NM_003298chr3126092 5737 5625 5050 4988 4733 4491 4417 4378 3889 3787 2076 21427 933 ----
NM_003320chr1193896 3778 3157 2865 1108 1032 946 645 395 ------
NM_003344chr761704 1545 1521 1253 495 480 21388 382 1710 --
NM_003392chr363469 3231 2955 2735 2633 123 23042 441 1209 --
NM_003404chr2011618 11721 11823 11413
NM_003474chr1062411 2341 2230 2193 2069 967 21881 1695 22334 486 --
NM_003483chr1232268 1855 1169 52512 2169 2022 1923 354 --1806
NM_003583chr1213120 ----23197 505
NM_003597chr262307 2061 766 745 688 261 ----1668
NM_003607chr173995 3808 3369 3107 1485 1461 805 34369 3339 1279 ----
NM_003617chr163503 3207 721 630 561 266 14273 23173 1901 11352
NM_003629chr193309 2626 2431 2221 876 799 680 656 545 33095 2134 500 12931 --
NM_003672chr111656 11494 1705 11487
NM_003714chr582870 2132 1934 1183 1038 834 804 631 12843 32912 2812 321 --
NM_003743chr221964 606 ----2338 266
NM_003759chr463907 3755 3645 3153 1183 299 32918 2682 386 14014 12769
NM_003861chr1482624 2492 2295 2175 1837 1019 809 111 ------
NM_003887chr261963 1872 1793 722 275 76 12234 ----
NM_003939chr1083885 3720 3499 3028 2893 1536 749 397 23580 100 11150 --
NM_003966chr5167470 6958 6503 6312 6198 5978 5777 5697 5615 5510 5117 2778 1437 851 834 220 1966 --16253
NM_003983chr1674265 4244 3211 1386 1184 360 44 23427 592 ----
NM_003994chr1294127 3654 3523 3415 3204 2929 1530 1060 685 34056 3988 2864 13583 --
NM_004035chr1774587 4123 3797 2074 1243 1229 641 14938 33896 1941 1403 14828
NM_004113chr331757 1411 582 11907 --1179
NM_004124chr1483477 3190 3092 933 674 545 464 56 21290 1154 12395 --
NM_004133chr842189 725 196 94 32627 1021 861 1267 --
NM_004136chr15103169 2791 2182 1994 1246 1015 635 607 536 214 42743 2309 1072 846 22587 141 --
NM_004171chr11259434 9321 9055 8937 8702 8234 7701 7244 7126 6391 6113 3533 3410 3213 3151 3134 3128 2222 1599 1516 1391 1159 1131 604 257 2863 804 17650 13248
NM_004232chr1873120 3028 3011 2760 1102 955 809 12403 ----
NM_004293chr963232 3029 2880 2662 2364 790 33550 2558 1279 ----
NM_004296chr1433840 3597 1066 42617 1540 1520 1117 23276 2958 14015
NM_004338chr1885791 5397 4846 2785 2050 1671 1551 39 46824 1818 761 115 45658 4885 4506 430 1491
NM_004397chr1154096 3590 2876 828 107 --1514 13312
NM_004412chr1075825 4330 4062 2403 2364 292 199 65960 5240 1298 941 500 101 25837 80 --
NM_004457chr21261 11434 --1478
NM_004501chr133080 2743 1575 42605 2574 603 415 1615 11597
NM_004514chr1761103 921 755 502 365 281 ----22722 1174
NM_004529chr941079 226 213 30 41384 292 142 121 ----
NM_004586chrX95483 4314 4131 4078 3923 3863 1892 790 548 12032 21711 250 --
NM_004612chr953880 3757 966 495 430 11838 ----
NM_004726chrX135791 5373 5357 5288 4577 4083 2283 2112 1652 1318 1254 389 364 34163 3780 787 ----
NM_004730chr531993 521 217 3654 164 153 11512 11360
NM_004744chr473911 2648 1349 559 270 137 69 13041 12523 --
NM_004748chr1543353 2922 1194 499 13864 ----
NM_004775chr1841919 1740 534 117 21969 1824 --1946
NM_004776chr2033102 1283 1276 --23366 1254 12883
NM_004798chr20103668 3649 3568 3060 2415 2229 1423 421 400 141 ----12673
NM_004815chr194899 4569 3396 1905 1685 1456 977 915 336 13200 13807 --
NM_004824chr631474 1400 1034 21240 530 ----
NM_004836chr22899 718 --1175 1323
NM_004845chrX104162 4095 4086 3335 3246 1653 1607 1512 1181 152 --11580 11434
NM_004859chr1783021 2570 2280 2274 2234 2106 1169 706 ----22449 1118
NM_004863chr14125051 4576 4470 4187 4153 3948 3647 3396 1291 512 79 66 25152 1334 24886 2088 25001 1385
NM_004866chr554445 1731 892 680 141 11351 11275 --
NM_004871chr1784199 4035 3762 3453 3355 2773 2680 361 21737 279 14328 --
NM_004896chr1031544 1530 511 --11338 11151
NM_004904chr7125962 5641 4930 4384 4288 2452 2076 1704 1606 1464 1166 829 35439 5060 2421 15613 24018 2174
NM_004924chr191267 1701 --1661
NM_004956chr764160 3885 3820 2992 2906 915 13991 --1851
NM_004992chrX137534 7423 6833 6452 6106 2795 2317 1775 1094 705 681 225 32 38388 6877 2485 ----
NM_004992chrX137534 7423 6833 6452 6106 2795 2317 1775 1094 705 681 225 32 38388 6877 2485 ----
NM_004996chr1631697 217 83 4372 132 118 104 1620 --
NM_005023chr571220 1126 981 602 201 152 74 1113 ----
NM_005036chr22147403 7127 6595 6434 5588 2988 2361 1680 1528 1352 960 412 286 171 47319 5445 3038 2258 28090 792 12324
NM_005056chr1275045 4931 4741 4675 1108 465 285 14062 --25520 4808
NM_005065chr1474478 4071 3805 3704 1692 1542 1217 11087 --11053
NM_005068chr63966 939 918 2901 147 --1237
NM_005079chr862711 2037 1036 900 808 490 3624 414 132 33145 2442 779 11140
NM_005093chr2095138 4465 3729 2147 2015 1641 1228 990 187 44724 4503 3741 3594 --25323 4571
NM_005156chr9104635 3555 3265 741 711 454 434 142 82 34 24678 3750 14757 14059
NM_005188chr11127893 7781 7512 6865 6525 5819 5131 2339 2118 1851 1541 34 28301 7179 --11778
NM_005190chr621093 29 --1879 2461 377
NM_005197chr1495960 5901 5802 5611 5176 2366 2073 1912 930 65118 4830 3883 2122 289 280 34159 2425 1811 13893
NM_005226chr95779 599 544 158 110 12655 12012 12116
NM_005233chr372453 2073 1942 789 710 368 277 41704 956 847 319 ----
NM_005235chr2116561 5880 5689 2718 1613 1229 1172 1160 951 266 204 12320 33159 1822 1141 25425 1812
NM_005241chr31239 11380 2898 30 21254 996
NM_005277chr43442 130 50 1270 --11253
NM_005338chr7113992 3909 3768 3636 3211 2857 1497 1397 792 675 502 13135 23671 312 --
NM_005339chr463244 2787 2738 1552 1488 1371 --11342 --
NM_005359chr18116570 6405 6108 5833 5118 4785 4030 2506 2361 1604 273 45485 4420 4412 929 12472 --
NM_005409chr41997 1740 --21062 178
NM_005433chr1822803 2242 1801 --2429 75
NM_005436chr1084121 3391 3351 3272 1464 1428 639 517 33027 2759 193 13917 --
NM_005458chr961980 1677 835 827 127 43 21963 972 --12398
NM_005475chr1282818 2785 2650 2515 2487 1118 714 649 ----32188 2082 1087
NM_005476chr91999 21291 90 152 11414
NM_005497chr17106034 5978 4610 4414 4282 3787 2205 1902 1021 657 34213 4170 2125 35788 3853 2393 --
NM_005502chr972865 2843 2473 2295 743 87 43 62678 2280 2165 1283 820 399 1812 --
NM_005504chr12106494 5070 4574 4232 4095 4060 2303 1315 744 465 35777 2116 1353 ----
NM_005509chr521717 1263 ----11804
NM_005578chr364882 4061 1891 1414 696 190 13230 13695 --
NM_005596chr9116325 5644 5011 4763 4066 3956 1031 910 564 557 491 35058 4446 1970 ----
NM_005647chrX72785 2636 2542 2419 1391 1362 122 32869 2126 381 23446 3089 22992 1104
NM_005665chr174673 3493 3424 3205 779 455 314 --11971 --
NM_005725chr121885 1576 1601 12364 1583
NM_005737chr282481 2462 1146 877 839 777 517 473 ----21967 125
NM_005759chr244445 3820 2968 920 33980 3506 281 1477 --
NM_005779chr543573 2518 2384 1121 23655 539 2137 86 23496 1222
NM_005795chr253055 3034 2958 868 287 31110 965 361 11141 --
NM_005813chr232567 2087 602 11955 22598 201 --
NM_005840chrX137418 7306 6944 6791 6711 6620 5453 2287 1892 1563 1409 931 146 27170 101 15554 --
NM_005901chr18108124 7971 7226 6777 6474 5431 5425 2010 1999 541 35439 1122 768 --12964
NM_005903chr585030 4368 3671 1744 1488 1256 1116 133 13178 11781 --
NM_005941chr833418 1023 658 23359 296 11543 12662
NM_005955chr1104327 4227 2125 1809 1690 1654 1636 1541 290 174 24420 1418 ----
NM_005957chr194916 4845 3936 3896 1964 347 317 266 31 11751 34504 1420 330 --
NM_005977chr133905 123 88 --1314 1231
NM_006007chr973928 3309 1625 970 641 530 351 13375 13043 --
NM_006011chr15114131 3565 1731 1661 1620 1477 779 762 704 536 383 11403 13291 1256
NM_006016chr652283 2097 1453 550 167 159 1407 --
NM_006080chr732935 2473 863 21932 900 11053 1374
NM_006106chr1132783 2649 520 31226 463 347 --1215
NM_006135chr121239 535 1922 --1933
NM_006141chr1652436 1793 910 553 333 135 --12236
NM_006154chr1552359 2100 1822 602 80 31053 1031 51 --1876
NM_006194chr144506 472 412 367 31104 948 460 ----
NM_006203chr5125313 4740 4223 3881 3712 3481 1698 1567 1525 1471 469 168 44731 3997 2070 2042 ----
NM_006206chr472857 2204 2123 1804 589 374 128 12501 12170 --
NM_006237chr132525 412 42317 1687 632 468 22169 405 --
NM_006241chr342211 2151 2135 410 21641 404 1335 --
NM_006252chr1127292 6535 5994 5560 5089 2379 1589 1219 636 525 462 312 17593 22210 1961 --
NM_006258chr1031397 1158 495 11080 --11184
NM_006282chr20104773 4603 4205 3989 3724 3316 1553 1512 1385 1248 --44453 3538 1625 538 --
NM_006306chrX125860 5645 5554 5537 5428 5361 5080 4758 3885 3816 622 136 35280 5178 2151 11302 13583
NM_006346chr133498 371 173 1154 1124 --
NM_006353chr661270 1236 1167 1134 385 69 11286 1488 1327
NM_006371chr394577 4461 4186 4148 1517 1423 1171 1093 493 34743 3576 1919 24890 1722 --
NM_006375chrX41732 1320 727 171 11777 --1586
NM_006380chr1784353 1678 994 756 726 706 599 21 34005 1296 65 ----
NM_006393chr1064374 3990 3503 406 380 369 21560 1222 --1691
NM_006434chr1083109 2579 2323 1143 1064 443 250 191 1533 160 --
NM_006457chr461488 718 583 437 248 145 13624 1753 --
NM_006464chr254127 3733 3121 2883 1363 54685 1824 614 340 124 1724 --
NM_006482chr1213120 ----23197 505
NM_006534chr2053306 932 820 108 74 1337 32241 1295 384 --
NM_006538chr273422 2783 2561 1616 449 362 54 23248 1561 --12687
NM_006544chr14135152 4872 4821 4416 2419 2057 1686 1585 1575 796 723 625 110 45901 3979 2346 790 15173 1614
NM_006546chr1776091 5187 4466 2120 1857 1243 605 46255 5716 5305 2254 24955 4256 16265
NM_006548chr361498 1097 520 503 349 212 31110 100 70 1324 --
NM_006599chr16177721 7101 6808 6362 6233 6175 6098 5923 5839 5274 3316 2366 2303 899 448 325 177 25254 1130 26955 2957 12549
NM_006614chr352875 2518 2363 1037 558 23455 271 ----
NM_006628chr1554180 4161 3898 3596 3293 44439 4273 3928 802 13793 --
NM_006654chr1264418 3498 1794 1617 757 714 44460 1677 1476 145 --1498
NM_006699chr162240 2002 1655 881 707 50 2425 191 1380 1479
NM_006720chr1064221 4080 3619 1390 990 170 34593 4425 900 ----
NM_006729chrX24301 1153 65365 5173 3754 1662 695 684 15615 --
NM_006750chr1697275 4970 2760 2493 2310 1766 1031 782 137 67905 7139 6621 5659 2778 341 12939 12706
NM_006766chr832719 2134 916 4873 436 70 22 1712 --
NM_006873chr223287 2882 2428 157 --1412
NM_006885chr1644122 700 535 60 44011 3123 1187 103 ----
NM_006895chr261640 1529 689 377 165 52 1872 11699 --
NM_006902chr133138 911 296 63213 2876 2039 652 509 195 22901 138 1284
NM_006918chr1194699 4484 3989 3611 2107 2000 1100 408 370 35548 3882 2175 ----
NM_006924chr1743977 3819 2756 1000 33420 3041 1561 ----
NM_006943chr2083103 2912 2044 929 908 677 57 37 22739 923 ----
NM_006954chr1093487 3339 3126 3114 3043 2394 2253 2126 1398 11063 ----
NM_006974chr1093487 3339 3126 3114 3043 2394 2253 2126 1398 11063 ----
NM_007011chr15106336 2468 2393 2121 2096 1638 1517 1008 547 287 11334 --11509
NM_007030chr584045 3618 3232 2038 1883 426 415 197 24777 4767 11836 --
NM_007038chr21105910 5855 5076 4695 4687 3808 2080 1815 1631 1550 75839 5589 4539 4433 753 477 157 --14145
NM_007039chr1462289 2021 1808 1767 1441 371 --11961 --
NM_007043chr1262059 1972 1885 537 509 28 2461 443 --1849
NM_007050chr20177861 7317 6010 5661 5407 4994 2208 1948 1755 1535 1240 775 519 339 241 231 48 27751 7618 37345 4913 1297 12442
NM_007064chr351640 1602 590 537 186 ----21225 49
NM_007106chr1342766 2640 663 340 1520 2332 170 --
NM_007124chr62521 21 1595 11968 11365
NM_007137chrX115554 5261 5186 4164 2159 1578 1084 1065 1001 976 953 35194 4803 1885 32193 2184 846 31525 1418 1236
NM_007153chr19134164 4046 4022 3355 3290 3250 3195 2968 1768 1562 697 365 27 33858 3620 1292 13230 11510
NM_007172chr2282819 1226 1143 1090 895 569 475 267 13247 ----
NM_007175chr863275 3171 3042 2560 2277 61 22898 2870 ----
NM_007203chr963022 1223 1163 301 52 44 23651 699 --22758 205
NM_007249chr13188590 8343 8252 8215 7042 6852 6276 5814 5788 3702 3077 2539 2413 2148 1920 1303 628 193 57844 7094 6371 2621 127 37693 1368 879 --
NM_007269chr1--2602 463 --149
NM_007292chr1774587 4123 3797 2074 1243 1229 641 14938 33896 1941 1403 14828
NM_007347chr1553059 2511 1001 712 357 --1505 11046
NM_007350chr1264053 3908 3453 1405 1129 989 23002 1353 ----
NM_007375chr132171 363 259 ----22811 760
NM_012096chr3123483 3417 3398 3199 3052 2829 2600 2557 2438 1192 1062 1031 ------
NM_012120chr632658 1958 1110 63025 2079 1184 1084 661 619 1649 --
NM_012137chr182849 2816 2461 2411 2070 1788 1078 395 12043 ----
NM_012156chr2073457 3307 2365 2129 2120 249 51 --12591 13094
NM_012164chr9105426 5308 5044 2489 2368 2128 2122 1920 1714 476 13025 --21509 90
NM_012180chr44653 523 235 112 ----1178
NM_012193chr11105237 4867 4771 4713 4206 3871 3417 2080 1059 172 1248 13738 --
NM_012214chr274398 2497 709 584 522 318 180 55398 4970 4913 4040 2382 25811 1757 15117
NM_012223chr241213 214 144 94 21345 507 --11125
NM_012234chr342811 2405 520 33 43208 3020 1478 837 23225 2297 --
NM_012249chr253552 1327 1272 1027 833 42546 2539 910 475 ----
NM_012252chr764968 4589 4009 979 846 744 33767 1784 1576 34108 428 331 --
NM_012262chr12599 355 63835 3521 3489 1903 1892 289 --45075 990 120 34
NM_012288chr634392 3811 975 31766 919 208 15472 15555
NM_012316chr1105018 5009 4804 4082 3944 1335 613 320 186 80 34243 3495 1262 55162 4839 4030 3787 1349 --
NM_012382chr5103302 3274 3018 2989 2918 2897 2891 1181 1157 824 1140 13491 --
NM_012395chr783085 2839 2404 1231 1042 900 231 99 ------
NM_013261chr463621 3258 2716 1203 560 553 23179 2587 32756 734 659 --
NM_013269chr1263643 1315 1272 764 559 24 43314 1798 1078 147 --23936 580
NM_013302chr1684517 4433 4282 3799 3504 3461 1407 572 23278 123 1254 --
NM_013309chr1532490 2303 1827 22467 1638 --1666
NM_013313chr2252993 2644 715 552 257 22945 350 1750 1822
NM_013374chr362526 2452 2321 2224 1913 437 22782 637 ----
NM_013381chr1212391 31474 846 497 --21601 286
NM_013411chr162620 2005 1896 888 542 383 32155 861 400 32737 1723 557 --
NM_013989chr1454557 3377 1826 1047 981 44717 1772 1706 838 24359 1620 11843
NM_014034chr66491 350 300 227 141 52 21087 394 ----
NM_014035chr53363 191 60 31372 1358 1229 --21350 523
NM_014048chr1695135 5028 4614 4057 1838 1787 892 475 413 53797 2094 1820 942 103 1960 24646 4395
NM_014106chr1552799 2365 1871 850 183 --22748 2585 --
NM_014112chr885044 4135 4086 3544 2129 1368 1099 404 44227 4214 894 336 23392 831 --
NM_014141chr7104168 4128 4115 3732 3716 1999 1769 1127 883 762 35340 5322 3682 23782 693 13289
NM_014155chr11137222 7177 7121 5009 4853 4632 2909 2534 2295 1764 1480 904 644 34793 227 199 12704 --
NM_014157chr1693695 3602 2646 2515 785 729 488 310 206 11558 11573 --
NM_014181chr272215 2146 1833 396 356 333 177 32452 917 228 ----
NM_014240chr353766 3593 3393 1093 155 33245 1314 600 --14017
NM_014325chr1272105 1749 1732 1670 1595 324 137 3582 533 428 1377 --
NM_014331chr467216 5724 5345 4737 2902 1437 26153 6054 47391 5254 1572 154 --
NM_014368chr992082 1855 1758 1462 714 688 581 407 245 ----1182
NM_014381chr14103141 3093 3009 2760 2516 2197 1227 948 705 100 1834 ----
NM_014388chr136062 2435 828 35988 492 186 24643 4401 12426
NM_014423chr595629 4728 4236 4105 1618 1485 1281 1211 287 25256 2082 --15198
NM_014552chr211342 11540 --11418
NM_014574chr1451432 1224 1156 1101 280 11305 ----
NM_014586chr2184749 4251 4229 3192 1572 1334 1158 216 1568 23366 556 11221
NM_014613chr552765 2588 1057 1048 401 22509 545 21135 605 21117 928
NM_014616chr372842 2796 2676 2361 701 573 27 12461 --12995
NM_014674chr342902 2843 1080 886 2762 47 --23947 33
NM_014701chr1562239 1081 806 611 496 466 32611 392 237 13281 --
NM_014702chr642307 1394 1311 1033 33225 2751 1132 12200 --
NM_014721chr6125708 5546 5086 4905 4645 2863 2662 2420 1738 1713 1639 1254 42882 1575 327 278 ----
NM_014729chr872066 1909 1889 1735 1405 234 125 21794 1459 --11617
NM_014730chr12155077 4950 4880 4489 4470 4174 4014 3662 3580 1969 1544 1246 942 843 50 12000 ----
NM_014730chr12155077 4950 4880 4489 4470 4174 4014 3662 3580 1969 1544 1246 942 843 50 12000 ----
NM_014732chr16105891 5586 4496 4310 4292 1593 1118 283 135 115 25815 3999 14727 --
NM_014755chr273964 3605 3523 2944 1177 916 747 12618 --13561
NM_014774chr152181 1264 1058 751 219 23043 1097 1643 12690
NM_014787chr152083 1896 1829 856 241 22553 2544 31088 922 549 185
NM_014810chr173545 2720 2567 2252 1147 815 799 --1715 --
NM_014826chr173995 3808 3369 3107 1485 1461 805 34369 3339 1279 ----
NM_014848chr1582363 2307 2295 699 552 415 213 201 12839 --11082
NM_014850chr343764 3310 3140 3023 44818 4729 4540 3365 43851 3789 3338 1803 24531 1124
NM_014864chr1104254 4036 3134 2963 2695 1466 1197 679 435 59 3789 503 162 14163 1658
NM_014872chr972181 1897 1813 762 420 214 125 1684 1140 --
NM_014873chr163770 3252 3033 1598 1484 1107 44801 3564 3339 1811 --14105
NM_014877chr1776185 5373 5010 2654 775 281 154 37777 2391 1502 ----
NM_014897chr1752944 2743 2238 209 201 --22830 137 1219
NM_014899chr592836 2084 1089 935 580 533 439 204 91 22520 1949 12750 --
NM_014904chr1064024 3347 3116 3034 2780 1573 11609 --11102
NM_014920chr683661 3149 2453 1392 886 775 723 107 43324 2430 1002 849 1134 --
NM_014934chr1363246 1556 860 727 463 313 33483 3426 1052 ----
NM_014935chr183762 3501 3326 3109 451 224 145 53 --23454 2994 1606
NM_014946chr252976 2955 2451 2426 991 12707 32741 925 869 1150
NM_014951chr1052468 1059 537 243 114 1149 3336 62 23 1180
NM_014961chr451515 577 532 266 149 21917 1416 --11484
NM_014982chr1485028 4674 4517 4312 3357 2119 1720 314 25255 4997 34800 4651 814 --
NM_014989chr641970 1573 653 102 --1211 21709 62
NM_014991chr493119 2493 2457 2449 2161 1098 924 511 357 32353 684 492 ----
NM_015020chr1663873 3252 3176 2522 2405 468 --2926 839 1454
NM_015035chr2085459 4509 4400 4358 1791 772 765 395 46395 6345 1738 800 24438 308 35649 1435 66
NM_015039chr194259 3636 2875 1598 1479 1247 1093 933 153 13002 ----
NM_015045chr1062192 1903 1573 650 559 370 12046 ----
NM_015049chr263063 2193 913 839 792 585 22298 983 12325 --
NM_015051chr993080 3009 2825 2818 2236 1328 1178 821 765 31048 895 272 --23402 2946
NM_015055chr1122002 286 12823 12584 12563
NM_015056chr2142663 1622 538 326 11875 12008 11744
NM_015064chr1263297 3173 781 733 681 422 22976 69 32964 2548 409 --
NM_015071chr5115356 5248 5051 4404 4370 4228 4023 2516 1524 240 181 45194 4817 4613 739 45746 3985 2547 2245 15605
NM_015076chr673850 3459 3296 3019 1017 967 693 24499 619 --176
NM_015090chr1106216 6063 5255 5054 4795 4782 4547 1461 1159 144 24371 1583 11935 --
NM_015092chr1694113 3924 3829 3754 3408 2863 1467 1065 442 23599 3450 156 --
NM_015097chr352005 1975 880 616 508 21789 589 22358 23 11915
NM_015100chr152055 1800 1695 1311 185 11272 21362 206 --
NM_015141chr342475 871 408 71 32581 333 190 --1253
NM_015192chr2042621 1218 326 86 22132 1122 12112 --
NM_015199chr352869 2636 1918 723 681 41051 881 521 379 1119 1444
NM_015200chr472608 2325 2222 2071 1622 900 423 1138 ----
NM_015206chr1553791 3446 2948 2500 395 33908 3106 294 13265 --
NM_015208chr1811140 43699 3645 1154 387 --1646
NM_015247chr1664804 4704 3371 1782 1122 993 --1378 24110 2052
NM_015267chr1231931 1521 545 31838 1615 524 --11984
NM_015271chr473622 945 812 282 247 107 72 3982 507 296 --24137 3077
NM_015278chr683229 3199 2919 2493 2460 1110 909 35 12482 1267 11182
NM_015285chr1852193 2111 783 602 326 1999 1816 --
NM_015299chr1443765 3027 1469 1245 22579 717 42478 1188 1169 672 22705 1213
NM_015310chr8147749 7058 6544 6383 6036 5566 5487 5417 2607 2425 1866 1577 672 501 46155 3015 2095 1571 26244 1487 26859 6854
NM_015313chr1163717 1825 1196 1075 1059 120 31939 1513 271 13957 --
NM_015328chr762576 2301 2229 1161 725 152 21988 100 --12855
NM_015336chr1222264 1985 3968 367 361 12322 --
NM_015349chr673015 2596 1873 1182 848 808 61 43098 2122 1173 404 --11239
NM_015365chrX31556 1042 148 23433 769 1756 --
NM_015385chr1083109 2579 2323 1143 1064 443 250 191 1533 160 --
NM_015458chr864578 4465 4360 3589 844 461 1871 15203 --
NM_015535chr274068 3936 2779 2627 1396 1159 266 24003 3465 11434 --
NM_015564chr5103608 3013 3007 2728 2524 2441 1392 1138 703 114 23167 2562 21076 193 12937
NM_015571chr632200 1695 994 32621 1042 40 1479 --
NM_015627chr131754 1301 72 31144 593 360 1748 2196 50
NM_015640chr165358 4711 4159 3377 3288 1774 44341 1162 1046 987 14194 15224
NM_015713chr893452 3020 2679 1290 1161 1097 806 707 419 12984 32922 2376 1345 --
NM_015852chr773281 2914 840 588 504 336 168 23066 1258 12334 --
NM_015879chr18167558 6573 5850 5819 5787 5758 5236 3373 3318 3283 2913 2705 2159 1786 1175 962 78076 6873 5425 2595 1666 1380 53 17283 16894
NM_015888chr173294 2694 2568 1149 454 133 79 ------
NM_015906chr141390 658 523 21 21536 768 11316 21705 992
NM_016009chr184701 4269 4174 3803 3548 3222 1716 1341 31369 540 391 24189 3583 14099
NM_016073chr1531128 828 747 21046 771 188 --
NM_016081chr462170 1884 759 492 257 114 169 21617 658 --
NM_016206chr3128968 8250 8084 7764 6694 6166 6030 3316 2883 643 339 313 21328 841 --28506 908
NM_016255chr6--22499 2381 22690 2621 22240 816
NM_016260chr297051 7026 4836 2965 2775 1945 1231 974 464 37448 6394 2414 11598 --
NM_016275chr34736 681 633 620 1725 ----
NM_016297chr2113692 3417 3208 3194 2412 1464 1367 1309 1195 947 266 1865 22342 301 190
NM_016315chr221758 438 31388 590 417 ----
NM_016322chr963112 2376 2130 1158 418 287 23227 2915 1679 --
NM_016356chr672797 2520 2125 2006 1128 1117 552 1536 ----
NM_016395chr1541546 697 651 503 11969 173 --
NM_016396chr1562353 2251 2238 1048 744 224 ------
NM_016424chr1751892 1391 697 680 568 1669 1121 --
NM_016454chr152309 92 ----1116
NM_016513chr683661 3149 2453 1392 886 775 723 107 43324 2430 1002 849 1134 --
NM_016530chr1584038 3743 2963 2697 1641 649 517 84 11308 11200 --
NM_016531chr473982 3929 2995 2829 852 314 305 11582 ----
NM_016544chr293966 3394 3233 3106 1511 997 811 780 69 ----13460
NM_016577chr3134170 3829 3704 3659 3626 3217 1428 1273 1058 996 883 639 416 1543 33890 1791 88 --
NM_017420chr1463578 3021 2802 1324 1165 271 23735 3493 12598 --
NM_017548chr341785 663 431 216 2701 265 12087 --
NM_017580chr1082436 2407 2172 2149 1699 222 140 28 21839 560 --2613 101
NM_017633chr693877 3393 3270 3015 2911 1571 1321 440 274 33495 3487 2422 11238 1729
NM_017637chr9119094 8856 7462 6823 6074 5855 5827 2952 2559 1616 1203 32331 1787 1436 27312 1131 29125 6914
NM_017643chr1762254 2097 1145 1136 1006 61 2940 889 --12350
NM_017644chr394275 3933 3490 3175 1626 1435 1304 1187 578 14178 ----
NM_017650chr775993 4784 4457 4421 1263 1126 315 54133 3727 2334 227 93 ----
NM_017651chr641219 573 294 180 159 1160 --
NM_017654chr721481 1323 21274 1203 1503 21531 1229
NM_017719chr351910 1562 862 471 258 ----22184 436
NM_017742chr1841788 1704 745 532 ----1572
NM_017752chrX31637 1550 668 22043 2007 12095 --
NM_017754chr665042 4966 1439 1425 753 408 11750 1588 --
NM_017761chr181453 1332 1248 410 302 254 224 169 11029 193 --
NM_017762chr1532273 981 150 42401 2260 1919 1664 ----
NM_017770chr672678 2607 2235 1098 904 479 97 12436 11889 --
NM_017779chr162300 1952 1075 871 804 170 --11088 12028
NM_017799chr1441314 442 307 104 2406 323 --21845 1740
NM_017813chr835285 5095 775 64984 4854 4590 4319 4066 1456 ----
NM_017831chr1864791 4304 3605 732 364 29 21133 850 ----
NM_017847chr131479 1393 321 12276 --21605 1504
NM_017848chrX114059 3271 3225 3089 2898 2830 1459 794 717 679 28 14134 ----
NM_017896chr2063408 2746 1277 1183 671 367 1731 12725 12790
NM_017919chr965861 5533 4630 3733 2227 1389 25675 4064 --13971
NM_017952chr284531 4498 4169 3748 3615 1395 764 50 33858 3368 1061 13881 --
NM_018027chr10113179 2876 1182 1118 676 534 396 330 109 86 51 ------
NM_018036chr1443762 1507 1340 377 43525 1392 1385 161 143 --
NM_018046chr54314 171 96 79 --2529 190 --
NM_018048chr1221872 379 ----1663
NM_018084chr2103339 3318 3141 2445 2384 2364 2167 582 306 114 33106 1171 421 22477 198 --
NM_018184chr351938 1763 1712 301 176 ----1706
NM_018214chr62174 97 ----21127 799
NM_018243chr473829 2989 2513 1049 935 564 483 13928 12800 1378
NM_018293chr372936 2917 1004 764 497 317 31 12128 12391 --
NM_018299chr843352 2416 1364 774 22573 2263 ----
NM_018317chr42105 59 182 --1321
NM_018318chr121152 4875 711 626 136 1686 --
NM_018351chr1262974 1895 1331 1244 1149 718 23049 115 24599 481 --
NM_018371chr81509 31070 563 172 --11089
NM_018373chr1495948 5054 4480 4061 1925 1772 1247 918 875 11859 55820 4451 1511 1480 1062 45685 5390 3938 1102
NM_018374chr744610 4481 4297 1975 1598 14215 14891
NM_018403chr384136 3656 2941 2840 1335 1266 874 496 13114 33548 2976 883 --
NM_018440chr8138487 7353 6981 6950 6744 6666 6333 5945 5711 2584 1235 345 312 15428 12530 27177 5906
NM_018452chr6_random63691 3097 2961 2652 2513 849 21375 805 1123 23147 1434
NM_018566chr164616 4458 3219 3156 1215 110 23962 3609 ----
NM_018590chr102530 31 ----21628 556
NM_018638chr1295195 4654 4624 3951 3663 2133 2049 472 74 2818 142 11777 --
NM_018660chr852806 2718 2593 2511 241 2270 89 22403 262 2718 232
NM_018695chr552382 2158 1647 241 167 12411 ----
NM_018698chrX31921 1541 594 41798 1509 787 102 1732 --
NM_018704chr161604 1426 496 313 307 274 11530 11991 --
NM_018841chr122729 655 53280 3099 2994 728 107 11533 --
NM_018898chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_018899chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_018900chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_018901chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_018902chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_018903chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_018904chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_018905chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_018906chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_018907chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_018908chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_018909chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_018910chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_018911chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_018945chr673643 3498 3375 3133 2330 1209 740 11080 --13190
NM_018947chr764957 4493 3513 990 693 147 --44357 3548 3267 397 --
NM_018948chr12451 330 ----11342
NM_018970chr792961 2427 2401 2212 873 401 227 101 37 22623 884 12548 --
NM_018976chr1252138 2049 1915 878 363 22703 614 --12901
NM_018979chr1252364 1905 1680 1626 415 22646 334 12144 --
NM_018993chr2071403 1253 1201 1120 1112 1048 938 ------
NM_018999chr1043527 3240 470 397 43472 1150 714 212 ----
NM_019001chr394042 3633 3180 3104 3056 1933 1257 669 348 34250 1372 250 23862 724 --
NM_019004chr711966 2799 350 --1571
NM_019050chr462259 2202 1892 1473 427 112 2549 162 ----
NM_019063chr242260 233 167 90 52324 850 446 366 207 1693 --
NM_019072chr574318 3590 3146 3048 2714 887 701 197 1540 14276
NM_019094chr1283777 3515 2955 1515 1182 1124 1056 829 21530 196 11087 --
NM_019596chr2192909 2457 2424 922 517 385 179 145 72 22077 138 --1651
NM_019610chr142054 2031 690 380 21791 364 21653 1599 124
NM_019862chr1631697 217 83 4372 132 118 104 1620 --
NM_019898chr1631697 217 83 4372 132 118 104 1620 --
NM_019899chr1631697 217 83 4372 132 118 104 1620 --
NM_019900chr1631697 217 83 4372 132 118 104 1620 --
NM_020039chr1231389 1189 202 1419 --3532 219 23
NM_020116chr421718 608 1299 --1243
NM_020119chr7103674 3342 3105 2477 1326 1186 1040 537 387 155 --31477 1452 1245 160
NM_020122chr265364 4778 2228 1105 533 174 54580 4158 2396 1546 1028 15634 --
NM_020132chr2185142 4810 3320 1745 1726 1541 1465 61 44203 3594 1736 1434 2858 140 15199
NM_020177chr533183 2574 2418 22864 2625 12602 --
NM_020198chr1751594 1555 1407 427 390 31491 367 223 11038 --
NM_020205chr142714 2658 1298 52 33472 936 401 12527 --
NM_020245chr663913 3386 1698 1566 108 100 54752 3528 3424 1153 436 1564 --
NM_020337chr432700 1030 705 32921 1010 349 23065 1936 --
NM_020338chr1093536 2785 2674 2524 2464 1494 742 622 109 33367 1146 824 1288 --
NM_020342chr242525 2360 2333 513 --31867 972 239 2865 345
NM_020390chr394694 4056 3695 3586 1876 1459 1350 1203 328 1342 141 --
NM_020425chr611872 31459 721 135 --11817
NM_020443chr1126901 6684 6017 5694 4933 4305 2232 2053 1888 1739 1226 547 11239 46232 5504 4512 632 --
NM_020455chr63724 402 156 12243 --22309 1933
NM_020466chr654629 3391 3320 1606 491 44225 3635 1519 282 13647 --
NM_020474chr1861832 1657 1362 548 477 299 11253 1175 1467
NM_020673chr20105333 5319 4996 4685 2936 2886 1870 1280 308 139 11539 ----
NM_020699chr1135270 5264 4757 4556 4335 4296 4233 3991 1485 1283 905 805 422 24515 1264 24268 1249 --
NM_020717chrX61951 1585 1355 909 234 165 31671 1410 1187 33201 586 287 11322
NM_020718chr1665285 5129 5086 4946 3988 1066 ----2356 205
NM_020727chr2132853 1495 628 ----23668 1623
NM_020734chr1253406 2866 2407 1002 68 23187 1155 ----
NM_020739chr1543353 2922 1194 499 13864 ----
NM_020766chrX104448 4417 4289 4144 4138 4046 3824 3128 1501 1377 11549 ----
NM_020772chr17118096 7326 6611 5846 5706 5343 5272 5227 117 105 45 76385 6164 6155 5409 3052 2557 1062 26134 5833 1213
NM_020776chr1862924 2722 2629 2205 1022 640 22096 606 1551 12714
NM_020782chr1264836 3297 3150 1340 186 78 23616 1618 23918 154 23019 1777
NM_020783chr1862247 1950 1593 724 421 92 ------
NM_020802chr1153150 2907 2114 790 76 12696 21211 661 21244 980
NM_020819chr61489 ----1908
NM_020841chr12123732 3580 3542 3252 3033 2830 1579 1538 962 55 29 21 1983 13310 11504
NM_020844chr8147374 7059 6234 6173 6101 5311 4987 2894 2286 1174 1141 888 476 38 17688 25765 1390 --
NM_020858chr1511996 11966 1110 21696 954
NM_020868chr251914 1896 1651 1583 144 ----1787
NM_020921chr1463265 2783 2246 933 766 652 33388 3286 409 12629 --
NM_020935chr284443 4191 3646 1565 1301 1190 1042 352 44244 3767 893 132 --12819
NM_020940chr1052124 1941 1802 132 35 52833 2248 1886 937 251 --12601
NM_020948chr121450 571 13229 --2310 232
NM_021032chr331757 1411 582 11907 --1179
NM_021072chr542323 2304 988 397 1416 ----
NM_021090chr22104794 4111 1904 1522 1282 1011 551 372 274 109 1976 13263 --
NM_021183chrX12188 21902 557 --22244 1982
NM_021255chr1453674 2623 1357 967 295 13584 --11074
NM_021629chr365106 4248 1303 970 205 47 35125 1200 593 2819 402 11642
NM_021633chr121403 1164 11175 1348 164
NM_021638chr443292 3108 1757 988 44269 4258 4099 298 --14553
NM_021647chr4124460 4216 4196 4045 3724 3374 2938 1881 1527 1246 1024 998 34382 4235 3795 14519 23231 1355
NM_021813chr6155690 5232 5075 4505 4478 3818 3812 3546 1819 1665 1440 1378 1258 587 96 --35733 5306 4220 --
NM_021814chr631390 1347 535 21076 514 1614 --
NM_021911chr593641 3619 3566 3530 2070 1409 1249 577 48 65027 4781 4650 4474 3838 354 35623 613 556 --
NM_021912chr1594066 3747 3653 3272 2845 1692 1182 1176 625 --13949 --
NM_021961chr1196521 6510 5120 2191 2151 1945 954 517 489 55762 5069 4959 922 597 ----
NM_021964chr356507 6444 4976 503 51 21221 1142 --26019 5151
NM_021977chr673773 3727 3121 2457 777 507 374 33377 3195 2513 1670 --
NM_022048chr15115453 5307 4401 4318 4269 4216 4119 1908 1423 1105 1096 65597 5227 4890 1771 940 118 --14551
NM_022075chr16816 730 374 173 49 42 3940 828 163 ----
NM_022091chr642040 1844 886 239 42544 1800 1063 204 ----
NM_022114chr154161 739 682 287 266 24273 516 --11537
NM_022166chr1686032 5594 5359 4419 1424 710 544 172 26055 1092 --11106
NM_022336chr251492 777 728 141 38 22242 175 294 46 1323
NM_022351chr883386 3012 2991 2933 2372 1299 1001 878 23592 3262 11246 --
NM_022444chr72247 83 51641 1540 474 387 190 ----
NM_022459chr13106250 5806 5778 5463 5026 4748 4670 2041 1222 1154 33950 2056 343 1559 12255
NM_022648chr294046 2990 1750 1419 1095 747 478 420 274 1470 ----
NM_022716chr132982 755 140 53057 2720 496 353 39 12745 1128
NM_022735chr121912 628 ----1148
NM_022898chr14104808 4585 4157 3794 3658 2951 1715 486 52 41 11798 ----
NM_022918chr1152132 1998 1489 629 147 ----11637
NM_024090chr441431 1417 621 78 41495 670 525 311 1456 --
NM_024408chr163107 2961 1456 997 970 102 22355 942 --12912
NM_024423chr1864179 4084 3662 2838 1277 814 12605 11489 13911
NM_024563chr561702 1551 1519 509 465 425 --11760 --
NM_024612chr172231 41 2152 138 --1127
NM_024613chr831724 646 48 1341 11811 --
NM_024646chr193911 3653 3636 3327 2661 2423 1207 346 28 --12960 --
NM_024665chr384704 4554 4452 3852 3525 524 364 95 41111 941 117 50 23738 2937 --
NM_024692chr251528 1398 1192 182 172 --11749 --
NM_024713chr155569 502 389 379 299 2606 110 --11169
NM_024763chr141018 1000 989 352 1363 11066 --
NM_024770chr2136149 4694 4248 4182 2560 2521 2107 2003 1705 1357 1330 1176 373 ----1991
NM_024884chr1474502 3684 3321 2828 1334 1206 376 13125 32960 243 234 --
NM_024920chr411594 41556 248 180 106 11520 --
NM_024921chrX51974 1701 624 331 114 11250 ----
NM_024947chr3178940 8889 8540 8423 8334 7932 7884 7759 7583 7036 6860 3400 2931 1354 1181 601 110 16253 ----
NM_024949chr485036 4692 4059 3983 3229 1685 948 609 35028 4516 3737 14090 1981
NM_024989chr267094 6932 6342 2632 2459 610 66709 6489 6291 3059 1321 876 ----
NM_024991chr1083109 2579 2323 1143 1064 443 250 191 1533 160 --
NM_025054chr853641 3177 2715 673 666 13574 --2922 456
NM_025073chr1104263 4243 4142 3901 3758 3000 1392 1330 880 462 33195 1687 766 ----
NM_025160chr1114266 4182 3829 3036 1579 1062 740 577 570 178 125 11379 ----
NM_025191chr163099 2250 1125 1010 949 688 1629 12642 1298
NM_030621chr1464239 4070 4060 3861 3748 611 1859 1189 --
NM_030623chr231744 527 113 21523 1219 1366 --
NM_030625chr1042333 924 370 275 ----12475
NM_030627chr553539 3531 1648 1089 255 31620 1289 1071 11229 --
NM_030637chr142532 509 --1238 1626
NM_030647chr775244 5031 4465 4014 2416 1918 782 15386 --25423 1817
NM_030648chr454475 4412 1795 1152 81 45307 4763 4233 1083 --15364
NM_030674chr12135525 5513 3935 3857 3846 2006 1876 1755 1309 1228 1001 986 555 25791 4762 --15903
NM_030791chr1451648 1483 480 423 384 21877 1614 --1618
NM_030806chr1129148 8311 8276 8188 7830 7315 7287 6954 6156 5891 650 24 47409 1801 1304 1165 12258 16620
NM_030816chr173635 3189 3147 2240 547 379 30 23469 3096 13050 1583
NM_030911chr1381498 1465 1337 1258 1224 352 305 252 1461 ----
NM_030918chr193336 2159 2111 1732 1151 1069 580 406 28 1950 34242 3544 277 25132 3580
NM_031271chr841196 1132 605 365 31559 1447 1282 ----
NM_031296chr442774 2489 1790 289 11749 21896 611 --
NM_031411chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_031418chr1152568 2040 1907 809 717 1628 21081 251 --
NM_031427chr14105115 5012 3825 3649 1952 1716 1615 1500 1484 1377 15246 25821 507 15402
NM_031453chr1042628 2314 1979 826 --2308 259 12592
NM_031468chr7116938 6506 5691 2832 2170 2022 1894 1783 1534 1238 124 28195 6595 37655 5500 3044 --
NM_031469chr643168 2499 494 435 53558 2752 2623 1584 185 1649 --
NM_031844chr133080 2743 1575 42605 2574 603 415 1615 11597
NM_031845chr263497 3132 1270 1207 585 430 23652 2828 12906 --
NM_031847chr263497 3132 1270 1207 585 430 23652 2828 12906 --
NM_031849chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_031857chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_031860chr592208 2134 1691 1685 1644 726 700 556 460 ------
NM_032041chr862525 2235 2156 2096 1672 1101 31796 766 695 --11806
NM_032116chr1385480 5159 4075 4060 3835 1469 633 252 34709 1439 955 ----
NM_032160chr1864322 4226 3891 3247 553 65 23978 1183 --1922
NM_032182chr1021224 203 2358 217 --1457
NM_032199chr1053360 3305 3031 1038 446 22798 945 13755 11152
NM_032208chr283405 2990 2484 1270 1165 862 849 808 23459 2749 ----
NM_032221chr2071898 1862 1793 1646 1603 544 139 11661 --1441
NM_032291chr151935 1864 1408 769 93 11806 --21760 470
NM_032373chr10105887 5162 4241 2338 1516 1086 485 425 204 182 55474 3689 2038 1097 102 15090 --
NM_032440chr102516 487 22660 505 ----
NM_032445chr1532232 809 551 12458 12070 1134
NM_032446chr583417 3282 3156 2785 1430 734 436 233 33738 3595 2873 --23201 131
NM_032457chr432836 2616 816 22421 952 13306 --
NM_032458chrX53250 3142 3049 1049 242 33325 2326 413 ----
NM_032509chr882218 2178 2163 1870 1736 1681 1638 917 1666 --12013
NM_032521chr2062839 1145 759 621 286 260 33197 2716 2091 12889 11184
NM_032826chr7124959 4935 3957 3945 3897 3855 1985 1132 938 828 504 108 14036 14209 15083
NM_032842chr741259 663 345 74 161 --148
NM_032866chr1572801 2000 1991 798 226 219 101 32253 928 419 12922 --
NM_032873chr1142905 1808 1726 1199 33170 2760 1275 33425 1088 456 --
NM_032876chr1452221 2067 821 508 74 21845 662 --1538
NM_032968chrX33299 3101 1510 53626 2937 2847 2594 164 22839 350 --
NM_032969chrX33299 3101 1510 53626 2937 2847 2594 164 22839 350 --
NM_032973chrY33294 3096 1510 43618 2932 2593 164 1350 --
NM_032975chr1893440 3285 2854 2545 2530 2457 897 632 152 ----33340 3130 699
NM_032980chr1893440 3285 2854 2545 2530 2457 897 632 152 ----33340 3130 699
NM_033020chr141390 658 523 21 21536 768 11316 21705 992
NM_033083chr363233 3212 2948 2896 2136 579 23155 2186 2998 714 --
NM_033143chr443629 3538 3115 1497 33754 261 121 ----
NM_033224chr7147465 7055 6877 6104 4890 3128 2887 2435 2385 1951 1656 1530 987 967 77633 7330 6927 6300 3239 3207 1137 25302 680 1632
NM_033285chr874283 3685 2835 1472 765 107 96 23943 1557 ----
NM_033364chr342052 1731 1289 37 21403 178 --1295
NM_033425chr1173466 3108 2277 1212 1108 743 484 2274 79 13502 32544 546 73
NM_033505chr2116599 6307 6211 5748 5205 5055 4960 4569 1920 1703 73 35761 2569 888 ----
NM_033637chr1083885 3720 3499 3028 2893 1536 749 397 23580 100 11150 --
NM_033656chr2185791 5416 4645 4333 2086 1754 720 306 54877 4691 1230 1105 826 ----
NM_052832chr863014 2603 2477 1022 651 408 22092 536 ----
NM_052834chr1852193 2111 783 602 326 1999 1816 --
NM_052885chr1234399 3927 1456 64975 4627 4484 1797 497 363 ----
NM_052913chr61366 2744 99 1752 1713
NM_052918chr1053394 3356 3155 2902 2331 32554 2312 264 --1164
NM_053016chr9117946 7417 7385 6470 5949 5103 3077 2906 2388 708 251 45722 2891 1385 493 12335 12447
NM_053043chr736391 1685 446 34842 2526 2061 --14599
NM_053064chr1463012 2671 2554 2466 1105 112 22789 1884 ----
NM_057175chr462189 1724 811 506 285 37 32591 1802 706 1680 2786 721
NM_057178chr1762678 2654 2450 1982 1955 119 --21762 696 1520
NM_080546chr961904 1781 1464 625 608 426 2524 150 --12009
NM_080669chr17144997 4188 3495 3251 3057 1779 1754 1479 1088 1063 399 341 201 150 54763 4656 4525 1642 1353 13515 --
NM_080867chr1464905 4831 3843 1902 579 208 34806 4351 990 11336 23451 663
NM_080872chr854045 2698 1496 1240 782 53982 3149 2520 1475 144 ----
NM_130386chr182233 114 ----2564 182
NM_130387chr361268 1027 345 186 128 83 2353 311 ----
NM_130391chr962808 2748 1160 303 275 67 32885 1429 820 32668 854 170 12307
NM_130392chr962808 2748 1160 303 275 67 32885 1429 820 32668 854 170 12307
NM_130393chr962808 2748 1160 303 275 67 32885 1429 820 32668 854 170 12307
NM_130434chr1531001 929 65 41082 766 203 48 11087 --
NM_130436chr2182374 1806 772 751 340 188 112 88 12358 ----
NM_130438chr21102951 2383 1349 1328 917 765 689 665 310 170 12935 12160 --
NM_130847chr1165259 5046 4104 4091 2220 2184 25802 5722 25421 909 --
NM_133170chr20177861 7317 6010 5661 5407 4994 2208 1948 1755 1535 1240 775 519 339 241 231 48 27751 7618 37345 4913 1297 12442
NM_133334chr4115142 2556 2323 2071 1914 1849 1638 609 408 177 163 11592 1641 --
NM_133367chr662797 2129 1051 783 766 274 22938 146 11195 --
NM_133372chr572640 2618 2305 2085 923 729 48 1259 --11153
NM_133445chr9103100 3091 3010 2532 2500 1398 1078 798 581 570 1264 ----
NM_133493chr664241 3953 3927 3391 936 854 12858 --14545
NM_133496chr184311 4224 4135 3984 3575 3184 956 452 74538 4297 3729 3672 3446 3408 2787 --2579 37
NM_133631chr331446 555 449 31479 1433 534 --11157
NM_133646chr294650 4570 4497 3979 1299 878 625 220 100 44334 1443 1406 201 11388 --
NM_138270chrX53374 1380 1071 979 892 22633 1198 166 --
NM_138348chr5106293 6170 6104 5147 4416 2417 2208 1349 1221 177 65821 5534 1774 1677 919 335 25717 127 1956
NM_138459chr622779 818 22647 427 151 12724
NM_138473chr1295183 4858 3814 3422 3378 2077 1764 129 94 21591 499 ----
NM_138576chr14104808 4585 4157 3794 3658 2951 1715 486 52 41 11798 ----
NM_138621chr273422 2783 2561 1616 449 362 54 23248 1561 --12687
NM_138694chr673462 3171 3078 1196 821 797 99 13431 23282 2624 --
NM_138713chr16177721 7101 6808 6362 6233 6175 6098 5923 5839 5274 3316 2366 2303 899 448 325 177 25254 1130 26955 2957 12549
NM_138714chr16177721 7101 6808 6362 6233 6175 6098 5923 5839 5274 3316 2366 2303 899 448 325 177 25254 1130 26955 2957 12549
NM_138731chr1464067 3817 3005 1543 1383 1106 22717 149 --1368
NM_138959chr1126483 6461 5751 4526 4178 1813 1348 1134 973 924 411 313 46088 1626 1040 273 11758 16239
NM_139207chr1241865 1603 690 148 ----1352
NM_139321chr2052999 1359 290 278 55 23705 1461 24165 3924 --
NM_139323chr2011618 11721 11823 11413
NM_144571chr496442 6430 6309 6112 5881 5345 4862 2325 667 46712 4795 2805 62 1360 34941 4436 189
NM_144578chr1454347 3674 1733 1299 666 15167 13378 11092
NM_144599chr15104748 4729 4496 4076 3360 1749 1595 1501 1074 652 ----23953 1621
NM_144718chr342565 1906 1717 185 21999 648 21960 375 --
NM_144778chr1352758 2553 2014 660 556 2932 50 ----
NM_144963chr872321 1922 1736 1068 835 255 117 ------
NM_144973chr1275111 4953 3670 3624 3533 3330 1553 35066 1238 103 14723 --
NM_145055chr1853116 3105 2437 2346 1043 33290 2998 2686 13555 --
NM_145117chr1151138 986 804 533 89 32716 669 369 32419 1267 963 --
NM_145176chr643554 2880 741 590 33569 2304 1179 163 31320 1191 463
NM_145259chr2107084 6542 6527 6172 5317 4325 1548 893 864 627 44575 1438 1161 987 1331 16233
NM_147150chr963022 1223 1163 301 52 44 23651 699 --22758 205
NM_147175chrX31954 1404 796 31528 451 246 --1405
NM_147223chr232147 789 129 --190 2521 449
NM_147233chr221964 606 ----2338 266
NM_148955chr15106273 5039 4861 4501 4242 4057 2588 467 445 134 56588 6228 6206 1064 835 ----
NM_148957chr1352426 1717 614 605 167 ----1125
NM_152261chr1252358 1759 653 160 77 1792 11626 --
NM_152263chr196019 5836 5711 5338 5139 3974 2432 2418 826 45897 5492 818 313 15126 25955 4335
NM_152282chr321098 132 1358 21294 343 1490
NM_152309chr1052149 1526 520 230 195 1888 1600 --
NM_152330chr1432292 763 194 42193 874 604 558 --11879
NM_152381chr231917 1440 38 2767 176 --2586 213
NM_152388chr283656 3414 3371 2645 923 529 235 227 23908 597 11372 --
NM_152409chr533401 426 419 32902 2607 231 23524 1124 --
NM_152440chr122952 434 1915 --1114
NM_152470chr1874069 3343 2920 2574 953 384 89 31103 625 72 1550 1602
NM_152493chr131422 1067 94 11572 --2659 420
NM_152556chr742222 1832 888 43 1476 ----
NM_152594chr1531837 920 778 3519 453 280 --21851 366
NM_152622chr543109 372 192 134 33072 2713 2156 1215 11279
NM_152624chr556753 6182 2401 1728 325 37343 6729 6441 12024 --
NM_152686chr542418 2340 204 158 22243 380 1359 12203
NM_152754chr743756 1087 1056 509 33453 3355 2950 2429 181 11444
NM_152756chr541500 961 439 419 33198 1091 172 33437 695 268 --
NM_152787chrX83134 2881 1100 1054 726 627 434 355 13974 ----
NM_152826chr15106273 5039 4861 4501 4242 4057 2588 467 445 134 56588 6228 6206 1064 835 ----
NM_152914chr17104091 3793 1624 1523 1214 1092 728 287 191 166 13913 1411 14369
NM_152924chr15106336 2468 2393 2121 2096 1638 1517 1008 547 287 11334 --11509
NM_153042chr661838 1392 384 374 365 53 21370 397 ----
NM_153050chr22104794 4111 1904 1522 1282 1011 551 372 274 109 1976 13263 --
NM_153051chr22104794 4111 1904 1522 1282 1011 551 372 274 109 1976 13263 --
NM_153188chr5104861 4329 3711 3559 3476 3451 546 531 355 116 1751 ----
NM_153207chr1233345 1524 752 22965 625 --13312
NM_153223chr551333 436 426 290 267 ----1353
NM_153262chr183239 2200 969 751 698 304 238 104 2350 325 ----
NM_153371chr1372388 2278 2179 1998 487 426 347 ------
NM_153456chr1395915 5448 5134 5054 4623 2112 2069 266 84 44648 4508 2471 361 25618 5494 14003
NM_153616chr1511996 11966 1110 21696 954
NM_153617chr1511996 11966 1110 21696 954
NM_153618chr1511996 11966 1110 21696 954
NM_153619chr1573234 2629 1006 844 388 298 247 13204 11348 12934
NM_153645chr2282819 1226 1143 1090 895 569 475 267 13247 ----
NM_170665chr12114149 3625 3500 3264 2981 1617 1320 1170 464 313 39 34026 1149 388 21742 220 --
NM_170706chr194259 3636 2875 1598 1479 1247 1093 933 153 13002 ----
NM_170751chr631474 1400 1034 21240 530 ----
NM_170752chr631474 1400 1034 21240 530 ----
NM_171998chrX62386 2314 1002 996 271 183 31773 555 432 ----
NM_172069chr282212 2015 1992 1926 1874 1608 558 381 1431 11761 --
NM_172071chr186067 5994 5139 1252 1088 1000 949 556 45482 4894 2696 473 ----
NM_172218chr82696 674 ----1212
NM_173084chr351829 1752 450 107 85 21666 1506 ----
NM_173214chr16177721 7101 6808 6362 6233 6175 6098 5923 5839 5274 3316 2366 2303 899 448 325 177 25254 1130 26955 2957 12549
NM_173463chr4104261 3429 2994 2843 1397 1144 897 544 118 74 14508 1188 21752 831
NM_173468chr4105805 5772 5492 4047 3750 2013 1872 1012 189 183 --11055 24945 4411
NM_173496chr1053071 2665 2564 2509 53 32613 2571 196 ----
NM_173511chr222440 401 33707 3632 2665 --2866 556
NM_173562chr663311 2620 2099 1299 1240 530 ----1412
NM_173582chr1166009 5519 5287 4851 1677 53 56299 5670 5467 4737 4406 25322 2383 14465
NM_173602chr1273180 3059 1193 924 810 443 41 52905 2370 872 769 695 ----
NM_173642chr1118920 7673 3612 3479 3170 2486 2364 2357 2113 993 692 31834 1276 31 38159 6504 2912 --
NM_173808chr164106 3938 2939 1794 1249 651 64276 3951 3423 1320 991 701 ----
NM_173825chr372613 2311 2135 1924 964 879 439 22711 2010 ----
NM_173829chr586191 5733 5612 2128 1730 1327 1132 138 34890 4796 4468 ----
NM_175571chr731602 317 289 --1276 11586
NM_175624chr1297001 6699 5546 3047 2661 2534 1403 889 112 32443 1803 1722 12580 17114
NM_175625chr1297001 6699 5546 3047 2661 2534 1403 889 112 32443 1803 1722 12580 17114
NM_175854chr1341900 934 468 46 --12046 1999
NM_175907chr1872733 2319 2163 988 512 71 24 22090 1954 --22783 290
NM_176081chr1075825 4330 4062 2403 2364 292 199 65960 5240 1298 941 500 101 25837 80 --
NM_176083chr1075825 4330 4062 2403 2364 292 199 65960 5240 1298 941 500 101 25837 80 --
NM_177438chr1464239 4070 4060 3861 3748 611 1859 1189 --
NM_177538chr2208853 8579 7977 7576 6791 6568 6478 6384 6070 3567 3424 3317 3277 3133 3117 2781 992 346 304 87 12490 45716 3293 2916 1743 13226
NM_177966chr331262 733 609 11461 --171
NM_177972chr1193896 3778 3157 2865 1108 1032 946 645 395 ------
NM_177996chr2073457 3307 2365 2129 2120 249 51 --12591 13094
NM_178011chr1032487 2470 1229 52550 2178 2148 682 602 ----
NM_178037chr1263297 3173 781 733 681 422 22976 69 32964 2548 409 --
NM_178038chr1263297 3173 781 733 681 422 22976 69 32964 2548 409 --
NM_178039chr1262932 2808 416 368 316 57 12611 32599 2183 44 --
NM_178040chr1262932 2808 416 368 316 57 12611 32599 2183 44 --
NM_178151chrX177604 7349 7255 6639 6611 6092 5271 5204 3061 2843 2247 1579 1225 1169 942 871 578 47789 7091 6228 1466 45793 5477 2376 732 --
NM_178152chrX177604 7349 7255 6639 6611 6092 5271 5204 3061 2843 2247 1579 1225 1169 942 871 578 47789 7091 6228 1466 45793 5477 2376 732 --
NM_178153chrX177604 7349 7255 6639 6611 6092 5271 5204 3061 2843 2247 1579 1225 1169 942 871 578 47789 7091 6228 1466 45793 5477 2376 732 --
NM_178498chr1134054 2914 218 43999 3760 679 607 11157 --
NM_178539chr1241984 1878 633 159 11637 --11694
NM_178585chr493119 2493 2457 2449 2161 1098 924 511 357 32353 684 492 ----
NM_178812chr831370 1255 110 2549 436 --1155
NM_178815chr1031770 692 335 22754 374 2654 132 --
NM_178823chr63876 211 138 ----1148
NM_181358chr143296 2740 1687 27 42952 1430 1332 1058 11465 --
NM_181481chr1885791 5397 4846 2785 2050 1671 1551 39 46824 1818 761 115 45658 4885 4506 430 1491
NM_181482chr1885791 5397 4846 2785 2050 1671 1551 39 46824 1818 761 115 45658 4885 4506 430 1491
NM_181483chr1885791 5397 4846 2785 2050 1671 1551 39 46824 1818 761 115 45658 4885 4506 430 1491
NM_181659chr2053306 932 820 108 74 1337 32241 1295 384 --
NM_181659chr2053306 932 820 108 74 1337 32241 1295 384 --
NM_181670chr1221457 1306 ----11226
NM_181672chrX51985 1352 722 713 65 11568 --11606
NM_181673chrX51985 1352 722 713 65 11568 --11606
NM_181705chr555045 4614 4255 3907 1930 23581 237 --1171
NM_181706chr1152293 2078 1537 906 377 22180 1997 11937 --
NM_181746chr16816 730 374 173 49 42 3940 828 163 ----
NM_181789chr1563143 2855 1046 975 815 50 32656 2260 388 --22707 1283
NM_181847chr1211184 2497 121 1440 11610
NM_182314chrX41732 1320 727 171 11777 --1586
NM_182493chr1685052 4448 3494 1999 1979 1839 1716 524 1567 11343 --
NM_182515chr19136555 6332 5905 5685 5564 5310 4637 1997 985 616 283 202 35 26110 425 170 --
NM_182697chr761704 1545 1521 1253 495 480 21388 382 1710 --
NM_182758chr1582462 1527 1278 1159 707 613 379 138 23583 3051 1722 --
NM_182763chr152119 1991 435 46 24 12265 12719 --
NM_182765chr1041702 1483 914 666 31921 1768 140 11452 --
NM_182767chr121627 21646 569 21898 680 --
NM_182898chr7125962 5641 4930 4384 4288 2452 2076 1704 1606 1464 1166 829 35439 5060 2421 15613 24018 2174
NM_182899chr7125962 5641 4930 4384 4288 2452 2076 1704 1606 1464 1166 829 35439 5060 2421 15613 24018 2174
NM_182907chr652283 1972 1795 1757 1745 32328 2137 2113 11574 --
NM_182948chr153155 2369 2301 1983 746 22103 953 --22992 2834
NM_182964chr1151138 986 804 533 89 32716 669 369 32419 1267 963 --
NM_183004chr1453668 2877 2826 729 594 43909 3702 3655 3211 --13233
NM_183043chr133905 123 88 --1314 1231
NM_183044chr133905 123 88 --1314 1231
NM_194247chr264170 4066 1741 1454 1196 989 --13483 --
NM_194286chr12105597 5402 4919 4816 4225 2046 1960 899 479 238 15173 35167 5060 4615 14986
NM_194291chr852948 2526 2393 2149 35 --1818 --
NM_194292chr121773 1264 41691 378 346 76 --1585
NM_194314chr1145624 5082 4958 4389 4274 3777 3491 1684 1538 1290 1048 610 389 132 31927 1658 1284 ----
NM_197941chr582408 1940 1028 856 637 525 322 66 41229 850 827 552 ----
NM_198066chr1463087 2804 2551 2403 1103 1069 2495 227 ----
NM_198086chr1452221 2067 821 508 74 21845 662 --1538
NM_198181chr1542381 2095 1848 91 22880 2347 --12245
NM_198182chr211342 11540 --11418
NM_198268chr143296 2740 1687 27 42952 1430 1332 1058 11465 --
NM_198269chr143296 2740 1687 27 42952 1430 1332 1058 11465 --
NM_198270chrX83159 2835 2227 2190 1085 1025 773 441 2418 340 23224 2618 1676
NM_198320chr12125136 4745 4688 4305 3513 3398 1744 1191 503 494 342 41 11267 25250 3813 --
NM_198336chr7--21669 1550 1249 21726 722
NM_198399chr321740 1291 ----2736 113
NM_198400chr1552359 2100 1822 602 80 31053 1031 51 --1876
NM_198465chrX42975 2692 2088 2060 12909 11859 1445
NM_198484chr3116216 5944 5237 4962 4568 3998 2454 2367 1580 1129 338 34590 4508 4066 22379 2078 14280
NM_198503chr12513 479 32113 1571 637 11873 --
NM_198549chr153144 2647 479 371 277 22912 2409 --1554
NM_198569chr63591 269 23 22110 1045 --22176 1800
NM_198581chr2106761 6693 5749 5623 5421 5271 5121 473 311 132 56899 4793 2783 1997 1978 ----
NM_198595chr443292 3108 1757 988 44269 4258 4099 298 --14553
NM_198859chr3124697 4475 4202 3647 3611 3602 3534 3302 3190 1309 810 708 11322 24090 3749 --
NM_198968chr1363246 1556 860 727 463 313 33483 3426 1052 ----
NM_199000chr731994 1576 456 41753 1595 1410 375 --11723
NM_199040chr1283777 3515 2955 1515 1182 1124 1056 829 21530 196 11087 --
NM_199072chr773188 3152 2986 2398 1197 975 761 21284 159 1816 --
NM_199160chr992023 1796 1699 1403 655 629 522 348 186 ----1123
NM_199320chr462902 2509 2459 2422 1122 813 12780 1932 22214 378
NM_199320chr462902 2509 2459 2422 1122 813 12780 1932 22214 378
NM_199421chr1464905 4831 3843 1902 579 208 34806 4351 990 11336 23451 663
NM_199436chr252976 2955 2451 2426 991 12707 32741 925 869 1150
NM_199454chr154161 739 682 287 266 24273 516 --11537
NM_201280chr631414 1273 29 --21387 250 --
NM_201591chr43442 130 50 1270 --11253
NM_201592chr43442 130 50 1270 --11253
NM_203329chr11146909 6609 6391 5985 5826 5301 5198 5100 4571 2460 2238 1878 1263 239 --36155 5729 2522 --
NM_203330chr11146909 6609 6391 5985 5826 5301 5198 5100 4571 2460 2238 1878 1263 239 --36155 5729 2522 --
NM_203331chr11146909 6609 6391 5985 5826 5301 5198 5100 4571 2460 2238 1878 1263 239 --36155 5729 2522 --
NM_203349chr1541691 865 430 137 2737 296 1162 1587
NM_203372chr21261 11434 --1478
NM_203458chr163369 1519 805 553 515 471 23626 1083 13348 13358
NM_203463chr2114846 4053 2999 1561 1486 1426 1090 1021 667 536 36 43848 3331 1655 1360 ----
NM_206594chr143485 1436 634 106 12926 22803 675 1662
NM_206595chr143485 1436 634 106 12926 22803 675 1662
NM_206854chr654921 4129 4051 3302 757 34356 3783 890 14833 --
NM_206855chr665886 5094 5016 4267 1722 634 55321 4748 1855 664 104 15798 --
NM_206876chr212926 43131 3090 1193 317 12552 13004
NM_206909chr8147749 7058 6544 6383 6036 5566 5487 5417 2607 2425 1866 1577 672 501 46155 3015 2095 1571 26244 1487 26859 6854
NM_207015chr331741 1550 606 41973 1928 1527 66 ----
NM_207171chr152055 1800 1695 1311 185 11272 21362 206 --
NM_207303chr1074143 2707 2560 1232 855 407 314 13615 13623 14058
NM_207361chr1396225 5900 4739 4457 2065 1319 1184 543 246 24016 677 --15122
NM_207404chr382219 2210 2148 1947 1723 1628 505 374 --22269 637 11657
NM_207435chr1251113 798 415 390 307 21163 1058 --159
NM_207577chr1162850 2503 2139 1044 945 68 32109 666 77 12229 --
NM_207578chr11176 2631 314 --1124
NM_207647chr911688 12476 --1887
NM_213589chr254176 3730 3496 3394 438 ----1353